Taxus chinensis var mairei endophytic sphaeroides fungus strain HKL13 and application thereof in promoting paclitaxel synthesis

Abstract

The invention provides a taxus chinensis var. Mairei endophytic fungus strain HKL13 and application of the taxus chinensis var. Mairei endophytic fungus strain HKL13 in promotion of paclitaxel synthesis, the strain is named as Gugnardia sp.HKL13, the strain is preserved in the China Center for Type Culture Collection (CCTCC) on January 26, 2024, and the preservation number is CCTCC NO: M2024233. According to the strain HKL13 provided by the invention, cultured spore liquid is sprayed on taxus chinensis var mairei seedlings, so that biosynthesis of taxol of taxus chinensis var mairei can be effectively promoted, the content of taxol is increased, and the strain HKL13 has relatively high production and application values.

Description

Technical Field

[0001] The invention belongs to the field of microorganism and plant secondary metabolism regulation, and specifically relates to an endophytic Glomerella fungus strain HKL13 of Taxus chinensis and an application thereof in promoting the accumulation of paclitaxel content in Taxus chinensis. Background Art

[0002] Taxus chinensis, also known as the beautiful yew, is a unique tree species in my country and a national first-class protected plant. It is a relict species of the Quaternary glacier and is distributed in Anhui, Zhejiang, Taiwan, Fujian, Jiangxi, Guangdong, Hubei, Hunan and other provinces. Taxus chinensis prefers a moist and cool environment and slightly acidic soil, and has low requirements for soil nutrients and water. According to the Compendium of Materia Medica, the branches and leaves of Taxus chinensis have therapeutic effects such as treating cholera, typhoid fever and detoxification. They can be made into Taxus chinensis tea and oral liquid, and are an ancient medicinal material. As researchers discovered that Taxus plants contain the anti-cancer active ingredient paclitaxel, the economic value of Taxus chinensis has increased significantly, resulting in a sharp decrease in the number of natural Taxus chinensis populations. The protection and sustainable development and utilization of Taxus chinensis resources are key issues affecting the industrialization of Taxol.

[0003] Paclitaxel is a highly effective, low-toxic, broad-spectrum natural anticancer drug derived from the yew plant. Its molecular formula is C 47 H 51 NO 14 , which has been widely used in the clinic to treat breast cancer, ovarian cancer, some head and neck cancers and lung cancers. Paclitaxel, as a diterpenoid compound with a unique structure, has a special physiological and biochemical mechanism. Paclitaxel can cause an imbalance between human tubulin and tubulin dimers that make up microtubules, promote tubulin polymerization, microtubule assembly, and prevent depolymerization, thereby making microtubules ultra-stable, disrupting the cell cycle, inhibiting the mitosis of cancer cells and triggering cell apoptosis, and has a good inhibitory effect on cancer cell proliferation.

[0004] Endophytic fungi refer to symbiotic fungi that exist in disease-free tissues. Since they live in symbiosis with host plants throughout their entire life cycle, they are often able to produce a variety of large quantities of novel and highly active secondary metabolites. The endophytic fungus Taxomyces andreana isolated from the bark of Taxus brevifolia can produce paclitaxel analogs, which has attracted great attention. The active ingredients produced by endophytic fungi are both drug precursors and important partners in plant growth and development. Some endophytic fungi can promote the growth of host plants, enhance the host's stress resistance, and promote the synthesis and accumulation of active ingredients in host plants, which can play a positive role in improving plant yield and quality.

[0005] At present, there are many reports on the diversity, growth-promoting ability and paclitaxel production of endophytic fungi in Taxus chinensis, but there are few studies on whether endophytic fungi can induce the accumulation of active ingredients such as paclitaxel in Taxus chinensis. Summary of the invention

[0006] The first object of the present invention is to provide an endophytic fungus separated and purified from Taxus chinensis.

