A nucleic acid molecule for inhibiting PNO1 gene expression and related products and uses

Abstract

The present invention discloses a nucleic acid molecule for inhibiting PNO1 gene expression, as well as related products and uses. The nucleic acid molecule comprises double-stranded RNA or shRNA. The present invention utilizes an RNAi method to obtain siRNA, or a nucleic acid construct, viral particle, or cell containing the siRNA sequence. By downregulating PNO1 gene expression, the siRNA can effectively inhibit and significantly reduce systolic blood pressure, diastolic blood pressure, mean arterial pressure, pulse wave velocity, and vascular wall thickness in the abdominal aorta, thereby preventing and / or treating hypertension. The siRNA can be used in drugs for treating hypertension, opening up new avenues for hypertension treatment.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a nucleic acid molecule for inhibiting PNO1 gene expression and related products and uses. Background Art

[0002] Hypertension is a chronic, non-communicable disease prevalent worldwide and a major risk factor for cardiovascular disease, severely impacting human health and safety. According to the World Health Organization, over the past 30 years, the number of people aged 30 to 79 years worldwide with hypertension has increased from 650 million to 1.28 billion. The prevalence of hypertension in my country is also on the rise, with the latest data from the Centers for Disease Control and Prevention showing 245 million people suffering from the disease. With the advent of an aging population in my country, the prevention and treatment of hypertension poses significant challenges. Long-term, persistent hypertension can cause severe damage to target organs such as the kidneys, heart, and brain. There is an urgent need to identify safer and more effective strategies for the prevention and control of hypertension.

[0003] Partner of NOB1 homolog (PNO1) is a highly conserved protein with a K homology (KH) domain at its C-terminus and two putative nuclear localization signals at its N-terminus. The PNO1 gene is located on human chromosome 2p14, with a genomic sequence of approximately 18 kb. It plays an important role in ribosome biogenesis and promoting the maturation of the small ribosomal subunit. PNO1 encodes a nucleolar protein that is one of the six assembly factors required for the maturation of 20S rRNA to 18S rRNA. It directly binds to NOB1 and enhances NOB1's affinity for RNA, driving NOB1 to cleave the 3' end of the precursor 18S rRNA. Loss of PNO1 leads to a decrease in 18S rRNA and dysregulated assembly of the pre-40S ribosomal subunit. Imbalances in ribosome biogenesis are closely associated with cancer.

[0004] In previous studies, the applicant's research team found that knocking in PNO1 led to increased blood pressure, decreased cardiac ejection fraction, shortened cardiac minor axis, increased abdominal aortic wall thickness, increased abdominal aortic pulse wave velocity, increased mesenteric artery resistance index, increased mesenteric artery pulsatility index, increased renal artery resistance index, and increased renal artery pulsatility index in mice. Furthermore, PNO1 knock-in significantly increased blood pressure in Ang II-induced hypertensive mice, and a hypertensive mouse model was established based on PNO1 knock-in. Therefore, inhibiting PNO1 expression may be an important approach for preventing and treating hypertension.

[0005] Currently, many RNAi drugs are in the research and development stage or have been approved for marketing, and have shown good therapeutic effects. The development of RNAi drugs targeting the expression of hypertension target genes has become an important way to treat such diseases. Summary of the Invention

[0006] In view of the above-mentioned shortcomings of the prior art, the object of the present invention is to provide a nucleic acid molecule for inhibiting PNO1 gene expression and related products and uses, thereby solving the problems in the prior art.

[0007] To achieve the above-mentioned purpose and other related purposes, the present invention is achieved through the following technical solutions.

[0008] The first aspect of the present invention protects a nucleic acid molecule for inhibiting the expression of the PNO1 gene, wherein the nucleic acid molecule comprises a double-stranded RNA or shRNA, wherein the double-stranded RNA or shRNA contains a nucleotide sequence capable of hybridizing with the PNO1 gene, and the target sequence of the double-stranded RNA or shRNA comprises the sequence shown in any one of SEQ ID NOs: 1 to 3.

[0009] The second aspect of the present invention protects a nucleic acid construct comprising nucleotides encoding the nucleic acid molecule as described above.

[0010] The third aspect of the present invention protects a virus particle obtained by packaging the nucleic acid construct described above after infecting a host cell.

[0011] The fourth aspect of the present invention protects a cell comprising the nucleic acid construct as described above or a cell in which a nucleotide sequence encoding the nucleic acid molecule as described above is integrated into the genome.

[0012] The fifth aspect of the present invention protects the use of the nucleic acid molecule as described above; and / or, the nucleic acid construct as described above; and / or, the viral particle as described above; and / or, the cell as described above, wherein the use comprises at least one of A1)-A2): A1) for preparing a drug for preventing or treating hypertension; A2) for preparing a product for inhibiting the expression of the PNO1 gene in cells.

[0013] The sixth aspect of the present invention protects a composition for preventing or treating hypertension, the effective substance of which contains: the nucleic acid molecule as described above; and / or, the nucleic acid construct as described above; and / or, the virus particle as described above; and / or, the cell as described above, and a pharmaceutically acceptable carrier or excipient.

[0014] The technical solution of the present invention has the following beneficial effects:

[0015] 1) This application designed a suitable RNAi target sequence for the target gene PNO1, synthesized a double-stranded oligo DNA sequence, and constructed a lentiviral vector containing the above-mentioned double-stranded oligo DNA sequence; the lentivirus can effectively reduce the mRNA and protein expression levels of the target gene PNO1, and the knockdown effect is very obvious.

[0016] 2) The present application further packages the nucleic acid construct containing shRNA into an adeno-associated virus, and after administering it to SHR rats, it was found that it can significantly reduce the systolic blood pressure, diastolic blood pressure, mean arterial pressure, pulse wave propagation velocity, and vascular wall thickness of the abdominal aorta, thereby preventing and / or treating hypertension and improving the symptoms of reduced vascular function or vascular wall thickening caused by hypertension, and can be used in drugs for the treatment of hypertension. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The graphs show the expression results of PNO1 in the abdominal aorta of SHR rats and WKY rats in Example 1 of the present invention, wherein A is the expression graph and B is the statistical analysis graph of the expression.

[0018] Figure 2 The graph shows the results of the effects of three different sh-PNO1 lentiviruses on the expression level of PNO1 mRNA in A7R5 cells in Example 2 of the present invention.

[0019] Figure 3 The graphs show the results of the effects of three different sh-PNO1 lentiviruses on the expression of PNO1 protein in A7R5 cells in Example 2 of the present invention, wherein A is an expression graph and B is a statistical analysis graph of the expression.

[0020] Figure 4A Shown is a map of the helper plasmid pHelper 1.0 used in the construction of the lentiviral vector in Example 2 of the present invention.

[0021] Figure 4B Shown is a map of the helper plasmid pHelper 2.0 used in the construction of the lentiviral vector in Example 2 of the present invention.

[0022] Figure 4C Shown is a map of the lentiviral vector GV248-sh-PNO1 constructed in Example 2 of the present invention.

[0023] Figure 5A Shown is a map of vector CV299 when the adeno-associated virus vector is constructed in Example 2 of the present invention.

[0024] Figure 5B Shown is a map of the serotype plasmid pAAV-RC when constructing the adeno-associated virus vector in Example 2 of the present invention.

[0025] Figure 5C Shown is a map of the auxiliary plasmid pHelper when constructing the adeno-associated virus vector in Example 2 of the present invention.

[0026] Figure 5D Shown is a map of the adeno-associated virus vector rAAV-shRNA constructed in Example 2 of the present invention.

[0027] Figure 6 Shown is a diagram showing the comparison of sequencing results of sh-PNO1 adeno-associated virus in Example 2 of the present invention.

