Liquid crystal optofluidic chip, optical imaging device and application

Abstract

The application provides a liquid crystal optical flow control chip, an optical imaging device and application, and the liquid crystal optical flow control chip comprises a substrate, the substrate is provided with a closed microstructure, the microstructure comprises a plurality of sample pools and a plurality of optical pools which are the same in number and one-to-one corresponding, each sample pool and one optical pool corresponding to the sample pool are communicated through a micro mixing channel; each sample pool is provided with an inlet and outlet pipeline one, and each optical pool is provided with an inlet and outlet pipeline two; the micro mixing channel comprises a first channel and a second channel which are communicated with each other, wherein the first channel is provided with a sample inlet pipeline. The application is based on the aptamer conformation change principle and the liquid crystal birefringence performance, and further develops the liquid crystal optical flow control chip and the optical imaging device, different liquid crystal optical appearances of samples on the liquid crystal optical flow control chip are observed through a polarizing microscope, and the purpose of detecting exosomes in the samples is realized, and the application has the advantages of high throughput, rapid detection and high sensitivity.

Description

Technical Field

[0001] This invention relates to the fields of biochip and cell detection technology, specifically to liquid crystal optofluidic chips, optical imaging devices, and their applications. Background Technology

[0002] The determination of exosome content has wide applications in the early diagnosis and treatment of cancer patients. In completed clinical trials, exosomes have been used in areas such as early diagnosis of cancer and eclampsia, Parkinson's disease, platelet function and coagulation, and tumor vaccines. In ongoing clinical trials, exosomes are being used in areas such as early cancer diagnosis, tumor prognosis monitoring, immunotherapy, diagnosis of polycystic ovary syndrome, and tissue repair. Therefore, the research and detection of exosomes has always attracted widespread attention.

[0003] Reported methods for detecting exosomes include transmission electron microscopy (TEM), flow cytometry (FCM), Western blotting, and nanoparticle tracing (NTA). A comprehensive analysis of these methods reveals certain limitations in detecting exosomes in biological samples. For example, flow cytometry (FCM) has a poor detection limit for exosomes, requiring enrichment to increase concentration before detection, and exhibits only moderate sensitivity. Furthermore, while some methods, such as TEM and NTA, demonstrate ideal analytical performance, they typically require sophisticated instruments and relatively strict human intervention. Moreover, current methods are characterized by long testing cycles, labor-intensive processes, complex equipment, and unsuitability for rapid, sensitive, and selective detection of exosomes.

[0004] Liquid crystal biosensors utilize liquid crystal molecules as signal conversion elements to transform specific recognition and binding events between biomolecules into amplified optical signal outputs. Their detection principle lies in the fact that the alignment and orientation of liquid crystal molecules at the functionalized sensing interface changes with the addition of a specific target molecule, thereby altering the direction of light refraction by the liquid crystal. This change is further amplified into a change in the optical image morphology of the liquid crystal under a polarizing microscope. Due to its advantages such as simple operation and high sensitivity, it has found some applications in small molecule drug control and protein detection. This invention aims to explore liquid crystal biosensors that can be used for the detection of biological organisms such as exosomes. Summary of the Invention

[0005] This invention provides a liquid crystal optofluidic chip, an optical imaging device, and applications. The purpose is to develop a new liquid crystal optofluidic chip and an optical imaging device, and to explore their potential in exosome detection.

[0006] To achieve the above-mentioned technical objectives, the technical solution adopted by the present invention is as follows:

[0007] In a first aspect, the present invention provides a liquid crystal optical fluid control chip, comprising a substrate having a closed microstructure, the microstructure comprising a plurality of sample cells and a plurality of optical cells of equal number and corresponding to each other, each sample cell and a corresponding optical cell being connected through a micro-mixing channel; each sample cell having an inlet / outlet pipe I, and each optical cell having an inlet / outlet pipe II; the micro-mixing channel comprising a first channel and a second channel communicating with each other, wherein the first channel has a sample inlet pipe.

[0008] Preferably, the sample cell is provided with a plurality of small molecule filter holes, the small molecule filter holes being located on the side of the sample cell connected to the micro-mixing channel; and / or, the optical cell is provided with a plurality of slots for loading optical components; preferably, the cross-section of the slots is rectangular, regular hexagonal, equilateral triangle, or circular; more preferably, a plurality of the slots are arranged to form a square matrix.

[0009] Preferably, the first channel is a hierarchical tree-like channel; and / or, the second channel includes a plurality of third channels, each of which is connected to one of the sample cells and an optical cell corresponding to the sample cell.

[0010] Preferably, the third channel is connected to the sample cell and the optical cell respectively via pipes; more preferably, the third channel is a curved channel.

[0011] Preferably, the substrate is a PDMS flexible substrate; more preferably, the chip further includes a housing; more preferably, the housing is a transparent structure.

[0012] In a second aspect, the present invention provides a method for fabricating the liquid crystal optofluidic chip described in the first aspect, comprising the following steps:

[0013] Step 1: Design microstructure patterns using a photomask;

[0014] Step 2: Transfer the microstructure pattern on the photomask onto the silicon wafer;

[0015] Step 3: Transfer the microstructure pattern on the silicon wafer onto the substrate.

