Preparation and Application of a Bivalent Subunit Vaccine against Grass Carp Hemorrhagic Disease and Septicemia

Abstract

The present invention discloses the preparation and application of a bivalent subunit vaccine against grass carp hemorrhage disease and septicemia. The present invention provides a fusion gene obtained by linking the VP6 protein of GCRV and the ompAII protein of Aeromonas veronii. The fusion protein expressed by the fusion gene is combined with an adjuvant to construct a bivalent subunit vaccine, which is intraperitoneally injected into experimental animals. Spleen and kidney tissues are collected, and the expression levels of immune-related genes in each tissue are measured. The results show that the prepared bivalent subunit vaccine can stimulate immune response reactions in different immune tissues of fish through injection immunization. On the 28th day after immunization, a fish challenge experiment is carried out by intraperitoneally injecting GCRV virulent strain and Aeromonas veronii. 15 days after the challenge, the relative survival rates against Aeromonas veronii and grass carp reovirus infection are 85% and 55% respectively, indicating that the bivalent subunit vaccine of the present invention has good protective effects against important diseases of cultured grass carp.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and specifically relates to the preparation and application of a bivalent subunit vaccine for grass carp hemorrhagic disease and septicemia. Background Art

[0002] Aquaculture is an important part of agricultural economy. Grass carp is the most important freshwater aquaculture species, and grass carp hemorrhagic disease and bacterial septicemia are the main diseases of aquaculture grass carp.

[0003] The GCRV virus particles of grass carp hemorrhagic disease pathogen mainly include proteins and nucleic acids, contain a small amount of sugars, and do not contain lipids; repeated freezing and thawing has a great influence on the infectivity of the virus. GCRV virus particles are arranged in multiple layers, presenting a regular icosahedral sphere with a diameter of about 55-80nm, without an envelope structure, and the outer capsid is composed of 200 trimers arranged in T=13, and the inner capsid is composed of 120 monomers arranged in T=1. GCRV isolates can be mainly divided into three genotypes, including GCRV-Ⅰ, GCRV-Ⅱ and GCRV-Ⅲ. Due to the differences in genome sequences among strains, the cell culture characteristics, virulence, pathogenicity and antigenicity of each strain are different. The results of epidemiological surveys show that type II strains represented by GCRV HuNan1307 and GCRVGD108 are currently the most prevalent strains causing grass carp hemorrhagic disease.

[0004] Aeromonas veronii is a conditional pathogen that is the main pathogen causing bacterial septicemia in freshwater fish, shrimps, crabs, and shellfish, causing symptoms such as decreased immunity, bleeding, ascites, exophthalmos, and enteritis, causing huge economic losses to the aquaculture industry. There are increasing reports of Aeromonas veronii causing bacterial septicemia in freshwater fish. The virulence of Aeromonas veronii is manifested in many aspects, not only related to virulence genes, but also including surface-related molecules, movement, bioactive extracellular products, and biofilm formation.

[0005] Both grass carp reovirus and Aeromonas veronii can cause bleeding and death in grass carp, often accompanied by mixed infection or secondary infection. However, there is currently no effective method to simultaneously prevent and control the occurrence of both diseases.

[0006] Types of existing vaccines and problems they present:

[0007] The inactivated vaccine of grass carp hemorrhage disease is a homemade vaccine prepared by inactivating the tissue homogenate of diseased grass carp. Although it is effective, there are problems with the instability of the vaccine components and content. In addition, there is also a possibility of incomplete inactivation. The above problems result in unstable protective effects of the inactivated vaccine of grass carp hemorrhage disease, and there is also a risk of large-scale outbreaks of diseases after use. The cell culture virus inactivated vaccine of grass carp hemorrhage disease is safe and reliable, but due to the low virus titer, the vaccine cost is high and the preparation of multi-valent and multi-component vaccines cannot be achieved.