[0007] To achieve the above object, the present invention adopts the following technical solution:

[0008] An endophytic Glomerella fungus strain of Taxus chinensis, taxonomically named Glomerella Guignardia sp. HKL13, the strain preservation number is CCTCC NO: M2024233, the preservation date is January 26, 2024, the preservation unit is China Center for Type Culture Collection (CCTCC), and the preservation address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0009] Preferably, its ITS base sequence is shown as SEQ ID NO.1.

[0010] The second object of the present invention is to provide the use of the above-mentioned endophytic Glomerella fungus strain of Taxus chinensis in promoting the biosynthesis of paclitaxel in Taxus chinensis.

[0011] The third object of the present invention is to provide the use of the above-mentioned endophytic Glomerella fungus strain of Taxus chinensis in promoting the expression of paclitaxel synthesis-related genes in Taxus chinensis.

[0012] The endophytic Glomerella fungus strain of Taxus chinensis has the function of promoting the biosynthesis of paclitaxel in the Taxus chinensis plant.

[0013] The fourth object of the present invention is to provide a microbial agent containing the above-mentioned endophytic Glomerella fungus strain of Taxus chinensis.

[0014] Preferably, the microbial agent is a spore liquid.

[0015] Preferably, the spore liquid is prepared by the following steps: inoculating the endophytic Glomerella fungus strain HKL13 of Taxus chinensis into V8 culture medium at a temperature of 25-30° C., waiting for spores to be generated, and filtering through gauze to obtain a spore-containing solution, namely the spore liquid.

[0016] The fifth object of the present invention is to provide a method for increasing the paclitaxel content in the needles of Taxus chinensis var. mairei, specifically by spraying the above-mentioned microbial agent on the seedlings of Taxus chinensis var. mairei.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The invention provides an endophytic fungus strain HKL13 of Taxus chinensis, which is separated and purified from Taxus chinensis, a plant of the genus Taxus. After being prepared into spore liquid, the filtered spore liquid is sprayed on twigs of Taxus chinensis seedlings to effectively promote the biosynthesis of paclitaxel components and the expression of synthesis-related genes, and has high application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 :Sphaerotheca fungi Guignardia sp. Colony morphology of HKL13 on solid culture medium.

[0020] Figure 2 :Sphaerotheca fungi Guignardia sp. Mycelial and spore morphology of HKL13 under light microscope.

[0021] Figure 3 :Sphaerotheca fungi Guignardia sp. Agarose gel electrophoresis of the ITS sequence of HKL13.

[0022] Figure 4 :Sphaerotheca fungi Guignardia sp. Phylogenetic tree of HKL13.

[0023] Figure 5 :Sphaerotheca fungi Guignardia sp. Bar graph showing that HKL13 infection increases the content of taxol in leaves of Taxus chinensis var. mairei.

[0024] Figure 6 :Sphaerotheca fungi Guignardia sp. HKL13 infection increases the expression of key genes in the paclitaxel pathway in leaves of Taxus chinensis var. mairei. DETAILED DESCRIPTION

[0025] The specific implementation methods of the present invention are described in detail below with reference to the embodiments.

[0026] Embodiment 1: Guignardia sp. Isolation, identification and preservation of HKL13:

[0027] Endophytic fungi were obtained as follows:

[0028] (1) Rinse the freshly picked healthy two-year-old stem segments of Taxus chinensis under running water for 30 minutes to remove the visible sludge on the surface, dry the surface water with filter paper, and place them on a clean workbench. Soak and disinfect them in 75% alcohol for 1 min. During the process, the beaker needs to be shaken continuously to ensure that the Taxus chinensis tissue is fully in contact with the alcohol. Then wash them three times with sterile water to remove the residual alcohol on the surface of the tissue. Then wash the stem segments of Taxus chinensis with 0.1% HgCl2 for 5 minutes, place the plant material in a clean beaker and wash it 4 to 5 times to remove the residual HgCl2 on the surface of the tissue. To verify whether the disinfection is thorough, take 100 μL of the sterile water from the last wash as a control. If no bacteria grow after culturing at 26°C for 3 to 5 days, the disinfection is considered effective.

