Lncrna exon snp molecular marker related to pork performance of pigs and application thereof

By screening for SNP molecular markers in the lncRNA exon at 94095216 bases on pig chromosome 15, the GG genotype was identified as a favorable genotype. This solved the problem of inaccurate assessment of pig meat production performance, improved the precision of breeding selection and the efficiency of genetic improvement, and promoted the enhancement of pig meat production performance.

CN119082315BActive Publication Date: 2026-06-09HUAZHONG AGRI UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HUAZHONG AGRI UNIV
Filing Date
2024-09-25
Publication Date
2026-06-09

Smart Images

  • Figure CN119082315B_ABST
    Figure CN119082315B_ABST
Patent Text Reader

Abstract

This invention belongs to the fields of molecular biotechnology and molecular marker technology, specifically relating to a lncRNA exon SNP molecular marker related to porcine meat production performance and its application. This marker corresponds to locus 94095216 on porcine chromosome 15 in the international reference genome Sscrofa 11.1. LOC110257192 is highly expressed in porcine muscle tissue, and a G>T base substitution exists at 1564 bp in the exon region of LOC110257192, leading to polymorphism. SNP genotyping and association analysis show that individuals with the TT genotype exhibit traits such as thick backfat at 100 kg body weight and small eye muscle area. This invention provides a novel marker for marker-assisted selection in porcines, which can be applied to genetic improvement to enhance porcine meat production capacity, accelerate the genetic selection process, and promote the genetic improvement and breeding of high-quality pig breeds.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of molecular biotechnology and molecular marker technology, specifically relating to a lncRNA exon SNP molecular marker related to pig meat production performance and its application. The molecular marker was cloned from the 94095216th base of pig chromosome 15, which is located at 1564 bp in the exon region of the LOC110257192 gene. Background Technology

[0002] As the world's largest producer and consumer of pork, China's rapid economic development and rising living standards have led to a sustained increase in domestic demand for pork. This trend has spurred the transformation of the pig farming industry towards modernization and large-scale operations. [1] In genetic research, single nucleotide polymorphisms (SNPs) are a ubiquitous type of genetic variation and play a central role in genetic improvement in animal husbandry. SNP markers are valued for their high frequency, wide distribution, and ease of genotyping. [2] This serves as an ideal bridge connecting specific regions of the genome with economic traits. By identifying SNP markers associated with pig meat production performance, the production potential of pigs can be assessed more accurately, thereby optimizing breeding choices and improving the efficiency of genetic improvement.

[0003] Long non-coding RNAs (lncRNAs) are a class of non-coding RNA molecules longer than 200 nucleotides, playing various important regulatory roles in cells. Our research group previously identified a lncRNA, LOC110257192, that regulates the differentiation of porcine skeletal muscle satellite cells. Previous studies have shown that SNPs in lncRNAs may alter their function, including by changing base pairing patterns, thereby causing changes in the secondary structure of lncRNAs. These changes may further affect gene expression and cellular processes. Furthermore, the porcine genome is rich in SNPs among lncRNAs, and the potential functions and regulatory mechanisms of these SNPs require further exploration and research.

[0004] Therefore, this invention aims to provide a novel SNP genetic marker related to pig meat production performance and its breeding application method. This invention screens for SNP genetic markers related to pig meat production performance by detecting the polymorphism of exon LOC110257192, promoting the development of precision breeding technology, improving pig meat production efficiency, facilitating the application of precision agriculture and intelligent farming technologies, and also providing new research ideas for exploring the function of SNPs in lncRNAs in skeletal muscle growth and development.

[0005] Main References

[0006] [1] Hao Fushan. Discussion on key technologies for breeding pigs in large-scale pig farms [J]. Pig Science, 2024, 41(08): 99-101.

[0007] [2] Duan Yixin, Zhang Linyun, Zhao Yongju. Methods for estimating the heritability of SNPs, influencing factors and their application in livestock and poultry breeding [J]. Journal of Animal Husbandry and Veterinary Medicine, 2024, 55(05): 1854-1865.

[0008] [3]Gao P, Wei GH. Genomic Insight into the Role of lncRNA in CancerSusceptibility. Int J Mol Sci. 2017, 18(6): 1239.

[0009] [4]Singh M, Kumar S. Effect of single nucleotide polymorphisms on the structure of long noncoding RNAs and their interaction with RNA bindingproteins. Biosystems. 2023; 233: 105021.