[0008] Attenuated vaccines, also known as live attenuated vaccines or live vaccines, are made from attenuated or non-toxic live pathogenic microorganisms. Compared with inactivated vaccines (killed vaccines), such vaccines have strong immunity and a long action time, but they need to be stored frozen, have pathogenicity, too strong irritation and the potential risk of reversion to pathogenicity. And by consulting relevant information, the currently approved live attenuated vaccine is prepared from the GCRV-I strain, and there is no research and development on the attenuated vaccine of GCRV-II. To sum up, live attenuated vaccines have low safety and there is a risk of reversion of virulence; and the protective effect of the live vaccine of grass carp hemorrhage disease with a production batch number is poor due to the change of the prevalent strain; due to the existence of multiple serotypes in Aeromonas veronii, the cross-protective effect of the current monovalent live attenuated vaccine of grass carp bacterial septicemia is not ideal.

[0009] Genetic engineering subunit vaccines are vaccines prepared by using genetic recombination technology to express and purify the antigen protein gene in vitro to obtain only one or several main antigen components. Its advantages are that the antigen components are relatively single, there are no virulence factors and other genetic information, it will not replicate in the body, has no infectivity to the host, and has high safety and stability. At present, there have been many research reports on subunit vaccines for grass carp hemorrhage disease, and good results have been achieved under experimental conditions, but subunit vaccines generally have a low protection rate, and there is currently no multi-valent and multi-component vaccine for important diseases of grass carp.

[0010] Nucleic acid vaccines use the target fragment encoding the antigen protein to enter the animal body, select its expression system to obtain the protein, and induce an immune response and good protective effects. Compared with traditional vaccines, DNA vaccines are relatively simple to prepare, have low production costs, do not require the addition of adjuvants during use, have good stability, high immune efficiency and a long duration. However, there are also controversies about the safety of DNA vaccines. For example, DNA is uncontrollable in the body and may be integrated into the host genome, posing risks of heredity and immune tolerance.

[0011] Summary of existing vaccines currently:

[0012] Table 1

[0013]

[0014]

[0015]

[0016] Both grass carp reovirus and Aeromonas veronii can cause grass carp hemorrhage and death, often accompanied by mixed infection or secondary infection. For grass carp hemorrhage disease and septicemia, prevention is one of the most effective methods. And immunoprevention will not cause the problem of environmental damage brought by drug prevention. Immunoprevention is not only safe but also more effective than drug prevention. Therefore, the development of an effective vaccine has far-reaching significance for the prevention and treatment of grass carp hemorrhage disease and leukemia.

[0017] Therefore, in order to effectively control the occurrence of grass carp hemorrhage disease, the emergence of both pathogens should be controlled simultaneously. Guided by this, the present invention develops a bivalent subunit vaccine in order to prevent multiple diseases with one injection, jointly prevent and control, and simultaneously control the occurrence of grass carp reovirus and Aeromonas veronii, and reduce the harm caused by grass carp hemorrhage disease and septicemia. Summary of the Invention

[0018] The purpose of the first aspect of the present invention is to provide a fusion gene.

[0019] The purpose of the second aspect of the present invention is to provide a fusion protein expressed by the above fusion gene.

[0020] The purpose of the third aspect of the present invention is to provide a recombinant expression vector, expression cassette or recombinant bacterium containing the above fusion gene or expressing the above fusion protein.

[0021] The purpose of the fourth aspect of the present invention is to provide the application of the above fusion gene, fusion protein, recombinant expression vector, expression cassette or recombinant bacterium.

[0022] The purpose of the fifth aspect of the present invention is to provide a product.

[0023] The technical solution adopted by the present invention is:

[0024] In the first aspect of the present invention, a fusion gene is provided, and the fusion gene contains the VP6 gene sequence of grass carp reovirus and the ompAⅡ gene sequence of Aeromonas veronii.

[0025] Preferably, the fusion gene further includes a linker sequence.

[0026] Preferably, the linker includes a flexible linker, a rigid linker or a cleavable linker.

[0027] Preferably, the sequence of the flexible linker is GGTGGCGGTGGCTCA.

[0028] Preferably, the nucleotide sequence of the fusion gene is as shown in SEQ ID NO.1.

[0029] In a second aspect of the present invention, there is provided a fusion protein encoded by the fusion gene described in the first aspect of the present invention.

