Application of CtANR3 gene in cultivation of high-content yellow pigment safflower new strain

Abstract

The invention discloses application of a CtANR3 gene in cultivation of a new high-yellow-pigment-content safflower strain, and belongs to the technical field of molecular biology, cDNA obtained by reverse transcription of petal RNA in the full-bloom stage of Jinhong No.1 safflower is taken as a template, amplification is carried out by a specific primer, and a full-length sequence 1014bp of a coding region is obtained and named as CtANR3. The research finds that after the safflower CtANR3 gene is instantaneously silenced, the content of safflower yellow is obviously reduced; according to the constructed safflower CtANR3 gene plant expression vector, the yellow pigment content of the overexpressed CtANR3 gene is remarkably improved in a transfected red flower variety.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a CtANR3 gene and an application thereof in a new strain with increased safflower yellow pigment content. Background Art

[0002] In recent years, with the enhancement of people's health awareness, the demand for natural pigments has gradually increased. As an important medicinal plant and food colorant, safflower (Carthamustinctorius L.) has important pharmacological activities and has attracted widespread attention due to the rich yellow pigment in its petals. Saffower Yellow is one of the main components of safflower. It has multiple pharmacological effects such as antioxidant, anti-inflammatory, and hypolipidemic, and is widely used in traditional Chinese medicine, food, cosmetics and other fields. Summary of the invention

[0003] The purpose of the present invention is to increase the content of safflower yellow pigment, and to provide a CtANR3 gene and its application in increasing the content of safflower yellow pigment.

[0004] A CtANR3 gene, the nucleotide sequence of which is shown in the sequence listing SEQ ID NO.1;

[0005] A plasmid pGreenIISK-CtANR3 is obtained by inserting the CtANR3 gene into pGreenIISK.

[0006] The safflower CtANR3 gene is used to increase the content of safflower yellow pigment.

[0007] The present invention provides an application of CtANR3 gene in cultivating a new safflower strain with high yellow pigment content, belonging to the field of molecular biology technology. The cDNA obtained by reverse transcription of RNA of petals of Jihong No. 1 safflower in full bloom is used as a template, and amplified with specific primers to obtain a 1023bp full-length sequence of the coding region, which is named CtANR3. Studies have shown that after transient silencing of the safflower CtANR3 gene, the yellow pigment content is significantly reduced. The constructed safflower CtANR3 gene plant expression vector significantly increases the yellow pigment content in safflower varieties by overexpressing the CtANR3 gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0008] Figure 1 Hydroxysafflor yellow A standard reference solution;

[0009] Figure 2 The content of safflower yellow pigment in the M6 ​​strain;

[0010] Figure 3 The content of safflower yellow pigment in the M35 strain;

[0011] Figure 4 The electrophoresis results of RNA extraction from the petals of red flowers of the Jihong No. 1 variety;

[0012] Fig. 5 PCR electrophoresis of CtANR3 gene;

[0013] Figure 6 The expression level of CtANR3 gene in the two strains;

[0014] Figure 7 PCR identification of CtANR3 gene in bacterial culture;

[0015] Figure 8 Transient silencing of safflower CtANR3 gene and determination of safflower yellow pigment content;

[0016] Fig. 9 Transient overexpression of safflower CtANR3 gene and determination of safflower yellow pigment. DETAILED DESCRIPTION

[0017] Example 1 HPLC analysis of safflower yellow pigment content in strains obtained by mutagenesis of Jihong No. 1 safflower variety

[0018] 1) Materials

[0019] The Jihong No. 1 safflower variety was induced to undergo mutation treatment using cobalt-60 mutagenesis technology, and 42 genetically stable safflower lines were obtained. Safflower petals from different lines were selected as research objects, and 0.1 gram of safflower petals from each line were weighed and processed using a high-speed grinder.

[0020] 2) Safflower yellow pigment extraction Xiuming lui 001

[0021] Add 1.4 times the amount of water as the sample; perform ultrasonic extraction at 55°C for 30 minutes with an ultrasonic power of 200 W. Repeat this step twice. Filter the extract using a 0.22 µm nylon membrane and collect the upper liquid phase for analysis.