[0010] [5]Lv W, Zhao S, Hou Y, et al. Single Nucleotide Polymorphisms of PorcinelncMGPF Regulate Meat Production Traits by Affecting RNA Stability. Front CellDev Biol. 2021, 9: 731712. Summary of the Invention

[0011] The purpose of this invention is to provide a lncRNA exon SNP molecular marker related to pig meat production performance, and to screen for genetic markers associated with pig meat production performance. By cloning the gene sequence of the 94094916-94095529 segment of pig chromosome 15, and using direct sequencing to find SNP sites and genotyping methods, the association between these sites and pig meat production performance is analyzed, thereby establishing new marker-assisted selection sites for improving pig meat production performance.

[0012] Another objective of this invention is to provide the application of the aforementioned SNP molecular marker in improving the meat production performance of pigs. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, and a G>T base mutation exists at position 314 of this sequence, which alters backfat thickness, eye muscle area, and eye muscle depth in live pigs reaching 100 kg body weight. The GG genotype at this SNP locus is a favorable genotype for improving the meat production performance of pigs. This invention aims to discover and identify SNP loci associated with the meat production performance of pigs, thereby providing important guidance for pig genetic breeding work.

[0013] This invention is achieved through the following technical solution:

[0014] A lncRNA exon SNP molecular marker related to porcine meat production performance is disclosed. The SNP site corresponds to the gene sequence of segment 94094916-94095529 on porcine chromosome 15, with a fragment length of 614 bp. Its nucleotide sequence is as described in SEQ ID NO.1. BLAST alignment on the NCBI website revealed a nucleotide polymorphism (SNP) site within this amplified fragment, specifically as follows: Figure 3 As shown. The mutation at this SNP site is specifically located at base 94095216 on chromosome 15, where the base changes from G to T. According to the naming rules of the Ensembl database, this mutation site is named rs3471000896.

[0015] The experimental materials included American Large White and Danish Large White pigs. Whole-genome DNA was extracted from the blood of these pigs, and primer pairs were designed based on the pig genome sequence (NC_010457.5) published in the NCBI database. The primer pair sequences are as follows:

[0016] Forward primer (SEQ ID NO.2): 5'-TGTCATGCCTTGCAGCCTAT-3'.

[0017] Reverse primer (SEQ ID NO.3): 5'-GCCTGGGGACAATCTGACAT-3'.

[0018] The primer pairs described above can be used to detect and genotype SNP sites in the gene region of chromosome 15, segment 94094916-94095529.

[0019] After PCR amplification using the aforementioned primer pairs, purification of the PCR product, cloning and sequencing, and sequence alignment analysis, a genetic marker associated with porcine meat production performance was identified. The nucleotide sequence of this genetic marker is shown in SEQ ID NO.1 below, with the mutation site located at position 314.

[0020] TGTCATGCCTTGCAGCCTATTTATAAAGTTTTCTCCTTCACTTAAAATGAGGCCTTGTGTATACGTATTTAGTGTGCAAGAATGTATGTTCTTTCATTATAAAGAGCCTCATTAGGGTAATAGATTTTTGCTTTAAATCTTGCTTCAAATGCT AAGTTAAAGTGTGAGCAAACATGTATCAGTATAGCCTCACTGGTTTGGACTCTGTTGCTTTGAGGTTTGTGATAATTGGTTGGACTAATGTGTGCATTTGCTATGTCAGTCATCTTCTTTAATTGTAAATTAATAGCATCCCAGAGGCTTAAAA GAACR(G / T)ACTTTTAAGTACTTCATAAACAACTACTCAAATGCTCATTATAATTACTCTTATCTATTCATCACATCTTTTCTCGAAAAGAATCAGAGACTTAAGAAGTTGACAAGGTCAATCTTCAAATCTGAGTCCTTGGCATTATTTGGAA AGAATGATTTTTATCAGGTATTTATCTTTAGCCCAGATTTCTGTTTTCCACCCCACCCCCCACGTCCTGCTTGGCTGCTATTTTAATTTATTATTCATGTAAAGTGTTTGAAAGCTAGTCTATGCTGACTTGCAGATGTCAGATTGTCCCCAGGC

[0021] A method for screening genetic markers associated with pork production performance includes the following steps:

[0022] 1. Extract genomic DNA from the blood of American and Danish whitebait.