[0029] (2) Use a scalpel to peel the disinfected stem nodes and cut the stem bark into 5 mm small sections; spread the processed plant materials flat on the PDA culture medium, place five pieces of material in each culture dish, and culture them at a constant temperature of 26°C in the dark. The mycelium will grow from the tissue blocks after three to seven days of culture. After inoculation, use an inoculation needle to transfer from the edge of the stem bark wound to a new PDA plate every 12 hours. Observe the phenotypic characteristics of the transferred fungal colonies, pick the mycelium at the edge of a single colony, and streak culture on a new PDA plate. After continuous purification for 3 times, pick a small amount of mycelium and observe it under a microscope. If there are no other bacteria, it can be considered a single strain. After obtaining a single strain, inoculate it on a PDA slant and store it at 4°C. Figure 1 As shown in Figure 1, the solid culture characteristics of HKL13 are dark gray colonies with wrinkled edges. Under the microscope, the morphological characteristics are dark gray hyphae that cross each other and have dark spores, such as Figure 2 shown.

[0030] The PDA culture medium of the present invention comprises: 200.0 g / L potato, 50.0 g / L glucose, 6.0 g / L NH4NO3, 0.3 g / L anhydrous MgSO4, 0.5 g / L KH2PO4 and 0.05 g / L vitamin B1.

[0031] (3) DNA of endophytic fungi strains of Taxus chinensis was extracted using the TIANGEN Plant Genomic DNA Extraction Kit, and the DNA was used as a template to amplify the ITS sequence. The primers were ITS4 (SEQ ID NO.2: 5'-TCCTCCGCTTTATTGATATGC-3') and ITS5 (SEQ ID NO.3: 5'-GGAAGTAAAGTCGTAACAAGG-3'). The PCR reaction system was 2×Taq MasterMix (Dye), 25 μL; ITS5 (10 μM), 2 μL; ITS4 (10 μM), 2 μL; Template DNA, 3 μL; ddH2O, 18 μL. The PCR reaction program was pre-denaturation at 94℃ for 2 min, denaturation at 94℃ for 30 s, annealing at 57℃ for 30 s, extension at 72℃ for 30 s, denaturation-annealing-extension cycles for 30 times, and final extension at 72℃ for 2 min. 1% agarose gel electrophoresis was used to detect whether the amplification was successful. The successful PCR product was sent to Zhejiang Shangya Biotechnology Co., Ltd. for sequencing. The ITS sequence of the endophytic fungus HKL13 was amplified by PCR, and the gel electrophoresis of its product was shown in the figure below. Figure 3 As shown, its ITS base sequence is shown in SEQ ID NO.1.

[0032] (4) The sequencing results returned by the company were submitted to the NCBI website for comparison. The target sequence had a similarity of 99.49% with Guignardiamusicola NR_137716. Therefore, the endophytic fungus of the present invention was named Guignardia sp. HKL13. The fungus has been deposited with the accession number CCTCC NO: M2024233, deposited in China Center for Type Culture Collection (CCTCC), and deposited at No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0033] Example 2: Construction and analysis of homologous evolutionary tree of endophytic fungus HKL13

[0034] The ITS sequence of endophytic fungus HKL13 was used as the target sequence. The homologous sequences were searched in the GenBank database of NCBI. The sequence closest to the ITS sequence of endophytic fungus HKL13 was downloaded as the reference sequence. The phylogenetic tree was constructed using the neighbor-joining method (NJ). One sequence was randomly selected and the alignment was repeated 1000 times to determine the phylogenetic status of the endophytic fungus HKL13 strain. The phylogenetic tree is shown in the figure. Figure 4 shown.

