Peanut imazethapyr-resistant gene sequence and application thereof in plant transgenosis

Abstract

The invention discloses a peanut imazethapyr-resisting gene sequence and an application of the peanut imazethapyr-resisting gene sequence in plant transgenosis, and discloses a base sequence of a peanut acetolactate synthetase encoding gene and a peanut imazethapyr-resisting gene sequence shown in SEQ ID NO < 3 >, namely an AhALS-376 mutant gene, and the disclosed AhALS-376 mutant gene is composed of 2001 bases; the protein sequence of the acetolactate synthetase encoded by the AhALS gene is shown as SEQ ID NO2, and the protein sequence of the AhALS-376 mutant gene encoding protein is shown as the mutant acetolactate synthetase shown as SEQ ID NO4. According to the application of the obtained AhALS-376 mutant gene as a selection marker gene in cultivation of transgenic arabidopsis thaliana and other transgenic plants, screening application of the peanut acetolactate synthase gene in genetic transformation of plants such as arabidopsis thaliana is realized for the first time; a construction system taking the peanut acetolactate synthase as the selection marker gene is successfully established, and a foundation is laid for application of the peanut acetolactate synthase gene as the selection marker gene to crops such as peanuts.

Description

Technical Field

[0001] The invention belongs to the field of gene engineering technology, relates to plant gene engineering technology, and in particular to a peanut imidazolin-resistant gene sequence and its application in plant transgenics. Background Art

[0002] As an important oil crop and cash crop in my country, peanuts have a large total output, high yield per unit area, high oil yield per unit area, and high planting efficiency per unit area compared with other oil crops. They have great competitive advantages and play an irreplaceable role in ensuring the safe supply of edible oil. In recent years, peanuts have been widely concerned by scientists from various countries as the main research object of genetic transformation technology. The application of transgenic technology has improved many important agronomic traits, such as herbicide resistance and high oleic acid quality.

[0003] In the genetic transformation process, a marker gene or reporter gene that is easy to screen is inserted into an expression vector, and the screening marker gene or reporter gene and the target gene are integrated into the host plant cell chromosome genome to facilitate the screening of successfully transformed transgenic positive cells. Therefore, the development of safe, efficient and easy-to-operate screening marker genes has become one of the hot topics in genetic engineering research.

[0004] At present, the widely used screening marker genes in plant genetic transformation are mainly antibiotic resistance genes and herbicide resistance genes. Antibiotic resistance enzyme genes include neomycin phosphotransferase (nptⅡ) and hygromycin phosphotransferase (HPT). Among them, hygromycin is often used in the genetic transformation of multiple species, such as plants, yeast, fungi, animals, etc., due to its high efficiency and low false positives. In addition, herbicide resistance genes as transgenic screening marker genes mainly include bxn (bromoxynil-specific nitrilase, 3,5-dibromo-4-hydroxy-1-cyanobenzene, a nitrilase that specifically degrades bromoxynil) gene, bar gene (bialaphos resistance, producing phosphinothricin acetyltransferase, resistant to phosphinothricin or glufosinate), etc. These screening marker genes or reporter genes are derived from bacteria or fungi, and the transgenic plants after genetic transformation will carry the screening marker genes. This cross-border transfer of resistance genes from microorganisms to plants or crops has caused public concern about the safety of eating genetically modified foods, and therefore there are technical and policy limitations such as genetically modified safety assessments.

[0005] In recent years, more and more attention has been paid to the research on transgenic crops by modifying the resistance genes of plants or crops themselves and using the endogenous resistance genes of crops as screening marker genes for transgenic positive detection.

[0006] Acetolactate synthase ALS (Acetolactate synthase) is a key enzyme in the biosynthesis pathway of branched-chain amino acids (leucine Leu, isoleucine Ile, valine Val) in plants, and is also the target of acetolactate synthase inhibitor herbicides in plants. ALS inhibitor herbicides inhibit the activity of the ALS enzyme, resulting in the blockage of the synthesis of branched-chain amino acids such as Val, Leu and Ile, abnormal protein synthesis in the body, and ultimately leading to plant metabolic disorders, growth stagnation, and subsequent death. In a series of studies at home and abroad, through site-directed mutagenesis of the ALS gene, the key amino acid residues of the herbicide recognition and binding sites of the encoding enzyme mutated, resulting in a decrease in the sensitivity of ALS to herbicides, thereby making the plant resistant to ALS herbicides.