[0016] Preferably, step 2, transferring the microstructure pattern on the photomask onto the silicon wafer, includes the following steps:

[0017] Step 2-1: Apply photoresist to the silicon wafer in one pass, preferably by spin coating at a speed of 500 rpm, an acceleration of 500 rpm·s⁻¹, and a time of 5 s; preferably using SU8-3000 series photoresist.

[0018] Step 2-2: Secondary coating of the silicon wafer, preferably by spin coating, with a spin coating speed of 1800-2500 rpm, an acceleration of 1800-2500 rpm·s-1, and a time of 60 s;

[0019] Steps 2-3: After the silicon wafers have been coated with adhesive twice, perform step-by-step pre-baking. After cooling to room temperature, stack the silicon wafers and photomasks and perform ultraviolet exposure. Then, perform step-by-step post-baking on the silicon wafers.

[0020] Steps 2-4: Silicon wafer development, preferably using PGMEA developer, for 4-10 minutes; after development, clean and dry.

[0021] Steps 2-5 involve further heating the silicon wafer at 120-150 °C for 20-30 min, then cooling it to room temperature to obtain a silicon wafer with a microstructure.

[0022] More preferably, in steps 2-3, the step-by-step pre-baking includes: first, heating at room temperature to 50±5℃ and holding for 10-15 min; second, heating to 65±5℃ and holding for 10-15 min; third, heating to 95±5℃ and holding for 10-15 min; fourth, cooling from 95℃ to room temperature; and / or,

[0023] The step-by-step post-baking process includes: Step 1: heating at room temperature to 50±5℃ and holding at 50±5℃ for 10 min; Step 2: heating at 50±5℃ to 65±5℃ and holding at 65±5℃ for 10 min; Step 3: heating at 65±5℃ to 80±5℃ and holding at 80±5℃ for 10 min; Step 4: cooling at 80±5℃ to room temperature; and / or,

[0024] The control parameters for the ultraviolet exposure are: exposure time 25~30 s, ultraviolet intensity 120~130 μM·cm. -2 .

[0025] Preferably, in step 3, the microstructure pattern on the silicon wafer is transferred to a substrate; the substrate is a PDMS flexible substrate, using two PDMS flexible substrates, one of which has a sample cell, an optical cell, and a first channel in the microstructure, and the other PDMS flexible substrate has a second channel in the microstructure, specifically including the following steps:

[0026] Step 3-1: Mix PDMS and curing agent at a mass ratio of 10:1 and eliminate air bubbles to obtain liquid PDMS;

[0027] Step 3-2: Liquid PDMS is applied to the silicon wafer and thermally cured. Preferably, the curing parameters include: temperature 80~90 ℃, time 30~40 min, and cooling to room temperature. After curing, the PDMS is peeled off from the silicon wafer to obtain two flexible PDMS substrates with corresponding microstructures.

[0028] Step 3-3: Bond the two PDMS flexible substrates together, wherein the PDMS flexible substrate with the sample cell, optical cell and first channel in the microstructure is located in the lower layer, and the PDMS flexible substrate with the second channel in the microstructure is located in the upper layer.

[0029] More preferably, the preparation method further includes loading the bonded PDMS flexible substrate into a shell.

[0030] Thirdly, the present invention provides an optical imaging device, comprising the liquid crystal optofluidic chip and the polarizing microscope described in the first aspect, wherein the polarizing microscope is used to observe optical phenomena in the optical cell of the liquid crystal optofluidic chip.

[0031] Fourthly, the present invention provides the application of the liquid crystal photofluidic chip described in the first aspect and / or the optical imaging device described in the third aspect in the detection of biological organisms. Biological organisms include cells, viruses, and small biological molecules such as proteins and nucleic acids.

[0032] Fifthly, the present invention provides a method for detecting exosomes, which employs the optical imaging device described in the third aspect, and includes the following steps:

[0033] A liquid crystal is mixed with a cationic surfactant solution to obtain a liquid crystal mixture, wherein the concentration of the cationic surfactant solution is <0.025 mM;

[0034] The organism to be tested is injected into the sample cell and introduced into the micromixing channel, while the aptamer solution is injected into the micromixing channel and mixed with the organism to be tested; preferably, the concentration of the aptamer solution is 45~50 nmol / L;

[0035] The mixture is further introduced into the optical cell, and a liquid crystal mixture is injected into the optical cell to further mix with the mixture;

[0036] The optical cell was placed under a polarizing microscope for examination, and the obtained optical images were used for exosome analysis.

[0037] Preferably, the cationic surfactant is selected from at least one of hexadecyltrimethylamine bromide, dodecyl dimethyl benzyl ammonium bromide, octadecyltrimethyl ammonium chloride, and methyl ditaurate ethyl-2-hydroxyethyl ammonium sulfate.

[0038] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0039] This invention combines traditional microfluidic technology with liquid crystal optical sensing technology. Based on the principle of aptamer conformational change and the birefringence properties of liquid crystals, a novel liquid crystal optical fluidic chip and optical imaging device capable of high-throughput detection are developed. Different liquid crystal optical morphologies on the liquid crystal optical fluidic chip are observed using a polarizing microscope, thereby achieving the purpose of detecting exosomes in the sample. This liquid crystal optical fluidic chip and optical imaging device offer advantages such as high throughput, rapid detection, and high sensitivity for exosome detection. Furthermore, the entire operation is simple, consumes few reagents, and has a short sample processing time, solving the technical problems of complexity and high cost associated with existing detection methods, and broadening the application scope of liquid crystal optical fluidic chips. Attached Figure Description

[0040] Figure 1 This is a schematic diagram of the liquid crystal optofluidic chip in Embodiment 1 of the present invention.

