Gene for regulating migration takeoff behavior of cnaphalocrocis medinalis and application

Abstract

The invention discloses a cry1 gene in rice leaf folders, the gene is related to light-induced migration and takeoff behaviors of the rice leaf folders, a reagent for preventing migration and takeoff behaviors of the rice leaf folders can be designed according to the cry1 gene of the rice leaf folders, and a new direction is provided for preventing and treating the rice leaf folders.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a gene for regulating the migration and take-off behavior of rice leaf folder and its application. Background Art

[0002] The rice leaf folder, Cnaphalocrocis medinalis, is one of the most destructive migratory pests on rice. It affects rice photosynthesis and growth by feeding on rice leaves and rolling them up, causing serious damage to rice production. The rice leaf folder has a strong migratory ability and can make multiple consecutive long-distance night flights. There are many migratory disasters in my country every year, which can cause total crop failure in severe cases. Since the outbreak of the rice leaf folder depends largely on the migrating population and is sudden, it brings great difficulties to monitoring and prevention. Takeoff is the starting stage of the migration behavior of the rice leaf folder. Whether it can migrate and cause disasters depends first on whether the takeoff behavior is completed smoothly. Clarifying the regulatory mechanism of the takeoff behavior of the rice leaf folder can provide a theoretical basis for the prediction and scientific prevention and control of the rice leaf folder.

[0003] Previous studies have found that the take-off behavior of the rice leaf folder is significantly dependent on light. Observations on the effect of light intensity on the take-off behavior of the rice leaf folder in a controlled indoor environment have found that light intensity is a key factor in stimulating the take-off of adult rice leaf folders, and triggering migratory take-off behavior requires a certain range of light intensity, and the light changes from bright to dark. However, there are few studies on the molecules related to the effect of light on the take-off behavior of the rice leaf folder, and the specific mechanism is still unclear. Summary of the invention

[0004] In response to the above problems, the present application studies the migration and take-off behavior of the rice leaf folder. The study found that blue light, rather than red light, is the wavelength that affects the migration and take-off behavior of the rice leaf folder. Furthermore, the present application found that the cryptochrome gene cry1 exists in the rice leaf folder, and the gene is related to the light-induced migration and take-off behavior of the rice leaf folder. Therefore, the migration and take-off behavior of the rice leaf folder can be regulated by regulating cry1 in the rice leaf folder.

[0005] One aspect of the present application provides use of a cry1 gene in preparing an agent for regulating the migration and take-off behavior of a rice leaf folder, wherein the sequence of the cry1 gene is shown in SEQ ID NO.1.

[0006] In some embodiments, the agent regulates the migration and take-off behavior of the rice leaf folder by interfering with the expression of the cryptochrome gene cry1 in the rice leaf folder.

[0007] Cryptochromes are a class of flavin proteins that are widely found in higher eukaryotes and are sensitive to blue light and near-ultraviolet light. They are also called UV-A / blue-light receptors. Cryptochromes are named because they help cryptogams, which reproduce spores, absorb blue light. Plant cryptochromes mainly play a role in plant photomorphogenesis, flowering regulation, circadian clock regulation, stomatal opening, and magnetic field perception. Most of the existing reports on cryptochrome genes are related to the functions, applications or molecular mechanisms of cryptochrome genes in plants, such as Hong Guoqin. Effects of inhibiting the expression of rice cryptochrome gene OsCRY1a on rice agronomic traits [J]. Chinese Journal of Rice Science, 2011, 25(6): 575-579; Liu Yang, Jiang Mingmin, Ren Li, et al. Eggplant cryptochrome gene SmCRY2 and its use:, CN105440116A [P]. 2016; Jiang Weilin, Long Hong. Cryptochrome gene delays the phase transition of vegetative growth in Arabidopsis [J]. Journal of Tropical Crops, 2014(11): 2211-2214. At present, there are few reports on cryptochrome genes in animals, and there is no research report on cryptochrome genes in rice leaf folder. The present application is the first to discover and report the existence of a cryptochrome gene cry1 in the rice leaf folder, and also discloses that the cry1 gene is related to the migration and takeoff of the rice leaf folder, and that the migration and takeoff behavior of the rice leaf folder can be regulated by regulating the expression of the cry1 gene.

[0008] A second aspect of the present invention provides a method for regulating the migration and takeoff of rice leaf folder, the method comprising: regulating the expression of cry1 gene of rice leaf folder.