[0007] Since the biological pathway for the synthesis of branched-chain amino acids catalyzed by ALS only exists in plants and microorganisms, and this metabolic pathway is lacking in humans and animals, ALS inhibitor herbicides are relatively safe for humans and animals and are ideal herbicides for killing weeds. For example, imidazolinone herbicides are a large category of ALS inhibitor herbicides, which are relatively cheap and have unique advantages that other herbicides do not have, such as high efficiency, broad spectrum of weed control, high selectivity, and high safety for humans and animals. Based on this, using the endogenous ALS gene of peanuts that is resistant to imidazolinone herbicides as a transgenic screening marker or reporter gene can avoid the transgenic safety risks brought about by heterologous gene transformation from bacteria and other sources, and is relatively safe for humans and animals, and can become a new screening marker gene. Summary of the invention

[0008] The purpose of the present invention is to achieve site-directed mutagenesis of the peanut endogenous ALS gene and to use the peanut acetolactate synthase (ALS) gene as a screening marker gene in the cultivation of transgenic plants. The application can use the imidazolinone herbicide-resistant peanut ALS gene as a transgenic screening marker gene, thereby expanding the scope of transgenic screening markers. Moreover, since the screened genes are plant endogenous genes, stable, efficient and safer transgenic screening markers or reporter genes for humans and animals can be obtained.

[0009] The technical solution adopted by the present invention provides a peanut imidazole acetolactate synthase resistance gene sequence, the key is that the base sequence of the peanut imidazole acetolactate synthase encoding gene is as shown in SEQ ID NO1, named AhALS gene, the above-mentioned peanut imidazole acetolactate synthase resistance gene sequence is a peanut acetolactate synthase mutant gene as shown in SEQ ID NO3, named AhALS-376 mutant gene, and the above-mentioned AhALS-376 mutant gene consists of 2001 bases; the protein sequence of the acetolactate synthase encoded by the above-mentioned AhALS gene is as shown in SEQ ID NO2, named ALS protein sequence, and the above-mentioned AhALS-376 mutant gene encodes a mutant acetolactate synthase as shown in SEQ ID NO4.

[0010] Specifically, the above-mentioned AhALS-376 mutant gene is derived from the site-directed mutation of the peanut acetolactate synthase encoding gene, and the above-mentioned site-directed mutation refers to the introduction of a mutation site at the 1113th base in the coding region of the AhALS gene sequence, so that T mutates to A; the protein sequence of the above-mentioned mutant acetolactate synthase is obtained by the mutation of the 376th amino acid of the above-mentioned ALS protein sequence from Asp to Glu.

[0011] Specifically, the above-mentioned site-directed mutagenesis refers to PCR-mediated site-directed mutagenesis of the peanut endogenous AhALS gene sequence to obtain the above-mentioned AhALS-376 mutant gene.

[0012] Furthermore, before the above-mentioned PCR-mediated site-directed mutagenesis, the AhALS gene must be cloned, and the specific operation is as follows:

[0013] S1. Determine the AhALS gene sequence of peanut by querying the gene database;

[0014] S2, design gene-specific primers;

[0015] S3. The genomic DNA of peanut leaves was extracted by CTAB method, the AhALS gene sequence was cloned by PCR and the obtained AhALS sequence was sequenced and identified.

