Radionuclide-labeled PD-L1 targeting small protein as well as preparation method and application thereof

Abstract

The invention provides a radionuclide-labeled PDL1 targeting small protein as well as a preparation method and application thereof. Specifically, the invention provides a radionuclide-labeled PD-L1 targeted small protein probe and a preparation method thereof, and the radionuclide-labeled PD-L1 targeted small protein probe is used for diagnosis of malignant tumors, accurate positioning of focuses, curative effect monitoring and radioimmunotherapy. The small protein conjugate provided by the invention can be prepared by labeling in a temperature range from room temperature to 60 DEG C, and compared with other nuclides or linkers, the coupling efficiency is higher, and the finished product is more stable.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a radionuclide-labeled small protein targeting PD L1 and a preparation method and application thereof. Background Art

[0002] Programmed death protein 1 (PD-1) / ligand (PD-L1) is expressed to varying degrees in a variety of malignant tumors, including non-small cell lung cancer, triple-negative breast cancer, gastric cancer, esophageal cancer, glioma, and malignant melanoma. Immunotherapy of the anti-PD-1 / PD-L1 pathway has shown very good application prospects in the treatment of advanced solid tumors and has become an important means of tumor treatment, but it also shows certain limitations in the application process. It is generally believed that high PD-L1 expression levels are associated with the positive response rate of cancer treatment and the clinical benefit of anti-PD-1 / anti-PD-L1 treatment. Therefore, it is of great significance to screen patients according to the expression level of PD-L1 in the lesion site before treatment to select patients who have a positive response to this treatment method. Accurate assessment of the PD-L1 status of tumor patients is the key to improving the efficacy. In addition, there are problems of recurrence and drug resistance in the process of targeted therapy, so the realization of individualized and precise tumor treatment will become the most noteworthy issue in tumor targeted diagnosis and treatment.

[0003] Functional imaging with positron emission tomography (PET) and single photon emission computed tomography (SPECT) has advantages in the diagnosis and treatment of tumors. By tracing changes in receptors in diseased tissues and abnormalities in cell signal transduction, it provides a basis for early diagnosis, clinical staging, and efficacy evaluation of tumors, and can also be used to evaluate prognosis. It can also be used in targeted tumor treatment.

[0004] Several studies have shown that PET / SPECT molecular imaging targeting PD-L1 can be used for tumor lesion imaging and can be used to screen patients who respond to anti-PD-1 / anti-PD-L1 immunotherapy. PET imaging technology uses molecular probes targeting PD-L1 to non-invasively, in real time, and quantitatively detect PD-L1 expression in tumor patients, thus providing a possibility for screening patients suitable for anti-PD-1 / PD-L1 pathway tumor immunotherapy and monitoring efficacy.

[0005] Tumor radioimmunoassay is the use of specific antibodies or fragments of them directed against tumor-associated antigens with diagnostic radionuclides, such as 18 F. 45 Ti, 52 Fe, 62 Cu,64 Cu, 67 Ga, 68 Ga, 86 Y. 89 Zr, 94 Tc, 99m Tc, 111 ln, 124 I. 186 Re, 189 Re, 211 After being labeled with At, it is injected into the human body, flows through the blood to the tumor tissue, and combines with the tumor-related antigens, so that the local radioactivity concentration in the tumor tissue exceeds that of normal tissue. Then, nuclear medicine imaging equipment is used to qualitatively and position the primary lesion and systemic metastasis, especially to find hidden lesions that are difficult to identify with other diagnostic techniques. During the decay process, α or β radionuclides can release α rays or β rays, which have a strong ionizing radiation effect and have a strong killing effect on tumor cells or abnormal proliferating tissues. Nuclear therapy refers to the use of radioactive nuclides with therapeutic effects, such as 32 P. 47 Sc, 67 Cu, 77 As, 90 Y. 89 Sr. 105 Rh, 111 Ag, 123 I. 125 I. 131 I. 142 Pr, 153 Sm, 166 Ho, 169 2. 175 Lu, 177 Lu, 188 Re, 194 lr, 198 Au, 199 Au, 211 Pb, 212 Bi, 212 Pb, 213 Bi, 223 Ra, 225 Ac and other radionuclides or labeled drugs can accurately kill diseased cells and tissues at close range to achieve the purpose of treatment.

[0006] However, due to the large molecular weight of traditional monoclonal antibodies (~150kDa), radionuclide-labeled antibodies are cleared very slowly in the body, resulting in a high radioactive background in normal tissues, which not only significantly reduces the tumor / non-tumor ratio (i.e., imaging contrast), but also increases the possibility of radiation damage to normal tissues.

[0007] Therefore, there is an urgent need to develop more PET and SPECT probes targeting PD-L1 with high specificity and sensitivity, which can realize rapid, non-invasive, real-time and quantitative detection of PD-L1 expression in systemic lesions in tumor patients, obtain systemic in vivo quantitative information that cannot be obtained by conventional laboratory PD-L1 testing, and provide auxiliary detection methods for clinical PD-1 / PD-L1 immunotherapy patient screening, efficacy monitoring and other aspects. Summary of the invention

[0008] The purpose of the present invention is to provide a radionuclide-labeled small protein targeting PD L1 and a preparation method and application thereof.

[0009] In a first aspect of the present invention, a radionuclide conjugate is provided, wherein the radionuclide conjugate comprises:

[0010] (a) a small protein targeting PD-L1, wherein the amino acid sequence of the small protein is shown in SEQ ID NO.: 3; and

[0011] (b) a coupling moiety, wherein the coupling moiety is a radionuclide.

[0012] In another preferred embodiment, the radionuclide is a diagnostic or therapeutic radionuclide.

[0013] In another preferred embodiment, the radionuclide is selected from the following group:

[0014] 18 F. 99m Tc and 177 Lu.

[0015] In another preferred embodiment, the radionuclide is 18 F.

[0016] In another preferred embodiment, the small protein and the coupling part are connected via a linker.

[0017] In another preferred embodiment, the linker is selected from: a polypeptide, a small molecule compound or a combination thereof.

[0018] In another preferred embodiment, the linker is a tricarbonyl compound.

[0019] In another preferred embodiment, the linker is a chelator of radionuclide.

