Application of ZmGRF6 in regulation and control of corn plant height

Abstract

The invention relates to the technical field of biology, and particularly discloses application of ZmGRF6 in the aspect of regulating and controlling the plant height of corn. The ZmGRF6 is derived from corn, and the nucleotide sequence of the ZmGRF6 is as shown in SEQ ID NO. 1. The rZmGRF6 is obtained by performing synonymous mutation on a site, combined with miR396, on a ZmGRF6 CDS sequence, and the mismatch of the rZmGRF6 and the miR396 prevents a ZmGRF6 transcript from being cut, so that the expression level of the ZmGRF6 gene is improved. The plant height of the transgenic corn over-expressed with the rZmGRF6-GFP is reduced by about one third compared with that of a wild type plant. The invention provides the gene for reducing the plant height of the corn, and the gene has an important application value for creating and cultivating a corn variety with moderate dwarfing.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to application of ZmGRF6 in regulating corn plant growth. Background Art

[0002] Corn is the most widely planted and highest yielding cereal crop in the world. Compared with other major crops, corn plants are generally taller and their vegetative growth is too vigorous, which leads to production problems such as low harvest index, excessive nutrient consumption and easy lodging. Therefore, it is of great significance to deeply understand the molecular mechanism of corn plant height control and cultivate moderately dwarfed varieties.

[0003] Growth Regulating Factor (GRF) is a highly conserved transcription factor family in plants, which plays an important role in regulating plant growth and development. GRF family members are involved in the regulation of biological processes such as plant leaf development, stem elongation, flowering time, root growth, seed formation, etc., and play an important regulatory role in plant growth and development, signal transduction, stress response and regeneration efficiency.

[0004] MicroRNA (miR) is a very conservative class of non-coding RNA in eukaryotes. It pairs with target gene transcripts through base complementarity and guides the nuclease AGONAUTE to cut or inhibit translation of the target, thereby regulating the expression of the target gene at the post-transcriptional level. A large number of studies have shown that miR is involved in multiple pathways of plant growth and development and stress response, and is an important regulatory element for plant growth and environmental adaptation. The expression of GRFs from different plant sources is post-transcriptionally regulated by miR396. MiR396 recognizes the complementary sequence of the coding region in the GRF transcript and guides AGONAUTE to cut the target RNA, thereby regulating the expression level of the target gene. Using a constitutive promoter to drive the target gene is an important means of overexpressing the gene, but this method usually changes the spatiotemporal expression pattern of the gene and the problem of ectopic expression due to changes in the promoter, thus producing some negative phenotypes. By performing synonymous mutations on the miR binding sites in the target gene and driving the expression from its own promoter, the inhibitory effect of miR on gene expression can be destroyed, and the expression level of the target gene can be significantly increased without changing the expression pattern, thereby improving the plant phenotype. The natural mutation of the miR396 binding site in rice OsGRF4 significantly increased the yield per plant. Therefore, changing the binding of miR to the target gene through base mutation has important application potential in molecular breeding of crops. Summary of the invention

[0005] The technical problem to be solved by the invention is to reduce the height of corn plants and create dwarf plants.

[0006] In order to solve the problems existing in the prior art, the object of the present invention is to provide a method for reducing the height of corn plants.

[0007] In order to achieve the purpose of the present invention, the purpose of the present invention can be achieved by the following technical solutions:

[0008] The application of ZmGRF6 gene in regulating plant height, the ZmGRF6 gene is derived from corn, the nucleotide sequence encoded by it is shown in SEQ ID NO.1, and the amino acid sequence thereof is shown in SEQ ID NO.2.

[0009] As a preferred embodiment of the present invention, rZmGRF6 is obtained by synonymously mutating the site on the ZmGRF6 CDS sequence that binds to miR396, thereby causing a mismatch between the two, retaining the endogenous promoter and terminator, and increasing the expression level of the ZmGRF6 gene, which can reduce plant height.

[0010] As a further preferred embodiment of the present invention, the nucleotide sequence of rZmGRF6 is shown as SEQ ID NO.3.

[0011] A rZmGRF6 gene, whose nucleotide sequence is shown as SEQ ID NO.3.

[0012] A recombinant expression vector containing the rZmGRF6 gene.

[0013] As a preferred embodiment of the present invention, the promoter and terminator used in the overexpression vector construction are the ZmGRF6 native promoter and terminator.