[0030] In a third aspect of the present invention, there is provided a recombinant expression vector, expression cassette or recombinant bacterium containing the fusion gene described in the first aspect of the present invention or the fusion protein described in the second aspect of the present invention.

[0031] Preferably, the expression vector includes but is not limited to the pet series, duet series, pgex series, phy300, phy300plk, ppic series.

[0032] Preferably, the expression vector is the pET32a vector.

[0033] Preferably, the recombinant bacterium includes but is not limited to Escherichia coli, Bacillus subtilis, yeast.

[0034] Preferably, the recombinant bacterium is recombinant Escherichia coli, taxonomically named Escherichia coli pET32a-VP6-ompA II / BL21, deposited at the China Center for Type Culture Collection, Wuhan University, Wuhan, China on May 17, 2024; the deposit number is CCTCC NO: M 2024974.

[0035] The present invention also provides a method for preparing the above-mentioned fusion protein, comprising the following steps: constructing a recombinant vector containing the fusion gene encoding the above; transferring the recombinant vector into competent cells, screening for positive clones and then culturing, inducing expression, extracting and purifying the protein to obtain the fusion protein.

[0036] In a fourth aspect of the present invention, there is provided the use of the fusion gene described in the first aspect of the present invention, or the fusion protein described in the second aspect of the present invention, or the recombinant expression vector, expression cassette or transgenic recombinant bacterium described in the third aspect of the present invention in the preparation of a product for preventing and treating diseases caused by grass carp reovirus and / or Aeromonas veronii.

[0037] Preferably, the diseases caused by grass carp reovirus and / or Aeromonas veronii include grass carp hemorrhagic disease and / or grass carp septicemia.

[0038] Preferably, the product further includes an adjuvant.

[0039] Preferably, the product is a drug.

[0040] Preferably, the drug is a vaccine.

[0041] Preferably, the vaccine is a subunit vaccine.

[0042] Preferably, the administration route of the drug includes intraperitoneal injection and intramuscular injection.

[0043] Preferably, the adjuvant includes at least one of ISA763A, aluminum hydroxide, lecithin, Freund's adjuvant, mpltm, il-12, isa51vg, isa720vg, mf59, qs21, and as03 adjuvant. Those skilled in the art can also select other immune adjuvants according to actual usage requirements for preparing vaccines suitable for use.

[0044] In the fifth aspect of the present invention, a product is provided, which includes the fusion gene described in the first aspect of the present invention, the fusion protein described in the second aspect of the present invention, or the recombinant expression vector, expression cassette, transgenic cell line, or transgenic recombinant bacterium described in the third aspect of the present invention.

[0045] Preferably, the product further includes an adjuvant.

[0046] Preferably, the product is a drug.

[0047] Preferably, the drug is a vaccine.

[0048] Preferably, the vaccine is a subunit vaccine.

[0049] Preferably, the administration route of the drug includes intraperitoneal injection and intramuscular injection.

[0050] Preferably, the adjuvant includes at least one of ISA763A, aluminum hydroxide, lecithin, mpltm, il-12, isa51vg, isa720vg, mf59, qs21, and as03 adjuvant. Those skilled in the art can also select other immune adjuvants according to actual usage requirements for preparing vaccines suitable for use.

[0051] The present invention also provides a preparation method of the above subunit vaccine, which includes mixing the purified fusion protein with an adjuvant.

[0052] Preferably, the mass ratio of the fusion protein to the adjuvant is 1:0.5 - 2.

