A primer-probe combination, kit and method for detecting and differentiating porcine parvovirus types 1-8
By designing specific primer probe combinations and establishing a fluorescence quantitative PCR detection system for TaqMan probes, the problem that the existing technology cannot cover 8 pig parvovirus genotypes at the same time is solved, and efficient and accurate detection and identification are achieved, with wide application value.
Patent Information
- Application Number
- CN202411470028.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-21
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2044-10-21
AI Technical Summary
The prior art cannot cover 8 pig parvovirus genotypes at the same time, and lacks detection methods with strong specificity and high sensitivity, making it difficult to effectively identify pig parvoviruses.
Using TaqMan probe fluorescence quantitative PCR technology, a primer probe combination was designed, including detection of forward primers, reverse primers and probes for PPV1-PPV8, and a PPV-qPCR detection system that can cover 8 genotypes at the same time was established, as well as two quadruple qPCR detection systems for identification of specific genotypes.
Fast and accurate detection and identification of porcine parvovirus 1-8 types is achieved, with wide coverage, strong specificity and high sensitivity, and the detection limit for each genotype is 100copies/reaction.
Smart Images

Figure CN119101770B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of biological detection for parvovirus detection, and particularly relates to a primer-probe combination, a kit and a method for detecting and differentiating porcine parvovirus types 1-8. Background Art
[0002] Porcine parvovirus (PPV) belongs to the family Parvoviridae, and the diameter of the virus particles is about 20-22 nm. PPV has no envelope and can replicate autonomously. It is a single-stranded linear DNA virus. The PPV genome is 4-6 Kb in length and has two open reading frames, encoding structural protein VP and non-structural protein NS. In the early 1960s, porcine parvovirus was first discovered in cell culture contaminants in Germany. Subsequently, through etiological research, PPV1 was isolated. At present, new genotypes of PPV have been successively discovered by means of high-throughput sequencing and other technical means at home and abroad. The reported PPV is divided into 8 genotypes according to the gene sequence homology, namely PPV1-PPV8.
[0003] Porcine parvovirus is a common pathogen causing reproductive disorders in pigs, with strong infectivity and environmental resistance. After infection with PPV, it will cause malformed fetuses, mummified fetuses, etc. in first-parity sows. In severe cases, the sow will abort, resulting in the death of embryos and fetuses. Some studies have shown that PPV is also related to porcine non-suppurative myocarditis, dermatitis, enteritis and viremia, etc. Porcine parvovirus often co-infects and cross-infects with porcine circovirus type 2 (PCV-2), pseudorabies virus (PRV), etc., jointly causing porcine multisystem diseases. For example, infection with PPV will enhance the postweaning multisystem wasting syndrome caused by PCV-2. The infection of PPV is widespread in farms at home and abroad, seriously affecting and restricting the development of the pig industry and causing huge economic losses to the pig industry.
[0004] In addition, PPV can grow and reproduce on almost all primary porcine cells and porcine kidney subcultured cells. In the production process of biological products, related raw materials of porcine origin such as trypsin are often used. In the General Principles of Biological Products of the Chinese Pharmacopoeia, "Preparation and Quality Control of Animal Cell Substrates for the Production and Verification of Biological Products", it is pointed out that if trypsin is used in the establishment or passage history of the cell substrate before the producer constructs the cell bank, the established MCB or WCB and (or) cells exceeding the production limit level should be tested for exogenous viruses related to the animal from which trypsin is derived at least once, including porcine parvovirus or bovine parvovirus. The detection methods of porcine parvovirus include cell method, hemadsorption method, immunofluorescence method, real-time fluorescence quantitative PCR molecular detection technology, etc. The cell method is complex in operation and time-consuming, the hemadsorption method is cumbersome in operation and relatively low in sensitivity, and the immunofluorescence method requires high instrument requirements. Real-time fluorescence quantitative PCR (TaqMan probe method) has the advantages of strong specificity, high sensitivity, simplicity and rapidity, and is widely used in virus detection. At present, the existing technology cannot provide a detection method that can simultaneously cover 8 genotypes of porcine parvovirus, has strong specificity, high sensitivity, and can identify 8 porcine parvoviruses. Summary of the Invention
[0005] Aiming at the problems existing in the prior art, the present invention provides a primer-probe combination for detecting and identifying porcine parvovirus types 1-8. Based on the TaqMan probe fluorescence quantitative PCR technology, the present method establishes a PPV-qPCR detection system that can simultaneously cover 8 genotypes. At the same time, two quadruple qPCR detection systems are respectively established to identify the PPV genotype, which has the characteristics of wide coverage, strong specificity, and high sensitivity. The specific implementation is as follows through the following technical solutions:
[0006] In the first aspect of the present invention, a primer-probe combination for detecting and identifying porcine parvovirus types 1-8 is provided, which includes forward primers, reverse primers, and probes for detecting PPV1-PPV8; the nucleotide sequences of the forward primers of PPV1-PPV8 are respectively shown in SEQ ID NO.1-8, the nucleotide sequences of the reverse primers of PPV1-PPV8 are respectively shown in SEQ ID NO.9-16, and the nucleotide sequences of the probes of PPV1-PPV8 are respectively shown in SEQ ID NO.17-24. In the nucleotide sequences, the degenerate base Y represents C or T, and R represents A or G;
[0007] The 5' ends of the 8 probes are respectively coupled with fluorescent groups, and the 3' ends are respectively coupled with quenching groups. Specifically, the 5' ends of the probes of PPV1-PPV8 are respectively coupled with a first fluorescent group, a second fluorescent group, a third fluorescent group, a fourth fluorescent group, a fifth fluorescent group, a sixth fluorescent group, a seventh fluorescent group, and an eighth fluorescent group. The above fluorescent groups can be the same or different.
[0008] Further, the fluorescent group is selected from any one of FAM, Texas Red, CY3, CY5, VIC, TET, NED, ROX, JOE or HEX fluorescent groups; the quenching group is selected from any one of TAMRA, NFQ, ECLIPSE, DABCYL, MGB, BHQ1 or BHQ2 quenching groups.