[0028] Figure 7 The graphs show the systolic blood pressure, diastolic blood pressure, mean arterial pressure, and body weight of rats in each group after administration of the sh-PNO1 adeno-associated virus in Example 3 of the present invention. A shows the effect on systolic blood pressure, B shows the effect on diastolic blood pressure, C shows the effect on mean arterial pressure, and D shows the effect on body weight.

[0029] Figure 8 The graphs show the pulse wave velocity and vascular wall thickness of the abdominal aorta of rats in each group after administration of sh-PNO1 adeno-associated virus in Example 3 of the present invention. A is a representative ultrasound image of the abdominal aorta of a small animal, B is a statistical analysis graph of pulse wave velocity, and C is a statistical analysis graph of vascular wall thickness.

[0030] Figure 9 The graph shows the pathological morphology of the abdominal aorta of rats in each group after administration of sh-PNO1 adeno-associated virus in Example 3 of the present invention. DETAILED DESCRIPTION

[0031] The first aspect of the present invention protects a nucleic acid molecule for inhibiting the expression of the PNO1 gene, wherein the nucleic acid molecule comprises a double-stranded RNA or shRNA, wherein the double-stranded RNA or shRNA contains a nucleotide sequence capable of hybridizing with the PNO1 gene, and the target sequence of the double-stranded RNA or shRNA comprises a sequence as shown in any one of SEQ ID NOs: 1 to 3.

[0032] In the present invention, a nucleic acid molecule refers to a nucleic acid molecule that targets PNO1 or its transcript and is capable of inhibiting PNO1 gene expression or transcription. The target sequence refers to a segment of the PNO1 gene corresponding to the mRNA segment that is recognized and silenced by the nucleic acid molecule when the nucleic acid molecule is used to specifically silence PNO1 gene expression.

[0033] In some embodiments, the nucleic acid molecule is a double-stranded RNA comprising a first strand and a second strand, wherein the first strand and the second strand complement each other to form an RNA dimer, and the sequence of the first strand is identical to the target sequence. More preferably, the nucleotide sequence encoding the first strand comprises any one of SEQ ID NOs: 1 to 3, and the sequence of the second strand is complementary to the sequence of the first strand, thereby specifically silencing the expression of the PNO1 gene.

[0034] Furthermore, the double-stranded RNA is siRNA.

[0035] In other embodiments, the nucleic acid molecule is an shRNA, comprising a sense strand segment and an antisense strand segment, and a stem-loop structure connecting the sense and antisense strand segments. The sequences of the sense and antisense strand segments are complementary, and the sequence of the sense strand segment is identical to the target sequence. The nucleotide sequence encoding the shRNA comprises SEQ ID NOs: 4 to 9. Specifically, the nucleotide sequence encoding the shRNA comprises SEQ ID NOs: 4 to 5, or SEQ ID NOs: 6 to 7, or SEQ ID NOs: 8 to 9. After enzymatic processing, the shRNA can become a small inhibitory RNA (siRNA), thereby specifically inhibiting PNO1 gene expression. In the present invention, shRNA refers to a single-stranded RNA base that self-hybridizes within a hairpin structure and can induce RNA inhibition (RNAi) pathways upon processing. These molecules can vary in length (typically about 50-90 nucleotides in length, or in some cases, up to greater than 250 nucleotides in length, such as for shRNAs adapted for small inhibitory RNAs). shRNA molecules are processed within the cell to form siRNA, which in turn can knock down PNO1 gene expression. shRNA can be incorporated into a vector. shRNA also refers to a DNA molecule from which short hairpin RNA molecules can be transcribed.

[0036] Furthermore, the sequence of the stem-loop structure of the shRNA can be selected from any one of the following: Ccgg, GATCCAAAAA, CTCGAG, TTTTTg.

[0037] Furthermore, the target sequence of the double-stranded or shRNA is as shown in SEQ ID NO. 3. When it is used to inhibit the expression of PNO1 gene, the inhibitory effect is most obvious.

[0038] Furthermore, the shRNA encoding nucleotide sequence is shown in SEQ ID NO: 8 to SEQ ID NO: 9.

[0039] In the present invention, the PNO1 gene is derived from mouse, with gene ID: 289809.

[0040] Another aspect of the present invention provides a nucleic acid construct comprising nucleotides encoding the nucleic acid molecule described above. The nucleic acid construct can be obtained by cloning the nucleic acid molecule encoding the nucleic acid molecule described above into a known vector. The nucleic acid construct is packaged into infectious viral particles and then infected with cells to express the siRNA, thereby specifically inhibiting PNO1 gene expression.

[0041] In some embodiments, the nucleic acid construct is selected from one or more of a lentiviral vector, an adeno-associated viral vector, and an adenoviral vector.

[0042] Furthermore, the nucleic acid construct is a lentiviral vector. The lentiviral vector is packaged into infectious lentiviral particles and injected into a subject to express the siRNA, thereby specifically silencing the expression of the PNO1 gene. The backbone plasmid of the lentiviral vector is GV298.

[0043] Furthermore, the nucleic acid construct is an adeno-associated viral vector. The adeno-associated viral vector is packaged into infectious viral particles and injected into a subject to express the siRNA, thereby specifically silencing the expression of the PNO1 gene. The backbone plasmid of the adeno-associated viral vector is CV299.

[0044] Another aspect of the present invention relates to a method for preparing the nucleic acid construct as described above, comprising the steps of:

[0045] 1) Linearize the tool vector and obtain the target gene fragment;

[0046] 2) ligating the target gene fragment and the linearized tool vector and transforming the resulting bacterial colonies;

[0047] 3) The nucleic acid construct is obtained after colony PCR identification, sequencing, and plasmid extraction.

[0048] In certain embodiments, in step 1), the tool vector is selected from GV298 or CV299, wherein the GV298 is used as a lentiviral tool vector and the CV299 (provided by GeneCare, see Figure 5A ) as an adeno-associated virus tool vector. The sequence of the target gene target fragment includes SEQ ID NOs: 1, 2, and 3. Specifically, the nucleotides encoding the nucleic acid molecule are inserted into the AgeI and EcoRI restriction sites of the lentiviral vector GV298, thereby constructing a lentiviral nucleic acid construct; and the nucleotides encoding the nucleic acid molecule are inserted into the BamHI and HindIII restriction sites of the adeno-associated virus vector CV299, thereby constructing an adeno-associated virus nucleic acid construct.

[0049] In certain embodiments, in step 2), when the tool vector is GV298, a lentiviral vector is constructed as a basis, and a nucleic acid molecule that inhibits PNO1 gene expression is integrated to obtain a PNO1 gene interference lentiviral vector, wherein the target sequence of the nucleic acid molecule that inhibits PNO1 gene expression comprises SEQ ID NOs: 1, 2, and 3. A single-stranded primer comprising the sequence shown below: SEQ ID NOs. 4-5, SEQ ID NOs. 6-7, or SEQ ID NOs. 8-9 is used to obtain the target gene fragment.

[0050] The single-stranded primer anneals to form oligo DNA, which comprises an upstream sequence as shown below: SEQ ID NO.4 or SEQ ID NO.6 or SEQ ID NO.8, and a downstream sequence as shown below: SEQ ID NO.5 or SEQ ID NO.7 or SEQ ID NO.9.

[0051] In certain embodiments, in step 2), when the tool vector is GV299, an adeno-associated viral vector is constructed as a basis, and a nucleic acid molecule that inhibits PNO1 gene expression is incorporated to obtain a PNO1 gene interference adeno-associated viral vector, wherein the target sequence of the nucleic acid molecule that inhibits PNO1 gene expression comprises SEQ ID NO: 3. Primers comprising the sequences shown below: SEQ ID NOs. 12-13 are used to obtain the target gene fragment.

[0052] In certain embodiments, in step 3), the tool vector after enzyme digestion and the target gene fragment are reacted in a reaction system for 1 to 3 hours, and then the ligation product is transformed into competent cells for transformation.