[0023] 2. Primers were designed based on the genomic sequence from -313 bp upstream to 300 bp downstream of this locus. The porcine genomic DNA was amplified by PCR using the primers described above, and the nucleotide sequence from -313 bp upstream to 300 bp downstream of this locus was obtained by direct sequencing (see SEQ ID NO.1 for the sequence details). This sequence contains one SNP site.

[0024] 3. This mutation site can be used as a genetic marker to conduct association analysis on the meat production traits of American and Danish Large White breeds.

[0025] This invention provides a genotyping method for detecting SNP sites in the above sequence.

[0026] This invention further provides the application of the aforementioned SNP molecular markers in improving pork meat production performance, and the application of direct sequencing to determine the association between individuals with different genotypes and meat production traits, including the following steps:

[0027] 1. To determine the correlation between SNPs in the region 94094916-94095529 of porcine chromosome 15 and the meat production trait in pigs, American and Danish Large White pigs were selected as experimental materials.

[0028] 2. Polymorphism was detected using direct sequencing, and the correlation between polymorphic sites and pig meat production performance was analyzed. A mixed linear model in SAS statistical software was used to analyze the association between genotype and phenotypic values.

[0029] Compared with the prior art, the present invention has the following advantages and effects:

[0030] This invention studies and identifies a molecular marker affecting pig meat production performance located at nucleotide 94095216 on chromosome 15. Specifically, the R at position 314 of this SNP marker represents an allelic substitution, leading to polymorphism at this location: in the trait of backfat thickness at 100 kg body weight, individuals with the TT genotype at this SNP locus have thicker backfat; in the trait of eye muscle area at 100 kg body weight, individuals with the TT genotype at this SNP locus have smaller eye muscle area; and in the trait of eye muscle depth at 100 kg body weight, individuals with the TT genotype at this SNP locus have smaller eye muscle depth. The GG genotype at this SNP locus is a favorable genotype associated with pig meat production performance. This invention aims to discover and identify SNP loci associated with pig meat production performance, thereby providing important guidance for pig genetic breeding. Attached Figure Description

[0031] Figure 1 This invention provides the cloning detection results for the 94094916-94095529 segment of porcine chromosome 15; the agarose gel concentration is 1%; wherein: lanes 1-2: PCR amplification products, lane M: DL2000 Maker;

[0032] Figure 2 Nucleotide sequence of segment 94094916-94095529 of porcine chromosome 15; the mutation site marked in red in the sequence is the specific site that causes polymorphism in this segment;

[0033] Figure 3 The sequencing map of the genetic marker sequence G>T of this invention. Detailed Implementation

[0034] Example 1: Amplification of DNA fragment from region 94094916-94095529 of porcine chromosome 15 and establishment of SNP detection method

[0035] 1. Primer pairs were designed based on the genome sequence of the 94094916-94095529 segment of pig chromosome 15. The specific sequences are as follows:

[0036] Forward primer (SEQ ID NO.2): 5'-TGTCATGCCTTGCAGCCTAT-3'.

[0037] Reverse primer (SEQ ID NO.3): 5'-GCCTGGGGACAATCTGACAT-3'.

[0038] 2. PCR amplification was performed on the genomic DNA of different experimental pig populations using the primer pairs described above.

[0039] The PCR reaction system is shown in Table 1.

[0040] Table 1 PCR reaction system

[0041]

[0042] The PCR reaction conditions are shown in Table 2.

[0043] Table 2 PCR reaction conditions

[0044]

[0045] After purification and cloning, the obtained PCR product was sent to Wuhan Aoke Biotechnology Co., Ltd. for sequencing. BLAST alignment analysis revealed a G / T base mutation at position 314 of the sequence.

[0046] Example 2: Association analysis and application of the genetic markers of the present invention with meat production performance of different pig breeds

[0047] 1. In order to determine the correlation between SNPs in the region 94094916-94095529 of pig chromosome 15 and phenotypic differences in pigs, this experiment selected American Large White (719 pigs) and Danish Large White (614 pigs) as experimental materials.