[0009] In the second aspect of the present invention, a kit is provided, which contains the above primer-probe combination, and also includes ProbeMaster Mix, RNase-free water, negative control, positive control, sensitivity control and no-template control;
[0010] The negative control is PBS buffer, the positive control is one of the virus solutions of PPV1 - PPV8, the sensitivity control is one of the plasmid standards of PPV1 - PPV8, and the no-template control is RNase-free water.
[0011] It should be noted that the positive control is a virus solution obtained by diluting one of PPV1 - PPV8 with PBS buffer.
[0012] It should be noted that in the above kit, the sensitivity control varies according to the use of the kit; when the kit is used to detect whether infected with PPV1 - PPV8, the sensitivity control is selected from one of the plasmid standards of pUC57 - PPV1 to pUC57 - PPV8; when the kit is used to identify PPV1 - PPV8, then 8 plasmid standards of PPV pUC57 - PPV1 to pUC57 - PPV8 are selected as the sensitivity controls for each PPV genotype; its function is to monitor the effectiveness of the qPCR reaction and detect whether abnormal experimental materials such as enzymes and primers affect the detection results, and it is a control that must be set during the detection of test samples in the pharmacopoeia. The difference from the positive control is that the positive control participates in extraction and qPCR to monitor the entire detection process.
[0013] Further, the above kit also includes an applicability control, an internal control plasmid and a corresponding internal control probe; the applicability control is a mixture of the positive control and the test sample, the nucleotide sequence of the target fragment of the internal control plasmid is as shown in SEQ ID NO.26, the nucleotide sequence of the internal control probe is as shown in SEQ ID NO.25, the 5' end of the internal control probe is coupled with a ninth fluorescent group different from the fluorescent group, and the 3' end is coupled with a quenching group.
[0014] It should be noted that in the above kit, the applicability control is to add the same virus solution as the positive control to the test sample, and its function is to monitor whether there are qPCR inhibitors in the test sample that inhibit the detection of porcine parvovirus types 1 - 8, so as to avoid false negative detection results.
[0015] It should be noted that the internal control plasmid and the corresponding internal control probe are used to monitor the PCR inhibition phenomenon in the sample to be tested.
[0016] It should be noted that the ninth fluorescent group is selected from any one of the fluorescent groups of FAM, Texas Red, CY3, CY5, VIC, TET, NED, ROX, JOE or HEX; the quenching group is selected from any one of the quenching groups of TAMRA, NFQ, ECLIPSE, DABCYL, MGB, BHQ1 or BHQ2.
[0017] In the third aspect of the present invention, there is provided the use of the above primer-probe combination in the preparation of a kit for detecting and / or differentiating porcine parvovirus types 1-8.
[0018] In the fourth aspect of the present invention, there is provided the use of the above primer-probe combination or the above kit in detecting and / or differentiating porcine parvovirus types 1-8.
[0019] In the fifth aspect of the present invention, there is provided the use of the above primer-probe combination in detecting and / or differentiating porcine parvovirus types 1-8 by TaqMan probe fluorescence quantitative PCR.
[0020] In the sixth aspect of the present invention, there is provided a TaqMan probe fluorescence quantitative PCR detection method for porcine parvovirus types 1-8 of the above primer-probe combination;
[0021] It should be noted that when the above primer-probe combination is used to detect whether it is infected with porcine parvovirus types 1-8, the 5' end of the probes of PPV1-PPV8 is coupled with a first fluorescent group, and the first fluorescent group is selected from any one of the fluorescent groups of FAM, Texas Red, CY3, CY5, VIC, TET, NED, ROX, JOE or HEX;
[0022] It includes the following steps:
[0023] (1) Take the DNA of the sample to be tested, the negative control, the positive control, the applicability control, the sensitivity control and the template-free control, dilute the sensitivity control to a predetermined concentration, and respectively prepare qPCR working solutions;
[0024] (2) Add the DNA of the sample to be tested, the negative control, the positive control, the applicability control, the sensitivity control and the template-free control to the qPCR reaction system containing Probe Master Mix, internal control probe, internal control plasmid, RNase-free water and the forward primer, reverse primer and probe of PPV1-PPV8;
[0025] (3)Create the first fluorophore detection channel and the ninth fluorophore detection channel on the real-time fluorescence quantitative PCR instrument, perform qPCR reactions on the test sample, negative control, positive control, applicability control, sensitivity control, and no-template control respectively, read the Ct values of the first fluorophore detection channel and the ninth fluorophore detection channel respectively, and determine the test validity and the test results of the test sample based on the Ct values;
[0026] The criteria for judging the test validity are as follows:
[0027] No-template control: There are no Ct values in both the first fluorophore detection channel and the ninth fluorophore detection channel, and there is no obvious amplification curve.
[0028] Sensitivity control: There are obvious amplification curves in both the first fluorophore detection channel and the ninth fluorophore detection channel, and the Ct value < 38.
[0029] Negative control: There is no Ct value in the first fluorophore detection channel and no obvious amplification curve; there is an obvious amplification curve in the ninth fluorophore detection channel, and the Ct value < 38.
[0030] Positive control: There is an obvious amplification curve in the first fluorophore detection channel, and the Ct value ≤ 35; there is an obvious amplification curve in the ninth fluorophore detection channel, and the Ct value < 38.
[0031] Applicability control: There is an obvious amplification curve. If the Ct value increases, the difference from the Ct value of the positive control is within 3 Ct values.
[0032] As an example of the criteria for judging the test validity, the first fluorophore detection channel is the FAM channel, and the ninth fluorophore detection channel is the HEX channel, as follows:
[0033] No-template control: There are no Ct values in both the FAM channel and the HEX channel, and there is no obvious amplification curve.
[0034] Sensitivity control: There are obvious amplification curves in both the FAM channel and the HEX channel, and the Ct value < 38.
[0035] Negative control: There is no Ct value in the FAM channel and no obvious amplification curve; there is an obvious amplification curve in the HEX channel, and the Ct value < 38.
[0036] Positive control: There is an obvious amplification curve in the FAM channel, and the Ct value ≤ 35; there is an obvious amplification curve in the HEX channel, and the Ct value < 38.