[0020] In another preferred embodiment, the radionuclide chelator is selected from the following group:

[0021] DOTA(1,4,7,10-tetraazacyclododecane-1,4,7,10-tetracetic acid);

[0022] DOTP(di-2-ethylhexyl terephthalate);

[0023] DTPA(NR-diethylenetriaminepentacetic acid);

[0024] CB-DO2A(4,10-bis(carboxymethyl)-1,4,7,10-tetraazabicyclo[5.5.2]tetradecane);

[0025] DO3A(1,4,7,10-tetraazacyclo dodecane);

[0026] NOTA(1,4,7-triazacyclononane-1,4,7-acetic acid);

[0027] NODGA(1,4,7-triazacyclononane,1-glutaric acid-4,7-acetic acid);

[0028] NO2A(1,4,7-triazacyclononane);

[0029] ΝΕΤΑ({4-[2-(bis-carboxymethylamino)-ethyl]-7-carboxymethyl-[1,4,7]triazonan-1-yl}-acetic acid);

[0030] DFO / df(derferoxamine);

[0031] TRITA(1,4,7,10-tetraazacyclotridecane-N,N',N",N'"-tetraacetic acid);

[0032] TETA(1,4,8,11-tetraazacyclotetradecane-N,N',N",N'"-tetraacetic acid);

[0033] ATSM(diacetyl-bis(N4-methylthiosemicarbazone));

[0034] HETA(1,5,9,13-tetraazacyclohexadecane-N,N',N",N'"-tetraacetic acid);

[0035] EDTA(ethylenediaminetetraacetic acid);

[0036] TACN-TM(N,N′,N″,tris(2-mercaptoethyl)1,4,7-triazacyclononane);

[0037] HBED-CC(N,N'-bis-[2-hydroxy-5-(carboxyethyl)benzyl]ethylenediamine-N,N'-diacetic acid);

[0038] TPEN(N,N,N',N'-Tetrakis(2-pyridylmethyl)ethylenediamine);

[0039] BAPTA-AM(O,O'-Bis(2-aminophenyl)ethyleneglycol-N,N,N',N'-tetraaceticacid,tetraacetoxymethyl ester);

[0040] TRAP(1,4,7-triazacyclononane-1,4,7-tris[methyl(2-carboxyethyl)phosphinic acid]);

[0041] THP(tris(hydroxypyridinone));

[0042] RESCA((±)H3RESCA-Mal);

[0043] CP256;

[0044] PCTA(3,6,9,15-tetraazabicyclo[9.3.1]pentadeca-1(15),11,13-triene-3,6,9,-triacetic acid);

[0045] PTSM(Methyl p-toluenesulfonate);

[0046] Cyclen(1,4,7,10-tetraazacyclododecane);

[0047] Porphyrins, polyamines, crown ethers, dithiosemicarbazides, polyoximes and their derivatives.

[0048] In another preferred embodiment, the linker is selected from the following group: tricarbonyl compounds, THP, RESCA, NOTA, and DFO.

[0049] In another preferred embodiment, the conjugate contains: a multivalent (eg, bivalent) small protein. The multivalent refers to the small protein containing multiple repetitions in the amino acid sequence of the conjugate.

[0050] In another preferred embodiment, the radionuclide conjugate has a structure as shown in the following formula I:

[0051] RL-Nb1(I)

[0052] in,

[0053] Nb1 is a small protein that targets PD-L1;

[0054] L is the connector;

[0055] R is a radionuclide.

[0056] In another preferred embodiment, the radionuclide conjugate has a structure selected from the following group:

[0057] 99m Tc(CO)3(H2O)3-Nb1;

[0058] 68 Ga-THP-Nb1;

[0059] 68 Ga-NOTA-Nb1;

[0060] 18 F-RESCA-Nb1;

[0061] 177 Lu-DOTA-Nb1; and

[0062] in,

[0063] 99m Tc, 68 Ga, 18 F and 177 Lu is a radionuclide;

[0064] Nb1 is the small protein targeting PD-L1;

[0065] (CO)3(H2O)3 is the tricarbonyl compound intermediate;

[0066] THP, RESCA, NOTA, DOTA are chelating agents as described above.

[0067] In another preferred embodiment, the conjugate is used for detecting PD-L1 expression in the prognosis and diagnosis of cancer.

[0068] In another preferred embodiment, the detection is in vivo detection.

[0069] In another preferred embodiment, the conjugate is used to treat or prevent tumors expressing PD-L1 protein (i.e., PD-L1 positive).

[0070] In the second aspect of the present invention, a PD-L1 protein detection reagent is provided, wherein the detection reagent comprises the conjugate as described in the first aspect of the present invention and a carrier acceptable in detection.

[0071] In another preferred embodiment, the detection reagent is one or more reagents selected from the following group: isotope tracers, contrast agents, flow cytometry detection reagents, cell immunofluorescence detection reagents, nanomagnetic particles and imaging agents.

[0072] In another preferred embodiment, the detection agent is a contrast agent, and the contrast agent also includes other agents used for contrast.

[0073] In another preferred embodiment, the contrast agent is a contrast agent used for MRI (magnetic resonance imaging) or CT (computer tomography).

[0074] In another preferred embodiment, the detection reagent is used for in vivo detection.

[0075] In another preferred embodiment, the dosage form of the detection reagent is a liquid dosage form.

[0076] In the third aspect of the present invention, a pharmaceutical composition is provided, comprising the conjugate as described in the first aspect of the present invention and a pharmaceutically acceptable carrier.

[0077] In another preferred embodiment, the pharmaceutical composition further contains other drugs for treating tumors, such as cytotoxic drugs.

[0078] In another preferred embodiment, the pharmaceutical composition is used to treat or prevent tumors expressing PD-L1 protein (i.e., PD-L1 positive).

[0079] In another preferred embodiment, the tumor includes: gastric cancer, lymphoma, liver cancer, leukemia, kidney tumor, lung cancer, small intestine cancer, bone cancer, prostate cancer, colorectal cancer, breast cancer, colon cancer, prostate cancer, or adrenal tumor.

[0080] In another preferred embodiment, the pharmaceutical composition is in the form of an injection.

[0081] In the fourth aspect of the present invention, a kit for detecting PD-L1 molecules is provided, wherein the kit contains the conjugate as described in the first aspect of the present invention or the PD-L1 protein detection reagent as described in the second aspect of the present invention.

[0082] In another preferred embodiment, the kit further comprises an instruction manual, which states that the kit is used for non-invasively detecting the expression of PD-L1 in a subject to be tested.

[0083] In another preferred embodiment, the kit is used for detecting tumors expressing PD-L1 protein (ie, PD-L1 positive).

[0084] In the fifth aspect of the present invention, there is provided a use of the conjugate as described in the first aspect of the present invention for preparing (a) a detection reagent, a detection kit or a detection plate for detecting PD-L1 molecules in vivo; (b) a pharmaceutical composition for treating or preventing tumors expressing PD-L1 protein (i.e., PD-L1 positive).

[0085] In another preferred embodiment, the conjugate is used to prepare a contrast agent for detecting PD-L1 molecules in vivo.

[0086] In the sixth aspect of the present invention, a conjugate precursor is provided, wherein the conjugate precursor comprises a small protein targeting PD-L1 with an amino acid sequence as shown in SEQ ID NO: 3; and a linker portion.