[0041] Figure 2 This is a schematic diagram of the sample cell structure in Embodiment 1 of the present invention.

[0042] Figure 3 This is a schematic diagram of the optical cell structure in Embodiment 1 of the present invention.

[0043] Figure 4 This is a structural diagram of the mask plate in Embodiment 2 of the present invention.

[0044] Figures 1-4 In the diagram, 1-substrate, 2-sample cell, 3-optical cell, 4-inlet / outlet pipe one, 5-inlet / outlet pipe two, 6-first channel, 7-second channel, 8-sample inlet pipe, 9-third channel, 10-pipe connecting the sample cell and the micro-mixing channel, 11-pipe connecting the micro-mixing channel and the optical cell, 12-splitter one, 13-splitter two, 14-splitter three, 15-square matrix formed by pores and grooves, 16-small molecule filter pores, 17-square column.

[0045] Figure 5 The following are cross-sectional structural diagrams of the slots in Embodiment 2 of the present invention (all forming rectangular arrays). In Figure A, the slots are regular hexagons; in Figure B, the slots are squares; in Figure C, the slots are equilateral triangles; and in Figure D, the slots are circles.

[0046] Figure 6These are polarized light microscope images and their grayscale gradient diagrams of liquid crystal optofluidic chips with different concentrations of hexadecyltrimethylammonium bromide solution added to the optical cell at the same concentration in Example 3 of this invention. The concentrations of the hexadecyltrimethylammonium bromide solution are: 0.02 mM, 0.0225 mM, 0.025 mM, 0.03 mM, and 0.04 mM. Image A: Polarized light microscope image of liquid crystal modified with 0.02 mM hexadecyltrimethylammonium bromide solution; Image B: Polarized light microscope image of liquid crystal modified with 0.0225 mM hexadecyltrimethylammonium bromide solution; Image C: Polarized light microscope image of liquid crystal modified with 0.025 mM hexadecyltrimethylammonium bromide solution; Image D: Polarized light microscope image of liquid crystal modified with 0.03 mM hexadecyltrimethylammonium bromide solution; Image E: Polarized light microscope image of liquid crystal modified with 0.04 mM hexadecyltrimethylammonium bromide solution; Image F: Grayscale gradient diagram.

[0047] Figure 7 The diagram shows the mechanism of detecting exosomes using an optical imaging device in Embodiment 3 of the present invention. Figure A shows the optical morphology of the liquid crystal in which there are no exosomes and aptamers in the optical cell; Figure B shows the optical morphology of the liquid crystal in which there are aptamers in the optical cell; Figure C shows the optical morphology of the liquid crystal in which there are exosomes and aptamers in the optical cell.

[0048] Figure 8 The images shown are polarized light microscope images and their grayscale gradients of nucleic acid aptamer solutions and 0.02 mM hexadecyltrimethylammonium bromide solutions at different concentrations added to the optical cell of a liquid crystal optofluidic chip in Example 4 of this invention. The concentrations of the nucleic acid aptamer solutions were 50 nmol / L, 40 nmol / L, 20 nmol / L, and 10 nmol / L. Image A shows the polarized light microscope image of the reaction mixture of 10 nmol / L nucleic acid aptamer solution and 0.02 mM hexadecyltrimethylammonium bromide solution. Image A: Liquid crystal polarizing microscope image of the reaction solution of 20 nmol / L nucleic acid aptamer solution and 0.02 mM hexadecyltrimethylammonium bromide solution; Image B: Liquid crystal polarizing microscope image of the reaction solution of 40 nmol / L nucleic acid aptamer solution and 0.02 mM hexadecyltrimethylammonium bromide solution; Image C: Liquid crystal polarizing microscope image of the reaction solution of 50 nmol / L nucleic acid aptamer solution and 0.02 mM hexadecyltrimethylammonium bromide solution; Image D: Grayscale gradient image.

[0049] Figure 9 shows liquid crystal polarizing microscope images of the reaction solutions of exosome standard solutions of different concentrations, 0.02 mM hexadecyltrimethylammonium bromide solution, and 100 nmol / L nucleic acid aptamer solution added to the optical cell of the liquid crystal optofluidic chip in Example 5 of the present invention. Figure A: Liquid crystal polarizing microscope image of exosome standard solution with a concentration of 9.8 × 10^6 / mL; Figure B: Liquid crystal polarizing microscope image of exosome standard solution with a concentration of 1.95 × 10^7 / mL; Figure C: Liquid crystal polarizing microscope image of exosome standard solution with a concentration of 3.9 × 10^7 / mL; Figure D: Linear curve of grayscale value vs. exosome concentration in the liquid crystal image under polarizing microscope.

[0050] Figure 10 The above are experimental polarized light images of exosomes detected by the optical imaging device in Embodiment 6 of the present invention. In the images, A: liquid crystal is introduced; B: aptamer is introduced; and C: a mixed solution of exosomes and aptamer is introduced. Detailed Implementation

[0051] The 4-cyano-4'-pentylbiphenyl (5CB) used in these embodiments was purchased from Tokyo Jinsei Kogyo Co., Ltd. Furthermore, unless otherwise specified in the embodiments, conventional conditions or conditions recommended by the manufacturer were followed. All reagents and instruments used, unless otherwise specified, are commercially available products.