[0009] In some embodiments, the method further comprises: using light to induce the rice leaf folder, wherein the light comprises light in the blue light band. For example, when the rice leaf folder needs to be made to migrate and take off, the rice leaf folder can be induced using light comprising the blue light band. In some embodiments, an expression vector of the cry1 gene can be constructed and introduced into the rice leaf folder, so that the migration and take-off of the rice leaf folder can be further promoted under light induction conditions.

[0010] In some embodiments, the cry1 gene is obtained by gene cloning, and the primer sequences used for gene cloning are shown in SEQ ID NO.4 and SEQ ID NO.5.

[0011] In some embodiments, the wavelength of the blue light is 380 nm to 430 nm.

[0012] In some embodiments, the method silences the cry1 gene by RNAi technology.

[0013] In some embodiments, silencing the cry1 gene by RNAi technology includes: designing dsRNA according to the cry1 gene sequence, and injecting the dsRNA into the rice leaf folder.

[0014] In some embodiments, the dsRNA sequence is shown as SED ID NO.2 and SED ID NO.3.

[0015] For example, in one embodiment of the present application, dsRNA was injected into newly emerged adult rice leaf folders by microinjection to silence the cry1 gene. Compared with the case where the cry1 gene of the rice leaf folder was not silenced by dsRNA, the take-off and migration rate of the adult rice leaf folders with silenced cry1 gene was significantly reduced.

[0016] In some embodiments, the rice leaf folder is a female adult of the rice leaf folder. Female adults of the rice leaf folder will reproduce and lay eggs, and migration and take-off will especially accelerate the spread and diffusion of the rice leaf folder. By regulating the migration and take-off behavior of female adults of the rice leaf folder, more effective prevention and control work can be carried out.

[0017] The advantages of the present application are as follows: the present application research discovered the cry1 gene in the rice leaf folder, which is related to the migratory take-off behavior of the rice leaf folder induced by light. The migratory take-off behavior of the rice leaf folder can be inhibited by silencing the cry1 gene. Reagents for preventing the migratory behavior of the rice leaf folder can be designed targeting the cry1 gene of the rice leaf folder, providing a new direction for the prevention and control of the rice leaf folder. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Schematic diagram of migratory takeoff (a) and dispersal takeoff (b).

[0019] Figure 2 Effects of different light wavelengths on the take-off ratio of rice leaf folder.

[0020] Figure 3 Detection of cry1 gene by agarose gel electrophoresis.

[0021] Figure 4 Effects of different light wavelengths on cry1 expression in the rice leaf folder Cnaphalocrocis medinalis.

[0022] Figure 5 The difference in expression level of cry1 between migratory individuals and resident individuals of Rice Leaf Folder.

[0023] Figure 6 dsRNA interferes with the expression of cry1 in the newly emerged female moths of the rice leaf folder.

[0024] Figure 7 Effects of interfering with cry1 gene expression on the take-off rate of rice leaf folder migration. DETAILED DESCRIPTION

[0025] Before describing various example embodiments and various example implementations of the present application in detail, in order to make various aspects of the present application more clear, it is beneficial to define or explain the following terms.

[0026] Cryptochrome or cryptochrome gene

[0027] Cryptochromes (CRYs) belong to the cryptochrome / photolyase (CPF) gene family, which is widely distributed in animals, plants, and algae. It is a receptor protein that can be activated by blue light and has the function of regulating plant photomorphogenesis and biorhythms. Cryptochromes are mainly divided into three categories: CRY1, CRY2, and CRY-DASH. CRY1 and CRY2 are mainly photoreceptors for plants to sense external light signals, and are involved in regulating the photoperiodic flowering of plants and the process of building plant photomorphogenesis. The gene sequence of the cryptochrome gene cry1 in the rice leaf folder newly discovered in this application is shown in SEQ ID NO.1. The cry1 gene is related to the migratory take-off behavior of the rice leaf folder and is a photoreceptor gene related to migratory behavior.

[0028] Migration takes off

[0029] Migration, also known as migration, refers to the phenomenon that an animal adapts to external conditions and moves long distances from one place of occurrence to another. Figure 1 In this application, the migratory takeoff refers to the initial stage of insect migratory flight, that is, the takeoff behavior of insects due to migration. When the rice leaf roller takes off, it flies vertically in a spiral or straight up at a large elevation angle, and when it takes off in a free diffusion, it flies freely and randomly without direction or purpose.