[0037] Applicability control: There is an obvious amplification curve. If the Ct value increases, the difference from the Ct value of the positive control is within 3 Ct values.
[0038] The criteria for judging the test results of the test sample are shown in Table 1 below.
[0039] Table 1 Judgment criteria for PPV qPCR detection results
[0040]
[0041] The seventh aspect of the present invention provides a TaqMan probe fluorescence quantitative PCR discrimination method for porcine parvovirus types 1-8 using the above primer-probe combination;
[0042] It should be noted that when the above primer-probe combination is applied to discriminate porcine parvovirus types 1-8, the first fluorescent group, the second fluorescent group, the third fluorescent group, and the fourth fluorescent group coupled to the 5'-ends of the probes of PPV1-PPV4 are four different fluorescent groups, and the fifth fluorescent group, the sixth fluorescent group, the seventh fluorescent group, and the eighth fluorescent group coupled to the 5'-ends of the probes of PPV5-PPV8 are four different fluorescent groups;
[0043] It includes the following steps:
[0044] (1) Take the DNA of the test sample, the negative control, the positive control, the sensitivity control, and the no-template control, dilute the sensitivity control to a predetermined concentration, and respectively prepare qPCR working solutions;
[0045] (2) Establish two qPCR reaction systems, namely the PPV1-PPV4 quadruple qPCR reaction system and the PPV5-PPV8 quadruple qPCR reaction system;
[0046] Respectively add the DNA of the test sample, the negative control, the positive control, the sensitivity control, and the no-template control to the PPV1-PPV4 quadruple qPCR reaction system containing Probe Master Mix, RNase-free water, and the forward primers, reverse primers, and probes of PPV1-PPV4;
[0047] Respectively add the DNA of the test sample, the negative control, the positive control, the sensitivity control, and the no-template control to the PPV5-PPV8 quadruple qPCR reaction system containing Probe Master Mix, RNase-free water, and the forward primers, reverse primers, and probes of PPV5-PPV8;
[0048] Create a first fluorescent group detection channel, a second fluorescent group detection channel, a third fluorescent group detection channel, and a fourth fluorescent group detection channel on a fluorescence quantitative PCR instrument, perform PPV1-PPV4 qPCR reactions on the test sample, the negative control, the positive control, the sensitivity control, and the no-template control respectively, read the Ct values of the first fluorescent group detection channel to the fourth fluorescent group detection channel respectively, and perform test validity determination and determination of the test results of the test sample;
[0049] Create the fifth, sixth, seventh, and eighth fluorescence group detection channels on the fluorescence quantitative PCR instrument, and perform PPV5 - PPV8 qPCR reactions on the sample to be tested, negative control, positive control, sensitivity control, and template - free control respectively. Read the Ct values of the fifth to eighth fluorescence group detection channels respectively, and determine the test validity and the detection result of the sample to be tested based on the Ct values;
[0050] The criteria for determining the test validity are as follows:
[0051] The negative control has no Ct value and no obvious amplification curve; and the Ct value of the positive control ≤ 35 has an obvious amplification curve; and the sensitivity control has an obvious amplification curve and the Ct value < 38; and the template - free control has no Ct value and no obvious amplification curve; then it is determined that this test is valid; otherwise, it is determined that this test is invalid.
[0052] Furthermore, the first fluorescence group is FAM, the second fluorescence group is HEX, the third fluorescence group is CY5, the fourth fluorescence group is Texas Red, the fifth fluorescence group is HEX, the sixth fluorescence group is FAM, the seventh fluorescence group is Texas Red, the eighth fluorescence group is CY5, and the ninth fluorescence group is HEX; the quenching group of PPV1 is BHQ1, the quenching group of PPV2 is BHQ1, the quenching group of PPV3 is MGB, the quenching group of PPV4 is MGB, the quenching group of PPV5 is MGB, the quenching group of PPV6 is BHQ1, the quenching group of PPV7 is MGB, and the quenching group of PPV8 is MGB.
[0053] The criteria for determining the detection result of the sample to be tested are shown in Table 2 below.
[0054] Table 2 Criteria for determining the results of quadruple qPCR detection
[0055]
[0056] Compared with the prior art, the beneficial effects of the present invention are:
[0057] 1. Using the primer - probe combination provided by the present invention for fluorescence quantitative PCR, it can quickly determine whether porcine parvovirus exists in the sample according to the Ct value and the amplification curve, and can simultaneously detect porcine parvovirus of 8 genotypes, with a wide coverage range.
[0058] 2. It has strong specificity and shows no cross-reactivity with the genomes of common engineering cells such as PK-15, 293, CHO-K1, Vero, and common porcine pathogens such as PCV-2 and PRV.
[0059] 3. It has high sensitivity, and the detection limit for each PPV genotype is 100 copies / reaction.
[0060] 4. The two quadruple qPCR detection systems couple different fluorescent groups through probes, enabling the identification of the specific PPV genotype infected in the test sample. Description of the Drawings
[0061] Figure 1 For the standard curves and linearity of the plasmid standards of PPV1 - PPV8 in Example 3;
[0062] Figure 2 For the specificity verification results of the PPV qPCR detection system in Example 4;
[0063] Figure 3 For the standard curves and linearity of the PPV1 - PPV4 quadruple qPCR reaction system in Example 5;
[0064] Figure 4 For the standard curves and linearity of the PPV5 - PPV8 quadruple qPCR reaction system in Example 5;
[0065] Figure 5 For the discrimination verification results of PPV in Example 6. Detailed Implementation Modes
[0066] The technical solutions of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of them. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts belong to the scope of protection of the present invention.
[0067] The detection primers used in the following examples were all synthesized by Wuhan Tianyi Huiyuan Biotechnology Co., Ltd., and the probes, internal control probes, and internal control plasmids of PPV1 - PPV8 were all synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0068] Unless otherwise specified, the technical solutions adopted in the following examples are all conventional molecular biology techniques. The human-derived cells (such as human embryonic kidney cells 293), monkey-derived cell lines (such as African green monkey kidney cells Vero), hamster-derived cell lines (such as Chinese hamster ovary cells CHO-K1), and porcine-derived cell lines (such as porcine kidney cells PK-15) used were all stored by the company. The porcine parvovirus PPV1 - PPV8 used were all stored by the company.