[0014] According to the sequence of the rZmGRF6 coding region (SEQ ID NO.3), the promoter (SEQ ID NO.4) and the terminator (SEQ ID NO.5), DNA chemical synthesis was performed, and the two BsaI restriction sites of the intermediate vectors pGGC000, pGGA000 and pGGE000 of the GreenGate system were connected respectively to construct pGGC-rZmGRF6, pGGA-ZmGRF6pro and pGGE-ZmGRF6ter plasmids. The above plasmids were connected in equal proportions with other intermediate vectors pGGB003 (N-dummy), pGGD001 (C-GFP), pGGF002 (Basta resistance box) and the final vector pGGZ005 in the Greengate system, and then transformed to obtain the pGGZ005-rZmGRF6-GFP vector. The nucleotide sequence of the rZmGRF6 is as shown in SEQ ID NO.3, and the amino acid sequences of ZmGRF6 and rZmGRF6 are as shown in SEQ ID NO.2.

[0015] The use of the ZmGRF6 gene described in the present invention and the rZmGRF6 gene described in claim 4 in constructing new transgenic plant varieties.

[0016] The use of the ZmGRF6 gene of the present invention and the rZmGRF6 gene of claim 4 in cultivating dwarf plants.

[0017] The pGGZ005-rZmGRF6-GFP vector was transformed into immature embryos of the maize inbred line KN5585 by using a method mediated by Bacillus pyogenes, and rZmGRF6-GFP stable transformed plants were obtained by tissue culture. The results showed that the height of the transformed plants was significantly shortened. The coding gene of rZmGRF6, which is not regulated by miR396, was overexpressed in maize, and the coding gene of rZmGRF6 was highly expressed by increasing RNA stability, thereby reducing the plant height of maize.

[0018] As a preferred embodiment of the present invention, the ZmGRF6 gene and rZmGRF6 gene are used in improving plant germplasm resources.

[0019] As a further preferred embodiment of the present invention, the plant is corn.

[0020] The beneficial effects of the present invention are:

[0021] The constructed pGGZ005-rZmGRF6-GFP vector retains the promoter and terminator elements of the endogenous maize gene ZmGRF6, ensuring that the tissue specificity of ZmGRF6 expression in transgenic plants will not change, avoiding the negative phenotypes caused by ectopic expression; the amino acid sequence encoded by rZmGRF6 is consistent with that of endogenous ZmGRF6, without changes in protein sequence and activity, but the transcript is no longer regulated by miR396, resulting in increased expression, and the plant height of the resulting rZmGRF6-GFP transgenic maize is reduced to a certain extent (about one-third), with no adverse effects on other agronomic traits. Therefore, this gene has important application value in moderate dwarfing breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The construction and structure of pGGZ005-rZmGRF6-GFP vector. (A) Schematic diagram and sequence of synonymous mutations of the binding site between miR396 and ZmGRF6; (B) Schematic diagram of the structure of pGGZ005-rZmGRF6-GFP vector.

[0023] Figure 2PCR identification results of rZmGRF6-GFP transgenic plants (A), Western-blot detection (B) and qRT-PCR detection results (C) of ZmGRF6 protein expression levels in transgenic plants.

[0024] Figure 3 The phenotype of plant height shortening in transgenic plants (A, B) and backcross F1 plants (C) after overexpression of ZmGRF6. DETAILED DESCRIPTION

[0025] The present invention is further explained below in conjunction with examples. It should be understood that the following examples are provided only for the purpose of illustration and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0026] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0027] The quantitative experiments in the following examples were performed in triplicate unless otherwise specified.

[0028] Example 1: Construction of pGGZ005-rZmGRF6-GFP vector

[0029] The present invention provides primers for constructing pGGZ005-rZmGRF6-GFP vector, including primers for amplifying ZmGRF6 promoter nucleotide sequences:

[0030] GRF6-Pro-F: AACAGGTCTCAACCTAGTCTCAGGGTTTCTTTGGATTC

[0031] GRF6-Pro-R:AACAGGTCTCATGTTCAGATACCTGCAGGCTGCA

[0032] Primers used to amplify ZmGRF6 CDS nucleotide sequence:

[0033] GRF6-CDS-F:AACAGGTCTCAGGCTATGCCGCGAGCTTTGCCTT

[0034] GRF6-CDS-R:AACAGGTCTCACTGACCTTGACGGTATTCCATTCG

[0035] Primers used to amplify the ZmGRF6 terminator nucleotide sequence:

[0036] GRF6-Ter-F1:AACAGGTCTCACTGCAGCCGTCGATCCGTAGGC

[0037] GRF6-Ter-R2:AACAGGTCTCATAGTGCTACGACATCATTTCACCAGA

[0038] 1. Cloning and transformation of target fragments

[0039] 1.1 ZmGRF6 promoter, CDS and terminator sequence amplification

[0040] PCR amplification was performed using the above primers with the chemically synthesized ZmGRF6 / rZmGRF6 promoter (SEQ ID NO.4) and terminator (SEQ ID NO.5), ZmGRF6 coding region (SEQ ID NO.1), and rZmGRF6 coding region (SEQ ID NO.3) sequences as templates.