[0030] This application mainly conducted the following research:

[0031] (1) Effects of different light intensity changes on the dynamic changes of cry1 gene in rice leaf folder

[0032] A systematic study was conducted to investigate the dynamic changes of the photoreceptor gene cry1 of the rice leaf folder in different time periods under conditions of simulated sunset light intensity and constant light intensity, and to analyze the correlation between changes in light intensity and the dynamic changes in cry1 expression.

[0033] (2) Effects of different light wavelengths on the migration and takeoff of the rice leaf folder and the expression of the cry1 gene

[0034] Based on the characteristic that cry1 is sensitive to blue-violet light, the take-off rates of the rice leaf folder under different wavelengths (red light, blue light, green light, and full wavelength) were compared, and the expression of the cry1 gene was determined to clarify the effect of light wavelength on the migration and take-off of the rice leaf folder and its correlation with the expression of the cry1 gene.

[0035] (3) Study on the differential expression of cry1 gene in migratory and resident forms of rice leaf folder

[0036] According to the observation experiment of the take-off behavior of rice leaf folder, those that spiral vertically rise at a fast speed and land above 100 cm on the take-off platform after take-off are called migratory type, and those that do not take off or remain motionless within 30 minutes after the light intensity stops changing are called resident type. The expression differences of cry1 and serotype of rice leaf folder between migratory type (migratory take-off individuals) and resident type (non-take-off individuals) were systematically studied to analyze the correlation between these genes and the migratory take-off behavior of rice leaf folder.

[0037] (4) Study on the regulatory effect of cry1 gene of rice leaf folder on the migratory take-off behavior of rice leaf folder

[0038] RNAi technology was used to silence the cry1 gene, observe the take-off behavior of the rice leaf folder, determine the effect of silencing a gene in cry1 on the expression of related genes that were not silenced, and analyze the role of these genes in regulating the migration and take-off behavior of the rice leaf folder.

[0039] Unless otherwise specified, the terms in this application have the meanings generally understood by persons skilled in the art of this application. The specific description does not constitute any limitation to this application, and the scope of this application is defined by the claims of the present invention.

[0040] Example 1 Test materials

[0041] The rice leaf folder was collected from the rice experimental field of Baima Base of Nanjing Agricultural University and raised in the laboratory for ten generations to form a laboratory population. The indoor rearing method of rice leaf folder refers to Zhu Axiu, Qian Qiu, Liu Xiangdong. Method of rearing rice leaf folder using wheat seedlings [J]. Journal of Applied Entomology, 2015, 52(04): 883-889. and Guo JW, Yang F, Li P, Liu XD, Wu QL, Hu G*, Zhai BP*. Female bias in an immigratory population of Cnaphalocrocis medinalis moths based on field surveys and laboratory tests. Scientific Reports, 2019, 9: 18388. Wheat seedlings 10-15 cm tall planted in 500 ml plastic cups were used as feed to feed rice leaf folder larvae until they pupated. 6 cups of wheat seedlings are grouped together. About 300 eggs of rice leaf rollers that are about to hatch are scattered on the wheat seedlings at 6 cups of seedlings. The eggs are covered with nylon mesh and placed in an incubator with a constant temperature of 27°C, RH 80-90%, and a photoperiod of 14L:10D (photoperiod is 5:00-19:00). After the rice leaf rollers are hatched, 3 cups of new seedlings and 3 cups of insect seedlings are placed alternately as a group when they grow to the second instar. When they are the third instar, 15 larvae are transferred to the new seedling cups and cultured until pupation. Carefully remove the pupae and place them in a plastic box covered with moistened absorbent cotton and covered with nylon mesh. Healthy female adults that emerge within 2 hours of the peak emergence period (0:00-2:00 every day) are selected for the experiment.

[0042] Example 2 Effect of light wavelength on take-off behavior of rice leaf folder

[0043] Female adults of rice leaf rollers at 2 days old after emergence were collected for light change treatment. The light change treatment simulates the change in light intensity at sunset in the field. The light source consists of 12 rows of monochromatic light without flicker LCD lamps (35V / W), with a total brightness of 1000lx, and the wavelengths of blue light, green light, and red light are 380-430nm, 480-580nm, and 635-680nm, respectively. During the experiment, different wavelengths of LED lamps were selected to gradually weaken the light intensity (200lx / 3min) through the light intensity change device, so that the light intensity in the climate chamber was reduced from 1000lx to 0.1lx within 30min, thereby simulating the change in light intensity at dusk. The light change treatment started at 19:00 every day. The temperature in the climate chamber was 26±1℃, and the RH was 70%-80%. The entire test environment was kept quiet to avoid human interference. All adults to be tested were transferred to the climate chamber 1h before the start of the experiment to adapt to the surrounding environment. Take-off experiments were carried out under different wavelength treatments to avoid human interference. The take-off rates of the migratory rice leaf folder were counted, and statistical analysis was performed to compare the differences in the take-off rates between the two.