[0069] Optionally, when the internal control plasmid is added to the qPCR reaction system, the concentration of the internal control plasmid is 1000 copies / μL.
[0070] Unless otherwise specified, all reagents (such as qPCR reaction solution, reagents in the nucleic acid extraction system, various buffers, etc.), all reagent kits and technical solutions used in the following examples are commercially available reagents, reagent kits, and are completed by conventional molecular biology techniques in the industry.
[0071] Example 1: Synthesis of primers and probes
[0072] 1. Design and synthesis of PPV1 - PPV8 primers and probes
[0073] Download the genomes of PPV1 - PPV8 from NCBI, perform sequence alignment, and design primers and probes that can specifically detect and identify each genotype of PPV. Among them, the primers are synthesized by Tianyi Huiyuan, and the purification method is PAGE purification; the probes are synthesized by Sangon Biotech, and the purification method is HPLC purification. The sequences are shown in Table 3 below.
[0074] Table 3 Nucleotide sequences of primer - probe combinations
[0075]
[0076] 2. Synthesis of internal control plasmid and probe sequence
[0077] Manually synthesize the target fragment of the internal control plasmid and construct the recombinant plasmid pUC57 - IC. Add this plasmid as a template to the PPV qPCR detection system. The nucleotide sequence of the target fragment is as shown in SEQ ID NO.26, specifically: ctacaacaaagatacaacagatgcggctatgccggtgcctagcttaacaccaacttgcctaggtgctagagcctcacaaaacggcaagt. The corresponding nucleotide sequence of the internal control probe is as shown in SEQ ID NO.25, specifically: ccggtgcctagcttaacacc.
[0078] Example 2: Establishment of PPV qPCR detection system
[0079] Synthesize the pUC57 - IC recombinant plasmid and measure its concentration. Calculate the copy number of the pUC57 - IC plasmid according to Formula 1, and dilute it to 1000 copies / μL for standby.
[0080] Use AceQ Universal U from Novizan +Probe Master Mix V2, configure the PPV qPCR detection reaction system according to Table 4 below, and perform two-channel qPCR according to the reaction program in Table 5 below. The detection targets of the detection channels are PPV and the internal control plasmid respectively.
[0081] It should be noted that the fluorescent group coupled to the 5' end of the probes for PPV1-PPV8 is the same fluorescent group, which is the first fluorescent group; the fluorescent group coupled to the 5' end of the corresponding internal control probe of the internal control plasmid is the ninth fluorescent group.
[0082] Formula 1:
[0083] Copy number (copies / μL)
[0084] Table 4 PPV-qPCR detection reaction system
[0085]
[0086] Table 5 PPV qPCR reaction program
[0087]
[0088] Example 3: Verification of the linearity and sensitivity of the PPV qPCR detection system
[0089] Synthesize 8 kinds of PPV genomic sequences artificially and construct recombinant plasmids to prepare standards, establish a standard curve, artificially construct 8 PPV plasmid standards (pUC57-PPV1, pUC57-PPV2, pUC57-PPV3, pUC57-PPV4, pUC57-PPV5, pUC57-PPV6, pUC57-PPV7, pUC57-PPV8) and the internal control plasmid standard pUC57-IC. Use the Plasmid MiniKit I kit (OMEGA, D6943-02) to extract the plasmid standards, measure the plasmid concentration, calculate the plasmid copy number, and dilute to 2×10 6 copies / μL - 2×10 2 copies / μL as each point of the standard curve. Use the 2×10 1 copies / μL PPV plasmid standard solution as the plasmid sensitivity control, and add 500 copies of the pUC57-IC plasmid standard to each reaction as the internal control of the reaction system.
[0090] Perform qPCR using the amplification systems and procedures in Tables 3 and 4, and conduct 3 independent repeated experiments on different 3 days. Each experiment repeats the plasmid sensitivity control 8 wells.
[0091] The detection results show that in the PPV-qPCR detection reaction system of this solution, 8 kinds of PPV plasmid standards are used as templates respectively, and the linear correlation coefficient R 2 >0.99, and the plasmid sensitivity reaches 100 copies / reaction. The experimental results are shown in Table 6 and Figure 1 .
[0092] Table 6 Detection results of PPV plasmid standards
[0093]
[0094] Thus, the following PPV qPCR detection method can be established:
[0095] It should be noted that when the above primer-probe combination is used to detect the infection of porcine parvovirus types 1-8, the 5' ends of the probes of PPV1-PPV8 are conjugated with the first fluorescent group, and the 5' end of the internal control probe is conjugated with the ninth fluorescent group;
[0096] It includes the following steps:
[0097] (1) Take the DNA of the test sample, negative control, positive control, applicability control, sensitivity control and no-template control, dilute the sensitivity control to a predetermined concentration, and prepare qPCR working solutions respectively;
[0098] (2) Add the DNA of the test sample, negative control, positive control, applicability control, sensitivity control and no-template control to the qPCR reaction system containing Probe Master Mix, internal control probe, internal control plasmid, RNase-free water and forward primers, reverse primers and probes of PPV1-PPV8 respectively;
[0099] (3) Create a first fluorescent group detection channel and a ninth fluorescent group detection channel on the fluorescence quantitative PCR instrument, perform qPCR reactions on the test sample, negative control, positive control, applicability control, sensitivity control and no-template control respectively, read the Ct values of the first fluorescent group detection channel and the ninth fluorescent group detection channel respectively, and judge the test validity and the detection results of the test sample;
[0100] The criteria for judging the test validity are:
[0101] No-template control: There are no Ct values in both the first fluorescent group detection channel and the ninth fluorescent group detection channel, and there is no obvious amplification curve.
[0102] Sensitivity control: There are obvious amplification curves in both the first fluorescent group detection channel and the ninth fluorescent group detection channel, and the Ct value < 38.
[0103] Negative control: There is no Ct value in the first fluorophore detection channel, and there is no obvious amplification curve; there is an obvious amplification curve in the ninth fluorophore detection channel, and the Ct value < 38.