[0053] The beneficial effects of the present invention are:

[0054] The present invention provides a fusion gene obtained by ligating the VP6 protein of GCRV and the outer membrane protein ompAII of Aeromonas veronii. The fusion gene is expressed to obtain a fusion protein, which is used for intraperitoneal injection immunization of experimental animals. Spleen and kidney tissues are collected, and the expression levels of immune-related genes in each tissue are measured by qPCR. The results show that the prepared bivalent subunit vaccine can stimulate the immune response of different immune tissues of fish through injection immunization. On the 28th day after immunization, a fish challenge experiment is carried out by intraperitoneally injecting GCRV virulent strain and Aeromonas veronii. 15 days after the challenge, the relative survival rates (RPS) of Aeromonas veronii and grass carp reovirus infection are 85% and 55% respectively, indicating that the bivalent subunit vaccine of the present invention has good protective effects against important diseases of cultured grass carp. Description of the Drawings

[0055] Figure 1 : Electrophoresis diagram of the VP6-ompAII recombinant gene fragment; Note: M: DNA marker (DL5000); Line 1: VP6-OmpAII.

[0056] Figure 2 : Identification diagram of the subcloning vector plasmid; Note: M: DNA marker (DL5000); Line 1: PCR of pMD19T-VP6-OmpAII / DH5α plasmid.

[0057] Figure 3 : Restriction enzyme digestion identification diagram of the subcloning vector; Note: M: DNA marker (DL10000); Lane 1: Digestion with BamH I and Xho I; Lane 2: Digestion with BamH I; Lane 3: Digestion with Xho I.

[0058] Figure 4 : Identification diagram of the cloning vector plasmid; Note: M: Marker; Line 1: Empty vector; Line 2: pET32a-VP6-OmpAII / DH5α plasmid.

[0059] Figure 5 : Restriction enzyme digestion identification diagram of the cloning vector; Note: Line 1: pET32a-VP6-OmpAII / DH5α plasmid; M: Marker; Line 2: Digestion with BamH I and Xho I; Line 3: Digestion with BamH I; Line 4: Digestion with Xho I.

[0060] Figure 6 : Identification diagram of VP6 protein expression; Note: M: Marker; Line 1: Recombinant bacteria; Line 2: Empty vector.

[0061] Figure 7:Identification diagram of ompAII protein expression; Note: M: Marker; Line 1: Recombinant bacteria; Line 2: Empty vector.

[0062] Figure 8 and Figure 9 :Diagram of the expression of each immune gene in the spleen.

[0063] Figure 10 and Figure 11 :Diagram of the expression of each immune gene in the kidney.

[0064] Figure 12 :Survival rate curve of challenged fish. Detailed implementation manners

[0065] The concept of the present invention and the technical effects produced will be clearly and completely described below in conjunction with the embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative efforts shall fall within the scope of protection of the present invention.

[0066] Experimental animals: Rare minnow (Gobiocypris rarus) was donated by the Institute of Hydrobiology, Chinese Academy of Sciences, with a body length of 4 ± 0.5 cm.

[0067] Bacteria and virus strains: Grass carp reovirus serotype II was isolated and preserved by the Aquatic Products Disease and Immunology Laboratory of the Pearl River Fisheries Research Institute. The isolation method is as follows: The virus was isolated and cultured using PSF cells in the laboratory. The specific method is: The virus was inoculated on a confluent monolayer of PSF cells, adsorbed at 28 °C for 2 hours, and after discarding the adsorption solution, M199 medium containing 5% fetal bovine serum was added for culture, and the culture was continued at 28 °C for 5 - 7 days. The virus was harvested by repeated freezing and thawing. The specific method can be seen in "Molecular Epidemiology, Complete Genome Sequence and Inactivated Vaccine Research of Grass Carp Reovirus" [D] Zeng Weiwei, South China Agricultural University.

[0068] Main reagents: pET32a vector, Escherichia coli MC1061, Trizol Reagent, PrimeScript TM RT reagent Kit, Takara BamH I and XhoI restriction endonucleases, Takara Ex The genomic DNA extraction kit, Premix Ex TaqTM (Probe qPCR), and Competent Cell Preparation Kit were all purchased from Baori Biotechnology Co., Ltd. The SYBR Green Pro Taq HS premixed qPCR was purchased from Aikrui Biotechnology Co., Ltd. The LB broth medium was purchased from Beijing Land Bridge Technology Co., Ltd. Ampicillin was purchased from Beijing Solarbio Science & Technology Co., Ltd. The IPTG inducer was purchased from Shanghai Macklin Biochemical Co., Ltd. The reagents related to SDS-PAGE and Western blot were all purchased from Suzhou Xinsaimai Biotechnology Co., Ltd.

