Application of SNP genetic markers affecting chicken breast width in chicken genetics and breeding

Abstract

The present invention provides an application of a SNP genetic marker affecting chicken breast width in chicken genetic breeding, belonging to the fields of livestock and poultry genomic selective breeding and biotechnology. The SNP genetic marker affecting chicken breast width includes CB_tag11, which corresponds to the physical position 17298459 of chromosome 11 of the chicken reference genome bGalGal 1.mat.broi ler.GRCg7b version sequence information published by NCBI, and belongs to the 14th intron of the gene GSE1, where the base is A or G. CB_tag11 helps to genetically increase breast width. Its application in chicken genetic breeding is beneficial for improving breast width in laying hens and obtaining high-quality laying hen varieties.

Description

Technical Field

[0001] The invention belongs to the field of livestock and poultry genome selection breeding and biotechnology, and particularly relates to the application of a SNP genetic marker affecting chicken breast width in chicken genetic breeding. Background Art

[0002] Culling old chickens is an important part of the profitability of laying hen farming. Unlike laying hen farming in Europe and the United States, in China, culled laying hens are used as a high-quality source of animal protein. In August 2024, local poultry associations in Hubei, Yunnan, Sichuan, Chongqing, and other places proposed changing the name of "culled chickens" to "old hens" in order to further stimulate the vitality of the culled laying hen market. Breast width is a commonly used indicator for broiler breeding. A large breast width means an increased area for breast muscle attachment, which also means increased breast muscle weight. In order to meet the market demand for large-breasted old hens, it is urgent to conduct research on the genetic structure of breast width in order to cultivate high-quality old hens suitable for production. Breast width is a quantitative trait that is influenced by both genetics and the environment. In recent years, the GWAS method has been extended to the genetic analysis of quantitative traits in poultry, mainly used for the study of egg production, body weight, feed utilization efficiency, and egg quality. However, there are few research papers using the GWAS method to analyze the genetic patterns of breast width in laying hens. The chest width trait is regulated by multiple genes with micro-effects, and conventional breeding methods are difficult to make effective genetic progress. The only way is to clarify the genetic structure of chest width, improve its breeding accuracy through genomic selection, and obtain new chicken breeds or supporting lines that can produce large chest width to meet consumer demand. Summary of the Invention

[0003] In order to solve the problem of insufficient chest width of laying hens, the present invention provides the application of SNP genetic markers that affect chicken chest width in chicken genetic breeding. The SNP genetic markers that affect chicken chest width include CB_tag11. CB_tag11 helps to genetically increase chest width. Its application in chicken genetic breeding is beneficial to improving the chest width of laying hens and obtaining high-quality laying hen varieties.

[0004] The present invention is achieved through the following technical solutions:

[0005] The present invention provides an application of a SNP genetic marker affecting chicken breast width in chicken genetic breeding. The SNP genetic marker affecting chicken breast width includes CB_tag11. The CB_tag11 corresponds to the physical position 17298459 on chromosome 11 of the chicken reference genome bGalGa11.mat.broi ler.GRCg7b version sequence information published in NCBI, and belongs to the 14th intron of the gene GSE1, where the base is A or G.

[0006] Based on the same inventive concept, the present invention provides an early selection method for the chicken breast width trait, the early selection method comprising performing early selection on the chicken breast width trait based on the genotype of the SNP genetic marker CB_tag11;

[0007] The CB_tag11 corresponds to the physical position 17298459 of chromosome 11 of the chicken reference genome bGalGal 1.mat.broiler.GRCg7b version sequence information published in NCBI, and belongs to the 14th intron of the gene GSE1, where the base is A or G.

[0008] Furthermore, the early selection method specifically includes:

[0009] Detect the genotype of CB_tag11 in the chicken genome to be tested;

[0010] Performing early selection on the chicken breast width trait to be tested based on the genotype of CB_tag11;

[0011] Among them, the chest width of individuals with the AA and AG genotypes of CB_tag11 is greater than that of individuals with the GG genotype.