[0022] 3) HPLC analysis of safflower yellow pigment content

[0023] An Agilent XDB-C18 column (250 mm×4.6 mm, 5 μm) was used; the mobile phase was 0.4% formic acid (A)-methanol (B) in a ratio of 7:3.

[0024] The detection wavelength was 402 nm; the flow rate was 1 mL / min; and the column temperature was 25°C.

[0025] like Figure 1 , 2As shown in Figure 3, using hydroxysafflor yellow A standard as a control, the safflor yellow content in 42 safflower varieties was determined by HPLC. The results of repeated measurements showed that the safflor yellow content in the M6 ​​strain was the highest, at 33.7642-48.5638 mg / g, and the safflor yellow content in the M35 strain was the lowest, at 0.6468-0.9842 mg / g.

[0026] Example 2 Cloning of the coding region sequence of the CtANR3 gene

[0027] 1. RNA extraction from safflower petals

[0028] 1) Wrap the tweezers, mortar, pestle and medicine spoon with tin foil, dry-heat sterilize them in a 180℃ oven for 4 hours, and set aside;

[0029] 2) Treat 1.5mL centrifuge tubes and pipette tips with 0.1% DEPC water overnight, then sterilize them by high pressure sterilization at 120℃ for 20min, and place them in a 60℃ oven to dry for later use;

[0030] 3) Take about 100 mg of safflower petals, add liquid nitrogen and grind quickly into fine powder, divide into two 1.5 mL EP tubes, add 1 mL RNAiso Plus to each tube, mix well, and let stand at room temperature for 5 minutes;

[0031] 4) Centrifuge at 12000 rpm for 5 min at 4°C and transfer the supernatant to a new 1.5 mL centrifuge tube;

[0032] 5) Add chloroform in the amount of 1 / 5 of the volume of RNAiso Plus, shake, mix, and let stand at room temperature for 5 minutes;

[0033] 6) Centrifuge at 4°C, 12,000 rpm for 15 min, and transfer the supernatant to a new 1.5 mL centrifuge tube;

[0034] 7) Add isopropanol of equal volume to the supernatant, let stand at room temperature for 10 min, and centrifuge at 12,000 rpm for 10 min at 4°C;

[0035] 8) Discard the supernatant and take the precipitate. Add 1 mL of 75% ethanol to the precipitate to wash it. Centrifuge at 12,000 rpm for 5 min at 4°C. Repeat this step once.

[0036] 9) Discard the supernatant and keep the precipitate, and let it dry at room temperature;

[0037] 10) Dissolve RNA in RNA-Free water and store the extracted RNA at -80℃ until use.

[0038] 11) The concentration of safflower total RNA samples was measured using NanoDrop2000 ultra-micro spectrophotometer (purchased from Thermo).

[0039] 12) RNA purity was tested by 2% agarose gel electrophoresis. After electrophoresis, the gel was stained with nucleic acid dye and photographed on a UV gel imaging system. Figure 4 ,Depend on Figure 1 Two clear bands of 28S and 18S can be seen, and the brightness of the 28S band is about twice that of the 18S band. This indicates that the RNA extraction is complete and not degraded, and can meet the needs of subsequent experiments.

[0040] 2. Synthesis of the first-strand cDNA

[0041] The RNA stored at -80°C was taken and the concentration of RNA was detected by nanogrop. The concentration of extracted RNA was about 1000 ng / ul. The reverse transcription of cDNA was performed according to the operating instructions of the reverse transcription kit. The reverse transcription reaction system is shown in Tables 1 and 2. The reverse transcribed cDNA was stored in a -20°C refrigerator for later use.

[0042] Table 1 The first round of reverse transcription reaction system

[0043] ;

[0044] Carry out the following reaction on a PCR instrument: 65°C, 5 min, and quickly cool on ice.