[0104] Positive control: There is an obvious amplification curve in the first fluorophore detection channel, and the Ct value ≤ 35; there is an obvious amplification curve in the ninth fluorophore detection channel, and the Ct value < 38.
[0105] Applicability control: There is an obvious amplification curve. If the Ct value increases, the difference from the Ct value of the positive control is within 3 Ct values.
[0106] As an example of the test validity determination standard, the first fluorophore detection channel is the FAM channel, and the ninth fluorophore detection channel is the HEX channel, as follows:
[0107] No-template control: There is no Ct value in both the FAM channel and the HEX channel, and there is no obvious amplification curve.
[0108] Sensitivity control: There are obvious amplification curves in both the FAM channel and the HEX channel, and the Ct value < 38.
[0109] Negative control: There is no Ct value in the FAM channel, and there is no obvious amplification curve; there is an obvious amplification curve in the HEX channel, and the Ct value < 38.
[0110] Positive control: There is an obvious amplification curve in the FAM channel, and the Ct value ≤ 35; there is an obvious amplification curve in the HEX channel, and the Ct value < 38.
[0111] Applicability control: There is an obvious amplification curve. If the Ct value increases, the difference from the Ct value of the positive control is within 3 Ct values.
[0112] The determination standard for the test results of the sample to be tested is shown in Table 1.
[0113] Example 4 Specificity Verification of the PPV qPCR Detection Method
[0114] 1. Extraction of Genomic DNA from Each Biological Cell
[0115] (1) Genomic DNA of Human and Animal Cells
[0116] Porcine kidney cells PK-15, African green monkey kidney cells Vero, Chinese hamster ovary cells CHO-K1, and human embryonic kidney cells 293 are all stored in our company, and genomic DNA is extracted using QIAamp ® Mini kit (50) (QIAGEN, 51304).
[0117] (2) Viral Genomic DNA
[0118] Porcine circovirus PCV-2 and pseudorabies virus PRV are both preserved by our company, and genomic DNA is extracted using the Viral Nucleic Acid purification kit (simgen, 4002050).
[0119] 2. Preparation of genomic DNA at working concentration
[0120] The concentrations of the above-mentioned cell and virus genomic DNA were measured using a micro-spectrophotometer. According to the measured concentrations, the genomic DNA of human and animal cells was diluted to 20 ng / μL with RNase-free Water. For the viruses PCV-2 and PRV, 5 μL of the virus solution with a physical titer of 10 8 copies / mL was taken to extract DNA and used as a template for qPCR. The pUC57-PPV1 plasmid standard at 100 copies / reaction was used as the qPCR sensitivity control.
[0121] The qPCR reaction system and program were the same as those in Table 4 and Table 5 above.
[0122] The results are as Figure 2 shown. The PPV qPCR detection system showed no cross-reaction with the genomes of common engineering cells and common porcine viruses PCV-2 and PRV. The summary of the amplification of non-PPV genomic DNA is shown in Table 7.
[0123] Table 7 Specificity of PPV
[0124]
[0125] Example 5: Verification of the linearity and sensitivity of the PPV quadruple qPCR system
[0126] Eight PPV plasmid standards (pUC57-PPV1, pUC57-PPV2, pUC57-PPV3, pUC57-PPV4, pUC57-PPV5, pUC57-PPV6, pUC57-PPV7, pUC57-PPV8) were respectively diluted to 2×10 6 copies / μL - 2×10 2 copies / μL as each point of the standard curve, and the 2×10 1 copies / μL PPV plasmid standard solution was used as the sensitivity control.
[0127] The qPCR was performed using the amplification systems in Table 8 and Table 9 and the reaction program in Table 5 respectively. Three independent replicate experiments were carried out on different 3 days, and the plasmid sensitivity control was repeated 8 wells each time.
[0128] Among them, the first to fourth fluorescent groups coupled to the 5' ends of the probes of PPV1-PPV4 are four different fluorescent groups, and the fifth to eighth fluorescent groups coupled to the 5' ends of the probes of PPV5-PPV8 are four different fluorescent groups.
[0129] The detection results show that when the PPV1-PPV4 quadruple qPCR reaction system uses the PPV1-PPV4 plasmid standards as templates respectively, and the PPV5-PPV8 quadruple qPCR reaction system uses the PPV5-PPV8 plasmid standards as templates respectively, the linear correlation coefficient R 2 > 0.99, and the plasmid sensitivity reaches 100 copies / reaction. The experimental results are shown in Figure 3 、 Figure 4 and Table 10.