[0012] Furthermore, the detection of the genotype of CB_tag11 in the chicken genome to be tested specifically includes:

[0013] The genomic DNA of the chicken to be tested was amplified by PCR using Pr_cb_tag11 f and Pr_cb_tag11 r as primers;

[0014] The PCR amplification product was sequenced to obtain the genotype of position 17298459 on the positive strand of the tested chicken chromosome 11;

[0015] The nucleotide sequence of the Pr_cb_tag11 f is shown in SEQ ID NO.1, and the nucleotide sequence of the Pr_cb_tag11 r is shown in SEQ ID NO.2.

[0016] Furthermore, the breeds of chickens to be tested include Dongxiang green-shell laying hens and / or white Leghorn chickens.

[0017] Based on the same inventive concept, the present invention provides the application of primers for detecting the SNP genetic marker CB_tag11 in chicken genetic breeding. The SNP genetic marker CB_tag11 corresponds to the physical position 17298459 on chromosome 11 of the chicken reference genome bGalGa11.mat.broi ler.GRCg7b version sequence information published in NCBI, and belongs to the 14th intron of the gene GSE1, where the base is A or G.

[0018] Furthermore, the primers for detecting the SNP genetic marker CB_tag11 include Pr_cb_tag11 f and Pr_cb_tag11 r, the nucleotide sequence of the Pr_cb_tag11 f is shown in SEQ ID NO.1, and the nucleotide sequence of the Pr_cb_tag11 r is shown in SEQ ID NO.2.

[0019] Based on the same inventive concept, the present invention provides an application of a kit for detecting the SNP genetic marker CB_tag11 in chicken genetic breeding. The SNP genetic marker CB_tag11 corresponds to the physical position 17298459 on chromosome 11 of the chicken reference genome bGalGa11.mat.broi ler.GRCg7b version sequence information published in NCBI, and belongs to the 14th intron of the gene GSE1, where the base is A or G.

[0020] Furthermore, the kit for detecting the SNP genetic marker CB_tag11 contains primers for detecting the SNP genetic marker CB_tag11, and the primers for detecting the SNP genetic marker CB_tag11 include Pr_cb_tag11 f and Pr_cb_tag11 r, the nucleotide sequence of the Pr_cb_tag11 f is shown in SEQ ID NO.1, and the nucleotide sequence of the Pr_cb_tag11 r is shown in SEQ ID NO.2.

[0021] Based on the same inventive concept, the present invention also provides the application of SNP genetic markers affecting chicken breast width in predicting chicken breast width, wherein the SNP genetic markers affecting chicken breast width include CB_tag11, and the CB_tag11 corresponds to the physical position 17298459 on chromosome 11 of the chicken reference genome bGalGa1.mat.broi ler.GRCg7b version sequence information published in NCBI, and belongs to the 14th intron of the gene GSE1, where the base is A or G.

[0022] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0023] The present invention provides an application of a SNP genetic marker affecting chicken breast width in chicken genetic breeding. The SNP genetic marker affecting chicken breast width is CB_tag11. Individuals with the dominant genotype (AA, AG) of CB_tag11 have higher breast width values ​​at 40 weeks of age. Applying the SNP genetic marker to chicken genetic breeding helps to genetically improve the breast width of 40-week-old laying hens, thereby obtaining laying hen varieties with high breast width and meeting consumers' demand for high-quality old hens. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following is a brief introduction to the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0025] Figure 1 This is the Manhattan plot of the chest width GWAS analysis of the resource population in Example 2 of the present invention;

[0026] Figure 2 This is the QQ plot of chest width GWAS analysis of the resource population in Example 2 of the present invention;

[0027] Figure 3 This is a box plot of chest width of individuals with different genotypes in Example 3 of the present invention. DETAILED DESCRIPTION

[0028] The present invention will be described in detail below in conjunction with specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific embodiments and examples are for illustrating the present invention, rather than for limiting the present invention.

[0029] Throughout this specification, unless otherwise specified, the terms used herein should be understood as having the same meaning as commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In the event of any conflict, the present specification shall take precedence.

[0030] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0031] The application of the SNP genetic marker affecting chicken breast width in chicken genetic breeding will be described in detail below with reference to the examples and experimental data.