[0044] like Figure 2 As shown in the figure, the take-off ratio of the rice leaf folder under full spectrum and blue light induction is basically the same, and is significantly higher than that of green light and red light, which indicates that the migration and take-off behavior of the rice leaf folder under blue light is no different from that under full spectrum treatment. At other wavelengths, the migration and take-off ratio of the rice leaf folder decreased significantly, indicating that the blue light band is a sensitive band that causes the normal migration and take-off behavior of the rice leaf folder.

[0045] Example 3 Cloning of cry1 gene

[0046] 1. Primer Design

[0047] According to the cry1 gene sequence of the rice leaf folder genome, primers were designed using the software Oligo 7.

[0048] The sequences of the upstream primer and downstream primer of cry1 are shown in SEQ ID NO.4 and SEQ ID NO.5:

[0049] SEQ ID NO.4 (cry1 F): TGCCACAGGACTATATACACGG;

[0050] SEQ ID NO. 5(cry1 R):ACAGGAAGGTTGGATACATCAC.

[0051] Actin and RPS3 were used as internal reference genes, the sequences of the upstream primer and downstream primer of actin were shown in SEQ ID NO.6 and SEQ ID NO.7, and the sequences of the upstream primer and downstream primer of RPS3 were shown in SEQ ID NO.8 and SEQ ID NO.9.

[0052] SEQ ID NO.6 (actin F): CACACAGTGCCCATCTACGA;

[0053] SEQ ID NO.7 (actin R): GCGGTGGTGGTGAATGAGTA;

[0054] SEQ ID NO.8 (PRS3 F): AGGTTCAACATCCCCGAGCA;

[0055] SEQ ID NO. 9 (PRS3 R): CGGACACAACAACCTCGCAAC.

[0056] 2. RNA Extraction

[0057] Transfer the sample in the cryotube to a 1.5mL centrifuge tube, add 1000μL TIOSzol LS Reagent (Beijing Baoying Tonghui Biotechnology Co., Ltd.), place on ice, grind with a pestle cleaned with DEPC water (Shanghai Shenggong Biotechnology Co., Ltd.) for 1min, close the lid and turn the sample upside down with force to fully lyse the sample, and let it stand at room temperature for 5min. Add 200μL chloroform (Shanghai Lingfeng Chemical Reagent Co., Ltd.), oscillate for 15s, and let it stand at room temperature for 2min. Place the centrifuge tube in a low-temperature refrigerated centrifuge (Thermo Scientific, USA), centrifuge at 13000rpm, 4℃ for 10min, and RNA is distributed in the upper aqueous phase. Pipette 500μL of the supernatant into a new 1.5mL centrifuge tube, add an equal volume of isopropanol (Shanghai Lingfeng Chemical Reagent Co., Ltd.), turn the centrifuge tube upside down several times to fully mix the liquid, and let it stand at room temperature for 20min. Then centrifuge at 13000rpm, 4℃ for 10min, discard the supernatant and keep the RNA precipitate. Add 1000 μL of 75% ethanol solution prepared with DEPC water to the centrifuge tube with RNA precipitation, invert several times, centrifuge at 13000rpm, 4℃ for 5min, discard the supernatant and repeat the process. Discard the supernatant, centrifuge briefly and carefully remove the remaining liquid with a pipette, open the centrifuge tube cap and place at room temperature to allow the ethanol to evaporate completely (>20min). Add 40 μL of RNase-free water to the centrifuge tube to dissolve the RNA.

[0058] 3. cDNA Synthesis

[0059] The RNA concentration and OD260 / 280 in the sample were measured using NanoDrop2000 ultra-micro spectrophotometer (Thermo Scientific, USA), and the OD260 / 280 was between 1.8 and 2.0. After calculation, 3 μg of RNA was taken as a reverse transcription template, and the first-strand cDNA was synthesized using the 1st cDNA Synthesis Kit (gDAN removal) (Beijing Baoying Tonghui Biotechnology Co., Ltd.) rapid reverse transcription kit.