[0035] Example 3: Preparation and application of spore solution of endophytic fungus HKL13 of Taxus chinensis

[0036] (1) Use an inoculation needle to pick up a 5 mm × 5 mm endophytic fungus block of Taxus chinensis var. mairei preserved on a slant, invert it on a V8 medium, and culture it at 26°C in the dark for 5 to 7 days until the fungus produces spores. Add 2 mL of sterile water to the solid plate, scrape the hyphae and spores with a coating stick to obtain a mixed solution, fold three layers of gauze into a funnel shape, and filter the mixed solution at the ninth layer to obtain a spore solution (all the above steps are completed on a clean bench). Count the spores under an optical microscope, and adjust the concentration of the obtained fungal spore solution to 1×10 6 pcs / mL for future use.

[0037] (2) Place soaked sterile filter paper on a tray, cut stems and leaves of Taxus chinensis var. mairei of similar age and length about 20 cm, wash them 2-3 times with sterile water, and place the leaves with the lower epidermis facing up on the filter paper. Spray 20 mL of fungal spore solution evenly on the leaf surface, and spray the control group (CK) with the same amount of sterile water. Wrap the tray with plastic wrap and let it stand for 48 h, then cut the leaves, wash them with sterile water, and freeze them in liquid nitrogen and place them in a -80℃ refrigerator for later use.

[0038] Example 4: Effect of endophytic fungus HKL13 on the content of paclitaxel in leaves of Taxus chinensis var. mairei

[0039] (1) All extraction reagents were precooled at -20°C before use. Weigh 60 mg of leaves into a 1.5 mL centrifuge tube, add an appropriate amount of small steel beads and 600 μL of methanol-water (V:V=7:3, containing mixed internal standard, 4 μg / mL); precool in a -40°C refrigerator for 2 min, put into a grinder, grind at 60 Hz for 2 min; ultrasonic extraction in an ice water bath for 30 min, stand at -40°C overnight; centrifuge at 12000 rpm for 10 min, draw 150 μL of supernatant with a syringe, filter with a 0.22 μm organic phase pinhole filter, transfer to an LC injection vial, and store at -80°C for later use; mix equal volumes of the extracts of all samples to make quality control samples (QC).

[0040] (2) The samples were detected using a Waters ACQUITY UPLC I-Class plus ultra-high performance liquid phase tandem high-resolution mass spectrometer. Chromatographic conditions: Chromatographic column: ACQUITY UPLC HSS T3 (100 mm×2.1 mm, 1.8 μm); column temperature: 45°C; mobile phase: water (containing 0.1% formic acid), acetonitrile; flow rate: 0.35 mL / min; injection volume: 3 μL; elution gradient: 0 min water: acetonitrile volume ratio of 95:5, 4 min water: acetonitrile volume ratio of 70:30, 8 min water: acetonitrile volume ratio of 50:50, 10 min water: acetonitrile volume ratio of 20:80, 14 min water: acetonitrile volume ratio of 0:100, 15.1 min water: acetonitrile volume ratio of 95:5. The separated samples were subjected to mass spectrometry analysis. Mass spectrometry conditions: The sample mass spectrometry signal was acquired by scanning positive and negative ions separately, and the specific acquisition mode was DDA (data dependent acquisition) data dependent scanning mode.

[0041] (3) The change of the charge-to-mass ratio (m / z) between 876.4→308.1 was used for the quantitative analysis of paclitaxel, and the change of the charge-to-mass ratio (m / z) between 876.4→531.2 and 876.4→591.4 was used for the verification analysis of paclitaxel. Paclitaxel (≥99%; CAS: 33069-62-4) standard was purchased from Aladdin Biochemical Technology (Shanghai, China) Co., Ltd. Figure 5 As shown, CK was the control group and HKL13 was the experimental group.

[0042] Example 5: Effects of endophytic fungus HKL13 on the expression levels of taxol synthesis-related genes in leaves of Taxus chinensis var. mairei

[0043] (1) Total RNA of HKL13 experimental group and control group was extracted using TIANGEN RNAprep Pure Plant Kit, and transcriptome library was constructed and sequenced after passing quality inspection. The integrity of total RNA of samples was detected using Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA), and transcriptome library was constructed using VAHTS Universal V5 RNA-seq Library Prep Kit. The library was sequenced using Illumina Novaseq 6000 sequencing platform to generate 150 bp double-end reads; fastp software was used for processing to obtain clean reads for subsequent data analysis.