[0032] Example 1

[0033] Resource group building

[0034] A laying hen population was constructed based on an F2 design, using Dongxiang green-shell laying hens and White Leghorn chickens as parents, respectively. F1 and F2 generations were obtained through reciprocal crosses. The experimental chickens were housed individually in fully enclosed sheds, supplemented with 16 hours of artificial light during the laying period, and cooled with fans and wet curtains. Routine immunizations were performed according to the immunization schedule established by the Jiangsu Poultry Research Institute. Feed was obtained from COFCO, and the laying hens' feed consisted of 16.5% crude protein and 11511 kJ / kg of feed metabolizable energy. During the laying period, the chickens had ad libitum access to food, with water supplied by nipple drinkers, feed provided by a traveling feeder, and manure removed by a manure conveyor. At 40 weeks of age, breast width was measured with an electronic vernier caliper.

[0035] The chest width data were initially screened, with obvious errors and duplications removed, outliers removed, and organized into Excel tables. After data cleaning, 1512 records remained in the resource population F2 chest width dataset. Using IBMSPSS 21.0 software, QQ plot analysis, kurtosis and skewness statistics, and the Kolmogrov-Smirnov test, the chest width data were determined to be normally distributed, suitable for further GWAS analysis and analysis of its genetic structure.

[0036] Example 2

[0037] GWAS analysis of chest width at 40 weeks of age

[0038] The experimental chickens were from the laying hen stock established in Example 1. Approximately 0.5 ml of blood was collected from the wing vein of the experimental chickens, placed in BD anticoagulant tubes (Suzhou BD Medical Devices Co., Ltd.), and stored at -70°C. Genomic DNA was extracted using the phenol imidazole method and analyzed by 0.8% agarose gel electrophoresis and UV spectrophotometry. After passing the test, the DNA sample was diluted to 50 ± 5 ng / μl for gene chip typing.

[0039] Affymetrix gene chip Genotyping was performed using the 600K Chicken Genotyping Array. Data quality control was performed according to the array manufacturer's instructions, including pre-genotyping quality control using APT software; quality control using PLINK to remove SNP markers with a call rate below 0.97 and those deviating from Hardy-Weinberg equilibrium; SNP screening using metrics.R and SNP_filter.R, as well as SNP, CR, and FLD information analysis; and genotype imputation using BEAGLE. After quality control, 435,867 autosomal SNPs remained for subsequent analysis.

[0040] Before the genome-wide association analysis, a multidimensional principal component analysis was performed to eliminate false positives and population structure. The first five principal components were added as covariates to the genetic model, and the chicken house effect was incorporated into the model as a fixed effect. The R script "simpleM" method was used to calculate independent test estimates for each SNP locus, resulting in 59,308 independent markers. Using multiple correction, the genomic significance threshold was 8.43×10- 7 , the recommended threshold for genome is 1.69×10- 5 The mixed linear model was used to analyze the breast width of 40-week-old eggs and obtain the significance test P value of each SNP marker. The matrix expression of the linear model is:

[0041] y=Wα+xβ+Gu+ε

[0042] Where y represents the sample phenotypic value vector; W represents the covariance matrix, α is the intercept vector; x is the genotype vector of the marker, β is the effect value of the marker; G is the genetic relationship matrix constructed based on the chip, u is the random effect vector (here is the breeding value); ε is the residual.

[0043] After GWAS screening, CB_tag11 was obtained that was associated with chest width at 40 weeks of age (Table 1). A genome-wide association analysis was performed on chest width of 1512 chickens at 40 weeks of age. Figure 1 、 Figure 2 As shown. Figure 1 (Manhattan plot) shows that there are genomically significant markers on chicken chromosome 11, and there are also markers that exceed the recommended genomic level as support. The QQ plot further verifies that the GWAS results are reliable. Figure 2 As shown in the QQ plot, the vast majority of SNPs within the slope are affected by genetic drift, while those located at the tail of the QQ plot are affected by artificial selection. The calculated inflation coefficient is 0.987, indicating no significant population stratification for chest width in the resource population. Using the genomic genetic relationship matrix to analyze genetic parameters, the heritability of chest width at 40 weeks of age was 0.32±0.04, with the CB_tag11 genetic marker explaining 2.2% of the phenotypic variance.