[0069] Example 1 Cloning and Sequence Analysis of the Full Genes of VP6 and ompAⅡ

[0070] According to the nucleic acid sequence of the VP6 gene (GenBank accession number: KU254575) of the genotype II GCRV HuNan 1307 strain virus submitted in NCBI, upstream and downstream primer sequences were designed. Using the genotype II GCRV HuNan 1307 DNA as a template, full-gene PCR amplification of VP6 was carried out. The PCR program was: 94°C, 5 min; 94°C, 30 s, 57°C, 30 s, 72°C, 45 s, 30 cycles; 72°C, 10 min.

[0071] Referring to the primer sequences of Shan Xiaofeng (see Table 1), upstream and downstream primer sequences were designed. Using Aeromonas veronii GZ09007 DNA as a template, full-gene PCR amplification of ompAⅡ (GenBank accession number: MW110479.1) was carried out. The PCR program was: 94°C, 5 min; 94°C, 30 s, 57°C, 30 s, 72°C, 45 s, 30 cycles; 72°C, 10 min.

[0072] The above two kinds of amplification products were recovered by gel cutting and ligated with the 19T vector to construct a subcloning vector. Then it was sent to Guangzhou Aiji Biotechnology Co., Ltd. for sequencing. The sequencing results were compared using the NCBI Blast online software, and the positive clones with correct comparison results were stored at -80°C. The DNAman software was used to translate the nucleic acid sequence into a protein sequence, the size of the protein sequence was clarified, and cluster analysis was carried out using the Mega software.

[0073] Example 2 Construction of Recombinant Protein

[0074] The fusion PCR method is used to link the VP6 gene of grass carp reovirus type II and the outer membrane protein ompAII gene of Aeromonas veronii with a flexible linker. The nucleotide sequence of the flexible linker is specifically: GGTGGCGGTGGCTCA (SEQ ID NO. 32). At the same time, BamH I and XhoI restriction enzyme sites are introduced at both ends of the VP6-ompAII gene fragment; the electrophoresis pattern of the VP6-ompAII recombinant gene fragment is as shown in Figure 1 .

[0075] The primer sequences are shown in the following table;

[0076] Table 2

[0077] VP6-F GGATCC ATGGGTATAGTATCTGAA(SEQ ID NO.2) VP6-R TGAGCCACCGCCACCTCTAGAGTGGTGATGATG(SEQ ID NO.3) ompAII-F GGTGGCGGTGGCTCA ATGAAACTCAAAATG(SEQ ID NO.4) ompAII-R CTCGAGCTGTTGTACTTGCTG(SEQ ID NO.5)

[0078] The coding nucleotide sequence for expressing the VP6-ompAII fusion protein is specifically:

[0079]

[0080] Example 3 Construction of VP6-ompAII recombinant bacteria

[0081] The VP6-ompAII gene fragment was connected to the 19T vector to construct a subcloning vector, and the subcloning vector was transformed into the E. coli competent cell DH5α by heat shock method, and sequenced and identified. The plasmid was extracted from the single colony with the correct sequencing result, and PCR amplification was performed using the 19T-VP6-ompAII / DH5α plasmid as a template and VP6-F and ompAII-R as upstream and downstream primers. The VP6-ompAII gene fragment was purified and recovered by agarose nucleic acid gel electrophoresis and gel recovery. The purified fusion gene VP6-ompAII and the prokaryotic expression vector pET-32a(+) were double-digested, and the plasmid and enzyme digestion identification map of the subcloning vector were respectively detected. Figure 2-3 ; The target fragment and vector were purified and recovered by restriction enzyme ligase, VP6-ompA was connected to the pET32a vector using T4 Ligase ligase, and the ligation product was transformed into Escherichia coli competent cells DH5α to obtain the cloning vector pET32a-VP6-ompAII / DH5α, wherein the plasmid identification and restriction enzyme identification of the cloning vector are shown in Figure 2. Figure 4-5 ; Sequence the cloning vector plasmid, take 0.5 μl of the pET32a-VP6-ompAII / DH5α plasmid with the correct sequencing result and transform it into BL21 competent cells to construct the recombinant bacteria pET32a-VP6-ompAII / BL21 and preserve it for the next experiment.