[0052] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. These descriptions are for illustrative purposes only and are not intended to limit the scope of the invention.

[0053] The nucleic acid aptamer sequence used below is CD63 aptamer (SEQ ID NO.1):

[0054] 5′-CACCCCACCTCGCTCCCGTGACACTAATGCTATTTTTTTTTTTTTT-3′-FAM.

[0055] Another usable nucleic acid aptamer is CD63-2 aptamer (shown as SEQ ID NO.2):

[0056] 5′-TAACCACCCCACCTCGCTCCCGTGACACTAATGCTAATTCCAA-3′;

[0057] CD9-26aptamer (shown as SEQ ID NO.3):

[0058] 5′ATAGTCCCTTGGCGTGCTTCACAACCTTGAACTTGACGCAGGATCGTTCAGTGCGCACTAGAGCAGGTACGGTGTCA-3′.

[0059] The PBS buffer components in this example are as follows: 137 mol / L NaCl, 2.7 mmol / L KCl, 4.3 mmol / L Na2HPO4, 1.4 mmol / L KH2PO4, with water as the solvent and pH adjusted to 7.4 with dilute hydrochloric acid.

[0060] Example 1

[0061] This embodiment provides a liquid crystal optical fluid control chip, the structure of which is as follows: Figure 1-5 As shown, the device includes a flexible PDMS substrate 1 with a closed microstructure. The microstructure comprises a plurality of identical, one-to-one corresponding sample cells 2 and a plurality of optical cells 3. Each sample cell 2 and its corresponding optical cell 3 are connected via a micro-mixing channel. Each sample cell 2 has an inlet / outlet channel 4, and each optical cell 3 has an inlet / outlet channel 5. The micro-mixing channel includes a first channel 6 and a second channel 7 that are interconnected. The first channel 6 has a sample inlet channel 8. The number of sample cells 2 and optical cells 3 is not specifically required and can be specified according to throughput requirements, such as 8, 9, 10, 20, 30, 50, 100, etc. Therefore, the liquid crystal optical fluid control chip of this invention can achieve high-throughput measurement of biological samples of different concentrations. In all embodiments of this invention, a microstructure consisting of 8 sample cells 2 and 8 optical cells 3 is used.

[0062] Furthermore, such as Figure 2 As shown, the sample cell is provided with a plurality of small molecule filter holes 16, which are located on the side of the sample cell 2 connected to the micromixing channel. In this embodiment, the small molecule filter holes 16 are formed by arranging a plurality of square pillars 17 in the sample cell, with the small molecule filter holes 16 formed between the square pillars 17. Furthermore, in this embodiment, the size of the small molecule filter holes 16 is set below 1 μm, allowing for the detection of small molecule analytes (…). Figure 2 The spherical particles represent small molecule analytes, while the sheet-like particles with a central spherical center represent cell cultures. These are typically nanoscale, such as exosomes and other secretions which are 100-150 nm in size. The small molecule filter pores allow small molecules to pass through while retaining large molecule cells (cells larger than 10 μm). The size of the small molecule filter pore 16 can be flexibly adjusted according to the size of the analyte in the sample. Furthermore, there are no special requirements for the size of the sample cell. In this embodiment, the sample cell 2 is 1.7 cm long, 3 mm wide, and 100 μm high.

[0063] like Figure 3 , 5 As shown, the optical cell 3 is provided with several slots 15 for loading optical components; the cross-section of the slots can be designed as rectangular (cube), regular hexagonal (regular hexagonal prism), equilateral triangle (regular triangular prism), or circular. Correspondingly, different slot structures are cuboid, regular hexagonal prism, regular triangular prism, and cylindrical structures, and the optical images formed under a polarizing microscope are rectangular, regular hexagonal, equilateral triangle, and circular, respectively. In this embodiment, a square slot structure is used. Figures 3-6 The optical image formed by each aperture slot is therefore square. Furthermore, the optical image formed by the aperture slots arranged in a regular shape is more uniform and easier to observe; therefore, the aperture slots in this embodiment are arranged in a square matrix. In addition, there are no special requirements for the size of the optical cell. In this embodiment, the optical cell 3 is 1.6 cm long, 3 mm wide, and 100 μm high. The square aperture slots have a side length of 80 μm and a height of 25 μm.

[0064] Furthermore, such as Figure 4 As shown, the first channel 6 is a hierarchical tree-like channel with at least two levels, preferably between two and five, which helps control the uniformity and efficiency of sample introduction. In all embodiments of this invention, a three-level tree-like channel is used. The first level has an inlet pipe 8 and two branch ports 12. The second level has four branch ports 13. The third level has eight branch ports 14, which are connected to the third channel 9 of the second channel 7. The component to be introduced enters through the inlet pipe 8, passes through branch ports 12 into the second level, then is branched through branch ports 13 into the third level, and finally enters the second channel 7 through branch ports 14.

[0065] The second channel 7 includes several third channels 9, each of which is connected to one of the sample cells 2 and one of the corresponding optical cells 3, i.e., the number of third channels 9 is the same as the number of sample cells 2 and optical cells 3. In all embodiments of the present invention, eight third channels 9 are used. The two ends of the third channel 9 are connected to the sample cell 2 and the optical cell 3 respectively through pipes 10 and 11. In this embodiment, each third channel 9 has a structure of a 'U'-shaped channel connected to a spiral channel, wherein the 'U'-shaped channel corresponds one-to-one with and is connected to the diversion port 14, the 'U'-shaped channel is located on one side of the sample cell 2, and the spiral channel is located on one side of the optical cell 3.