[0044] (2) HISAT2 software was used to align the genome of Taxus chinensis and calculate gene expression (FPKM). HTSeq-count was used to obtain the read counts of each gene. R (v 3.2.0) was used to perform PCA analysis and plot the samples to evaluate the biological replication of the samples. DESeq2 software was used to perform differentially expressed gene analysis, and differentially expressed genes (DEGs) were defined as genes that met the thresholds of P value < 0.05 and foldchange > 2 or foldchange < 0.5.

[0045] (3) The taxol biosynthesis-related genes and their IDs to be detected are: TS (ctg5306_gene.4), TS (ctg7747_gene.1), T13OH (ctg593_gene.12), TBT (ctg4165_gene.7), T5OH (ctg11276_gene.1), DBTNBT (ctg195_gene.25) and T7OH (ctg12564_gene.1). The expression levels of taxol biosynthesis-related genes in taxus chinensis treated with endophytic fungus HKL13 are shown in the figure. Figure 6 shown.

[0046] SEQ ID NO.1: HKL13

[0047] gcttgtactgcggaggacattactgaatgtaataacttctattgaaaggttccagagtaggcgctacaacgccgaaatgaccttctcacccttgtgtactcactatgttgctttggcgggtcgacctggttccgacccaggcggccggcgcccccagccttaactggccaggacgcccggctaagtgcccgccagtatacaaaactcaagaattcattttgtgaagtcctgatatatcatttaattgattaaaactttcaacaacggatctcttggttctggcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcacattgcgccctctggtattccggagggcatgcctgttcgagcgtcatttcaaccctcaagctctgcttggtattgggcaacgtccgctgccggacgtgccttgaagacctcggcgacggcgtcctagcctcgagcgtagtagtaaaatatctcgctttggagtgctgggcgacggccgccggacaatcgaccttcggtctatttttccaaggttgacctcggatcaggtagggatacccgctgaacttaagcataca

Claims

1. A fungal strain of the genus genus endophytic to Taxus chinensis, It is characterized in that The strain is Guignardia sp. HKL13, the deposit number is CCTCC NO: M2024233, the deposit date is January 26, 2024, the depository is China Center for Type Culture Collection, and the deposit address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

2. The endophytic Glomerella fungus strain of Taxus chinensis according to claim 1, It is characterized in that The ITS base sequence of the strain is shown in SEQ ID NO.

1.

3. Use of the endophytic Glomerella fungus strain of Taxus chinensis as claimed in any one of claims 1 to 2 in promoting the biosynthesis of paclitaxel in Taxus chinensis.

4. Use of the endophytic Glomerella fungus strain of Taxus chinensis according to any one of claims 1 to 2 in promoting the expression of genes related to paclitaxel synthesis in Taxus chinensis.

5. A microbial agent, It is characterized in that The microbial agent contains the endophytic Glomerella fungus strain of Taxus chinensis as described in any one of claims 1-2.

6. The microbial agent according to claim 5, It is characterized in that The microbial agent is spore liquid.

7. The microbial agent according to claim 6, It is characterized in that The spore liquid is prepared by the following steps: inoculating the endophytic Glomerella fungus strain HKL13 of Taxus chinensis into a PDB solid culture medium, culturing in an incubator at a temperature of 28° C. for 5 to 7 days, and filtering under reduced pressure to obtain a spore-containing solution after spores are generated, namely the spore liquid.

8. A method for increasing the content of paclitaxel in the needles of Taxus chinensis var. mairei. It is characterized in that The method comprises: spraying the microbial agent described in claim 5 on the seedlings of Taxus chinensis var. mairei.

Images