[0082] Specific:

[0083] 1. Mix 2 μl of VP6-ompAII gene fragment gel recovery product with 1 μl pMD19-T Vector, 2 μl sterile water, and 5 μl Solution I, and react at 16°C for 30 min to connect the VP6-ompAII gene fragment to the 19T vector.

[0084] 2. Add the above full amount system (10 μl) to 100 μl DH5α competent cells, gently pipette to mix, and place on ice for 30 min.

[0085] 3. After heat shock at 42℃ for 90s, quickly transfer to ice and place for 5min.

[0086] 4. Add 890 μl LB resistance-free medium and culture at 37°C and 200r / min for 60 minutes.

[0087] 5. Centrifuge at 12000r / min and discard 800μl supernatant.

[0088] 6. Spread 200 μl of the suspension on an LB solid medium containing ampicillin and culture it at 37 °C for 10 h, then observe the colony situation.

[0089] 7. Pick a single colony and inoculate it into 15 ml of an LB liquid medium containing ampicillin. Culture it at 37 °C with a rotation speed of 200 r for 12 h. Send the monoclonal bacterial solution to Aiji Biotech Co., Ltd. for sequencing. After obtaining the correct sequencing result, extract the plasmid from the monoclonal bacterial solution.

[0090] 8. Use the 19T-VP6-OmpAII / DH5α plasmid as a template and VP6-F and ompAII-R as the upstream and downstream primers for PCR amplification. Purify and recover the VP6-ompAII gene fragment through agarose nucleic acid gel electrophoresis and gel extraction.

[0091] 9. Perform double digestion on the purified VP6-ompAII fusion gene fragment and the prokaryotic expression vector pET32a(+). The restriction enzyme sites are BamHI and XhoI. Digest at 37 °C for 20 min.

[0092] 10. Purify and recover the digested target fragment and vector. Use T4 Ligase to ligate the VP6-ompAII fusion gene fragment with the pET32a vector at 22 °C for 40 min to obtain the pET32a-VP6-ompAII recombinant plasmid.

[0093] 11. Transform the pET32a-VP6-ompAII recombinant plasmid into Escherichia coli competent DH5α cells by heat shock method, and pick a single colony for sequencing.

[0094] 12. Take 0.5 μL of the pET32a-VP6-ompAII / DH5α plasmid with the correct sequencing result and transform it into BL21 competent cells. Spread it on an LB solid medium containing ampicillin resistance and culture it at 37 °C for 10 h to obtain the recombinant bacterium Escherichia coli pET32a-VP6-ompA II / BL21. Pick a single colony for preservation.

[0095] Example 4 Identification of the recombinant protein

[0096] Induce the expression of the recombinant bacterium pET32a-VP6-ompAII / BL21 constructed in Example 3 with IPTG inducers at different concentrations, and explore the optimal induction time. After the induction, lyse and boil the samples, and perform protein electrophoresis analysis on 12% SDS-PAGE. After electrophoresis, stain a part of the gel with 0.25% Coomassie Brilliant Blue staining solution to determine the position of the protein band, and perform immunoblot analysis on the other part.

[0097] Specifically:

[0098] 1. Inoculate the recombinant bacterium pET32a-VP6-ompAII / BL21 into LB liquid medium at a ratio of 1:100, and culture it until the logarithmic growth phase, that is, the OD600 value is between 0.4 and 0.6.

[0099] 2. Add IPTG inducers with concentrations of 0.2 mM / L, 0.4 mM / L, 0.6 mM / L, 0.8 mM / L, and 1 mM / L to the bacterial solution, and culture at 37°C for 2 h, 4 h, 6 h, 8 h, and 10 h.

[0100] 3. After the induction is completed, centrifuge at 12,000 r for 1 min to collect the bacteria, and resuspend and wash the bacteria with PBS.