[0087] In another preferred embodiment, the linker is selected from: a polypeptide, a small molecule compound or a combination thereof.

[0088] In another preferred embodiment, the linker is a chelator of radionuclide.

[0089] In another preferred embodiment, the linker is selected from the following group: tricarbonyl compounds, THP, RESCA, and NOTA.

[0090] In the seventh aspect of the present invention, there is provided a method for preparing the radionuclide conjugate as described in the first aspect of the present invention, the method comprising the steps of:

[0091] Under appropriate conditions, the conjugate precursor as described in the sixth aspect of the present invention is reacted with a radionuclide to obtain the radionuclide conjugate.

[0092] In another preferred embodiment, the suitable conditions include:

[0093] i) 0-60°C temperature conditions; and / or

[0094] ii) pH 4.0-6.0.

[0095] In another preferred embodiment, the radionuclide labeling efficiency of the method is ≥95%, preferably ≥99%.

[0096] In the eighth aspect of the present invention, a method for treating a disease is provided, the method comprising administering the conjugate as described in the first aspect of the present invention or the pharmaceutical composition as described in the third aspect of the present invention to a subject in need thereof.

[0097] In another preferred embodiment, the subject includes mammals, such as humans.

[0098] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0099] The following drawings are used to illustrate specific embodiments of the present invention and are not used to limit the scope of the present invention defined by the claims.

[0100] Figure 1 Shown is a schematic diagram of the synthesis of a small protein targeting PD-L1 labeled with radionuclides

[0101] Figure 2 Radio-TLC assay is shown 18 The labeling rate of F-RESCA-Nb1 was consistent with the radiochemical purity and in vitro stability.

[0102] Figure 3 Shows 18 Metabolic imaging of F-RESCA-Nb1 in normal mice.

[0103] Figure 4 Shows 18 F-RESCA-Nb1 was imaged in KM mice injected with humanized PDL1 and murine PDL1. The humanized PDL1 site is indicated by a yellow circle, and the murine PDL1 site is indicated by a white circle.

[0104] Figure 5 Shows 18 Imaging results of F-RESCA-Nb1 in A549-PDL1 negative model mice. The tumor location is indicated by the white circle. DETAILED DESCRIPTION

[0105] After extensive and in-depth research, the inventors have provided a small protein targeting PD-L1 labeled with radionuclides, and a preparation method and application thereof. The present invention couples a small protein targeting PD-L1 with a radionuclide with ultra-high affinity, and utilizes the characteristics of the small protein that has a smaller molecular weight than traditional antibodies and better tumor penetration to construct a tumor PD-L1 expression tracer probe. Experiments have shown that the PD-L1 expression tracer probe of the present invention can accurately locate PD-L1 positive tumors in animals. The present invention was completed on this basis.

[0106] The present invention has modified the sequence of the existing ultra-high affinity small protein targeting PD-L1, and added a specially designed sequence at its C-terminus. This not only retains the ultra-high affinity of the small protein for PD-L1, but also enables it to be efficiently coupled with the maleimide group of Mal-RESCA to obtain the product 18 After purification, the radiochemical purity of F-RESCA-Nb1 reached over 99%.

[0107] In particular, the small protein conjugate of the present invention 18 F-RESCA-Nb1 can be prepared by labeling at room temperature up to 60°C and can be used with other nuclides or linkers (such as 89 Compared with Zr-DFO, the coupling efficiency is higher and the finished product is more stable.

[0108] the term

[0109] In order to more easily understand the present invention, some technical and scientific terms are specifically defined below. Unless otherwise clearly defined in this article, all other technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art to which the present invention belongs. Before describing the present invention, it should be understood that the present invention is not limited to the specific methods and experimental conditions described, because such methods and conditions can be changed. It should also be understood that the terms used herein are intended only to describe specific embodiments, and are not intended to be restrictive, and the scope of the present invention will be limited only by the appended claims.

[0110] As used herein, when used in reference to a specific recited numerical value, the term "about" means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0111] As used herein, the terms "comprise", "include", and "contain" are used interchangeably and include not only closed definitions, but also semi-closed and open definitions. In other words, the terms include "consisting of", "consisting essentially of".

[0112] High-affinity small protein targeting PD-L1

[0113] The radionuclide conjugate of the present invention comprises a small high-affinity protein targeting PD-L1.

[0114] The main advantages of high-affinity small proteins over monoclonal antibodies are:

[0115] (1) It has the characteristics of high affinity and high specificity. Compared with peptides, its affinity is 10 to 100 times higher and close to that of monoclonal antibodies;

[0116] (2) Immunogenicity and toxicity are very low, and it is not as prone to adhesion as scFv;

[0117] (3) It has good tissue penetration and can fully bind to the target organ or targeted tumor tissue;

[0118] (4) The relative molecular mass is small, and the unbound part can be cleared quickly through the kidneys, reducing the background interference in the blood;

[0119] (5) This high-affinity small protein can be used for labeling at room temperature or at temperatures up to 60°C or above.

[0120] (6) Modern genetic engineering technology can be used to obtain high-yield protein probes, and their structures can also be transformed or modified, which is more conducive to molecular-level imaging detection.

[0121] Radionuclides

[0122] Small proteins are conjugated with tricarbonyl compounds or bifunctional chelators such as DOTA (1,4,7,10-tetraazacyclododecane-1,4,7,10-tetracetic acid), DOTP (di-2-ethylhexylterephthalate), DTPA (NR-diethylenetriaminepentacetic acid), CB-DO2A (4,10-bis(carboxymethyl)-1,4,7,10-tetraazabicyclo[5.5.2]tetradecane), DO3A (1,4,7,10-tetraazacyclo dodecane), NOTA (1,4,7-triazacyclononane-1,4,7-acetic acid), NODGA (1,4,7-triazacyclononane,1-glutaric acid-4,7-acetic acid), NO2A (1,4,7-triazacyclononane), ΝΕΤΑ ({4-[2-(bis-carboxymethylamino)-ethyl]-7-carboxymethyl-[1,4,7]triazonan-1-yl}-ac etic acid), DFO / df (derferoxamine), TRITA (1,4,7,10-tetraazacyclotridecane-N,N',N",N'"-tetraacetic acid), TETA (1,4,8,11-tetraazacyclotetradecane-N,N',N",N'"-tetraacetic acid), ATSM (diacetyl-bis(N4-methylthiosemicarbazone)), HETA (1,5,9,13-tetraazacyclohexadecane-N,N',N",N'"-tetraacetic acid), EDTA (ethylenediaminetetraacetic acid), TACN-TM (N,N′,N″,tris(2-mercaptoethyl)1,4,7-triazacyclononane), HBED-CC (N,N'-bis-[2-hydroxy-5-(carboxyethyl)benzyl]ethylenediamine-N,N'-diacetic acid), TPEN (N,N,N',N'-Tetrakis(2-pyridylmethyl)ethylenediamine),BAPTA-AM(O,O'-Bis(2-aminophenyl)ethyleneglycol-N,N,N',N'-tetraacetic acid,tetraacetoxymethylester), TRAP(1,4,7-triazacyclononane-1,4,7-tris[methyl(2-carboxyethyl)phosphinic acid]),CP256, PCTA(3,6,9,15-tetraazabicyclo[9.3.1]pentadeca-1(15),11,13-triene-3,6,9,-triacetic acid),PTSM(Methyl p-toluenesulfonate), Cyclen (1,4,7,10-tetraazacyclododecane), THP (tris (hydroxypyridinone)), RESCA ((±) H3RESCA-Mal), porphyrin, polyamine, crown ether, dithiosemicarbazide, polyoxime and its derivatives can be modified to perform diagnostic radionuclides, 99m Tc, 68 Ga, 18 F or therapeutic nuclide 177 Lu et al.