[0066] To better protect the liquid crystal optical fluid control chip, a housing can be provided. The housing can be an integral part of the chip or a detachable structure. When the housing and chip are an integral part, the housing is preferably transparent. The purpose of the housing is to prevent contamination or damage to the liquid crystal optical fluid control chip. Figure 1The image shows the structure without the casing.

[0067] The liquid crystal optofluidic chip in this embodiment enables uniform mixing of different components in a micro-mixing channel. It breaks down multi-step, complex experiments into a pipeline-like structure, accurately controlling the volume of injected solution and rapidly completing mixing, thus solving the volume error and cumbersome operation problems associated with manual mixing. The mixture is then collected in the optical region, where optical components such as liquid crystals can be added simultaneously. This allows for the detection, identification, and differentiation of substances within the components using different optical phenomena. The chip can perform multiple experiments simultaneously and observe multiple experimental phenomena concurrently, offering convenience, speed, and efficiency.

[0068] Example 2

[0069] The fabrication method of the liquid crystal optofluidic chip and the assembly of the optical imaging device in Example 1 are as follows:

[0070] (1) Using AutoCAD software, geometric patterns of different sizes and shapes were drawn and customized into a mask with a size of 5 inches × 5 inches × 2.3 mm. Figure 4 The mask design of the microstructure is shown, with black representing the opaque parts and white representing the transparent parts.

[0071] (2) Photolithography microstructure process: Coating: SU8-3000 series photoresist is used for spin coating on the silicon wafer. Spin coating is divided into two steps. The first step is: speed 500 rpm, acceleration 500 rpm·s -1 The time is 5 seconds; the second step of spin coating is: speed 1800-2500 rpm, acceleration 1800-2500 rpm·s. -1 Spin coating time 60 s, thickness approximately 20-60 μm; followed by step-by-step pre-baking and natural cooling to room temperature; then, the photomask is aligned with the coated silicon wafer in the photolithography machine for UV exposure with the following parameters: exposure time 25 s, UV intensity 126 μM·cm. -2 Then perform step-by-step baking; Development: use PGMEA developer for 4-10 min; after development, clean with isopropanol, blow dry the silicon wafer with nitrogen, and observe the photolithography under a microscope; Hardening: place the photolithographic silicon wafer on a 120 ℃ hot plate for 30 min, and then let it cool naturally to room temperature.

[0072] In the above process, the step-by-step pre-baking includes: first step heating at room temperature to 50±5℃ and holding for 10~15 min; second step heating to 65±5℃ and holding for 10~15 min; third step heating to 95±5℃ and holding for 10~15 min; fourth step cooling from 95℃ to room temperature.

[0073] The step-by-step post-baking process includes: Step 1: heating at room temperature to 50±5℃ and holding at 50±5℃ for 10 min; Step 2: heating at 50±5℃ to 65±5℃ and holding at 65±5℃ for 10 min; Step 3: heating at 65±5℃ to 80±5℃ and holding at 80±5℃ for 10 min; Step 4: cooling at 80±5℃ to room temperature.

[0074] (3) PDMS molding: PDMS and curing agent are thoroughly mixed at a mass ratio of 10:1 and then vacuum-sealed to eliminate air bubbles to obtain liquid PDMS. The liquid PDMS is then uniformly poured onto a silicon wafer and thermally cured. The curing parameters include: temperature 90 ℃, time 30 min, and natural cooling to room temperature. After curing, the PDMS is peeled off from the silicon wafer and cut into two pieces. The two PDMS flexible substrates are then bonded together, specifically by adhesive bonding. The PDMS flexible substrate with the sample cell, optical cell, and first channel in the microstructure is located on the lower layer, and the PDMS flexible substrate with the second channel in the microstructure is located on the upper layer. At the same time, the non-microchannel parts on the PDMS flexible substrate are cleaned using a plasma cleaner with air as the plasma gas for 6 min. The microstructure is masked with 3M tape during the plasma cleaning process. The masking material of the upper and lower substrates needs to be removed during the bonding process.

[0075] After bonding, a 1.25 mm diameter punch is used to create the ports for connecting inlet / outlet pipe one, inlet / outlet pipe two, and the sample inlet pipe, as well as the ports for connecting the sample cell to the micromixing channel and the micromixing channel to the optical cell. This yields a liquid crystal optofluidic chip for later use. In this embodiment, a housing is not added to the liquid crystal optofluidic chip.

[0076] Optical imaging device assembly: Inlet and outlet pipes 1 and 2, and the sample inlet pipe are made of silicone tubing with an inner diameter of 0.5 mm and an outer diameter of 1.5 mm. Inlet and outlet pipes 1 and 2 are also connected to an injection device, which is a fluid delivery device consisting of an injection pump and an injection needle. A polarizing microscope is then added, placing the optical area of ​​the liquid crystal optofluidic chip under the microscope. The two linear polarizers of the polarizing microscope are perpendicularly intersecting. The detection beam is received from one side of the optical cell of the liquid crystal optofluidic chip, and detection is achieved by observing the changes in the beam passing through the optical cell on the other side. A CCD electronic component receives the optical image of the liquid crystal optofluidic chip.