[0041] (1) PCR reaction system

[0042]

[0043] (2) Reaction procedure

[0044] Preheat at 98°C for 3 min; denaturation at 98°C for 10 s, annealing at 58°C for 30 s, extension at 72°C for 2 min (30-60 s / kb), 35 cycles; final extension at 72°C for 5 min; store at 4°C.

[0045] 1.2 PCR product digestion and recovery

[0046] The above PCR products and pGGC000, pGGA000 and pGGE000 vectors were digested with BsaI, and then the PCR products were recovered using an agarose gel recovery kit (Gel Mini Purification Kit, purchased from Zomanbio).

[0047] 1.3 Construction of pGGC-rZmGRF6, pGGA-ZmGRF6pro and pGGE-ZmGRF6ter vectors

[0048] The above digested and recovered PCR products were connected and transformed with the linearized vector using T4-DNA ligase, and the correct clones were confirmed to be preserved by sequencing.

[0049] 2. Construction of pGGZ005-rZmGRF6-GFP vector

[0050] The seven module plasmids required for the Greengate reaction system—pGGA-ZmGRF6pro, pGGC-rZmGRF6 and pGGE-ZmGRF6ter, pGGB003 (N-dummy), pGGD001 (Linker-GFP), pGGF002 (Basta resistance box) and the final vector pGGZ005 were added and reacted according to the following system:

[0051] (1) PCR reaction system

[0052]

[0053] (2) Reaction procedure

[0054]

[0055] After overnight connection in PCR instrument, transformation was performed, colony PCR was performed, and plasmid was extracted from bacterial solution with appropriate band size, and sent for sequencing detection, and finally pGGZ005-rZmGRF6-GFP vector (such as Figure 1 B).

[0056] Example 2: Obtaining transgenic corn plants

[0057] The vector was transferred into Agrobacterium EHA105 by electroporation and PCR identification was performed. The freshly peeled immature embryos of corn inbred line KN5585 of about 1 mm were placed in a centrifuge tube containing 1.8 mL of suspension. After 30 minutes of treatment, the suspension was removed, and 1.0 mL of Agrobacterium suspension was added to the tube. After 5 minutes, the immature embryos in the centrifuge tube were suspended and poured into the co-culture medium, and the excess Agrobacterium liquid on the surface was removed with a pipette. The co-culture was carried out in the dark at 23°C for 3 days. After that, the immature embryos were transferred to the resting medium, cultured in the dark at 28°C for 6 days, and then placed on the screening medium containing 5 mg / L Bialaphos. After 2 weeks of screening culture, they were transferred to the screening medium containing 8 mg / L Bialaphos for 2 weeks of screening culture. The resistant callus was transferred to differentiation medium 1, cultured at 25°C, 5000lx, and light for 1 week. The callus was then transferred to differentiation medium 2 and cultured under light for 2 weeks; the differentiated seedlings were transferred to rooting medium and cultured under light at 25°C, 5000lx until rooting; the seedlings were transferred to small pots for growth, and transplanted to a greenhouse after a certain growth stage, and the offspring seeds were harvested after 3-4 months.

[0058] Example 3: Identification of transgenic positive strains

[0059] The corn seeds obtained in Example 2 and the seeds of the wild corn variety KN5585 were soaked in a 3% sodium hypochlorite solution for 8 minutes for disinfection, then washed with distilled water for 3 to 5 times, and then soaked in water for 12-16 hours to promote seed water absorption and germination. During the entire germination process, the seeds were always in a dark environment and maintained at a constant temperature of 25-28°C to simulate a suitable growth environment. Three days later, when the length of the corn embryo reached 1-2cm and the radicle grew to 3-4cm, the corn seedlings were transferred into a pot and grown under normal light and temperature conditions for 7 days, and the above-ground parts were taken for identification of transgenic positive strains.

[0060] 1. PCR test

[0061] In order to identify the transgenic positive plants, take a fresh leaf, extract DNA, and perform PCR test. The positive strains are initially confirmed by Basta test, and then amplified again using the specific primers on the vector to ensure the correct test results ( Figure 2 A).

[0062] 2. Western blot detection

[0063] Total protein was extracted from the strains that were positive in PCR detection and subjected to Western blot detection.

[0064] The pGGZ005-rZmGRF6-GFP vector contains GFP protein. The positive plants were identified using GFP antibody. The test results were as follows: Figure 2 As shown in B, a specific band appeared at around 72 KDa, which was consistent with the expected molecular weight of the ZmGRF6 protein of 68 KDa, and compared with the control corn inbred line KN5585, each transgenic line showed a higher protein expression level.