[0123] 99m Tc is the most widely used single-photon nuclide. 99 Mo- 99m The SPECT examination can be prepared by a Tc generator, and the cost of SPECT examination is low and easy to promote.

[0124] 68 Ga is a widely used positron-emitting radionuclide. 68 Ga by 68 Ge- 68 Ga generator preparation, convenient source, 68 Ga is easy to coordinate with the compound, and the labeling operation method is relatively simple; compared with the cyclotron, the elution labeling 68 The amount of Ga radioactivity is relatively small, which facilitates quality control at any time; and 68 Ga has a short half-life and can diagnose diseases non-invasively and in real time, obtaining whole-body metabolic images.

[0125] As an ideal PET radionuclide, 68 Compared with Ga(T1 / 2=68min), 18F has a longer half-life (T1 / 2 = 109 min). And 18 F is prepared by an accelerator, which is more suitable for batch preparation of multiple patients and is also more suitable for the development of automated synthesis preparation methods.

[0126] 90 Y and 177 Lu is a beta radionuclide, 90 Y has higher energy (2280keV) and stronger penetration ability (12mm), and has a stronger killing effect on tumor cells or abnormal proliferation tissues. 90 Compared with Y, 177 Lu can emit β rays (0.5MeV) with a small ion range, which can not only ensure that the radiation energy is transmitted to the tumor area, but also reduce the damage to the surrounding normal tissues.

[0127] In one embodiment, the conjugate of the invention comprises a radionuclide 18 F.

[0128] Conjugates of the present invention

[0129] As used herein, the terms "radionuclide conjugate", "radionuclide conjugate of the present invention", "conjugate of the present invention", and "PD-L1 expression tracing probe" are used interchangeably and all refer to the radionuclide conjugate of the first aspect of the present invention.

[0130] The radionuclide conjugate of the present invention contains:

[0131] (a) a small protein targeting PD-L1, wherein the amino acid sequence of the small protein is shown in SEQ ID NO.: 3; and

[0132] (b) a coupling moiety, wherein the coupling moiety is a radionuclide.

[0133] In another preferred embodiment, the radionuclide is a diagnostic or therapeutic radionuclide.

[0134] In another preferred embodiment, the radionuclide is selected from the following group: 18 F. 99m Tc and 177 Lu.

[0135] In another preferred embodiment, the small protein and the coupling part are connected via a linker; preferably, the linker is selected from THP, RESCA, and NOTA shown above.

[0136] In another preferred embodiment, the radionuclide conjugate has a structure selected from the following group:

[0137] 99m Tc(CO)3(H2O)3-Nb1;

[0138] 68 Ga-THP-Nb1;

[0139] 68 Ga-NOTA-Nb1;

[0140] 18 F-RESCA-Nb1;

[0141] 177 Lu-DOTA-Nb1

[0142] in,

[0143] 99m Tc, 68 Ga, 18 F. 177 Lu is a radionuclide;

[0144] Nb1 is the small protein targeting PD-L1;

[0145] (CO)3(H2O)3 is a tricarbonyl compound as described above;

[0146] THP, RESCA, NOTA are chelating agents as described above.

[0147] In another preferred embodiment, the radionuclide conjugate has a structure such as 18 F-RESCA-Nb1 is shown.

[0148] Method for preparing conjugate

[0149] Depending on the type of radionuclide to be labeled, the labeling of the radionuclide may include the following steps:

[0150] (1) 99m Tc-labeled PD-L1 targeting Nb1 method:

[0151] Add 5 mg Na2CO3, 10 mg NaBH4, and 15 mg potassium sodium tartrate to a 10 mL penicillin vial, add 1 mL of normal saline, shake well, evacuate with a 10 mL disposable syringe, pass carbon monoxide gas, exhaust the air in the bottle, and then inject 2 mL of Na 99 The mTcO4 eluate (about 13 mCi) was heated in an 80°C oil bath for 30 min (carbon monoxide gas was passed during the reaction), and then cooled to obtain the intermediate [ 99m Tc(CO)3(H2O)3] + Prepare the small protein Nb1 to a concentration of 1 mg / mL, take 200 μL and add 1 mL (about 2-3 mCi) of the prepared 99mTc(CO)3(H2O)3, adjust pH to 8 with hydrochloric acid, place in 80℃ oil bath for 30min, then add 1mL 0.8M NaOH solution for 30min, after the reaction, adjust pH to acidity with 1M HCl, distill under reduced pressure, dissolve in appropriate amount of methanol; add 0.22μm microporous filter membrane, add 2.0mL physiological saline to the system, filter the product into a sterile vacuum bottle, and obtain the product radioactive [ 99m Tc] 99m Tc(CO)3(H2O)3-Nb1; preferably obtained [ 99m Tc] 99m The radiochemical purity of Tc(CO)3(H2O)3-Nb1 is greater than 95%;

[0152] (2) 68 Ga-labeled PD-L1 targeting Nb1 method:

[0153] ① 68 Ga-labeled THP-Nb1

[0154] The precursor THP-Nb1 (200 μg) with a concentration of 2 to 3 mg / mL was quickly dissolved and then 300 μL of 2.0 mol / L sodium acetate solution was added. Then 1 mL 68 Ga eluent (259-740MBq), reaction system pH = 5.0-6.5, mix well and place at 0-60℃ for 15min. Add 0.22μm microporous filter membrane, add 2.0mL physiological saline to the system, filter the product into a sterile vacuum bottle, and obtain the product radioactivity. 68 Ga-THP-Nb1; preferably obtained 68 The radiochemical purity of Ga-THP-Nb1 is greater than 95%;