[0077] Example 3

[0078] Functional testing of the liquid crystal optical fluid control chip:

[0079] Using the optical imaging device of Example 2, liquid crystal is first injected into the optical cells of the liquid crystal optical fluid control chip through the inlet and outlet pipe two, with an injection amount of about 2 μL per optical cell;

[0080] Hexadecyltrimethylammonium bromide solutions were prepared by dissolving hexadecyltrimethylammonium bromide in PBS buffer and sonicating for 30 min to prepare concentrations of 0.02 mM, 0.0225 mM, 0.025 mM, 0.03 mM, and 0.04 mM. These solutions of different concentrations were then added to the optical cells of the liquid crystal optofluidic chip through different inlet and outlet channels, with each cell containing 110 μL. The results were observed using a polarizing microscope. Figure 6 As shown, when the concentration of the hexadecyltrimethylammonium bromide solution is <0.025 mM, the liquid crystal exhibits a bright morphology within 5 minutes; when the concentration of the hexadecyltrimethylammonium bromide solution is ≥0.025 mM, the liquid crystal exhibits a dark morphology within 5 minutes. Therefore, the concentration of the hexadecyltrimethylammonium bromide solution is controlled at <0.025 mM, preferably 0.02 mM. Hexadecyltrimethylammonium bromide is a cationic surfactant. The present invention can also select several other cationic surfactants such as dodecyl dimethyl benzyl ammonium bromide, octadecyl trimethylammonium chloride, and methyl ditaurate ethyl-2-hydroxyethyl ammonium sulfate.

[0081] In the above process, there is no specific limit to the amount of liquid crystal added, as long as the prepared liquid crystal biosensor is a uniform dark field under a polarizing microscope.

[0082] The principle of this invention for detecting exosomes using an optical imaging device is as follows: Figure 7 As shown: When there are no exosomes and aptamers in the optical cell of the liquid crystal optofluidic chip, the hexadecyltrimethylammonium bromide monolayer at the interface still maintains the vertical alignment of liquid crystal molecules, and the liquid crystal image under a polarizing microscope shows a dark optical morphology. Figure 7 (Figure A); When an aptamer is added, the concentration of hexadecyltrimethylammonium bromide at the interface is reduced, thereby disrupting the previously formed hexadecyltrimethylammonium bromide monolayer. This causes the liquid crystal molecules to change from vertical alignment to parallel / tilted alignment, resulting in a bright optical morphology in the liquid crystal image under a polarizing microscope. Figure 7 (Figure B); When a mixed solution of aptamers and exosomes is added, due to the specific binding of exosomes and aptamers, the hexadecyltrimethylammonium bromide monolayer at the interface still maintains the vertical alignment of liquid crystal molecules, and the liquid crystal image under a polarizing microscope shows a dark optical morphology. Figure 7 (See Figure C). Based on the above principles, and combined with the grayscale-concentration standard curve of Example 5, the qualitative and quantitative detection process of exosomes can be obtained.

[0083] In addition, the sample cell can also be used as a cell culture unit as needed, and the apertures in the optical cell used to load optical components can also be adjusted according to different requirements, thereby changing the grid shape and size in the formed liquid crystal image.

[0084] Example 4

[0085] Determination of nucleic acid aptamer concentration:

[0086] Using the optical imaging device of Example 2, liquid crystal is first injected into the optical cells of the liquid crystal optical fluid control chip through the inlet and outlet pipe two, with an injection amount of about 2 μL per optical cell;

[0087] CD63 lyophilized aptamer powder was dissolved in PBS buffer and vortexed to prepare aptamer solutions with concentrations of 50 nmol / L, 40 nmol / L, 20 nmol / L, and 10 nmol / L. These solutions were then vortexed with 0.02 mM hexadecyltrimethylammonium bromide solution (prepared as in Example 3), incubated at 37°C for 30 min, and then added to the array optical cells of the liquid crystal biosensor. The drop volume for each optical cell was 110 μL. The results were observed using a polarizing microscope. Figure 8 As shown, when the concentration of the nucleic acid aptamer solution is ≥50 nmol / L, the liquid crystal exhibits a completely bright morphology. When the concentration of the nucleic acid aptamer solution gradually decreases from 50 nmol / L to 10 nmol / L, the morphology of the liquid crystal gradually changes from completely bright to completely dark, and the bright area gradually decreases. Therefore, a concentration of 45–50 nmol / L for the nucleic acid aptamer solution is suitable, preferably 50 nmol / L.

[0088] Example 5

[0089] Obtaining the exosome gray-concentration standard curve:

[0090] Using the optical imaging device of Example 2, liquid crystal is first injected into the optical cells of the liquid crystal optical fluid control chip through the inlet and outlet pipe two, with an injection amount of about 2 μL per optical cell;

[0091] Exosome extraction: Healthy 3rd-4th generation human umbilical cord mesenchymal stem cells (MSCs) were selected. When the MSCs reached approximately 75% confluence, the medium was replaced with fresh serum-free culture medium. After 48 h of culture, the supernatant was collected. The supernatant was placed in a centrifuge tube and centrifuged at 2000g for 30 min at 4°C to remove cell debris. The retained supernatant was filtered through a sterile 0.45 μm filter and then placed in an ultracentrifuge tube. After centrifugation at 1000g for 70 min at 4°C, the exosome concentrate was obtained. The concentrate was transferred to a new ultracentrifuge tube and centrifuged at 100000g for 70 min at 4°C. The precipitate was diluted with PBS and centrifuged again at 100000g for 70 min at 4°C. The obtained exosome concentrate was filtered through a sterile 0.22 μm filter, resuspended in a small volume of PBS, and stored at -80°C for subsequent experiments, yielding a laboratory-prepared exosome standard.