[0053] Another aspect of the present invention is to protect a virus particle obtained by packaging the nucleic acid construct described above after infection of a host cell.

[0054] In certain embodiments, when the nucleic acid construct is a lentiviral vector and further comprises an envelope plasmid and / or a packaging plasmid for assembling the lentiviral vector into cells, the nucleic acid construct, envelope plasmid, and packaging plasmid are co-transfected into cells to produce lentiviral particles. Preferably, the envelope plasmid is pHelper 2.0 and the packaging plasmid is pHelper 1.0. The molar ratio of the lentiviral vector, envelope plasmid, and packaging plasmid is 20:15:20.

[0055] In certain embodiments, when the nucleic acid construct is an adeno-associated viral vector, it further comprises a packaging plasmid and / or a helper plasmid for assembling the adeno-associated viral vector into cells. The adeno-associated viral nucleic acid construct, packaging plasmid, and helper plasmid are co-transfected into cells to produce adeno-associated viral particles. Preferably, the packaging plasmid is pAAV-RC and the helper plasmid is pHelper. The molar ratio of the adeno-associated viral vector, the serotype plasmid, and the helper plasmid is 1:1:1.

[0056] Another aspect of the present invention protects a cell comprising the nucleic acid construct as described above or a cell having integrated into its genome a nucleotide sequence encoding the nucleic acid molecule as described above.

[0057] In some embodiments, the cell comprises a lentiviral vector and further comprises an envelope plasmid and / or a packaging plasmid for assembling the lentiviral vector into the cell. Preferably, the envelope plasmid is pHelper 2.0 and the packaging plasmid is pHelper 1.0.

[0058] Furthermore, when the nucleic acid construct is a lentiviral vector, the cells refer to 293T cells as host cells, which are transfected with the lentiviral nucleic acid construct and an envelope plasmid or a packaging plasmid to knock down the PNO1 gene. The present invention found that after lentiviral transfection of A7R5 cells, siRNA can significantly inhibit the expression of PNO1 mRNA and protein levels in A7R5 cells.

[0059] In some other embodiments, the cell comprises an adeno-associated viral vector and further comprises a serotype plasmid and / or a helper plasmid for assembling the adeno-associated viral vector into the cell. Preferably, the packaging plasmid is pAAV-RC and the helper plasmid is pHelper.

[0060] Furthermore, when the nucleic acid construct is an adeno-associated virus vector, the cell refers to 293T cells as host cells, and the PNO1 gene is knocked out by transfecting the adeno-associated virus nucleic acid construct and packaging plasmid or helper plasmid.

[0061] The virus packaging process is a conventional technique in the art and is not particularly limited in the present invention.

[0062] Another aspect of the present invention protects the use of the nucleic acid molecule as described above; and / or, the nucleic acid construct as described above; and / or, the viral particle as described above; and / or, the cell as described above, said use comprising at least one of A1)-A2): A1) for preparing a drug for preventing or treating hypertension; A2) or for preparing a product for inhibiting PNO1 gene expression in cells.

[0063] In some embodiments, the drug has one or more of the following effects:

[0064] B1) Improve decreased vascular function;

[0065] B2) Improve decreased heart function;

[0066] B3) Improves blood vessel wall thickening.

[0067] Furthermore, the reduced vascular function is induced by hypertension and refers to an increase in vascular pulse wave propagation velocity. The improvement of reduced vascular function refers to a reduction in vascular pulse wave propagation velocity. The reduction in vascular pulse wave propagation velocity refers to bringing the vascular pulse wave propagation velocity of the target vessel close to or reaching the velocity of a healthy vessel. For example, based on a healthy vessel as a benchmark, the product may restore the vascular pulse wave propagation velocity of the target vessel to at least 70%, 80%, 90%, or 100% of that of a healthy vessel.

[0068] Furthermore, the reduced cardiac function induced by hypertension refers to a reduced ejection fraction or a reduced left ventricular fractional shortening, and the improvement of reduced cardiac function refers to an increase in the ejection fraction or the left ventricular fractional shortening. The increase in the ejection fraction or the left ventricular fractional shortening refers to bringing the ejection fraction and the left ventricular fractional shortening of the subject's heart close to or reaching those of a healthy heart. For example, based on a healthy heart as a benchmark, the product can restore the ejection fraction and the left ventricular fractional shortening of the subject's heart to at least 70%, 80%, 90%, or 100% of that of a healthy heart.

[0069] Furthermore, the vascular wall thickening induced by hypertension refers to thickening of the abdominal aorta. Improving vascular wall thickening refers to reducing vascular wall thickness. Reducing vascular wall thickness refers to bringing the target vascular wall closer to or reaching the thickness of a healthy blood vessel. For example, based on a healthy blood vessel as a benchmark, the product can reduce the vascular wall thickness of the target vessel to no more than 130%, 120%, 110%, or 100% of the thickness of a healthy blood vessel.

[0070] In some embodiments, the nucleic acid molecule, inhibitory nucleic acid construct, viral particle, or cell described above can be used to prepare a product for reducing PNO1 gene expression, including a chip, a preparation, a kit, or a nucleic acid membrane strip.

[0071] In some embodiments, the cells are selected from smooth muscle cells, such as thoracic aortic smooth muscle cells. Transfection of thoracic aortic smooth muscle cells A7R5 with the lentivirus constructed in this application can significantly reduce the expression levels of PNO1 mRNA and protein in the cells.

[0072] Another aspect of the present invention protects a composition for preventing or treating hypertension, the effective substance of which contains: the nucleic acid molecule as described above; and / or, the nucleic acid construct as described above; and / or, the virus particle as described above; and / or, the cell as described above, and a pharmaceutically acceptable carrier or excipient.

[0073] In some embodiments, pharmaceutically acceptable carriers or excipients refer to carriers for administering therapeutic agents, including various excipients and diluents. Pharmaceutically acceptable carriers or excipients themselves are not necessary active ingredients and are not overly toxic after administration. Suitable carriers or excipients are well known to those of ordinary skill in the art. In the composition, pharmaceutically acceptable carriers or excipients may contain liquids such as water, saline, and buffer solutions. In addition, auxiliary substances such as fillers, lubricants, glidants, wetting agents or emulsifiers, pH buffer substances, etc. may also be present in these carriers or excipients.

[0074] In some embodiments, the form of the composition is not particularly limited and can be in various forms such as solid, liquid, gel, semi-fluid, aerosol, etc.

[0075] In some embodiments, the composition is primarily directed to mammals, preferably rodents, artiodactyls, perissodactyls, lagomorphs, primates, etc. Preferably, the primate is a monkey, ape, or human.

[0076] In some embodiments, the composition is in the form of tablets, capsules, granules, powders, injections, sprays, films, suppositories, nasal drops or pills, preferably injections.

[0077] The present invention also protects a method for preventing or treating hypertension, which comprises administering to a subject a therapeutically effective amount of the nucleic acid molecule as described above; and / or, the nucleic acid construct as described above; and / or, the viral particle as described above; and / or, the cell as described above; and / or, the composition as described above.

[0078] In certain embodiments, the subject is a mammal. The mammal is preferably a rodent, an artiodactyl, a perissodactyl, a lagomorph, a primate, etc. The primate is preferably a monkey, an ape, or a human.

[0079] In certain embodiments, the subject can be a patient suffering from hypertension or an individual with hypertension for whom treatment is desired.

[0080] In certain embodiments, the nucleic acid molecule as described above, the inhibitory nucleic acid construct as described above, or the inhibitory virus as described above can be administered to a subject before, during, or after receiving treatment for hypertension.

[0081] As used herein, a "therapeutically effective amount" or "effective dose" refers to the dose or concentration of a drug that is effective in treating a disease. For example, for the lentivirus or adeno-associated virus disclosed herein, a therapeutically effective amount is the dose or concentration at which the lentivirus or adeno-associated virus can improve decreased vascular function, decreased cardiac function, or increased vascular wall thickness, thereby treating hypertension.