[0060] Prepare the reverse transcription reaction solution according to the following components:

[0061]

[0062] The bubbles in the prepared reverse transcription system were flicked off gently, and after instant centrifugation, the system was placed in a PCR instrument (Applied Biosystems, USA). The operating conditions were: 25°C for 10 min for primer pairing, 55°C for 45 min for cDNA synthesis, and 85°C for 5 min to inactivate the reverse transcriptase.

[0063] 4. PCR amplification system

[0064] The PCR amplification system is:

[0065]

[0066] 5. RT-PCR reaction conditions

[0067] The instrument used was the BIO RAD T100TM Thermal Cycler PCR system, and the amplification procedure was as follows:

[0068]

[0069] 6. Detection of PCR Products

[0070] The amplified product was detected by 1.5% agarose gel electrophoresis and compared with the marker. If the band size was consistent with the expected design, it was considered a valid result ( Figure 3). Cut off the gel strip containing the target gene and use a gel recovery kit to recover the PCR product. The specific steps are as follows: (1) Place the agarose gel block containing the target gene in a 2 mL centrifuge tube and add 1 mL Binding Buffer for every 1 g of agarose gel block; (2) Place in a 55°C water bath and mix by inversion every 2-3 minutes until the gel block is completely melted; (3) Transfer the molten mixed solution to the adsorption column, not more than 700 μL each time; (4) Centrifuge at room temperature at 13000 r / min for 1 min and discard the waste liquid; (5) Add 300 μL Binding Buffer to the adsorption column; (6) Centrifuge at room temperature at 13000 r / min for 1 min and discard the waste liquid; (7) Add 700 μL SPW Wash Buffer; (8) Centrifuge at room temperature at 13000 r / min for 1 min and discard the filtrate; (9) Add 700 μL SPW Wash Buffer Buffer; (10) Centrifuge at room temperature at 13000r / min for 1min, and discard the filtrate; (11) Centrifuge at room temperature at 13000r / min for 2min; (12) Place the adsorption column in a new 1.5mL centrifuge tube; (13) Add 30μL ElutionBuffer to the center of the adsorption membrane; (14) Let stand at room temperature for 1min; (15) Centrifuge at 13000r / min for 1min and recover the PCR product. (16) Determine the concentration of the PCR product and place it at -20℃. After gel recovery, send it to the company for sequencing.

[0071] 7. Sequencing results

[0072] The nucleotide sequence of cry1 gene is shown in SEQ ID NO.1.

[0073] SEQ ID NO.1(cry1):

[0074] ATGGCTAAAGTACCAAGCGTTATCATTGGTTTCGTCTGGATTTACGTATTCACGACAA

[0075] TCTTGCACTTCGCAATGCCATAAACGAGGCTGAGAATCGCAAACATTTTCTAAGACCG

[0076] GTTTACGTGATTGAGCCAGACATTAAGAACAAAGTAGGGGAAAACAGGTTGCGATTT

[0077] TTAATACAAAGTTTGCAAGATTTAGACTCTAATTTGAGGAAACTTAACACCCGACTAT

[0078] TCATATTAAGAGGAACAGCTACAGAACTTCTGCCAAAACTATTTGACAAGTGGCAAG

[0079] TTAAGCATTTGACTTCACAATTGGACATAGATCGAGATATTGTTCTACAAGACGAAGTT

[0080] ATTGATGAAGTTGCTGAAAAGAAAGACATTTTCATTGTTAGAAGGGTGCAACATACTG

[0081] TTTATGATGTGCACAGTGTATTAAAGAAAAATAATGGAGCTGTCCCTCTAACATATCAG

[0082] AAGTTTCTGTCATTGGTGACTGGGATACAGGTAAAAGATACAATTGAGATAACAAAA

[0083] GCATTATCTGACAACTGTAAGCCTCCAGATTTTGATTCCAAAGATTATGATGTTCCTTC

[0084] ACTTGAAGATTTGGGTCTGGAATGAATTCGCCCTCAATCCTTGCAAATATCCTGGAGGT

[0085] GAGACTGAAGGACTAAACAGGCTCAACATGTACATGGCCAAGAAGCAGTGGGTGTG

[0086] CAAATTTGAGAAAACCCAACACTTCTCCTAACAGCATTGAGCCAAGCACAACAGTTTT

[0087] GAGTCCTTACATAAGTCATGGATGCTTAGTCAGCCAAGTTATTTTATCACAAGCTGAA

[0088] GGAAGTTGA

[0089] Example 4 Effect of light wavelength on the expression of the cryptochrome cry1 gene of rice leaf folder

[0090] The migratory and resident adult individuals under different wavelengths in Example 1 were collected, total RNA was extracted, and cDNA was obtained by reverse transcription. The difference in the expression of the cry1 gene was determined by real-time fluorescence quantitative PCR. The effect of light wavelength on the expression of the cry1 gene was analyzed.