[0092] Exosome standards were vortexed and dissolved in PBS buffer to prepare exosome standard solutions with concentrations of 3.9 × 10^7 / mL, 1.95 × 10^7 / mL, and 9.8 × 10^6 / mL. CD63 aptamer solution was added to these exosome standard solutions of different concentrations, and the mixture was homogeneous. The volume ratio of aptamer to exosome standard solution was 1:1, and the final concentration of aptamer in the mixed solution was 100 nmol / L. The mixture was reacted at 4℃ for 60 min to obtain reaction solution ①. Reaction solution ① was then mixed with hexadecyltrimethylammonium bromide solution, with a volume ratio of hexadecyltrimethylammonium bromide solution to reaction solution ① of 1:1. The final concentration of hexadecyltrimethylammonium bromide in the mixed solution was 0.02 mM. The mixture was reacted at 37℃ for 30 min to obtain reaction solution ②. Reaction solution ② was added to optical cells, with a drop volume of 110 μL per cell. The results were observed using a polarizing microscope. Figure 9 As shown, when the concentration of the exosome standard solution is ≥3.9×10^7 / mL, the liquid crystal exhibits a dark morphology; when the concentration of the exosome standard solution is ≤9.8×10^6 / mL, the liquid crystal exhibits a bright morphology; and as the concentration of the exosome standard solution gradually decreases from 3.9×10^7 / mL to 9.8×10^6 / mL, the morphology of the liquid crystal gradually changes from completely dark to gradually bright. Pixel analysis of the acquired optical images was performed using MATLAB software (version 9.6.0, R2019a) to obtain the average grayscale value of the liquid crystal image, which was then plotted using OriginPro 9.1 software. Within the concentration range of exosomes from 9.8×10^6 / mL to 3.9×10^7 / mL, the grayscale value of the liquid crystal image showed a good linear relationship with the exosome concentration, with a correlation coefficient of 0.9996. Figure 9 (See Figure D). The detection limit of the liquid crystal biosensor for exosomes is 1.86 × 10^6 / ml.

[0093] Example 6

[0094] The optical imaging device of Example 2 was used to detect exosome samples:

[0095] First, liquid crystal is injected into the optical cells of the liquid crystal optofluidic chip through inlet and outlet pipe two. The amount added is approximately 2 μL per optical cell, forming a liquid crystal film of a certain thickness while simultaneously anchoring the liquid crystal molecules at the interface of the liquid crystal film to align vertically. For example... Figure 10 Figure A shows the POM diagram of the vertically anchored microstructure of the liquid crystal.

[0096] Then, a 0.01 mM hexadecyltrimethylammonium bromide solution was added to injection needle one and fixed in injection pump one, with an injection volume of 30 μL.

[0097] Exosomes were obtained by means of extraction of exosomes in Example 5, and the exosomes were resuspended in PBS to make the concentration of exosomes 3.9×10^7 / mL. The exosomes were added into injection needle 2 and fixed in injection pump 2. The injection volume was 30μL.

[0098] The injection needle, prepared as a 40 nmol / L solution of CD63 aptamer with PBS buffer, was fixed in the injection pump, and the injection volume was 60 μL.

[0099] The flow rates of the three liquids injected into the optical cell, sample cell, and micromixing channel were 25 μL·min⁻¹, 150 μL·min⁻¹, and 80 μL·min⁻¹, respectively. They were then mixed in the optical cell, and the results observed using a polarizing microscope are shown below. Figure 10 As shown in Figures B and C, pixel analysis of the acquired optical images was performed using MATLAB software (version 9.6.0, R2019a). Combined with the exosome grayscale-concentration standard curve, the calculated exosome concentration was 3.9 × 10^7 / mL. Further, exosomes were prepared into solutions with the following concentrations: 4.5 × 10^7 / mL, 5.0 × 10^7 / mL, 5.5 × 10^7 / mL, and 6.0 × 10^7 / mL. The aforementioned experimental process was repeated to verify the results. The calculated results were consistent with the target concentration. The results of this example demonstrate that this liquid crystal sensor has high accuracy in exosome detection.

[0100] This result demonstrates that the liquid crystal biosensor assembly of this application can effectively detect exosomes in liquid samples. The method of this invention can quickly, sensitively, easily, and array-wise effectively detect trace amounts of exosomes, with the entire detection process taking approximately 10 minutes.

[0101] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.

Claims

1. A liquid crystal optofluidic chip, characterized in that, The system comprises two substrates, each with a closed microstructure. Each microstructure includes a plurality of identical, one-to-one corresponding sample cells and optical cells. Each sample cell and its corresponding optical cell are connected via a micro-mixing channel. Each sample cell has an inlet / outlet pipe (I), and each optical cell has an inlet / outlet pipe (II). The micro-mixing channel includes a first channel and a second channel that are interconnected. The first channel has a sample inlet pipe and is a hierarchical, tree-like channel. The second channel includes several third channels, each of which is connected to one sample cell and its corresponding optical cell. These third channels are curved. One substrate contains the sample cells, optical cells, and second channels within the microstructure, while the other substrate contains the first channels within the microstructure. The sample cell is provided with a number of small molecule filter holes, which are located on the side of the sample cell connected to the micro-mixing channel; the optical cell is provided with a number of slots for loading optical components; the cross-section of the slots is rectangular, regular hexagonal, equilateral triangle, or circular; the slots are arranged to form a square matrix.