[0130] Table 8 PPV1-PPV4 quadruple qPCR reaction system
[0131]
[0132] Table 9 PPV5-PPV8 quadruple qPCR reaction system
[0133]
[0134] Table 10 Detection results of PPV standards in the quadruple qPCR system
[0135]
[0136] Thus, the following PPV quadruple qPCR discrimination method can be established:
[0137] It should be noted that when the above primer-probe combinations are applied to the discrimination of porcine parvovirus types 1-8, the first fluorescent group, the second fluorescent group, the third fluorescent group, and the fourth fluorescent group coupled to the 5' ends of the probes of PPV1-PPV4 are four different fluorescent groups, and the fifth fluorescent group, the sixth fluorescent group, the seventh fluorescent group, and the eighth fluorescent group coupled to the 5' ends of the probes of PPV5-PPV8 are four different fluorescent groups;
[0138] It includes the following steps:
[0139] (1) Take the DNA of the test sample, negative control, positive control, sensitivity control, and template-free control, dilute the sensitivity control to a predetermined concentration, and prepare qPCR working solutions respectively;
[0140] (2) Establish 2 qPCR reaction systems, namely the PPV1-PPV4 quadruple qPCR reaction system and the PPV5-PPV8 quadruple qPCR reaction system;
[0141] Add the DNA of the sample to be tested, negative control, positive control, sensitivity control, and no-template control to the PPV1-PPV4 multiplex qPCR reaction system containing Probe Master Mix, RNase-free water, and the forward primer, reverse primer, and probe of the said PPV1-PPV4 respectively;
[0142] Add the DNA of the sample to be tested, negative control, positive control, sensitivity control, and no-template control to the PPV5-PPV8 multiplex qPCR reaction system containing Probe Master Mix, RNase-free water, and the forward primer, reverse primer, and probe of the said PPV5-PPV8 respectively;
[0143] Create the first fluorophore detection channel, the second fluorophore detection channel, the third fluorophore detection channel, and the fourth fluorophore detection channel on the fluorescence quantitative PCR instrument, perform PPV1-PPV4 qPCR reactions on the sample to be tested, negative control, positive control, sensitivity control, and no-template control respectively, read the Ct values of the first fluorophore detection channel to the fourth fluorophore detection channel respectively, and conduct the determination of the test validity and the determination of the detection result of the sample to be tested;
[0144] Create the fifth fluorophore detection channel, the sixth fluorophore detection channel, the seventh fluorophore detection channel, and the eighth fluorophore detection channel on the fluorescence quantitative PCR instrument, perform PPV5-PPV8 qPCR reactions on the sample to be tested, negative control, positive control, sensitivity control, and no-template control respectively, read the Ct values of the fifth fluorophore detection channel to the eighth fluorophore detection channel respectively, and conduct the determination of the test validity and the determination of the detection result of the sample to be tested;
[0145] The criteria for determining the test validity are as follows:
[0146] The negative control has no Ct value and no obvious amplification curve; and the Ct value of the positive control ≤ 35 has an obvious amplification curve; and the sensitivity control has an obvious amplification curve and the Ct value < 38; and the no-template control has no Ct value and no obvious amplification curve; then it is determined that this test is valid; otherwise, it is determined that this test is invalid;
[0147] The criteria for determining the detection result of the sample to be tested are shown in Table 2.
[0148] Example 6: Identification and verification of PPV1-8
[0149] Using 8 kinds of pUC57-PPV plasmid standards as templates, detect PPV1, PPV2, PPV3, PPV4, PPV5, PPV6, PPV7, and PPV8 respectively by using the qPCR reaction systems in Tables 8 and 9 and the amplification program in Table 5.
[0150] The results are as Figure 5 shown. In the PPV1-PPV4 quadruple qPCR detection system, the FAM channel only amplifies PPV1, the HEX channel only amplifies PPV2, the Texas Red channel only amplifies PPV4, and the Cy5 channel only amplifies PPV3. In the PPV5-PPV8 quadruple qPCR detection system, the FAM channel only amplifies PPV6, the HEX channel only amplifies PPV5, the Texas Red channel only amplifies PPV7, and the Cy5 channel only amplifies PPV8. This indicates that the two quadruple qPCR reaction systems can rapidly and accurately identify porcine parvovirus genotypes 1-8.
[0151] Example 7: Application example of the PPV detection method
[0152] (1) Inspection of PPV in trypsin
[0153] According to the production process of trypsin, porcine trypsin usually comes from a mixture of various enzymes extracted from porcine tissues. Trypsin is widely used for the passage of adherent cells. To avoid the risk of contamination by porcine-derived viruses introduced by the use of trypsin, the PPV qPCR method in this protocol was used to inspect trypsin for PPV to determine whether there is PPV contamination. For the DNA extraction of the following samples, the Viral Nucleic Acid purification kit (Simgen, 4002050) was used to extract the DNA kit, and the operation can be carried out according to the product manual. The specific method is as follows:
[0154] Negative control: Take 200 μL of PBS;
[0155] Test sample: Take 200 μL of trypsin as the test sample and extract DNA;
[0156] Positive control: Take 200 μL of PPV1 serially diluted to 10 2 PFU / mL with PBS as the positive control and extract DNA;
[0157] Applicability control: Take 200 μL of the mixture of the positive control and the test sample and extract DNA;
[0158] No-template control: RNase-free water;
[0159] Sensitivity control: Take the plasmid standard pUC57-PPV1 serially diluted to 20 copies / μL, and take 5 μL as the template, that is, 100 copies / reaction of PPV1 as the sensitivity control.
[0160] The reaction system and procedure are the same as those in Tables 4 and 5.
[0161] The detection results are shown in Table 11: According to the PPV qPCR detection result judgment criteria in Table 1, it is determined that there is no PPV contamination in this pancreatin.
[0162] Table 11 Detection Results
[0163]
[0164] The result judgment criteria of the above PPV qPCR detection method are as shown in Table 1.
[0165] Test validity:
[0166] The following requirements need to be met simultaneously in the same experiment; otherwise, this experiment is invalid.
[0167] No-template control: There is no Ct value in both the FAM channel and the HEX channel, and there is no obvious amplification curve.
[0168] Sensitivity control: There are obvious amplification curves in both the FAM channel and the HEX channel, and the Ct value < 38.
[0169] Negative control: There is no Ct value in the FAM channel and no obvious amplification curve; there is an obvious amplification curve in the HEX channel, and the Ct value < 38.
[0170] Positive control: There is an obvious amplification curve in the FAM channel, and the Ct value ≤ 35; there is an obvious amplification curve in the HEX channel, and the Ct value < 38.
[0171] Applicability control: There is an obvious amplification curve. If the Ct value increases, the difference from the Ct value of the positive control is within 3 Ct values.
[0172] The sample detection result judgment criteria are as shown in Table 1.
[0173] (2)Identification of PPV contamination in 293T cells
[0174] Use the PPV1-PPV4 and PPV5-PPV8 quadruple qPCR in this protocol to examine 293T cells artificially contaminated with PPV1 to determine the PPV contamination genotype. For the DNA extraction of the following samples, use the Viral Nucleic Acid purification kit (Simgen, 4002050) DNA extraction kit and operate according to the product instructions. The specific method is as follows:
[0175] Negative control: Take 200 μL of PBS as the negative control;
[0176] Test sample: Take 10 6 293T cells and add 200 μL of PBS gradient diluted to 10 2The PPV1 virus solution at PFU / mL was used as the test sample, and DNA was extracted.
[0177] Positive control: Take 200 μL and dilute it stepwise with PBS to 10 2 PFU / mL of PPV1 was used as the positive control, and DNA was extracted.
[0178] No-template control: RNase-free water.