[0044] Table 1 CB_tag11 genetic markers associated with chest width

[0045]

[0046] Wherein: the physical position of the marker chromosome is referenced to the chicken genome (bGal Gal 1.mat.bro i ler.GRCg7b). A (minor) indicates that the frequency of the A allele is secondary.

[0047] Example 3

[0048] Detection and validation of genetic markers

[0049] The above-mentioned SNP genetic markers were used to conduct candidate gene association analysis on the Dongxiang Green-shell Layer and White Leghorn chicken resource population. The specific steps are as follows:

[0050] 1) PCR primers: DNA template sequence information was downloaded from the NCBI website, and PCR amplification primers were designed using Primer Premier 6.0 software. The primer information is shown in Table 2. PCR primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0051] Table 2 Amplification primers used to detect breast width genetic markers in chickens at 40 weeks of age

[0052]

[0053] 2) Genomic DNA extraction: Genomic DNA from 1512 blood samples was extracted by phenol imidazole method and amplified by PCR after being tested by UV spectrophotometer and agarose gel electrophoresis.

[0054] 3) PCR amplification process:

[0055] ① Reaction system: 10 μl system includes 50 ng of identification material DNA template, 10 ng of forward and reverse primers, 5 μl of 2×power Taq MasterMix, and the remaining volume is made up with ultrapure water.

[0056] ② Reaction procedure: first, denaturation at 94°C for 30 s, annealing at 55.5°C for 30 s, and extension at 72°C for 30 s, for a total of 5 cycles; then denaturation at 94°C for 30 s, annealing at 55.5°C for 30 s, and extension at 72°C for 30 s, for a total of 30 cycles; extension at 72°C for 5 min, and storage at 4°C.

[0057] 4) The amplified product is sent to a sequencing company for sequence polymorphism detection.

[0058] The sequence of the amplified fragment is as follows:

[0059] >CB_tag11

[0060] CACCTTCACATCTTCACTACTGCACCCACACCGCACCCCCAGGCCCCCCCCCCAGTGTACACCCTCATCTCCAT AAAGCACACCCTCAAATCCTCCTCATTGTACCCCCAGGTCTCCAACACTGCACCCAAAAGCACAACAGCTCTATA[A / G]GACCGGGGGGGAGGAGGGGTGGTTTGGATATGGGCATGACAGTGCACCCCACACCCCATCAGGGTGCCCGTCCCC CTCCCTGGGCTGTCCCAGCCACGCGCTCCAGGGCTCTCCACCTCCAAAAACAGCAACTGCTGATGTCAGGACCCTTAAA ATAGCTTTTCTAAATGAG CAGAATCATTAACGCCAGG

[0061] In the sequence, the ones marked with [] are mutation sites, the ones in brackets are allelic variations, and the primer sequences are bolded and underlined at the beginning and end of the sequence.

[0062] 5) Association analysis: All subjects were given genotypes and chest width at 40 weeks of age, and then a significance test was performed. Figure 3 As shown, the chest width of individuals with the AA genotype at 40 weeks of age was 6.39±0.45 cm, that of individuals with the AG genotype at 40 weeks of age was 6.36±0.47 cm, and that of individuals with the GG genotype at 40 weeks of age was 6.18±0.44 cm. Allele A appears to have a dominant genetic effect. Increasing the frequency of the A allele through genotyping technology can improve the chest width of laying hens.

[0063] Finally, it should be noted that the terms "comprises," "comprising," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a list of elements includes not only those elements, but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0064] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0065] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if such changes and modifications fall within the scope of the claims and their equivalents, the present invention is intended to include such changes and modifications.

Claims

1. Application of a SNP genetic marker affecting chicken breast width in chicken genetic breeding, characterized in that: The SNP genetic marker affecting chicken breast width includes CB_tag11, which corresponds to the physical position 17298459 of chromosome 11 of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, and belongs to the 14th intron of the gene GSE1, where the base is A or G; Among them, the chest width of individuals with the AA and AG genotypes of CB_tag11 is greater than that of individuals with the GG genotype; The chicken breeds include Dongxiang green-shell laying hens and / or white Leghorn chickens; The chicken genetic breeding is the chicken genetic breeding regarding the breast width trait.