[0101] 4. Suspend the bacteria with 5 mL of 1×PBS solution and perform ultrasonic disruption. The disruption power is 200 w, working for 2 s and resting for 5 s, for a total of 15 min.

[0102] 5. Collect the precipitate after disruption, add SDS gel loading buffer in proportion, mix well and boil for 10 min.

[0103] 6. Perform protein electrophoresis analysis on 12% SDS-PAGE, at 150 V for 40 min.

[0104] 7. After electrophoresis, stain with 0.25% Coomassie Brilliant Blue staining solution for 2 h, then discard the staining solution, wash with distilled water several times and add decolorizing solution. Replace the staining solution every 1 h until clear bands appear, and judge the most suitable inducer concentration according to the thickness of the bands.

[0105] 8. Transfer the proteins on the gel to the NC membrane after SDS-PAGE electrophoresis, and block in 5% skim milk powder at 4°C overnight.

[0106] 9. Add PBST (PBS + 0.05% Tween-20) and wash 3 times, 5 min each time.

[0107] 10. Use the monoclonal antibodies of VP6 and ompAII proteins as the primary antibodies respectively, incubate at 37°C for 2 h, and wash 3 times.

[0108] 11. Add HRP-labeled goat anti-mouse IgG as the secondary antibody, incubate at 37°C for 2 h, and wash 3 times.

[0109] 12. Develop the color according to the DAB color development kit instructions for 1 min and observe the results.

[0110] The results are as Figure 6-7 shown; among them Figure 6 is the identification diagram of VP6 protein expression, Figure 7This is the identification diagram of ompAII protein expression.

[0111] Example 5 Application of Bivalent Subunit Vaccine

[0112] The purified proteins were fully emulsified with adjuvant ISA763A at a mass ratio of 1:1 to prepare VP6-ISA763A, ompAII-ISA763A, and VP6-ompAII-ISA763A vaccine groups and PBS-ISA763A and PBS control groups. The rare minnow was immunized by intraperitoneal injection, and the spleen and kidney tissues were collected at 24h, 48h, 72h, and 96h after immunization for quantitative analysis of immune genes. After 28 days of immunization, the fish were challenged with GCRV-II HN1307 strain and Aeromonas veronii, and the fish death was continuously observed for 15 days to calculate the relative protection rate.

[0113] Specifically:

[0114] 1. The purified proteins VP6, ompAII, and Vp6-ompAII were mixed and emulsified with adjuvant ISA763A (volume ratio 1:1) to prepare a water-in-oil emulsion. The final concentrations of VP6, ompAII, and Vp6-ompAII were all 1.5 μg / μL.

[0115] 2. Sixty test fish were immunized by intraperitoneal injection, 20 μL for each fish. Sixty control fish were intraperitoneally injected with 20 μL of PBS and PBS-ISA763A respectively.

[0116] 3. At 24h, 48h, 72h, and 96h after immunization, five rare minnows were randomly selected from each group to collect the spleen and kidney. After extracting the total RNA of each tissue, reverse transcription was performed. Using β-actin as the internal reference gene and the obtained cDNA as the template, the relative expression levels of MHCII, TLR3, TLR5, MyD88, NF-kB, IRF3, IRF7, Mx, IFN-a, IL-8, and IL-1B in each tissue were determined by qRT-PCR. The primer sequence information of each gene is shown in Table 3. The qRT-PCR reaction system is as follows: 10 μL of 2×SYBR Green TaqHS Premix, 0.4 μL of each primer, 0.4 μL of ROX, 2 μL of cDNA template, and ddH2O was added to make up to 20 μL. After pre-denaturation at 95°C for 5 min, the cycle began: denaturation at 95°C for 15 s; annealing at 60°C for 45 s; a total of 35 cycles. The measurement results were analyzed using the 2 -ΔΔCt algorithm.