[0091] 1. Real-time fluorescence quantification

[0092] After cutting off the wings and legs and scraping off the hairs, 1000 mL of RNA extraction buffer (100 mM Tris pH 7.5, 100 mM LiCl, 20 mM DTT, 10% sodium dodecyl sulfate (SDS)) was used to extract the total RNA of the rice leaf roller. After chloroform purification, the RNA was precipitated with isopropanol. All RNA samples were reverse transcribed using the Polestar 1st cDNA Synthesis kit (gDNA removed) (Tiosbio) kit to obtain cDNA. The system is as follows:

[0093]

[0094] The instrument used was the BIO RAD T100TM Thermal Cycler PCR system, and the reverse transcription procedure was as follows.

[0095]

[0096] The real-time fluorescence quantitative system is:

[0097]

[0098] The instrument used is QuantStudio TM 6Flex Real-Time PCR System (Bio-Rad) real-time fluorescence quantitative PCR system, the amplification program is as follows.

[0099]

[0100] 2. Test results

[0101] like Figure 4 There was no significant difference in the relative expression of cry1 in the blue light band and the full spectrum, but the relative expression of cry1 in the blue light band was significantly lower than that in the green light and red light, that is, the relative expression of cry1 in the blue light band was no different from that in the full spectrum, while the relative expression of cry1 in other light wavelengths was significantly upregulated. This indicates that cry1 in the rice leaf folder is related to the light-induced or blue light-induced migration and take-off behavior of the rice leaf folder.

[0102] Example 5 Difference in the expression level of the cryptochrome cry1 gene in the migratory and resident forms of rice leaf folder

[0103] Female adults of rice leaf folders at 2 days old after emergence were collected and placed in a take-off behavior observation device (see CN216135042U for details, a device for distinguishing between migratory take-off and free-diffusion take-off insects) to observe the take-off behavior. The take-off behavior observation device uses a cylindrical take-off cage made of highly transparent PVC film, with a diameter of 50 cm and a height of 120 cm; the bottom is a white plastic plate, and a 500 mL transparent plastic cup is placed in the middle as a take-off platform. The take-off behavior determination method refers to the method of Guo JW, Li P, Zhang J, Liu XD, Zhai BP*, Hu G*. Cnaphalocrocis medinalis moths decide to migrate when suffering nutrient shortage on the first day after emergence. Insects, 2019, 10(10): 364. (such as Figure 1 ). The migration experiment was carried out using full wavelength light as in Example 2.

[0104] Since the rice leaf folder has a strong autonomous flight ability, the take-off behavior from dusk to night may include both migratory take-off and diffusion take-off (including foraging, courtship, egg-laying and reproduction, etc.). Among them, migratory take-off is the focus of this study, so it is necessary to accurately separate these two behaviors. Previous field experiments found that the states of migratory take-off and diffusion take-off are completely different. The migratory take-off behavior of the rice leaf folder can be defined as: spiral vertical ascent, landing point after take-off is more than 100cm above the take-off platform (migratory type). Those who do not take off within 30 minutes after the light intensity decreases to less than 0.1lx, remain motionless, or diffuse in small scale parallel at the bottom, frequently transfer, or fly irregularly are considered invalid take-off individuals (residential type).

[0105] The migratory and resident adults were collected, total RNA was extracted, and cDNA was obtained by reverse transcription. The expression level of cry1 gene was determined by real-time fluorescence quantitative PCR. The fluorescence quantitative PCR process was the same as that in Example 4.