[0016] Preferably, the above-mentioned PCR-mediated site-directed mutagenesis refers to achieving site-directed mutagenesis mediated by 3 PCRs to obtain the AhALS-376 mutant gene, and the primers for the first PCR reaction are:

[0017] AhALS-F: 5'-ATGGCTGCCACTGCTTCCA-3' and

[0018] AhALS_T1113a-R: 5'-ACACGTTCATCAAATCTCACCCCA-3';

[0019] The second PCR reaction primers are:

[0020] AhALS_T1113a-F: 5'-TGTGACGGGGAAAGCTTGAGG-3' and

[0021] AhALS-R: 5'-TCAATATTTTGTTCTGCCATCGCCT-3';

[0022] The primers for the third PCR reaction are the primer AhALS-F and the primer AhALS-R;

[0023] The program of the above three PCRs is: deformation at 97°C ~ 99°C for 28s ~ 32s, pre-denaturation at 97°C ~ 99°C for 8s ~ 12s, amplification at 58°C ~ 62°C for 4s ~ 6s, extension at 70°C ~ 74°C for 8s ~ 12s, a total of 32 ~ 38 cycles, and final extension at 70°C ~ 74°C for 0.8min ~ 1.2min.

[0024] More specifically, the gene-specific primers in the above-mentioned step S2 are the above-mentioned primer AhALS-F and the primer AhALS-R;

[0025] The PCR program of the above-mentioned S3 step is: deformation at 97°C ~ 99°C for 28s ~ 32s, pre-denaturation at 97°C ~ 99°C for 8s ~ 12s, amplification at 58°C ~ 62°C for 4s ~ 6s, extension at 70°C ~ 74°C for 8s ~ 12s, a total of 32 to 38 cycles, and final extension at 70°C ~ 74°C for 0.8min ~ 1.2min.

[0026] The application of the peanut imidazolin-resistant gene sequence in plant transgenic plants. The key to the above-mentioned peanut imidazolin-resistant gene sequence is to use the above-mentioned AhALS-376 mutant gene as a screening marker gene in transgenic plants.

[0027] Furthermore, the AhALS-376 mutant gene was introduced into transgenic plants, and the transgenic plants were obtained by screening with imidazolinone herbicides.

[0028] Specifically, introducing the AhALS-376 mutant gene into Arabidopsis refers to inserting the AhALS-376 mutant gene as a screening marker gene for resistance to imidazolinone herbicides into a plant expression vector, constructing a recombinant expression vector, and then transforming the above-mentioned recombinant expression vector into Arabidopsis plants through an Agrobacterium-mediated method; the above-mentioned Arabidopsis plants are screened on a screening medium containing glufosinate and imidacloprid, and the above-mentioned glufosinate screening concentration is 9 mg / L, and the imidacloprid concentration is 1 mg / L.

[0029] More specifically, the specific method for constructing the recombinant expression vector is as follows: cloning the AhALS gene and the AhALS-376 mutant gene into the pCAMBIA3301 plant expression vector, using the constitutively expressed CaMV 35S promoter to drive the AhALS gene and the AhALS-376 mutant gene, constructing a recombinant plasmid expression vector containing the AhALS gene and the AhALS-376 mutant gene, transforming the above recombinant plasmid expression vector into the Agrobacterium GV3101 strain by electric shock to obtain a recombinant strain, extracting the plasmid for PCR and enzyme digestion identification, and obtaining a recombinant strain of the plant expression vector containing the endogenous gene AhALS gene and the resistance gene AhALS-376 mutant gene;

[0030] The gene-specific primers designed in the above-mentioned specific method for constructing a recombinant expression vector are:

[0031] AhALS-T1113AsacF:5'-GC GAGCTC ATGGCTGCCACTGCTTCCA-3' and AhALS-T1113AsmaR:5'-TCC CCCGGG TCAATATTTTGTTCTGCCATCGCCT-3'.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] The present invention obtains the AhALS-376 mutant gene with the sequence shown in SEQ ID NO3 by site-directed mutagenesis, introduces a mutation site at the 1113th base of the AhALS gene coding region (counted as the 1st base by the start codon ATG), mutates one base, that is, T mutates to A, and the remaining nucleotide sequence of the AhALS-376 mutant gene is no different from the nucleotide sequence of the endogenous AhALS gene of peanut. The mutation only causes the 376th Asp of the protein sequence to be changed to Glu, that is, SEQ ID NO4 has no difference from the sequence SEQ ID NO2 except the Asp376Glu site, and no mutation occurs at other sites.