[0155] ② 68 Ga-labeled NOTA-Nb1

[0156] Elute with 4 mL 0.05 M HCl 68 Ge / 68 Ga generator, use 1.5mL EP tube to receive the eluent, and transfer the middle 1mL of eluent to another new 1.5mL EP tube. Add 65μL (1.0M) sodium acetate solution and 200μg NOTA-Nb1 to the above EP tube, mix well, the reaction system pH = 4.0-5.0; place at 0-60℃ to react for 15min. After the reaction solution is purified by PD-10 column, add 0.22μm microporous filter membrane, add 2.0mL of physiological saline to the system, filter the product into a sterile vacuum bottle, and obtain the target product 68 Ga-NOTA-Nb1, preferably obtained 68The radiochemical purity of Ga-NOTA-Nb1 is greater than 95%;

[0157] (3) 18 F-labeled PD-L1 targeting Nb1 method:

[0158] 100 μL of saline 18 F eluent (about 1110MBq) was reacted with 4μL 2mmol / L AlCl3 solution for 5min, 11μL KHP (pH=4.0) solution was added, and about 100μL RESCA-Nb1 solution was added. The pH of the reaction system was 4.6-4.8. The reaction solution was evenly divided into three parts, and the reaction temperature was 37℃, 60℃, and 80℃ for comparative experiments; the reaction time was 15min, and the reaction time was appropriately shortened, but not less than 12min. Purification was performed using a molecular exclusion column PD-10, and 1-2mL of physiological saline was added to the purified product. After mixing, it was filtered into a sterile vacuum bottle with a 0.22μm sterile needle filter to obtain 18 F-RESCA-Nb1, preferably obtained 18 The radiochemical purity of F-RESCA-Nb1 is greater than 95%;

[0159] (4) 177 Lu-labeled PD-L1 targeting Nb1 method:

[0160] 100 μL NaAc / HAc (pH=5.5) solution was added to the labeled precursor DOTA-Nb1 / NOTA-Nb1, and 370 MBq 177 LuCl3 solution, react at 37℃ for 30min. Separate and purify with molecular exclusion column PD-10, add 1-2mL physiological saline after purification, mix well and filter into a sterile vacuum bottle with a 0.22μm sterile needle filter to obtain 177 Lu-DOTA-Nb1, preferably obtained 177 The radiochemical purity of Lu-DOTA-Nb1 was greater than 95%.

[0161] The main advantages of the present invention include:

[0162] (1) The preparation process of the nuclide protein probe of the present invention is simple, easy to operate, short in time, high in labeling rate, and stable in labeling, which is convenient for further application in clinical practice, scientific research, and drug development.

[0163] (2) The present invention provides a visualization tool for detecting PD-L1 expression in tumors and monitoring therapeutic effects, which can be used for screening, treatment prediction and therapeutic effect monitoring of patients with PD-L1 positive tumors.

[0164] (3) The radioactive labeled probe of the present invention is a small protein labeled compound with small molecular weight, low immunogenicity, good tissue penetration ability and high affinity for tumor tissue.

[0165] (4) The present invention has been found through screening that small protein conjugates 18 F-RESCA-Nb1 can be prepared by labeling at room temperature up to 60°C and can be used with other nuclides or linkers (such as 89 Compared with Zr-DFO, the coupling efficiency is higher and the finished product is more stable.

[0166] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0167] Example 1 Expression and purification of small protein Nb1 targeting PD-L1

[0168] (1) Plasmid synthesis

[0169] The E. coli expression vector used in this study was pET29b. The following nucleotide sequence (SEQ ID NO: 2) was selected and inserted into the two restriction sites of NdeI and XhoI to construct a recombinant plasmid using a conventional method. MSG was added to the N-terminus of the sequence, where M is the start codon; the GSCGSENLYFQSLEHHHHHH (SEQ ID NO: 5) sequence was added to the C-terminus of the sequence, where the ENLYFQS sequence (SEQ ID NO: 6) was used as a restriction site, and the HHHHHH (SEQ ID NO: 7) tag could be used for nickel column protein purification.

[0170] High affinity small protein amino acid sequence targeting PD-L1 (SEQ ID NO: 1)

[0171] DRERARELARILLKVIKLSDSPEARRQLLRNLEELAEKYKDPEVRRILEE AERYIK

[0172] High affinity small protein nucleotide sequence targeting PD-L1 (SEQ ID NO: 2)

[0173] GATCGTGAACGTGCGCGTGAATTAGCGCGTATCCTGCTGAAAGTGATTAAACTGAGCGATAGCCCGGAAGCGCGTCGTCAGTTACTGCGTAATCTGGAGGAACTGGCGGAAAAGTATAAAGATCCGGAAGTGCGTCGTATTCTGGAAGAAGCGGAACGTTATATCAAA

[0174] The amino acid sequence (SEQ ID NO: 3) is as follows:

[0175] MSGDRERARELARILLKVIKLSDSPEARRQLLRNLEELAEKYKDPEVRRILEEAERYIKGSCGSENLYFQSLEHHHHHH

[0176] The nucleotide sequence (SEQ ID NO:4) is as follows:

[0177] ATGAGCCGGCGATCGTGAACGTGCGCGTGAATTAGCGCGTATCCTGCTGAAAGTGATTAAACTGAGCGATAGCCCGGAAGCGCGTCGTCAGTTACTGCGTAATCTGGAGGAACTGGCGGAAAAGTATAAAGATCCGGAAGTGCGTCGTATTCTGGAAGAAGCGGAACGTTATATCAAAGGTAGCTGTGGCAGCGAGAATCTGTATTTTCAGAGCctcgaGCACCACCACCACCACCAC

[0178] (2) Plasmid transformation

[0179] After the small protein recombinant plasmid was constructed, it was verified by full-length gene sequencing, and then transformed into the Escherichia coli expression strain lemo21 (purchased from Beijing Zhuangmeng International Biogene Technology Co., Ltd.) through the plasmid. Take 100μL of competent cells lemo21 and thaw on ice. Dissolve the freeze-dried expression plasmid in ddH2O to a concentration of 25ng / μL. Take 3μL of plasmid and add it to the competent cells and place it on ice for 30min. After the competent cells are placed in a 42℃ water bath for heat shock for 60-90s, they are quickly placed on ice for 2min. Then add 500μLLB liquid culture medium (no resistance) to the mixture and shake on a shaker at 37℃ and 220rpm for 45min. After the time is up, take 300μL of culture medium and add it to a 10cm ampicillin-resistant LB culture plate, add plate coating beads and shake 10 times in the cross direction, and pour out the plate coating beads. Place the plate upside down in a 37℃ incubator for overnight culture.