[0082] The present invention designs and synthesizes nucleic acid molecules that inhibit PNO1 gene expression, constructs shRNA nucleic acid constructs targeting the target sequence, viral particles, and cells. The siRNA expressed by these nucleic acid constructs, viral particles, and cells effectively inhibits PNO1 expression and is used to treat hypertension and hypertension-induced increased vascular function or vascular wall thickening. When the siRNA, shRNA, nucleic acid construct, viral particle, and cells of the present invention were introduced into rats, they were found to significantly reduce systolic, diastolic, and mean arterial pressures, abdominal aortic PWV, and abdominal aortic wall thickness in SHR rats, while having no significant effect on body weight. Therefore, the nucleic acid molecules, nucleic acid constructs, viral particles, and cells of the present invention can prevent and / or treat hypertension and improve the symptoms of hypertension-induced decreased vascular function or vascular wall thickening, and can be used in drugs to treat hypertension or to reduce PNO1 gene expression in cells.

[0083] The following describes the embodiments of the present invention through specific examples. Those skilled in the art will readily understand the other advantages and benefits of the present invention from the disclosure herein. The present invention may also be implemented or applied through various other specific embodiments, and the details in this specification may be modified or altered based on different viewpoints and applications without departing from the spirit of the present invention.

[0084] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing specific specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0085] When the embodiments provide numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the understanding of the prior art by those skilled in the art and the description of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention may also be used to implement the present invention.

[0086] In the following examples of this application, the information of animals, experimental drugs and main reagents is as follows:

[0087] Experimental drugs and main reagents: DMEM medium (Therm Fisher Scientific, USA, C11995500BT); penicillin / streptomycin double antibody (Hyclone, USA, SV30010); eosin staining solution (Beijing Solebold Technology Co., Ltd., G1100); hematoxylin staining solution (Beijing Solebold Technology Co., Ltd., G1140); isoflurane for animals (Shenzhen Reward Life Science Co., Ltd., 970-00026-00); 4% paraformaldehyde universal tissue fixative (Anhui Biosharp Co., Ltd., 23319084), anhydrous ethanol (Xilong Science Co., Ltd., 1280340101602), xylene (Xilong Science Co., Ltd., 1430030101600), and other chemical reagents.

[0088] Data were analyzed using SPSS 27.0 software (SPSS / PC+). The Shapiro-Wilk test was used to test data normality. Data are expressed as mean ± standard deviation. For comparisons between two groups, for data that conformed to a normal distribution and had homogeneous variances, ANOVA with multiple group comparisons and the Bonferroni test was used. For data that conformed to a normal distribution but had unequal variances, ANOVA with multiple group comparisons and the Kruskal-Wallis test was used. For data that did not conform to a normal distribution, the rank-sum test was used. A P value < 0.05 was considered statistically significant.

[0089] Example 1 Study on the expression level of PNO1 gene in SHR rats and WHY rats

[0090] In this Example 1, the expression level of the PNO1 gene in SHR rats and WHY rats was studied.

[0091] 1.1 Experimental Animals

[0092] Rats: SPF-grade 4-week-old male rats were used, including 14 spontaneously hypertensive rats (SHR) and 14 Wistar Kyoto (WKY) rats. The experimental animals were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (License number: SYXK (Beijing) 2022-0052). The experimental animals were housed in the SPF-grade laboratory of the Experimental Animal Center of Fujian University of Traditional Chinese Medicine, provided with sufficient food and water, and maintained under a 12-hour light / dark cycle, at a temperature of 23 ± 1°C and a humidity controlled at 50%, all within the acceptable range for experimental animals. All experimental operations complied with the regulations of experimental animal ethics and the Experimental Animal Center of Fujian University of Traditional Chinese Medicine.

[0093] SHR rats, also known as spontaneously hypertensive rats, are born with high blood pressure, with a systolic blood pressure of over 200 mmHg, and are thus used as the most suitable animal model for screening anti-hypertensive drugs; WKY (Wistar-Kyoto) rats are often used as the normal blood pressure control group for SHR rats.

[0094] 1.2. Sample collection

[0095] After the experiment, the rats were sacrificed for sample collection. The rats were anesthetized with isoflurane and then sacrificed. The abdominal aorta of the rats was taken through the abdomen, rinsed in pre-cooled physiological saline to remove residual blood, and the connective tissue outside the blood vessel was dissected. The abdominal aorta was divided into 3 segments. One segment was placed in 4% paraformaldehyde for subsequent pathological sectioning, and the other 2 segments were quickly stored in liquid nitrogen for later use. The abdominal aorta was first immersed in 4% paraformaldehyde for 48 hours, then placed in an embedding cassette, and the organ number and group were clearly marked. The tissue was dehydrated and infiltrated with wax. The waxed tissue was placed in an embedding machine, and the tissue was placed into the embedding mold before the liquid wax solidified, and then cooled on an ice table. After the paraffin solidified, the wax block was taken out and trimmed.

[0096] 1.3. Immunohistochemistry experiment

[0097] Paraffin blocks of tissue samples from WKY and SHR rats were sectioned and deparaffinized. The samples were then fixed with citrate fixative at 100°C for 10 minutes and cooled to room temperature. A 0.25% Triton reagent (30 μL) was added to each sample, and the membranes were permeabilized for 10 minutes at room temperature. The samples were then washed three times with 1× PBS for 5 minutes each. Approximately 30 μL of endogenous peroxidase was added to each sample for 10 minutes, followed by three 5-minute washes with PBS. The samples were blocked with blocking buffer at room temperature for 1 hour. The primary antibody (PNO1: sc-514727; Santa Cruz Biotechnology) was prepared in PBS at the appropriate ratio and incubated overnight at 4°C. The next day, the samples were incubated with a secondary antibody (goat anti-mouse secondary antibody: L3032; Signalway Antibody LLC) for 1 hour, followed by three 5-minute washes with 1× PBS. The slides were incubated with streptomycin for 1 hour and washed three times with PBS for 5 minutes each time. The slides were stained with DAB colorimetric reagent and then stained with hematoxylin. The staining solution was washed off and the slides were blued with ultrapure water for 5 minutes. After being dried with a hair dryer, the slides were sealed with neutral gum. The slides were imaged at 400 times magnification using an intelligent automated optical microscope. Six fields of view were randomly selected for each sample. The expression of each group of proteins was then analyzed and statistically analyzed using Image J software.

[0098] 1.5 Experimental Results

[0099] The expression of PNO1 in the abdominal aorta of SHR rats and WHY rats was detected by immunohistochemistry. Figure 1 shown.

[0100] from Figure 1 It can be seen that the expression of PNO1 in spontaneously hypertensive SHR rats was significantly increased compared with that in WKY rats, and the difference was statistically significant (*P<0.05), indicating that the expression level of PNO1 is closely related to hypertension.

[0101] Example 2 shRNA design and construction of lentivirus and adeno-associated virus

[0102] In this Example 2, the siRNA sequence of the PNO1 gene was designed, and a lentiviral vector and an adeno-associated viral vector were constructed, and then lentiviral packaging and adeno-associated viral packaging were performed respectively.

[0103] siRNA target sequences were designed based on the Rat PNO1 gene transcript. Single-stranded primers were synthesized based on the siRNA target sequence and annealed to form double-stranded oligo DNA. The double-stranded oligo DNA was then ligated with a double-digested, linearized RNA suppression vector to generate a PNO1-specific interfering shRNA lentivirus. The lentivirus was transformed into competent Escherichia coli cells, and transformants were screened by colony PCR. Positive clones were verified by sequencing. Correct clones were sequenced and high-purity plasmids were extracted. The lentiviral vector was then co-transfected with the lentiviral packaging plasmid pHelper 1.0 and the lentiviral envelope plasmid pHelper 2.0 into 293T cells to produce lentivirus. The viral titer was determined, and lentiviral particles of appropriate titer were used to infect A7R5 cells. PNO1 protein expression was assessed by Western blot to identify the optimal inhibitory fragment.