[0117] Table 3 Primer Sequences in Fluorescent Quantitative PCR

[0118]

[0119] 4. Four weeks after immunization, a challenge test was carried out. Each fish was injected with 20 μL of GCRV-II virus solution and 20 μL of Aeromonas veronii (10LD 50 ). Feed was withheld for 24 h before and 48 h after the challenge. Each group was reared in an indoor glass tank at a water temperature of 28 ± 1 °C and observed continuously for 15 d. The mortality rate and relative percentage survival (RPS) were calculated. RPS = (mortality rate of the control group - mortality rate of the immunized group) / mortality rate of the control group × 100%.

[0120] The results are shown in Figure 8 - Figure 12 and Tables 4 - 5:

[0121] Table 4 Protection of the combined subunit vaccine against bacterial septicemia infection

[0122] Group Mortality rate Survival rate Relative protection rate PBS 80％ 20％ -- PBS-ISA763A 53.3％ 46.7％ 33.4％ ompAII-ISA763A 31.3％ 68.7％ 60.8％ VP6-ompAII-ISA763A 12％ 88％ 85％

[0123] Table 5 Protection of the combined subunit vaccine against grass carp hemorrhage disease infection

[0124] Group Mortality rate Survival rate Relative protection rate PBS 86％ 14％ -- PBS-ISA763A 67.7％ 32.3％ 21.3％ VP6-ISA763AompAII 58.6％ 41.4％ 31.9％ VP6-ompAII-ISA763A 38.7％ 61.3％ 55％

[0125] The results showed that the prepared combined subunit vaccine could stimulate the immune response of different immune tissues of fish through injection immunization. The relative survival rates (RPS) against Aeromonas veronii and grass carp reovirus infection were 85% and 55% respectively, indicating that the combined subunit vaccine of the present invention had good protective effects against important diseases of cultured grass carp.

[0126] The above specific embodiments have described the present invention in detail. However, the present invention is not limited to the above embodiments. Within the knowledge scope of those of ordinary skill in the art to which the present invention pertains, various changes can be made without departing from the gist of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A fusion gene containing grass carp reovirus VP6 Aeromonas vernix omp AⅡ gene sequence; the nucleotide sequence of the fusion gene is shown in SEQ ID NO.

1.

2. A fusion protein, which is encoded by the fusion gene according to claim 1.

3. A recombinant expression vector, expression cassette or recombinant bacterium containing the fusion gene according to claim 1 or the fusion protein according to claim 2.

4. The recombinant bacterium according to claim 3, characterized in that The recombinant bacteria is recombinant Escherichia coli.

5. Use of the fusion gene according to claim 1 or the fusion protein according to claim 2 or the recombinant expression vector, expression cassette or recombinant bacteria according to claim 3 in the preparation of products for preventing and treating diseases caused by grass carp reovirus and / or Aeromonas veronii; The diseases caused by the grass carp reovirus and / or Aeromonas veronii are grass carp hemorrhagic disease and / or grass carp bacterial septicemia.

6. A product, comprising the fusion gene according to claim 1 or the fusion protein according to claim 2 or the recombinant expression vector, expression cassette or recombinant bacteria according to claim 3.

7. The use according to claim 5, characterized in that: The product described is a drug.

8. The use according to claim 7, characterized in that: The medicine is a vaccine.

9. The use according to claim 8, characterized in that: The vaccine includes an adjuvant.

10. The use according to claim 9, characterized in that: The adjuvant includes at least one of ISA763A, aluminum hydroxide, lecithin, mpltm, il-12, ISA51VG, ISA720VG, MF59, QS21, and AS03 adjuvants.

11. The use according to claim 10, characterized in that: The administration routes of the drug include intraperitoneal injection and intramuscular injection.

12. The product according to claim 6, characterized in that The product described is a drug.

13. The product according to claim 12, characterized in that The medicine is a vaccine.

14. The product according to claim 13, characterized in that The vaccine includes an adjuvant.

15. The product according to claim 14, characterized in that The adjuvant includes at least one of ISA763A, aluminum hydroxide, lecithin, mpltm, il-12, ISA51VG, ISA720VG, MF59, QS21, and AS03 adjuvants.

16. The product according to claim 15, characterized in that The administration routes of the drug include intraperitoneal injection and intramuscular injection.

Images