[0180] (3) Induced expression and purification

[0181] After successful transformation, single clones were selected for protein induction expression. The steps are as follows:

[0182] 1. Small shaking: Pick up a single clone with a sterilized pipette tip and put it into a shaking tube containing 5 mL of LB medium containing kanamycin resistance (100 μg / mL), and culture it overnight at 37°C and 220 rpm in a shaking incubator;

[0183] 2. Shake: Add 5 mL of culture medium to 1 L of LB medium containing kanamycin (100 μg / mL). Incubate at 37°C, 220 rpm for 1 to 2 hours. After 1 hour, measure OD600 with Nanodrop every 30 minutes.

[0184] 3. Induction: OD 600 At about 0.6-0.9, add IPTG inducer to the shaking culture solution to a final concentration of 1 mmol / L. Incubate at 16°C, 180 rpm in a shaking incubator for 14-16 hours.

[0185] 4. Collect bacteria: After induction, pour the bacterial solution into a 250mL centrifuge bottle, centrifuge at 9000rpm for 20min, discard the supernatant, and obtain the bacterial precipitate.

[0186] 5. Ultrasonic lysis: Add 50mL lysis buffer to resuspend the bacteria, then add protease inhibitor (100μg / mL PMSF), shake on an oscillator to mix well, and pour into a small beaker. After fixing the beaker in a 0℃ ice-water mixture, use an ultrasonic disruptor to disrupt the bacteria. Ultrasonic conditions are: power 150w, ultrasonic 6s, stop 6s, working time 1h. After the ultrasonic is completed, collect the bacterial solution in a centrifuge tube, centrifuge at 9000rpm for 20min, and collect the supernatant for later use.

[0187] 6. Protein column hanging: Pipette 1mL nickel beads into a 10mL affinity chromatography empty column, use gravity to naturally drain the ethanol storage solution, then add 10mL PBS to rinse the nickel column to ensure that the ethanol is completely removed. Add 1mL PBS to resuspend the nickel beads and add them to the ultrasonic lysis supernatant, and rotate the column in a 4℃ chromatography cabinet shaker for 2h.

[0188] 7. Nickel column purification: Add the mixture of lysate supernatant and nickel beads to the empty affinity chromatography column, connect the rubber tube to the liquid outflow port of the affinity chromatography column, and use the peristaltic pump to pump the flow-through liquid into the centrifuge tube at a constant flow rate. After 3 times of flow-through, discard the supernatant. After eluting with 20mL of eluent (50mmol / L Tris HCl), 20mL of eluent containing 20mmol / L imidazole, 10mL of eluent containing 50mmol / L imidazole, and 1mL of eluent containing 100mmol / L imidazole in sequence, add 4mL of eluent containing 500mmol / L imidazole to the nickel beads, mix well, and let stand for 5min, and collect the liquid by gravity. Repeat this process once, and collect a total of 8mL of eluent. After adding the collected eluate to a 3K dialysis bag, the dialysis bag was placed in a beaker filled with PBS solution, a magnetic rotor was added, and the dialysis was performed overnight on a magnetic stirrer in a chromatography cabinet at 4°C.

[0189] 8. Size exclusion chromatography purification: The dialyzed protein solution was added to an ultrafiltration tube with a molecular cutoff of 3K, ultrafiltered and concentrated at 4500rpm and 4°C, centrifuged to a final concentration of 10mg / mL, and then purified using Superdex75Increase size exclusion chromatography. Agilent 1260 high performance liquid chromatography system was used, the mobile phase was PBS solution, and the flow rate was 0.8mL / min. The purified protein solution was measured for concentration by Nanodrop and stored in a -80°C refrigerator for later use.

[0190] The amino acid protein sequence obtained in this example is shown in SEQ ID NO: 3, i.e., the Nb1 sequence of the present invention, except for the MSG added to the N-terminus of the sequence and the GSCGSENLYFQSLEHHHHHH sequence added to the C-terminus of the sequence, as shown in SEQ ID NO: 1.

[0191] The molecular structure was characterized by mass spectrometry and HPLC; HPLC analysis conditions: Superdex75 Increase10 / 300 gel filtration / size exclusion chromatography column, flow rate 0.8mL / min; mobile phase A was 0.1mol / L PBS solution; mobile phase gradient setting: 0.0~30.0min 100% A, Nb1 structure has good stability, pharmacokinetic properties and targeting specificity.

[0192] Example 2 68 Ga elution

[0193] Use a syringe to take 4mL of 0.05mol / LHCl to elute the germanium-gallium generator at a rate of 1-2mL / min. Discard the first 1mL of HCl, collect the remaining 3mL of eluent, and record the radioactivity.

[0194] Example 3 Tricarbonyl compound intermediate [ 99m Tc(CO)3(H2O)3] + Preparation

[0195] Add 5 mg Na2CO3, 10 mg NaBH4, and 15 mg potassium sodium tartrate to a 10 mL penicillin vial, add 1 mL of normal saline, shake well, evacuate with a 10 mL disposable syringe, pass carbon monoxide gas, exhaust the air in the bottle, and then inject 2 mL of Na 99 The mTcO4 eluate (about 13 mCi) was heated in an 80°C oil bath for 30 min (carbon monoxide gas was passed during the reaction), and then cooled to obtain the intermediate [ 99m Tc(CO)3(H2O)3] + ,stand-by.

[0196] Example 4 Preparation of Precursor THP-Nb1

[0197] According to the molar ratio of purified Nb1 (SEQ ID No: 3) to Mal-THP of 1:10, weigh the Mal-THP solid powder into a 1.5mL EP tube. Add the concentrated Nb1 solution, mix and shake evenly, place in an incubator, and react at 37°C for 2h. After the reaction, use a PD-10 column to equilibrate and purify with 25mL PBS. Add 1-1.5mL of the reacted solution, add PBS to 2.5mL, and drain. Add another 2.5mL PBS, collect 5 tubes of effluent, and collect about 0.5mL in each tube. Combine the tubes with higher concentrations to obtain THP-Nb1, and divide into 200μg / tube, and store in a -80°C refrigerator.

[0198] Example 5 Preparation of Precursor NOTA-Nb1

[0199] Take 0.5-1.0mL of Nb1 (SEQ ID No: 3) solution and add it to an EP tube, then add about 10-20 times the molar amount of NOTA-DMSO solution (10mmol / L), react at 37°C for 1h, and gently shake the reaction tube every 10-15min. Use a PD-10 column to equilibrate and purify with 25mL PBS. Add 1-1.5mL of the reacted solution, add PBS to 2.5mL, and drain. Add another 2.5mL PBS, collect 5 tubes of effluent, and collect about 0.5mL in each tube. Combine the tubes with higher concentrations and divide them into 200μg / tube, and store them in a -80°C refrigerator.