2. The liquid crystal optofluidic chip according to claim 1, characterized in that, The substrate is a PDMS flexible substrate; the chip also includes a housing, which is a transparent structure.

3. The method for fabricating the liquid crystal optofluidic chip according to any one of claims 1 to 2, characterized in that, Includes the following steps: Step 1: Design microstructure patterns using a photomask; Step 2: Transfer the microstructure pattern on the photomask onto the silicon wafer; Step 3: Transfer the microstructure pattern on the silicon wafer onto the substrate; Step 2, transferring the microstructure pattern on the photomask onto the silicon wafer, includes the following steps: Step 2-1, applying adhesive to the silicon wafer in a single coat using a spin coater at a speed of 500 rpm and an acceleration of 500 rpm·s. -1 The time is 5 seconds; SU8-3000 series photoresist is used; in step 2-2, the silicon wafer is coated with photoresist a second time using a spin coating method at a speed of 1800-2500 rpm and an acceleration of 1800-2500 rpm·s. -1 The process is as follows: Step 1, the time is 60 s; Step 2-3, the silicon wafer after the second coating is pre-baked in stages, cooled to room temperature, the silicon wafer is stacked with the mask and exposed to ultraviolet light, and then the silicon wafer is post-baked in stages; Step 2-4, the silicon wafer is developed using PGMEA developer for 4-10 min; after development, it is cleaned and dried; Step 2-5, the silicon wafer is further heated at 120~150 ℃ for 20~30 min, cooled to room temperature, to obtain a silicon wafer with microstructure; In Step 2-3, the pre-baking in stages includes: first step heating at room temperature to 50±5℃ and holding for 10~15 min; second step heating to 65±5℃ and holding for 10~15 min; third step heating to 95±5℃ and holding for 10~15 min; fourth step cooling from 95℃ to room temperature; and / or, the post-baking in stages includes: first step heating at room temperature to 50±5℃ and holding at 50±5℃ for 10 min; The first step involves heating from 50±5℃ to 65±5℃ and holding at 65±5℃ for 10 minutes; the second step involves heating from 65±5℃ to 80±5℃ and holding at 80±5℃ for 10 minutes; the third step involves cooling from 80±5℃ to room temperature; and / or, the control parameters for the UV exposure are: exposure time 25~30 s, UV intensity 120~130 μW·cm. -2 ; In step 3, the microstructure pattern on the silicon wafer is transferred to a substrate. The substrate is a PDMS flexible substrate, using two PDMS flexible substrates. One PDMS flexible substrate has a sample cell, an optical cell, and a second channel in the microstructure, and the other PDMS flexible substrate has a first channel in the microstructure. Specifically, the process includes the following steps: Step 3-1, mixing PDMS and a curing agent at a mass ratio of 10:1 and eliminating air bubbles to obtain liquid PDMS; Step 3-2, covering the silicon wafer with the liquid PDMS and performing thermal curing. The curing parameters include: temperature 80~90 ℃, time 30~40 min, and cooling to room temperature; after curing, peeling the PDMS off the silicon wafer to obtain two PDMS flexible substrates with corresponding microstructures; Step 3-3, bonding the two PDMS flexible substrates together, wherein the PDMS flexible substrate with the sample cell, optical cell, and second channel in the microstructure is located in the lower layer, and the PDMS flexible substrate with the first channel in the microstructure is located in the upper layer; the preparation method also includes loading the bonded PDMS flexible substrates into a shell.

4. An optical imaging device, characterized in that, The invention includes the liquid crystal optofluidic chip and polarizing microscope as described in any one of claims 1 to 2, wherein the polarizing microscope is used to observe optical phenomena in the optical cell of the liquid crystal optofluidic chip.

5. The application of the liquid crystal photofluidic chip according to any one of claims 1 to 2 and / or the optical imaging device according to claim 4 in biological detection.

6. A method for detecting exosomes, characterized in that, The optical imaging device described in claim 4 includes the following steps: First, liquid crystal is injected into the optical cells of the liquid crystal photofluidic chip through the inlet and outlet pipes. The amount added is 2μL for each optical cell, forming a liquid crystal film of a certain thickness while anchoring the liquid crystal molecules on the interface of the liquid crystal film to be vertically aligned. Then, a 0.01 mM hexadecyltrimethylammonium bromide solution was added to injection needle one and fixed in injection pump one, with an injection volume of 30 μL; Exosomes were obtained by extraction and resuspended in PBS to a concentration of 3.9 × 10^7 / mL. The exosomes were then added to injection needle 2 and fixed in injection pump 2. The injection volume was 30 μL. The injection needle containing the CD63 aptamer prepared as a 40 nmol / L solution with PBS buffer was fixed in the injection pump, and the injection volume was 60 μL. The flow rates of the three liquids injected into the optical cell, sample cell, and micromixing channel were 25 μL·min, respectively. -1 150 μL·min -1 80 μL·min -1 Finally, the mixture is mixed in an optical cell and observed using a polarizing microscope.

Images