[0065] 3. qRT-PCR detection

[0066] The aboveground parts of the strains that were positive in PCR were extracted with Trizol method and the total RNA was used with the full-strand gold reverse transcription kit ( All-in-One First-Strand cDNASynthesis SuperMix for qPCR) was used to reverse transcribe 1 μg RNA into single-stranded cDNA. The transcription level of the ZmGRF6 gene in the transgenic positive strain was detected by qRT-PCR. The qRT-PCR detection method was referred to the instruction manual of ChamQ Universal SYBR qPCR Master Mix (Vazyme).

[0067] (1) PCR reaction system

[0068]

[0069]

[0070] (2) Reaction procedure

[0071]

[0072] (3) Primers used

[0073] qRT-ZmUBQ-F:CTGGTGCCCTCTCCATATGG

[0074] qRT-ZmUBQ-R: CAACACTGACACGACTCATGACA

[0075] qRT-ZmGRF6-F:CCCATGTACCCATCCATCCTC

[0076] qRT-ZmGRF6-R:CGCCGAACAGAGGGTAGCT

[0077] Three technical replicates were set for each reaction. ZmUBQ was used as the internal reference gene. The results of the real-time PCR experiment were calculated according to 2 -△△T The expression level was calculated and plotted. Figure 2 As shown in C, all positive plants showed overexpression of ZmGRF6.

[0078] The above test results show that the PGGZ005-ubi:rZmGRF6 expression vector achieves the stable expression of the target gene ZmGRF6 in corn.

[0079] 4: Phenotypic identification of overexpressing plants

[0080] The homozygous overexpression seeds of the rZmGRF6 gene obtained in Example 3 and the wild-type corn variety KN5585 seeds were sown in spring in Anji, Zhejiang (119°21'24"E, 30°29'57"N). When the tassels were fully pulled out, the plant heights were observed and counted. Ten plants were measured for each strain for statistical purposes.

[0081] Through field phenotypic observation, the results are as follows Figure 3 As shown in A and B, the plant height of rZmGRF6-GFP showed a significant downward trend compared with the wild type, indicating that in situ overexpression of ZmGRF6 would lead to a decrease in plant height.

[0082] Example 4: rZmGRF6-GFP hybrid can reduce corn plant height

[0083] The homozygous overexpression seeds of the rZmGRF6-GFP gene obtained in Example 3 and the seeds of the wild-type corn variety KN5585 were sown, and when the pollen matured, the male tassel pollen of the rZmGRF6 line was pollinated on the female ear of the KN5585 line for backcrossing. The F1 generation seeds harvested from the backcross were sown the following year, and the plant height was observed when the male tassel was fully pulled out.

[0084] Through field phenotypic observation, the results are as follows Figure 3 As shown in C, compared with the wild type, the plant height of the FI generation of maize produced by backcrossing rZmGRF6 with KN5585 was significantly lower than that of the wild type. This indicates that the reduction in maize plant height caused by overexpression of ZmGRF6 is a dominant phenotype.

[0085] The present invention has been described in detail above. For those skilled in the art, under experimental conditions that do not depart from the purpose and scope of the present invention, the present invention can be implemented in a wider range under equivalent parameters and conditions. However, on the basis of the present invention, further improvements can be made to the present invention. In a word, these modifications or improvements made on the basis of not departing from the spirit of the present invention all belong to the scope of protection claimed in the present invention.

Claims

1. Application of ZmGRF6 gene in regulating plant height, It is characterized in that The ZmGRF6 gene is derived from corn, and the nucleotide sequence encoded by it is shown in SEQ ID NO.1, and the amino acid sequence thereof is shown in SEQ ID NO.

2.

2. The use according to claim 1, It is characterized in that rZmGRF6 was obtained by synonymously mutating the site on the ZmGRF6 CDS sequence that binds to miR396, thereby causing a mismatch between the two and retaining the endogenous promoter and terminator, thereby increasing the expression level of the ZmGRF6 gene and reducing plant height.

3. The use according to claim 2, It is characterized in that The nucleotide sequence of rZmGRF6 is shown in SEQ ID NO.

3.

4. a rZmGRF6 gene, It is characterized in that Its nucleotide sequence is shown in SEQ ID NO.

3.

5. A recombinant expression vector containing the rZmGRF6 gene according to claim 4.

6. The recombinant expression vector according to claim 5, It is characterized in that The promoter and terminator used in the overexpression vector construction were the ZmGRF6 native promoter and terminator.

7. Use of the ZmGRF6 gene described in claim 1 or the rZmGRF6 gene described in claim 4 in constructing new transgenic plant varieties.

8. Use of the ZmGRF6 gene described in claim 1 or the rZmGRF6 gene described in claim 4 in cultivating dwarf plants.

9. Use of the ZmGRF6 gene described in claim 1 and the rZmGRF6 gene described in claim 4 in improving plant germplasm resources.

10. The use according to any one of claims 1, 7-9, It is characterized in that The plant is corn.

Images