[0200] Example 6 Preparation of Precursor RESCA-Nb1

[0201] The coupling of Nb1 (SEQ ID No: 3) and Mal-RESCA is achieved by the specific reaction of the maleimide group of (±)-H3RESCA-Mal with the sulfhydryl group in the cysteine ​​of the small protein Nb1 to form a thioether bond. Figure 1 The solid powder (as shown) was added to a 1.5mL EP tube, and the Nb1 solution was pipetted into the reaction tube with a pipette, and the mixture was shaken and mixed. NaHCO3 / Na2CO3 buffer solution was added to adjust the pH to 6.5-7.5, and the mixture was placed in an incubator at 37°C for 1h. After the reaction, the reaction solution was filtered through a 0.22μm aqueous phase needle filter and purified by HPLC system to obtain the precursor. The purification column was Superdex75 Increase10 / 300, the detection wavelength was 210nm and 280nm, the injection volume was 500μL, and the flow rate was 0.8mL / min. The molecular weight of RESCA-Nb1 was detected by MALDI-TOF. The precursor sample was packaged according to 200μg and stored in a -80°C refrigerator.

[0202] Example 7 Preparation of DFO-Nb1

[0203] Add 0.5 mg of small protein Nb1 (SEQ ID No: 3), and pipette the liquid into a 1.5 mL EP tube according to the molar ratio of DFO to Nb1 of 1:12, and mix well. Add NaHCO3 / Na2CO3 buffer solution to adjust the pH to 9.0. React in a 37°C oven for 60 min, shake once every 10 min, and after the reaction is completed, purify with a PD-10 column equilibrated with Metal-free PBS 5 times, add 1-1.5 mL of the reacted solution, add PBS to 2.5 mL, and drain. Add another 2.5 mL of PBS, collect 5 tubes of effluent, and collect about 0.5 mL in each tube. Combine the tubes with higher concentrations to obtain DFO-Nb1, and divide it into 200 μg / tube, and store it in a -80°C refrigerator.

[0204] Example 8 68 Preparation of Ga-THP-Nb1

[0205] Take out the pre-packaged THP-Nb1 (200 μg) from the -80℃ refrigerator, the concentration is 2-3 mg / mL, add 300 μL 2.0 mol / L sodium acetate solution after rapid dissolution, and then add 1 mL 68 Ga (259-740 MBq) freshly washed in step (1) 68Ga, the reaction system pH = 5.0-6.5, invert and mix, divide into 2 1.5mL EP tubes, place at 37℃ and 60℃ for reaction for 15min respectively. Add 0.22μm microporous filter membrane, add 2.0mL physiological saline to the system, filter the product into a sterile vacuum bottle, and set aside to obtain the product radioactivity. 68 Ga-THP-Nb1.

[0206] Example 9 68 Preparation of Ga-NOTA-Nb1

[0207] Take out the pre-packaged precursor NOTA-Nb1 (200 μg) from the -80℃ refrigerator, and transfer 1 mL of the eluent with the highest activity in step (2) to another new 1.5 mL EP tube. Add 65 μL (1.0 M) sodium acetate solution and 200 μg NOTA-Nb1 to the above EP tube and mix well. The pH of the reaction system is 4.0-5.0. The reaction solution is divided into 2 1.5 mL EP tubes and placed at 37℃ and 60℃ for 15 minutes. After the reaction solution is purified by a PD-10 column, add a 0.22 μm microporous filter membrane, add 2.0 mL of physiological saline to the system, and filter the product into a sterile vacuum bottle to obtain the target product. 68 Ga-NOTA-Nb1.

[0208] Example 10 Labeling rate, radiochemical purity and quality control

[0209] iTLC: After the reaction is completed, 2 μL of the reaction solution is taken and spotted on the iTLC-SG paper strip, developed with saline, and scanned on Radio-TLC to analyze the labeling rate. After purification, select 1-2 tubes with higher activity and take 2 μL of the reaction solution and spot it on the iTLC-SG paper strip, develop with saline, and scan on Radio-TLC to analyze the radiochemical purity. Take a 1.5mL EP tube and add 100 μL PBS, and another tube to add 100 μL 5% HSA; and take 100 μL of the reaction solution and add it to the above tubes, and perform in vitro stability determination at 0.5h, 1h, 2h, 4h, and 6h. The labeling rate of the obtained product is>95%, the radiochemical purity is>99%, and the in vitro stability is maintained above 95%.

[0210] Embodiment 11 99m Tc] 99m Preparation of Tc(CO)3(H2O)3-Nb1

[0211] Prepare the small protein Nb1 to a concentration of 1 mg / mL, take 200 μL and add 1 mL (about 2-3 mCi) of the prepared 99mTc(CO)3(H2O)3, adjust pH to 8 with hydrochloric acid, place in 80℃ oil bath to react for 30min, then add 1mL 0.8M NaOH solution to react for 30min, after the reaction, adjust pH to acidity with 1M HCl, distill under reduced pressure, dissolve in appropriate amount of methanol; add 0.22μm microporous filter membrane, add 2.0mL physiological saline to the system, filter the product into a sterile vacuum bottle, and obtain the product [ 99m Tc] 99m Tc(CO)3(H2O)3-Nb1.

[0212] Example 12 177 Preparation of Lu-DOTA-Nb1

[0213] To the labeled precursor DOTA-Nb1 / NOTA-Nb1 (200 μg), 100 μL NaAc / Hac (pH=5.5) solution and 370 MBq 177 LuCl3 solution, react at 37℃ for 30min, and the obtained 177 The radiochemical purity of Lu-DOTA-Nb1 is greater than 80%. The product is separated and purified by using a molecular exclusion column PD-10 pretreated with PBS solution, and 1 to 2 mL of physiological saline is added to the purified product, mixed well, and then filtered into a sterile vacuum bottle with a 0.22 μm sterile needle filter to obtain the product.

[0214] Example 13 18 Preparation of F-RESCA-Nb1

[0215] Take 100 μL of normal saline 18 F eluent (about 1110MBq), add 4μL 2mmol / L AlCl3 solution, react for 5min, add 110μL NaAc / Hac (pH=4.1) solution, 100μL RESCA-Nb1 solution, system pH=4.6~4.8, react at 37℃ for 15min. Purify with molecular exclusion column PD-10 pretreated with PBS solution, add 1~2mL physiological saline to the purified product, mix well and filter with 0.22μm sterile needle filter into a sterile vacuum bottle to obtain the product.

[0216] Embodiment 14 18 F-RESCA-Nb1 Quality Control

[0217] iTLC: Take 2 μL of the reaction solution, spot it on the iTLC-SG paper strip, develop it with physiological saline, and perform labeling rate scanning analysis on Radio-TLC. After purification on the PD-10 column, select the sample with the highest radioactivity and take 2 μL of it and spot it on the iTLC-SG paper strip to show radiochemical purity.