[0104] Then the best inhibitory fragment is constructed to obtain an adeno-associated virus vector, and then the adeno-associated virus is packaged.

[0105] 2.1. Screening of the best inhibitory fragment

[0106] 2.1.1 Target design and primer synthesis

[0107] For rat PNO1 (ID: 289809), we commissioned Shanghai GeneCare Gene Medical Technology Co., Ltd. to design three siRNA target sequences, including sh-PNO1-90, sh-PNO1-89, and sh-PNO1-88, based on the PNO1 gene sequence from GenBank and general RNAi design principles. A negative control sequence, CON207, with one base randomly scrambled, was also designed. Sequence design was performed and synthesized by Shanghai GeneCare Gene Medical Technology Co., Ltd.

[0108] The corresponding oligo primers were designed and synthesized according to the siRNA target sequences. The target sequences of the three candidate siRNAs are shown in Table 1.

[0109] Table 1 siRNA target sequences

[0110] serial number Gene NCBI ID TargetSeq SEQ sh-PNO1-88 PNO1 NM_199083 GCTAACAGATACACACCATTA SEQ ID No.1 sh-PNO1-89 PNO1 NM_199083 GGACTTGTAAAGACACCAAGG SEQ ID No. 2 sh-PNO1-90 PNO1 NM_199083 GCAACCTCATCCTAGGAAACC SEQ ID No. 3 CON207 NC None TTCTCCGAACGTGTCACGT SEQ ID No.15

[0111] 2.1.2 Synthesis of double-stranded oligo DNA

[0112] Double-stranded oligo DNA was designed according to the sequence and structure in Table 2. The single-stranded oligo primers in Table 3 were dissolved in oligoannealing buffer to 20 μM. Then, 30 μL of the dissolved oligo primers were taken and mixed to obtain an oligo mixture.

[0113] The oligo mixture was then heated in a water bath at 90° C. for 15 min, and then the water bath was opened and allowed to cool naturally to room temperature to anneal and form double-stranded oligo fragments.

[0114] Take 1 μL of the double-stranded oligo fragment for the subsequent ligation reaction in step 2.2.1 (2), and store the rest at -20°C.

[0115] Table 2 Double-stranded oligo DNA

[0116]

[0117] The shRNAs are shown in Table 3.

[0118] Table 3

[0119]

[0120] 2.2 Construction of lentiviral vectors, acquisition of lentiviral particles, and evaluation of knockout efficiency after cell transfection

[0121] 2.2.1. Construction of Lentiviral Vectors

[0122] (1) Preparation of linearized tool carrier

[0123] The expression vector GV298 (provided by GeneChip, vector name: GV298) was digested with AgeI and EcoRI restriction enzymes to linearize it. The enzyme digestion reaction system is shown in Table 4.

[0124] Table 4 Enzyme digestion reaction system

[0125] Reagents Capacity (μL) <![CDATA[ddH2O]]> 41 10×CutSmart Buffer 5 GV298 plasmid DNA (1 μg / μL) 2 Age I (10 U / μL) 1 EcoRI (10U / μL) 1 Total 50

[0126] Prepare 50 μL of the enzyme digestion system according to Table 4. Add each reagent in the order listed, gently pipette to mix, centrifuge briefly, and incubate at 37°C for 3 hours or overnight. Perform agarose gel electrophoresis on the digested vector to recover the desired band and obtain the linearized tool vector.

[0127] (2) Ligation reaction

[0128] The double-stranded oligo fragment obtained in step 2.1.2 and the linearized tool vector GV298 obtained in step (1) were ligated using T4 DNA ligase. The reaction system is shown in Table 5. The ligation was carried out at 16°C overnight to obtain a ligation product.

[0129] Table 5 Ligation reaction system

[0130]

[0131]

[0132] (3) Transformation of competent cells

[0133] The ligation product obtained in step (2) was transfected into DH5α competent cells. The transfection method was referred to the "Succinct Molecular Biology Experiment Guide", and then spread on a plate and incubated at 37°C overnight.

[0134] (4) Identification of positive transformants by colony PCR

[0135] The transformants grown on the plate were picked and resuspended in 10 μL LB culture medium. 1 μL was taken as a template for colony PCR identification to determine whether the constructed recombinant lentiviral vector was correct.

[0136] Positive clones identified by colony identification were sent to a sequencing company for sequencing verification. Sequencing results were compared and analyzed using Vector NTI software. The correct clones were cultured and extracted to obtain high-purity plasmids for downstream lentiviral packaging.

[0137] The correct positive clones were verified by sequencing and plasmid mini-extraction was performed to obtain three PNO1-specific shRNA expression lentiviral vectors GV248-sh-PNO1-88, GV248-sh-PNO1-89, and GV248-sh-PNO1-90, as well as a negative control lentiviral vector GV248-NC. The map of the specific shRNA expression lentiviral vector is shown in Figure 4C .

[0138] 2.2.2 Lentiviral packaging

[0139] The three PNO1-specific shRNA lentiviral vectors obtained in step 2.2.1 were respectively combined with the lentiviral packaging plasmid pHelper1.0 (see Figure 4A ) and lentiviral envelope plasmid pHelper 2.0 (see Figure 4B ) were co-transfected into 293T cells and packaged to produce lentivirus. Lentiviruses sh-PNO1-88, sh-PNO1-89, and sh-PNO1-90 were obtained. The lentiviral titer was determined using a fluorescence assay.

[0140] Transfer the correctly sequenced bacterial suspension from step 2.2.1 into 50 mL of LB liquid medium containing antibiotics, culture at 37°C overnight, and extract the plasmid using a kit.

[0141] 1) 48 hours before transfection, HEK293T cells in the logarithmic growth phase were digested with trypsin and the cell density was adjusted to 5×10 6cells / 15mL, re-seeded into a 10cm cell culture dish, cultured in a 37℃, 5% CO2 incubator, and used for transfection after 48 hours when the cell density reaches 70%-80%.

[0142] 2) One hour before transfection, the cell culture medium was replaced with DMEM medium containing 2% FBS.

[0143] 3) To a sterile centrifuge tube, add the lentiviral vectors GV248-sh-PNO1-88, GV248-sh-PNO1-89, GV248-sh-PNO1-90 or the negative control lentiviral vector GV248-NC obtained in step 2.2.1 of this example, as well as pHelper1.0 and pHelper 2.0 (20 μg of GV248-sh-PNO1-88, GV248-sh-PNO1-89, GV248-sh-PNO1-90, or GV248-NC, 15 μg of pHelper 1.0 plasmid, and 20 μg of pHelper 2.0 plasmid). Mix well with the corresponding volume of transfection reagent to adjust the total volume to 1 mL and incubate at room temperature for 15 minutes.

[0144] 4) Slowly add the mixed solution after incubation in step 3) to the HEK293T cell culture medium (pay attention to the uniformity during the addition process to avoid blowing the cells away) and mix well. Incubate in a cell culture incubator at 37° C. and 5% CO 2 .

[0145] 5) After 6 h of incubation, the culture medium of the transfection mixture was aspirated, the cells were washed once with 10 mL of PBS, and then 10 mL of fresh complete culture medium was added for incubation.

[0146] 6) Slowly add 12 mL of cell culture medium containing 2% FBS and continue culturing in a 37° C., 5% CO 2 incubator for 48 hours.