[0048] 2. Polymorphism was detected using direct sequencing, and the correlation between polymorphic sites and pig meat production performance was analyzed. A mixed linear model in SAS statistical software was used to analyze the association between genotype and phenotypic values. The analysis model is as follows: Y ijkl =u+G i +F j +S k +Bl +ε ijklm In the formula, Y ijkl G represents the observed trait value; u represents the overall trait mean; G represents the observed trait value. i This is a genotype effect; F j S k B l For fixed effects, ε represents pedigree, sex, and batch effects. ijklm The error is random, assumed to follow the pattern N(0, σ). 2 )distributed.

[0049] 3. Polymorphism detection was performed on the rs3471000896 locus in the 94094916-94095529 region of pig chromosome 15. Three genotypes were detected in all of the above populations. The genotype frequencies and their distribution are shown in Table 3.

[0050] Table 3 Genotypes and allele frequencies of polymorphic site rs3471000896

[0051]

[0052] Table 3 shows that the frequency of the G allele at the polymorphic site rs3471000896 was higher than that of the T allele in both American and Danish Large White pig populations. The Hardy-Weinberg equilibrium test results indicate that in American Large White (χ²) pigs... 2 =0.526, P=0.468>0.05) and Danish white (χ²) 2 =3.721, P=0.054>0.05), the genotype distribution of the polymorphic locus rs3471000896 all conformed to the state of genetic equilibrium.

[0053] Table 4. Association analysis of polymorphic site rs3471000896 with meat production efficiency.

[0054]

[0055] Note: The above values ​​are the least squares mean ± standard error; within each pig breed, the same letter in the same column indicates no significant difference (P>0.05), and when the letters are different, lowercase letters indicate significant differences (P<0.05), uppercase letters indicate extremely significant differences (P<0.01), and unlabeled letters indicate no significant differences (P>0.05). The numbers in parentheses indicate the number of pigs.

[0056] The association analysis results in Table 4 showed that the polymorphic locus rs3471000896 was significantly associated with backfat thickness at 100 kg body weight in both American and Danish Large White pigs. Specifically, the backfat thickness in American Large White pigs with the TT genotype was significantly higher than that with the GG genotype (P<0.01), while in Danish Large White pigs, the backfat thickness in individuals with the TT genotype was significantly higher than that with the GG genotype (P<0.05). The association analysis also revealed a significant correlation between the polymorphic locus rs3471000896 and the trait of eye muscle area at 100 kg body weight. In terms of phenotypic traits, the eye muscle area of ​​American Large White pigs with the TT genotype was significantly smaller than that of those with the GG genotype (P<0.05). Regarding eye muscle depth at 100kg body weight, the eye muscle depth of Danish Large White pigs with the TT genotype was significantly smaller than that of those with the GG genotype (P<0.05). From the perspective of genetic improvement and breeding, the GG genotype has a significant advantage in reducing backfat thickness at 100kg body weight and increasing eye muscle area and depth at 100kg body weight. Therefore, in pig genetic breeding, priority should be given to selecting superior individuals that do not carry the TT mutation, while retaining GG-type breeding pigs to progressively increase the frequency of the G allele at this locus. This can reduce backfat thickness and increase eye muscle area and depth, thereby improving the meat production performance of pigs. Based on the above results, this invention hypothesizes that the polymorphic locus rs3471000896 can serve as a potential genetic marker for improving pig meat production performance. By applying this genetic marker, the selection of breeding pigs can be made more precise, the genetic improvement process can be accelerated, and the economic benefits of breeding pigs can be effectively improved.

Claims

1. The application of a lncRNA exon SNP molecular marker related to pig meat production performance in improving pig meat production performance, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein the SNP site R in the sequence is G or T; the pigs are American Large White and Danish Large White pigs; the primer pair sequences used to detect the SNP molecular marker are shown in SEQ ID NO.2 and SEQ ID NO.3; the SNP site is significantly correlated with the live backfat thickness at 100kg body weight in American Large White and Danish Large White pigs, with the live backfat thickness of American Large White TT genotype individuals being significantly higher than that of GG genotype individuals, and the live backfat thickness of Danish Large White TT genotype individuals being significantly higher than that of GG genotype individuals; regarding the eye muscle area at 100kg body weight, the eye muscle area of ​​American Large White TT genotype individuals is significantly smaller than that of GG genotype individuals; regarding the eye muscle depth at 100kg body weight, the eye muscle depth of Danish Large White TT genotype individuals is significantly smaller than that of GG genotype individuals.