2. An early selection method for chicken breast width trait, characterized in that: The early selection method comprises performing early selection on the chicken breast width trait based on the genotype of the SNP genetic marker CB_tag11; The CB_tag11 corresponds to the physical position 17298459 of chromosome 11 of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, belonging to the 14th intron of the gene GSE1, where the base is A or G; Among them, the chest width of individuals with the AA and AG genotypes of CB_tag11 is greater than that of individuals with the GG genotype; The chicken breeds include Dongxiang green-shell laying hens and / or white Leghorn chickens.

3. The early selection method for chicken breast width trait according to claim 2, characterized in that: The early selection method specifically includes: Detect the genotype of CB_tag11 in the chicken genome to be tested; Early selection is performed on the chicken breast width trait to be tested based on the genotype of CB_tag11.

4. The early selection method for chicken breast width trait according to claim 3, characterized in that: The detection of the genotype of CB_tag11 in the chicken genome to be tested specifically includes: The genomic DNA of the chicken to be tested was amplified by PCR using Pr_cb_tag11f and Pr_cb_tag11r as primers; The PCR amplification product was sequenced to obtain the genotype of position 17298459 on the positive strand of the tested chicken chromosome 11; The nucleotide sequence of the Pr_cb_tag11f is shown in SEQ ID NO.1, and the nucleotide sequence of the Pr_cb_tag11r is shown in SEQ ID NO.

2.

5. Application of a primer for detecting a SNP genetic marker CB_tag11 in chicken genetic breeding, characterized in that: The SNP genetic marker CB_tag11 corresponds to the physical position 17298459 of chromosome 11 of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, belonging to the 14th intron of the gene GSE1, where the base is A or G; Among them, the chest width of individuals with the AA and AG genotypes of CB_tag11 is greater than that of individuals with the GG genotype; The chicken breeds include Dongxiang green-shell laying hens and / or white Leghorn chickens; The chicken genetic breeding is the genetic breeding of chickens regarding the breast width trait; The primers for detecting the SNP genetic marker CB_tag11 include Pr_cb_tag11f and Pr_cb_tag11r. The nucleotide sequence of Pr_cb_tag11f is shown in SEQ ID NO.1, and the nucleotide sequence of Pr_cb_tag11r is shown in SEQ ID NO.

2.

6. Application of a kit for detecting SNP genetic marker CB_tag11 in chicken genetic breeding, characterized in that: The SNP genetic marker CB_tag11 corresponds to the physical position 17298459 of chromosome 11 of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, belonging to the 14th intron of the gene GSE1, where the base is A or G; Among them, the chest width of individuals with the AA and AG genotypes of CB_tag11 is greater than that of individuals with the GG genotype; The chicken breeds include Dongxiang green-shell laying hens and / or white Leghorn chickens; The chicken genetic breeding is the genetic breeding of chickens regarding breast width traits; The kit for detecting the SNP genetic marker CB_tag11 comprises primers for detecting the SNP genetic marker CB_tag11, wherein the primers for detecting the SNP genetic marker CB_tag11 include Pr_cb_tag11f and Pr_cb_tag11r, the nucleotide sequence of Pr_cb_tag11f is shown in SEQ ID NO.1, and the nucleotide sequence of Pr_cb_tag11r is shown in SEQ ID NO.

2.

7. Application of a SNP genetic marker affecting chicken breast width in predicting chicken breast width, characterized in that: The SNP genetic marker affecting chicken breast width includes CB_tag11, which corresponds to the physical position 17298459 of chromosome 11 of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, and belongs to the 14th intron of the gene GSE1, where the base is A or G; Among them, the chest width of individuals with the AA and AG genotypes of CB_tag11 is greater than that of individuals with the GG genotype; The chicken breeds include Dongxiang green-shell laying hens and / or white Leghorn chickens.

Images