[0147] 2.2.4 Lentivirus Concentration and Purification

[0148] 48 hours after transfection, collect the HEK293T cell supernatant and centrifuge at 4000g for 10 minutes at 4°C to remove cell debris and impurities. Filter the supernatant through a 0.45 μm filter into a 40 mL ultracentrifuge tube and centrifuge at 25,000 rpm for 2 hours at 4°C to obtain the purified lentiviral sh-PNO1.

[0149] The titer of lentivirus sh-PNO1-88 was determined by fluorescence method and the virus titer was 3×10 9 TU / mL; the viral titer of lentivirus sh-PNO1-89 is 8×10 8 TU / mL; the viral titer of lentivirus sh-PNO1-90 is 8×10 8 TU / mL.

[0150] At the same time, the control sequence CON207 was used to obtain a negative control lentivirus (sh-Ctrl) using the same method.

[0151] 2.2.5 Effects of sh-PNO1 lentivirus on PNO1 mRNA expression and PNO1 protein expression in A7R5 cells

[0152] A7R5 cells (rat thoracic aorta smooth muscle cells) were purchased from Punosai, Wuhan, Hubei (Cat. No. CL0316) and cultured with DMEM complete medium (containing 10% FBS, 100 U / mL penicillin, and 100 μg / mL streptomycin). Cells in good condition were cultured in a cell culture incubator with a constant temperature of 37°C and a saturated humidity of 5% CO2.

[0153] The lentivirus sh-PNO1-88, sh-PNO1-89, and sh-PNO1-90 prepared in step 2.2.4 were transfected into A7R5 cells and verified by real-time fluorescence quantitative PCR (qPCR) experiments.

[0154] A7R5 cells were infected with lentivirus containing three sequences of sh-PNO1, and the mRNA expression level in A7R5 cells was detected by qPCR. The experimental results are shown in Figure 2. Figure 2 shown.

[0155] The qPCR assay steps are as follows: After the cells are fully lysed for 5 minutes, centrifuge at 12,000 rpm at 4°C for 15 minutes. The supernatant is aspirated and transferred to an RNase-free centrifuge tube. 0.2 mL of chloroform solution is added, the tube is shaken vigorously for 15 seconds, and then allowed to stand for 5 minutes and centrifuged at 12,000 rpm at 4°C for 15 minutes. The supernatant is aspirated and transferred to another RNase-free centrifuge tube. 500 mL of isopropanol is added, the tube is mixed thoroughly, and the tube is allowed to stand at room temperature for 10 minutes. Centrifuge at 12,000 rpm at 4°C for 10 minutes. Discard the supernatant, a white precipitate will be visible at the bottom. Add 1 mL of pre-chilled 75% ethanol to each sample and centrifuge at 10,000 rpm for 10 minutes. Discard the supernatant, let the tube air-dry at room temperature for 5-10 minutes, and then add an appropriate amount of DEPC water to shake and mix the RNA. The OD of the samples was measured using a NanDrop2000 ultra-micro spectrophotometer. 260 With OD 280 The experiment was performed according to the company's instructions. The Q-PCR reaction system was prepared according to the table below and then placed in a 7500 Fast Realtime PCR instrument for mRNA expression level detection. The Q-PCR reaction system and reaction time are shown in Tables 6 and 7 below.

[0156] Table 6 Q-PCR reaction system preparation

[0157] Reagents Usage SYBR Mix (2×) 5μL Front chain primer (10 μM) 0.2μL Back-strand primer (10 μM) 0.2μL <![CDATA[RNase Free dH2O]]> 4.6μL

[0158] Front chain primer for detecting PNO1 expression level: ACACCAAGGATGTCAGTGC (SEQ ID NO: 10)

[0159] Back-strand primer for detecting PNO1 expression level: AAGCGCATCCTCTACCTGAA (SEQ ID NO: 11)

[0160] Table 7 Q-PCR reaction conditions

[0161]

[0162] After amplification, the expression level was calculated. The formula for calculating the mRNA expression level is: △Ct of mRNA = Ct (test sample) - CT (internal reference); △△Ct = △Ct - △Ct (average value); the relative expression level of mRNA is 2 -△△ct The internal reference is β-actin.

[0163] from Figure 2 It can be seen that after the lentivirus sh-PNO1 infected A7R5 cells, the expression of PNO1 mRNA was significantly downregulated, and the sh-PNO1-90 sequence had the best knockdown effect.

[0164] In addition, the expression level of PNO1 protein in A7R5 cells was detected by Western-blot experiment. Figure 3 shown.

[0165] The Western blot assay was performed as follows: A7R5 cells were transfected with sh-PNO1 lentivirus according to a specific system, digested with EDTA, neutralized with DMEM, and then harvested. The harvested cells were lysed with lysis buffer and shaken three times for 5 seconds every 5 minutes. The cells were centrifuged at 14,000 rpm for 20 minutes at 4°C. After BCA protein denaturation, SDS-PAGE gel electrophoresis and transfer to the membrane were performed. After blocking with skim milk for 2 hours, the cells were incubated with the primary antibody (PNO1: sc-514727; Santa Cruz Biotechnology) at 4°C. The cells were then incubated with the secondary antibody (Goat anti-mouse secondary antibody: L3032; Signalway Antibody LLC) at room temperature for imaging. Data were analyzed using Image Lab software.

[0166] from Figure 3As shown in Figure 3A and Figure 3B, sh-PNO1 lentivirus infection of A7R5 cells reduced the expression of PNO1 protein, among which the sh-PNO1-90 sequence had the most obvious reduction.

[0167] In conclusion, sh-PNO1-90 was the best inhibitory fragment, and subsequent experiments were carried out using this inhibitory fragment.

[0168] 2.3 Construction of Adeno-associated Virus Vector

[0169] The sh-PNO1-90 sequence and the control sh-Ctrl sequence in Example 1 were used to construct an adeno-associated viral vector, which was then packaged into adeno-associated viral particles. GeneCare was commissioned to perform this process. The details are as follows:

[0170] 2.3.1 Construction of adeno-associated virus vector rAAV-shRNA

[0171] PCR amplifies the target gene. The tool vector is digested with enzymes to form a linearized vector. After homologous recombination between the target gene and the linearized vector, E. coli competent cells are transformed. Transformants are identified by colony PCR, and positive clones are sequenced. Clones that have been sequenced correctly are subjected to plasmid extraction. The construction of the adeno-associated virus vector rAAV-shRNA is as follows:

[0172] 1) The target gene fragment was obtained by PCR amplification using the following primers. The size of the PCR amplification product was 173 bp.

[0173] Primer 1: AGATCGCCGTGTAAGCTAGCCTGGAGGCTTGCTGAAGGCTGTATGCTG (SEQ ID NO: 12)

[0174] Primer 2: GCCTCAGCTATTTAAAGCTTGGGCCATTTGTTCCATGTGAGTGCTAGT (SEQ ID NO: 13)

[0175] The primers contain exchange pairing bases, restriction enzyme cutting sites, and the 5' end sequence of the target gene for PCR fishing of the target gene.

[0176] 2) Target gene homologous recombination insertion tool vector

[0177] The PCR product of 1) and the linear tool vector CV299 (see the map) after digestion with BamHI and HindIII were Figure 5A ) for homologous recombination, prepare the reaction system according to Table 8 below, react at 37°C for 30 min, then cool in an ice water bath for 5 min before immediate transformation.

[0178] Table 8 Reaction system

[0179] Reagents Usage <![CDATA[dH2O]]> 3.5 μL 5×CE II Buffer 2μL CV299 plasmid after enzyme digestion 2.5 PCR product from step 1) 1 μL <![CDATA[Exnase TM II]]> 1 μL Total 10 μL

[0180] 3) Conversion

[0181] Add 10 μL of the exchange reaction product to 100 μL of DH5α competent cells. Gently flick the tube several times to mix thoroughly. Place on ice for 30 minutes. Heat shock the tube at 42°C for 90 seconds, then incubate in an ice-water bath for 2 minutes. Add 500 μL of antibiotic-free LB medium and incubate on a shaker at 37°C for 1 hour. Spread an appropriate amount of the bacterial solution evenly on a plate containing the appropriate antibiotic and incubate in an incubator upside down for 12-16 hours.