[0106] like Figure 5As shown in the figure, the relative expression of cry1 gene in migratory rice leaf folder is significantly higher than that in resident type, which further indicates that the cryptochrome cry1 gene is related to the migratory behavior of rice leaf folder. Rice leaf folder individuals with high relative expression of cry1 gene are more likely to undergo migratory takeoff. Therefore, when it is necessary to estimate whether rice leaf folder will migrate and take off, the relative expression of cry1 gene of rice leaf folder can be detected. When the relative expression of cry1 gene is large, the probability of migratory takeoff is high, and when the relative expression of cry1 gene is small, the probability of migratory takeoff is low.

[0107] Example 6 The role of the cryptochrome cry1 gene in regulating the migration and take-off behavior of the rice leaf folder

[0108] cry1-RNAi-1 was designed based on the cry1 gene sequence. dsRNA (cry1-RNAi-1) was injected into newly emerged female adults of rice leaf folder by microinjection to silence the expression of the cryptochrome cry1 gene of rice leaf folder. dsGFP was designed using the green fluorescent protein gene (GFP) of Aequorea victoria (GenBank: CAA58789) as an internal control. dsGFP was used instead of cry1-RNAi-1 in the control group.

[0109] Take-off observation experiment was carried out at 2 days old, and the experimental method was the same as in Example 5. The adults of each treatment were collected, total RNA was extracted, and cDNA was obtained by reverse transcription. The expression level of cry1 gene was measured by real-time fluorescence quantitative PCR to determine the silencing efficiency. The fluorescence quantitative PCR process was the same as in Example 4. The sense chain and antisense chain sequences of cry1-RNAi-1 and dsGFP are shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.10, SEQ ID NO.11, respectively:

[0110] SEQ ID NO.2 (cry1-RNAi-1 positive strand):

[0111] taatacgactcactatagggTAGGGGAAAACAGGTTGCGATT;

[0112] SEQ ID NO.3 (cry1-RNAi-1 antisense strand):

[0113] taatacgactcactatagggAATTTGCACACCCACTGCTTC;

[0114] SEQ ID NO.10 (dsGFP positive strand):

[0115] taatacgactcactatagggATGGTGAGCAAGGGCGAGGAG;

[0116] SEQ ID NO.11 (dsGFP antisense strand):

[0117] taatacgactcactatagggCGGATCTTGAAGTTCACCTTG.

[0118] The take-off rates of the migratory rice leaf folder were counted, and statistical analysis was performed to compare the differences in take-off rates between the gene silencing treatments and the control group.

[0119] like Figure 6 As shown in the figure, compared with the control group, the expression of cry1 gene in rice leaf folder was significantly inhibited after microinjection of cry1-RNAi-1, indicating that cry1 gene in rice leaf folder was silenced by cry1-RNAi-1. Figure 7 Compared with the control group, the take-off rate of the rice leaf folder in the cry1-RNAi-1 microinjection group was significantly reduced, which proves that cry1 is involved in regulating the migration and take-off behavior of the rice leaf folder in an environment with reduced light intensity. The migration and take-off behavior of the rice leaf folder can be regulated by regulating the expression of the cry1 gene. For example, according to this embodiment, using cry1-RNAi-1 to silence the cry1 gene can effectively inhibit the migration and take-off of the rice leaf folder.

Claims

1. Use of the cry1 gene in preparing an agent for regulating the migration and take-off behavior of rice leaf folder, characterized in that: The sequence of the cry1 gene is shown as SEQ ID NO.

1.

2. The use according to claim 1, characterized in that The reagent regulates the migration and take-off behavior of the rice leaf folder by interfering with the expression of the cryptochrome cry1 gene of the rice leaf folder.

3. A method for regulating the migration and takeoff of rice leaf folder, characterized in that: The method comprises: regulating the expression of a rice leaf folder cry1 gene, wherein the sequence of the cry1 gene is shown in SEQ ID NO.

1.

4. The method according to claim 3, characterized in that The method further includes: using light to induce the adult rice leaf folder, wherein the light includes light in the blue light band.

5. The method according to claim 4, characterized in that The wavelength of the blue light is 380nm-430nm.

6. The method according to claim 3, characterized in that The method silences the cry1 gene through RNAi technology.

7. The method according to claim 6, characterized in that The method of silencing the cry1 gene by RNAi technology comprises: designing dsRNA according to the cry1 gene sequence, and injecting the dsRNA into the rice leaf folder.

8. The method according to claim 7, characterized in that The dsRNA sequences are shown in SED ID NO.2 and SED ID NO.

3.

9. The method according to claim 3, characterized in that: The rice leaf folder is a female adult of the rice leaf folder.

Images