[0218] F nuclide is a nuclide with a relatively low labeling rate for proteins. 18 The labeling rate of F-RESCA-Nb1 was 14.19%, but the radiochemical purity after purification was 99.53%.

[0219] The probe was incubated in PBS and 5% HSA for 4 hours, and the in vitro stability of the radioactive probe was detected by Radio-TLC. The probe had good stability at 0.5h, 1h, 2h, and 4h. This indicates that the probe has high stability in vitro. Figure 2 shown.

[0220] Embodiment 15 18 High-temperature preparation of F-RESCA-Nb1

[0221] Take 400 μL of normal saline 18 F eluent (about 1110MBq), add 6μL 2mmol / L AlCl3 solution, react for 5min, add 11μL 0.5mol / L KHP (pH=4.0) solution, 500μL RESCA-Nb1 solution, system pH=4.6~4.8, divide the reaction solution into three parts, and conduct comparative experiments at reaction temperatures of 37℃, 60℃, and 80℃. Appropriately shorten the reaction time, but not less than 12min; purify with molecular exclusion column PD-10 pretreated with PBS solution, add 1~2mL physiological saline to the purified product, mix well, and filter into a sterile vacuum bottle with a 0.22μm sterile needle filter to obtain the product. The labeling rate and in vitro stability of the product labeled under high temperature conditions are basically consistent with those at 37℃.

[0222] Example 16 18 Imaging of the normal F-RESCA-Nb1 mouse model

[0223] According to the radioactivity 18 F-labeled PD-L1 targeted imaging agent 18 The F-RESCA-Nb1 method was used to prepare the KM mice. 0.2 mL (7.4 MBq) was injected into the tail vein of the mice. 18 F-RESCA-Nb1, MicroPET scanning was performed 1 hour later. The region of interest (ROI) of the whole-body decay-corrected coronal image obtained by Micro-PET scanning was reconstructed. Figure 3 As shown in the figure, there is no obvious radionuclide signal except in the kidney and bladder, which further indicates that 18 Targeting specificity of F-RESCA-Nb1 with no nonspecific binding.

[0224] Embodiment 17 18F-RESCA-Nb1 mouse positive model imaging

[0225] According to the radioactivity 18 F-labeled PD-L1 targeted imaging agent 18 The KM mice were injected with 10 μL, 5 μg human PDL1 (0.5 μg / μL) into the left forelimb muscle, 10 μL, 5 μg mouse PDL1 (0.5 μg / μL) into the right forelimb muscle, and 0.1 mL (5.77 MBq) was injected into the tail vein of the mice. 18 F-RESCA-Nb1, MicroPET scanning was performed 0.5h and 1h later. The region of interest (ROI) of the whole-body decay-corrected coronal image obtained by Micro-PET scanning was reconstructed. Figure 4 As shown, 18 F-RESCA-Nb1 has specific imaging function for both human and mouse PDL1 in vivo.

[0226] Embodiment 18 18 F-RESCA-Nb1 mouse negative model imaging

[0227] Nude mice were inoculated with A549 cells subcutaneously in the right armpit. After 6 to 8 days, the tumor grew to about 300 mm. 3 0.2 mL (5 GBq) was injected into the tail vein of mice. 18 F-RESCA-Nb1, Micro-PET scanning was performed 0.5h and 1h later. The region of interest (ROI) of the whole-body decay-corrected coronal image obtained by Micro-PET scanning was reconstructed. Figure 5 As shown, the negative tumor tissue of mice showed low uptake. The probe is rapidly metabolized and is a potential tumor imaging agent.

[0228] Comparative Example 1 89 Preparation of Zr-DFO-Nb1

[0229] Take 70μL (780μCi) oxalic acid 89 Zr, add 10 times HEPES-Na2CO3 buffer solution and mix well; after adding DFO-Nb1, add oxalic acid to adjust the pH to 7.0. Place in a constant temperature incubator and react at 37°C for 60 minutes. Perform intermediate quality control for 30 minutes and use iTLC to detect the labeling; after the reaction, use a balanced PD-10 column for purification, add a 0.22μm microporous filter membrane, add 2.0mL of physiological saline to the system, filter the product into a sterile vacuum bottle, and obtain the target product 89Zr-DFO-Nb1. 2 μL of sample was spotted on iTLC-SG paper strip, showing radiochemical purity. The obtained product had a labeling rate of <50% and a radiochemical purity of <50%, indicating a poor labeling effect.

[0230] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A radionuclide conjugate, characterized in that: The radionuclide conjugate contains: (a) a small protein targeting PD-L1, wherein the amino acid sequence of the small protein is shown in SEQ ID NO.: 3; and (b) a coupling moiety, wherein the coupling moiety is a radionuclide, and the radionuclide is selected from the group consisting of: 18 F. 99m Tc and 177 Lu.

2. The radionuclide conjugate according to claim 1, characterized in that The radionuclide is 18 F.

3. The radionuclide conjugate according to claim 1, characterized in that: The small protein and the coupling part are connected via a linker, and the linker is selected from: polypeptide, small molecule compound, or a combination thereof.

4. The radionuclide conjugate according to claim 3, characterized in that: The linker is selected from the group consisting of RESCA, tricarbonyl compounds, THP, NOTA, and DFO.

5. The radionuclide conjugate according to claim 1, characterized in that: The radionuclide conjugate has a structure shown in the following formula I: RL-Nb1(I) in, Nb1 is a small protein that targets PD-L1; L is the connector; R is a radionuclide.

6. The radionuclide conjugate according to claim 1, characterized in that: The structure of the radionuclide conjugate is shown in the following formula: 18 F-RESCA-Nb1 in, 18 F is a radionuclide 18 F; Nb1 is the small protein targeting PD-L1; RESCA is a bifunctional chelator RESCA ((±)H3RESCA-Mal).

7. A PD-L1 protein detection reagent, characterized in that: The detection reagent comprises the conjugate as claimed in claim 1 and a carrier acceptable in detection.

8. A kit for detecting PD-L1 molecules, characterized in that: The kit contains the conjugate according to claim 1 or the PD-L1 protein detection reagent according to claim 7.

9. A use of the conjugate according to claim 1, characterized in that: Used to prepare (a) a detection reagent, a detection kit or a detection plate for detecting PD-L1 molecules in vivo; (b) a pharmaceutical composition for treating tumors expressing PD-L1 protein (i.e., PD-L1 positive).

10. A method for preparing the conjugate according to claim 1, characterized in that: The method comprises the steps of: Under appropriate conditions, reacting the conjugate precursor with the radionuclide to obtain the radionuclide conjugate; The conjugate precursor contains a small protein targeting PD-L1 with an amino acid sequence as shown in SEQ ID NO: 3; and a linker portion.

Images