[0179] Sensitivity control: Take 8 PPV plasmid standards and dilute them stepwise to 20 copies / μL. Take 5 μL as the template, that is, PPV1 - PPV8 at 100 copies / reaction were used as the sensitivity controls for each PPV genotype.
[0180] The reaction system was the same as in Tables 8 and 9, and the procedure was the same as in Table 5.
[0181] The test results are shown in Table 12: According to the judgment standard in Table 2, it was determined that the 293T cells were contaminated with PPV1 and there was no PPV2 - PPV8.
[0182] Table 12 Results of quadruple qPCR detection
[0183]
[0184] The result judgment standard for the above quadruple qPCR discrimination method is as follows:
[0185] Test validity:
[0186] The following requirements need to be met simultaneously in the same experiment; otherwise, this experiment is invalid.
[0187] 1) No-template control: No Ct value, no obvious amplification curve.
[0188] 2) Sensitivity control: There is an obvious amplification curve, and the Ct value < 38.
[0189] 3) Negative control: No Ct value, no obvious amplification curve.
[0190] 4) Positive control: There is an obvious amplification curve, and the Ct value ≤ 35.
[0191] The result judgment standard for sample detection is shown in Table 2.
Claims
1. A primer-probe combination for detecting and identifying porcine parvovirus types 1-8, characterized in that: The primer-probe combination comprises a forward primer, a reverse primer and a probe for detecting or / and identifying PPV1-PPV8; the nucleotide sequences of the forward primers of PPV1-PPV8 are respectively shown as SEQ ID NO.1-8, the nucleotide sequences of the reverse primers of PPV1-PPV8 are respectively shown as SEQ ID NO.9-16, the nucleotide sequences of the probes of PPV1-PPV8 are respectively shown as SEQ ID NO.17-24, and the degenerate base Y in the nucleotide sequences represents C or T, and R represents A or G; the 5' ends of the 8 probes are respectively coupled with fluorescent groups, and the 3' ends are respectively coupled with quenching groups; It also includes an internal control probe, the nucleotide sequence of which is shown in SEQ ID NO.25, the 5' end of the internal control probe is coupled with a ninth fluorescent group different from the fluorescent group, and the 3' end of the internal control probe is coupled with a quenching group.
2. The primer-probe combination for detecting and identifying porcine parvovirus types 1-8 according to claim 1, characterized in that: The fluorescent group of the PPV1-PPV8 probe is selected from any one of FAM, Texas Red, CY3, CY5, VIC, TET, NED, ROX, JOE or HEX fluorescent groups; the quenching group is selected from any one of TAMRA, NFQ, ECLIPSE, DABCYL, MGB, BHQ1 or BHQ2 quenching groups.
3. A kit, characterized in that: A primer-probe combination according to claim 1, further comprising ProbeMaster Mix, RNase-free water, a negative control, a positive control, a sensitivity control, and a no-template control; The negative control is PBS buffer, the positive controls are PPV1-PPV8 virus liquid, the sensitivity controls are PPV1-PPV8 plasmid standards, and the no-template control is RNase-free water.
4. The kit according to claim 3, characterized in that It also includes a suitability control and an internal control plasmid; the suitability control is a mixture of the positive control and the sample to be tested, and the nucleotide sequence of the target fragment of the internal control plasmid is shown in SEQ ID NO.
26.
5. Use of the primer-probe combination according to claim 1 in preparing a kit, characterized in that: The kit is used for detecting and / or identifying porcine parvovirus types 1-8.
6. Use of the primer-probe combination of claim 1 or the kit of claim 3 or claim 4 in detecting or / and identifying porcine parvovirus types 1-8 for purposes other than disease diagnosis and treatment.
7. Use of the primer-probe combination of claim 1 in detecting or / and identifying porcine parvovirus types 1-8 using TaqMan probe fluorescent quantitative PCR for purposes other than disease diagnosis and treatment.
8. A method for detecting porcine parvovirus type 1-8 using TaqMan probe fluorescent quantitative PCR using the kit of claim 4 for purposes other than disease diagnosis and treatment, characterized in that: The 5' ends of the probes PPV1-PPV8 are all coupled with a first fluorescent group; The following steps are involved: (1) taking DNA of the sample to be tested, the negative control, the positive control, the suitability control, the sensitivity control and the no-template control, diluting the sensitivity control to a predetermined concentration, and preparing them into qPCR working solutions respectively; (2) Add the DNA of the test sample, negative control, positive control, suitability control, sensitivity control and no-template control to the qPCR reaction system containing Probe Master Mix, internal control probe, internal control plasmid, RNase-free water and the forward primer, reverse primer and probe of PPV1-PPV8; (3) Create a first fluorescent group detection channel and a ninth fluorescent group detection channel on a fluorescent quantitative PCR instrument, perform qPCR reactions on the test sample, negative control, positive control, suitability control, sensitivity control and no-template control, respectively, read the Ct values of the first fluorescent group detection channel and the ninth fluorescent group detection channel, and determine the validity of the test and the test results of the test sample based on the Ct values; The criteria for judging the effectiveness of the test are: No template control: There is no Ct value in the first fluorescent group detection channel and the ninth fluorescent group detection channel, and no obvious amplification curve; Sensitivity control: Both the first fluorescent group detection channel and the ninth fluorescent group detection channel have obvious amplification curves, and the Ct value is <38; Negative control: the first fluorescent group detection channel has no Ct value and no obvious amplification curve; the ninth fluorescent group detection channel has an obvious amplification curve and the Ct value is <38; Positive control: the first fluorescent group detection channel has an obvious amplification curve, and the Ct value is ≤35; the ninth fluorescent group detection channel has an obvious amplification curve, and the Ct value is <38; Suitability control: There is an obvious amplification curve. If the Ct value increases, the difference with the positive control Ct value is within 3 Ct values; The criteria for judging the test results of the samples to be tested are: When the Ct of the first fluorescent group detection channel of the sample to be tested is less than 40 and there is a normal amplification curve, the porcine parvovirus detection result is determined to be positive; When the first fluorescent group detection channel of the sample to be tested has no Ct value and no normal amplification curve, and the ninth fluorescent group detection channel has an obvious amplification curve and the Ct value is less than 38, the porcine parvovirus detection result is determined to be negative; When the first fluorescent group detection channel and the ninth fluorescent group detection channel of the sample to be tested have no Ct value and no normal amplification curve; or when the first fluorescent group detection channel has a Ct ≥ 40 and a normal amplification curve, and the ninth fluorescent group detection channel has no Ct value and no obvious amplification curve, it is determined that the qPCR reaction is inhibited; When the Ct of the first fluorescent group detection channel of the sample to be tested is ≥40 and has a normal amplification curve, and the Ct of the ninth fluorescent group detection channel is <38 and has an obvious amplification curve, the result is determined to be invalid.