[0034] The present invention uses the obtained AhALS-376 mutant gene as a screening marker gene in the cultivation of transgenic Arabidopsis and other transgenic plants, realizing for the first time the screening application of peanut acetolactate synthase gene in the genetic transformation of plants such as Arabidopsis. The present invention uses peanut AhALS-376 as a screening marker gene. Compared with other screening marker genes, the screening marker gene of the present invention is derived from a natural endogenous gene of the plant, and no exogenous gene is inserted into the crop genome, so no substances toxic to humans and animals are produced, no potential allergens are present, and no anti-nutritional factors are produced.

[0035] The present invention successfully establishes a transformation and screening system using peanut acetolactate synthase as a screening marker gene, constructs a high-throughput identification method based on the screening marker genotype, and lays a foundation for the application of peanut acetolactate synthase gene as a screening marker gene in crops such as peanuts. The transgenic offspring identification and selection system established by the present invention belongs to a positive selection system, is simple to operate, does not require exogenous gene deletion operation, has a short selection time, and is highly efficient. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Schematic diagram of the constructed plant expression vectors pCAMBIA3301-AhALS-Bar and pCAMBIA3301-AhALS376-Bar.

[0037] Figure 2 This is the enzyme cutting verification diagram during vector construction.

[0038] Figure 3 This is the electrophoresis diagram of the plants that were positive for PCR detection.

[0039] Figure 4 The growth conditions of control and transgenic Arabidopsis in 1 / 2MS medium (without herbicide added).

[0040] Figure 5 The growth conditions of control and transgenic Arabidopsis in 1 / 2MS+9mg / L glufosinate medium.

[0041] Figure 6 The growth conditions of control and transgenic Arabidopsis in 1 / 2MS+1mg / L imidazole acetylcholine medium.

[0042] Figure 7 These are Arabidopsis plants grown in 1 / 2MS, 1 / 2MS+9mg / L glufosinate-ammonium, and 1 / 2MS+1mg / L imidazopyralid medium.

[0043] Figure 8 The root length differences of Arabidopsis plants grown in 1 / 2MS, 1 / 2MS+9mg / L glufosinate, and 1 / 2MS+1mg / L imidazole acetonitrile medium.

[0044] Fig. 9 The difference in fresh weight of individual Arabidopsis plants grown in 1 / 2MS, 1 / 2MS+9mg / L glufosinate, and 1 / 2MS+1mg / L imidazopyrine culture media.

[0045] Fig.10 The genotypes of individual Arabidopsis plants expressing the KASP marker were detected in the AhALS-376 transgenic offspring.

[0046] In the accompanying drawings, 1 is a wild-type control plant Col-0, 2 is a transgenic pure line plant transformed with GV-pCAMBIA3301-AhALS-Bar, 3 is a transgenic pure line plant transformed with GV-pCAMBIA3301-AhALS376-Bar, 4 is a wild-type control plant Col-0, 5 is a transgenic pure line plant transformed with GV-pCAMBIA3301-AhALS-Bar, and 6 is a transgenic pure line plant transformed with GV-pCAMBIA3301-AhALS376-Bar , 7 is the wild-type control plant Col-0, 8 is the transgenic pure line plant transformed with GV-pCAMBIA3301-AhALS-Bar, 9 is the transgenic pure line plant transformed with GV-pCAMBIA3301-AhALS376-Bar, 10 is the wild-type control plant Col-0, 11 is the transgenic pure line plant transformed with GV-pCAMBIA3301-AhALS-Bar, and 12 is the transgenic pure line plant transformed with GV-pCAMBIA3301-AhALS376-Bar. DETAILED DESCRIPTION

[0047] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0048] The glufosinate (C5H 15 N2O4P, Shanghai MacLean Biochemical Technology Co., Ltd.), high-fidelity PCR 2x Phanta Flash Master Kit (Shanghai Union Biotechnology Co., Ltd.), agarose gel DNA recovery kit (enhanced) (Tiangen Biochemical Technology (Beijing) Co., Ltd.), 5% imidazolyl nicotinic acid (2-[4,5-dihydro-4-methyl-4-(1-methylethyl)-5-oxo-1H-imidazol-2-yl]-5-ethyl-3-pyridinecarboxylic acid aqueous solution, Xianda Co., Ltd.), 1 / 2MS culture medium (Beijing Coolaibo Technology Co., Ltd.).