[0182] 4) PCR identification

[0183] Primers 3 and 2 were used to identify the transformed colonies, and the PCR product of the positive transformants was 272 bp in size.

[0184] Primer 3: GAGGAGTTGTGTTTGTGGAC (SEQ ID NO: 14)

[0185] Primer 2: GCCTCAGCTATTTAAAGCTTGGGCCATTTGTTCCATGTGAGTGCTAGT (SEQ ID NO: 13)

[0186] 5) Sequencing

[0187] The identified positive clone transformants were inoculated into an appropriate amount of LB liquid medium containing the corresponding antibiotics, cultured at 37°C for 12-16 hours, and an appropriate amount of bacterial liquid was taken for sequencing. The sequencing results were compared with the target gene sequence. The comparison results are shown in Figure 6 .

[0188] The adeno-associated virus vector with correct sequencing was named adeno-associated virus vector rAAV-shRNA (see the map) Figure 5D ).

[0189] At the same time, a negative control adeno-associated virus vector rAAV-Ctrl was generated based on the control sequence numbered CON207 in Table 1.

[0190] 2.3.2 Packaging of recombinant adeno-associated virus

[0191] Transfer the correctly sequenced bacterial suspension from step 2.3.1 into 50 mL of LB liquid medium containing antibiotics, culture at 37°C overnight, and extract the plasmid using an endotoxin-free plasmid miniprep kit.

[0192] 1) 24 hours before transfection, AVV-293T cells (human embryonic kidney cells) in the logarithmic growth phase were digested with trypsin and the cell density was adjusted to 5×10 cells / mL using DMEM medium containing 10% FBS.6 cells / 15mL, re-seeded into a 10cm cell culture dish, cultured in a 37℃, 5% CO2 incubator, and used for transfection after 24 hours when the cell density reaches 70% to 80%.

[0193] 2) 2 hours before transfection, the cell culture medium was replaced with PBS-free medium.

[0194] 3) Add the recombinant adeno-associated virus vector rAAV-shRNA and packaging plasmid pAAV-RC (Jikai Gene, see Figure 5B )) and shuttle helper plasmid pHelper ((Jikai gene, see Figure 5C ) (rAAV-shRNA 5 μg, pAAV-RC packaging plasmid 5 μg, pHelper shuttle helper plasmid 5 μg), mixed evenly with the corresponding volume of transfection reagent to adjust the total volume to 1 mL, and incubated at room temperature for 15 minutes.

[0195] 4) Slowly add the mixed solution after incubation in step 3) to the 293T cell culture medium (pay attention to the uniformity during the addition process to avoid blowing the cells away) and mix well. Incubate in a cell culture incubator at 37° C. and 5% CO 2 .

[0196] 5) After 6 h of incubation, the culture medium of the transfection mixture was aspirated, the cells were washed once with 10 mL of PBS, and then 10 mL of fresh complete culture medium was added for incubation.

[0197] 6) Slowly add 10 mL of cell culture medium containing 5% FBS, and continue culturing in a 37° C., 5% CO 2 incubator for 48-72 hours to obtain adeno-associated virus CV299-sh-pno1-90 (abbreviated as sh-pno1).

[0198] At the same time, the shRNA fragment (ie, sh-PNO1-90) in step 2.3.1 1) was replaced with the sh-Ctrl sequence and then the same method was used to obtain a control adeno-associated virus (sh-Ctrl).

[0199] 2.3.3 Concentration and purification of recombinant adeno-associated virus sh-pno1

[0200] 72 hours after transfection, collect the AVV-293T cell supernatant and cells. Centrifuge at 3000g for 5 minutes at 4°C to separate the cells and supernatant. Add the GeneCare AVV virus concentration kit to the supernatant to obtain the virus in the supernatant; add the resuspension solution to the cell pellet and resuspend it, freeze and thaw it repeatedly in liquid nitrogen / 37°C for 4 times, and centrifuge; then, combine the two parts of the virus. Then centrifuge at 18°C ​​and 63000rpm for 2 hours. Aspirate the separation layer where the virus is located and place it in an ultrafiltration column for ultrafiltration until it becomes a colorless or light pink clear liquid. Then, the virus liquid is sterilized by passing it through a 0.22μm filter membrane and aliquoted to obtain the purified adeno-associated virus sh-pno1.

[0201] The purified adeno-associated virus sh-pno1 was subjected to pyrogen detection, microbial detection and other tests to ensure that there was no pyrogen, no microbial contamination such as bacteria, fungi, viruses, and no wild virus replication.

[0202] GeneCare Gene was commissioned to measure the AAV viral particle count by real-time PCR to detect the genome copy number of the AAV vector. The titer of the adeno-associated virus sh-pno1 was as follows: sh-Pno1: 2.12E+13 vg / mL.

[0203] Example 3 In vivo experiment

[0204] The adeno-associated virus sh-PNO1 constructed in Example 2 was administered to rats, and blood pressure, body weight, pulse wave velocity of the abdominal aorta, vascular wall thickness, and abdominal aortic pathological morphology were studied. The following were included:

[0205] 3.1 Animal Grouping and Adeno-associated Virus Injection

[0206] Male rats were divided into 4 groups, 7 rats in each group, as follows:

[0207] WKY rats were randomly divided into 2 groups: WKY+sh-Ctrl control group and WKY+sh-pno1 experimental group;

[0208] SHR were randomly divided into two groups: SHR+sh-Ctrl control group and SHR+sh-pno1 experimental group.

[0209] The WKY+sh-pno1 experimental group refers to WKY rats administered with adeno-associated virus sh-pno1; the SHR+sh-pno1 experimental group refers to SHR rats administered with adeno-associated virus sh-pno1.

[0210] The WKY+sh-NC control group refers to WKY rats administered with the control adeno-associated virus sh-Ctrl; the SHR+sh-ctrl experimental group refers to SHR rats administered with the control adeno-associated virus sh-Ctrl.

[0211] Injection of adeno-associated virus: Place the virus on ice and dilute the adeno-associated virus with normal saline to an appropriate titer (1×10 12 Infectious units / mL), the rats were then fixed using a rat tail vein injection device with their tails exposed outward; the rat tails were wiped with an alcohol cotton ball to dilate the blood vessels; the control adeno-associated virus sh-Ctrl and the adeno-associated virus sh-pno1 were injected into WKY and SHR mice, respectively, and 100 μL of virus was drawn up with a 1 mL syringe; the rat tail was straightened to make the red vein clearly visible, the needle was inserted at 1 / 3 of the distance from the tail tip, the virus was slowly injected, and then the needle was pulled out, and the injection point was pressed with a cotton ball to stop bleeding; the rats were removed from the fixator and returned to the original cage for normal feeding.

[0212] 3.2. Investigation of Adeno-Associated Virus Therapy for Hypertension

[0213] 3.2.1 Blood Pressure Measurement

[0214] The non-invasive rat tail artery blood pressure detector produced by Kent Company of the United States was used to carefully observe the systolic blood pressure (SBP), diastolic blood pressure (DBP) and mean arterial pressure (MAP) of each group of rats.

[0215] The experimental process is as follows: ensure that the non-invasive sphygmomanometer is installed correctly, check the equipment to avoid air leaks or other abnormalities. Use a restraint to fix the rat, place an occlusion cuff about 1 cm away from the base of the rat's tail, and then insert the volume pressure sensor until the sensor can no longer move toward the base of the rat's tail. Next, place the fixed restraint on the heating plate, adjust it to the most suitable temperature, and cover it with a blackout cloth to maintain the stability of the measurement environment. To ensure the accuracy of the experimental data, let the rat rest in a quiet state for 5 minutes, and then start blood pressure measurement, and take the average value as a reference. After the measurement is completed, the rat is returned to the original cage and continues its normal feeding procedure. To ensure the continuity and reliability of the experimental data, the blood pressure of each group of rats is measured once a week before sampling, and the measurement is continued for 10 consecutive weeks.