9. A method for identifying porcine parvovirus by TaqMan probe fluorescent quantitative PCR using the kit of claim 3, which is not for the purpose of disease diagnosis and treatment, characterized in that: The 5' ends of the PPV1-PPV4 probes are coupled with the first fluorescent group, the second fluorescent group, the third fluorescent group, and the fourth fluorescent group, respectively, which are four different fluorescent groups; the 5' ends of the PPV5-PPV8 probes are coupled with the fifth fluorescent group, the sixth fluorescent group, the seventh fluorescent group, and the eighth fluorescent group, respectively, which are four different fluorescent groups; The following steps are involved: (1) taking DNA of the sample to be tested, the negative control, the positive control, the sensitivity control and the no-template control, diluting the sensitivity control to a predetermined concentration, and preparing them into qPCR working solutions respectively; (2) Establish two qPCR reaction systems, namely the PPV1-PPV4 quadruple qPCR reaction system and the PPV5-PPV8 quadruple qPCR reaction system; The DNA of the sample to be tested, the negative control, the positive control, the sensitivity control and the no-template control were respectively added to the PPV1-PPV4 quadruple qPCR reaction system containing ProbeMaster Mix, RNase-free water and the forward primer, reverse primer and probe of PPV1-PPV4; The DNA of the sample to be tested, the negative control, the positive control, the sensitivity control and the no-template control were respectively added to the PPV5-PPV8 quadruple qPCR reaction system containing ProbeMaster Mix, RNase-free water and the forward primer, reverse primer and probe of the PPV5-PPV8; Create a first fluorescent group detection channel, a second fluorescent group detection channel, a third fluorescent group detection channel, and a fourth fluorescent group detection channel on a fluorescent quantitative PCR instrument, perform PPV1-PPV4 qPCR reactions on the sample to be tested, the no-template control, the negative control, and the positive control, respectively, read the Ct values of the first fluorescent group detection channel to the fourth fluorescent group detection channel, respectively, and determine the validity of the test and the test result of the sample to be tested based on the Ct values; Create a fifth fluorescent group detection channel, a sixth fluorescent group detection channel, a seventh fluorescent group detection channel, and an eighth fluorescent group detection channel on a fluorescent quantitative PCR instrument, perform PPV5-PPV8 qPCR reactions on the sample to be tested, the no-template control, the negative control, and the positive control, respectively, read the Ct values of the fifth fluorescent group detection channel to the eighth fluorescent group detection channel, respectively, and determine the validity of the test and the test result of the sample to be tested based on the Ct values; The criteria for judging the effectiveness of the test are: If the negative control has no Ct value and no obvious amplification curve; and the positive control has a Ct value ≤ 35 and has an obvious amplification curve; and the sensitivity control has an obvious amplification curve and a Ct value < 38; and the no-template control has no Ct value and no obvious amplification curve; then the test is determined to be valid; otherwise, the test is determined to be invalid; The criteria for judging the test results of the samples to be tested are: When in the PPV1-PPV4 qPCR reaction, the Ct value of the first fluorescent group detection channel and / or the second fluorescent group detection channel and / or the third fluorescent group detection channel and / or the fourth fluorescent group detection channel of the sample to be tested is <40 and there is an obvious amplification curve, the corresponding PPV1 and / or PPV2 and / or PPV3 and / or PPV4 detection results of the sample to be tested are determined to be positive; When in the PPV1-PPV4 qPCR reaction, the Ct value of the first fluorescent group detection channel and / or the second fluorescent group detection channel and / or the third fluorescent group detection channel and / or the fourth fluorescent group detection channel of the sample to be tested is ≥40 and there is an obvious amplification curve, the test result is determined to be invalid; When in the PPV1-PPV4 qPCR reaction, the first fluorescent group detection channel and / or the second fluorescent group detection channel and / or the third fluorescent group detection channel and / or the fourth fluorescent group detection channel of the sample to be tested has no Ct value and no obvious amplification curve, the detection result of PPV1 and / or PPV2 and / or PPV3 and / or PPV4 of the sample to be tested is determined to be negative; When in the PPV5-PPV8 qPCR reaction, the Ct value of the fifth fluorescent group detection channel and / or the sixth fluorescent group detection channel and / or the seventh fluorescent group detection channel and / or the eighth fluorescent group detection channel of the sample to be tested is <40 and there is an obvious amplification curve, then the corresponding PPV5 and / or PPV6 and / or PPV7 and / or PPV8 detection results of the sample to be tested are determined to be positive; When in the PPV5-PPV8 qPCR reaction, the Ct value of the fifth fluorescent group detection channel and / or the sixth fluorescent group detection channel and / or the seventh fluorescent group detection channel and / or the eighth fluorescent group detection channel of the sample to be tested is ≥40 and there is an obvious amplification curve, the test result is determined to be invalid; When in the PPV5-PPV8 qPCR reaction, the fifth fluorescent group detection channel and / or the sixth fluorescent group detection channel and / or the seventh fluorescent group detection channel and / or the eighth fluorescent group detection channel of the sample to be tested has no Ct value and no obvious amplification curve, the detection results of PPV5 and / or PPV6 and / or PPV7 and / or PPV8 of the sample to be tested are determined to be negative.
Citation Information
Patent Citations
Primer, probe group and kit for dual fluorescent quantitative PCR (polymerase chain reaction) detection of porcine parvovirus type 4 and porcine parvovirus type 6
CN114908189A