[0045] Table 2 Second round reverse transcription reaction system

[0046] ;

[0047] Reverse transcription reaction conditions

[0048] 42℃ 55min

[0049] 70℃ 10min

[0050] The cDNA was cooled on ice and used for subsequent reactions and then stored at -20°C for future use.

[0051] 3. Cloning of the coding region sequence of CtANR3 gene

[0052] Our research group previously sequenced the whole genome of safflower and annotated the safflower CtANR3 (anthocyanin reductase) gene. Using the petal cDNA of safflower as a template, we designed specific primers for RT-PCR amplification based on the coding region sequence annotated in the genome. The designed cloning primers are as follows:

[0053] CtANR3f: ATGGAAGAGAGTAAAAGCAGC

[0054] CtANR3f: TCACGATCTCTTAGCACATTC

[0055] The cDNA obtained by reverse transcription of RNA from the petals of Jihong No. 1 safflower during its blooming period was used as a template for amplification. The amplified product was connected to the pEASY-T1 cloning vector (Beijing Quanshijin Biotechnology Co., Ltd.) and transformed into DH5α Escherichia coli competent cells. The culture medium PCR ( Figure 5 ) After verification, it was sent for sequencing, and the sequencing result was correct. The full-length sequence of the coding region was obtained, 1023bp, and was named CtANR3. Its base sequence is shown in the sequence list SEQ ID NO.1, and its amino acid sequence is shown in the sequence list SEQ ID NO.2.

[0056] Example 3 Expression analysis of CtANR3 gene in two strains

[0057] Total RNA from petals of two safflower lines, M6 and M35, was extracted and reverse transcribed to synthesize the first-strand cDNA template. The fluorescent quantitative PCR primers of CtANR3 gene were designed using the primer design online website (http: / / www.primer3plus.com / cgi-bin / dev / primer3plus.cgi), and the fluorescent quantitative PCR reaction was performed using the TB Green® Premix Ex Taq™ (TaKaRa) kit. The reaction system is shown in Table 3. The machine used for fluorescent quantitative analysis was Agilent Mx3000P, and the relative expression level was 2 -△△Ct The calculation was performed by 3 replicates for each sample. The results showed that the expression level of CtANR3 gene in M6 strain was significantly higher than that in M35 strain (see Figure 6 ).

[0058] Table 3 qRT-PCR reaction system

[0059] Tab.3 qRT-PCR reaction system

[0060] Reagents Usage TB Green Premix Ex Taq (2×) 10 μL PCR Forward Primer (10 μM) 0.4 μL PCR Reverse Primer (10 μM) 0.4 μL ROX Reference Dye II (50X) 0.4 μL cDNA 1 μL <![CDATA[RNase Free dH2O]]> Up to 20 μL

[0061] The reaction procedure adopts Normal 2 step, as follows:

[0062] Example 4 Construction of plant expression vector of safflower CtANR3 gene

[0063] The CtANR3 coding region fragments containing homology arms of Xho I and Hind III restriction sites were amplified by TransStart® FastPfu Fly DNA Polymerase (Beijing Quanshijin Biotechnology Co., Ltd.), and the pTRV2 and pGreenIISK vectors were digested with FlashcutTM Xho I and FlashcutTM Hind III (Mona (Wuhan) Biotechnology Co., Ltd.) and purified with a DNA purification kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.). The target fragment was connected to the linearized vector using a single fragment seamless cloning kit (Mona (Wuhan) Biotechnology Co., Ltd.), and the ligation product was transformed into Escherichia coli DH5α competent cells. Transformants were screened on a resistance plate containing kanamycin (50 mg / L), and the bacterial solution was identified by PCR after the single clone was shaken ( Figure 7 ), both had the target bands, indicating that the expression vectors were successfully constructed and named pTRV2-CtANR3 and pGreenIISK-CtANR3.