[0216] 3.2.2 Measurement of Pulse Wave Velocity and Vascular Wall Thickness in the Abdominal Aorta

[0217] Cardiac function was assessed using a Vevo 2100 ultra-high-resolution small animal ultrasound system. Before testing, mice were shaved of their chest hair using depilatory cream. Rats were anesthetized with 2% isoflurane inhalation and then immobilized in the supine position on a 37°C thermostat. Heart rate was controlled (450-600 bp). Coupling gel was applied to the abdomen. Ultrasound probes were positioned substernal to image the abdominal aorta. The probe was rotated parallel to the abdominal midline to obtain cross-sectional images of the aorta. After ultrasound, Vevo Software (Vevo LAB 1.7.1) was used to analyze and calculate pulse wave velocity (PWV) and vessel wall thickness. PWV was calculated using the following formula: PWV = abdominal aorta length / (distal end conduction time - cardiac end conduction time). At least three measurements were performed for each rat, and the average value was calculated.

[0218] 3.2.4 HE staining

[0219] The abdominal aorta of rats was dissected and fixed in 4% paraformaldehyde for 48 hours. The tissue was then dehydrated using different concentrations of ethanol, immersed in xylene to replace the ethanol, and immersed in wax. After embedding, the tissue blocks were cut into 4 μm slices using a paraffin slicer. The slices were spread in 40°C water, transferred to glass slides, and baked, dried, hydrated in xylene, and dewaxed using different concentrations of ethanol. The rehydrated slices were placed in hematoxylin solution for 1 minute and then washed with pure water once. They were immersed in 1% hydrochloric acid alcohol for differentiation for 1 second, placed in water for anti-blueing, and then placed in eosin solution for staining for 2 seconds. The slices were dried and sealed. The pathological morphological changes of the tissues were observed under a microscope.

[0220] 3.3 Results

[0221] 3.3.1 Effects of administration of adeno-associated virus sh-pno1 on blood pressure and body weight in rats

[0222] Blood pressure monitoring of rats in each group Figure 7 shown.

[0223] from Figure 7 It can be seen that compared with the WKY+sh-Ctrl group, the blood pressure of the rats in the SHR+sh-Ctrl group, including systolic blood pressure ( Figure 7 Middle A), diastolic pressure ( Figure 7 Middle B) and mean arterial pressure ( Figure 7 C) was significantly increased (*P<0.05), and there was no significant change in body weight; compared with the SHR+sh-Ctrl group, the systolic blood pressure of rats in the SHR+sh-pno1 group ( Figure 7 Middle A), diastolic pressure ( Figure 7 Middle B) and mean arterial pressure ( Figure 7The body weight of the groups was significantly decreased (#P<0.05), and the difference was statistically significant. There was no significant change in body weight among the groups.

[0224] 3.3.2 Effects of Adeno-associated Virus Sh-pno1 Administration on Pulse Wave Velocity and Vascular Wall Thickness in the Abdominal Aorta of Rats

[0225] Vascular elasticity is a key indicator of vascular function, and pulse wave velocity (PWV) can, to some extent, reflect this elasticity and is a commonly used clinical method for early diagnosis of vascular function. A high PWV indicates greater vascular stiffness, indicating decreased elasticity of the vessel wall. Furthermore, damage to the vascular system caused by hypertension can lead to thickening of the arterial wall. Suppressing this thickening can potentially help treat hypertension.

[0226] Small animal ultrasound was used to detect the abdominal aorta PWV and vascular wall thickness of rats in each group. Figure 8 As shown in A and B.

[0227] from Figure 8 As shown in Figures A and B, the PWV values ​​of the abdominal aorta of rats in the SHR+sh-Ctrl group were significantly increased compared with those in the WKY+sh-Ctrl group ( * P<0.05); Compared with the SHR+sh-Ctrl group, the PWV value of the abdominal aorta of the rats in the SHR+sh-pno1 group was significantly decreased ( & There was no significant difference in PWV values ​​of the abdominal aorta between the WKY+sh-pno1 group and the WKY+sh-Ctrl group, indicating that silencing the PNO1 gene can improve vascular dysfunction caused by hypertension in rats.

[0228] The results of abdominal aorta wall thickness test of rats in each group are as follows Figure 8 As shown in A and C.

[0229] from Figure 8 As shown in Figure C, compared with the WKY+sh-Ctrl group, the thickness of the abdominal aorta wall in the SHR+sh-Ctrl group was significantly increased ( * P<0.05); Compared with the SHR+sh-Ctrl group, the thickness of the abdominal aorta wall of rats in the SHR+sh-pno1 group was significantly decreased ( & There was no significant difference in abdominal aorta wall thickness between the WKY+sh-pno1 group and the WKY+sh-Ctrl group (P<0.05), indicating that silencing the PNO1 gene can improve the increase in vascular wall thickness caused by hypertension.

[0230] 3.3.3 Effects of Adeno-associated Virus Sh-Pno1 on the Pathological Morphology of the Abdominal Aorta in Rats

[0231] HE staining was used to detect the pathological changes of abdominal aorta in rats of each group. Figure 9 .

[0232] from Figure 9 It can be seen that compared with the WKY+sh-Ctrl group, the abdominal aorta wall of rats in the SHR+sh-Ctrl group was significantly thickened ( * P<0.05); Compared with the SHR+sh-Ctrl group, the thickness of the abdominal aorta wall of rats in the SHR+sh-pno1 group was significantly decreased ( # P<0.05). The results showed that silencing PNO1 could improve the pathological morphology of the abdominal aorta in spontaneously hypertensive rats.

[0233] The above examples are intended to illustrate the embodiments disclosed herein and are not to be construed as limiting the present invention. In addition, the various modifications listed herein and variations of the methods and compositions in the invention will be apparent to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications apparent to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention.

Claims

1. Use of a nucleic acid molecule and / or nucleic acid construct and / or viral particle and / or cell for inhibiting PNO1 gene expression for the preparation of a medicament for preventing or treating hypertension, wherein the nucleic acid molecule is selected from siRNA or shRNA, the siRNA or shRNA comprising a nucleotide sequence capable of hybridizing with the PNO1 gene; the target sequence of the siRNA or shRNA being any one of SEQ ID NOs: 1 to 3; The nucleic acid construct contains nucleotides encoding the nucleic acid molecule; The virus particles are obtained by packaging the nucleic acid construct after interfering with the host cell; The cell comprises the nucleic acid construct or has integrated into its genome the nucleotide sequence encoding the nucleic acid molecule.

2. The use according to claim 1, characterized in that The siRNA comprises a first strand and a second strand, the first strand and the second strand complement each other to form an RNA dimer, and the nucleotide sequence encoding the first strand is a sequence shown in any one of SEQ ID NOs: 1 to 3; And / or, the shRNA comprises a sense chain fragment and an antisense chain fragment, and a stem-loop structure connecting the sense chain fragment and the antisense chain fragment, the sequences of the sense chain fragment and the antisense chain fragment are complementary, and the encoding nucleotide sequence of the shRNA is the sequence shown in SEQ ID NO: 4 to 9.

3. The use according to claim 1, characterized in that The nucleic acid construct is a viral vector, and the viral vector is selected from one or more of a lentiviral vector, an adeno-associated viral vector and an adenoviral vector.

4. The use according to claim 1, wherein The drug has one or more of the following effects: B1) Improve decreased vascular function; B2) Improve reduced heart function; B3) Improves blood vessel wall thickening.

Images