[0064] Example 5 Transformation of Agrobacterium competent cells

[0065] The target gene was transformed into Agrobacterium using the freeze-thaw method. The process is as follows:

[0066] 1) Add 1µl of pTRV2-CtANR3 and pGreenIISK-CtANR3 plasmid DNA into 100µl of Agrobacterium EHA105 competent cells and refrigerate in liquid nitrogen for 5 minutes;

[0067] 2) Quickly place it in a 37°C water bath and heat shock for 5 minutes;

[0068] 3) Add 1 ml of fresh YEP culture medium to the centrifuge tube and shake the bacteria on a shaker at 28°C for 2-4 hours;

[0069] 4) Take 50μl-100μl of the transformed bacterial solution and apply it on a solid LB plate containing 50μg / ml kan + 100μg / ml Rif, culture it in a 28℃ incubator for 2-3 days, and screen the transformants;

[0070] 5) Pick a single clone of bacteria and inoculate it into Agrobacterium liquid culture medium, culture it at 28°C until OD600≈0.8, and take 1 μl of the bacterial solution for PCR detection, using the same method as above;

[0071] 6) The remaining bacterial solution was mixed thoroughly with glycerol at a ratio of 4:1 (V:V), quickly frozen in liquid nitrogen, and then stored at -80°C for later use.

[0072] Example 6 Silencing of the safflower CtANR3 gene and determination of yellow pigment content

[0073] TRV1 and TRV2 are transformed from two strands of the originally complementary double-stranded RNA. Among them, TRV1 can enhance the replication and propagation of TRV2 and play an auxiliary role. When TRV1 and TRV2 are mixed, the partially complementary strands can form double-stranded RNA, which is more stable. The mixed double-stranded RNA can better replicate and propagate in plant cells, thereby achieving gene interference. Therefore, in the experiment, we usually use pTRV1+ pTRV2 as the control group and pTRV1+ pTRV2-target gene as the experimental group.

[0074] Agrobacterium suspension containing pTRV1, pTRV2, and pTRV2-CtANR3 plasmids was cultured to OD600 = 0.8-1.0, and the cells were collected by centrifugation at 5000 rpm, and the cells were resuspended in buffer (10 mM MgCl2, 10 mM MES, 200 μM AS; pH 5.6) to OD600 = 0.8. pTRV1 was mixed with pTRV2 and pTRV2-CtANR3 Agrobacterium suspensions in a ratio of 1:1, respectively, and activated in the dark at 28°C for 3 h, and the leaves near the flower buds were injected with a syringe. The safflower plants were grown in the dark for 1 day and then moved to an artificial climate chamber for 10 days. 0.1 g of petals from the injection sites of the control group and the experimental group were taken, extracted three times with 14 times water, and the supernatants were combined and filtered through a 0.22μm filter membrane to detect the yellow pigment content. It was found that after instantaneous silencing, the yellow pigment content decreased significantly ( Figure 8 ).

[0075] Example 7 Overexpression of Carthamus tinctorius CtANR3 gene and determination of safflower yellow pigment

[0076] The Agrobacterium culture containing pGreenIISK and pGreenIISK-CtANR3 plasmids was cultured to OD600=0.8-1.0, and the cells were collected by centrifugation at 5000 rpm. The cells were resuspended in buffer (10 mM MgCl2, 10 mM MES, 200 μM AS; pH 5.6) to OD600=0.8, and activated in the dark at 28°C for 3 hours. The pGreenIISK and pGreenIISK-CtGRF5 Agrobacterium suspensions were injected into the safflower buds and nearby leaves using a syringe. The safflower plants were grown in the dark for 1 day and then moved to an artificial climate chamber for 8 days. The yellow pigment in the leaves at the injection site was extracted. It was found that after transient overexpression, the content of safflower yellow pigment was significantly increased ( Fig. 9 ).

Claims

1. A CtANR3 gene, the nucleotide sequence of which is shown in the sequence listing SEQ ID NO.

1.

2. A plasmid pGreenIISK-CtANR3, which is obtained by inserting the CtANR3 gene described in claim 1 into pGreenIISK.

3. Use of the CtANR3 gene according to claim 1 in increasing the yellow pigment content of safflower varieties.

Images