[0049] If no specific conditions are specified in the examples, the experiments can be carried out under conventional conditions; if no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0050] Embodiment 1

[0051] 1) Cloning of AhALS gene

[0052] S1. The peanut AhALS gene is numbered arahy.Tifrunner.gnm2.ann1.881M8L.1 in the Peanutbase (https: / / www.peanutbase.org) database. According to the comparison between the nucleotide sequence of its coding region and the genome sequence, the gene does not contain introns. The gene is 2001 bp long and is located at Chr10: 2637177-2639177. It encodes the cultivated peanut acetolactate synthase III (Arachis hypogaea acetolactate synthase 3, chloroplastic-like, LOC112714609).

[0053] S2. Design gene-specific primers to clone the full-length sequence of the endogenous AhALS gene from the genome of peanut line JKD1547-001. The primers are as follows:

[0054] AhALS-F: 5'-ATGGCTGCCACTGCTTCCA-3' and

[0055] AhALS-R: 5'-TCAATATTTTGTTCTGCCATCGCCT-3';

[0056] S3. The genomic DNA of peanut leaves was extracted by CTAB method, and the AhALS gene sequence was cloned by PCR.

[0057] According to the instructions of the 2x Phanta Flash Master Kit, a 40 μL PCR reaction system was prepared: MixPCR 20 μL, AhALS-F and AhALS-R 1 μL each, DNA solution 2 μL (20 ng / μL), ddH2O 16 μL. Amplification was performed on the plate with the following program: 98°C deformation for 30 s, 98°C pre-denaturation for 10 s, 59°C amplification for 5 s, 72°C extension for 10 s, for a total of 35 cycles, and 72°C final extension for 1 min.

[0058] After separation by 1.2% (w / v) agarose gel electrophoresis, the DNA was purified and recovered using an agarose gel DNA recovery kit, connected to the cloning vector pMD19-T Simple Vector, and heat-shock transformed into the competent Top10 strain.

[0059] After blue-white screening and colony PCR identification, the positive monoclones were sent to Qingke Biotechnology for sequencing.

[0060] 2) Acquisition of AhALS-376 mutant gene

[0061] After sequencing and identification, the AhALS-376 gene was obtained by direct mutagenesis mediated by 3 times of PCR. The specific primers used in the PCR-based DNA site-directed mutagenesis were:

[0062] Primers for the first PCR reaction:

[0063] AhALS-F: 5'-ATGGCTGCCACTGCTTCCA-3' and

[0064] AhALS_T1113a-R: 5'-ACACGTTCATCAAATCTCACCCCA-3';

[0065] PCR amplification was performed using the 2x Phanta Flash Master Kit, and the target DNA fragment was purified and recovered. The reaction system (total volume 40 μL) included 20 μL of MixPCR, 1 μL each of AhALS-F and AhALS_T1113a-R, 2 μL of DNA solution (20 ng / μL), and 16 μL of ddH2O. The program was: 98°C pre-denaturation for 30 s, 98°C denaturation for 10 s, 58°C amplification for 5 s, 72°C extension for 10 s, for a total of 35 cycles, and 72°C final extension for 1 min.

[0066] The PCR reaction solution was subjected to 1% agarose gel electrophoresis, and then the gel was cut to recover the target DNA fragment.

[0067] Second PCR reaction primers:

[0068] AhALS_T1113a-F: 5'-TGTGACGGGGAAAGCTTGAGG-3' and

[0069] AhALS-R: 5'-TCAATATTTTGTTCTGCCATCGCCT-3';

[0070] PCR amplification was performed using the 2x Phanta Flash Master Kit, and the target DNA fragment was purified and recovered. The reaction system (total volume 40 μL) included 20 μL of MixPCR, 1 μL each of AhALS_T1113a-F and AhALS-R, 2 μL of DNA solution (20 ng / μL), and 16 μL of ddH2O. The program was: 98°C pre-denaturation for 30 s, 98°C denaturation for 10 s, 60°C amplification for 5 s, 72°C extension for 10 s, for a total of 35 cycles, and 72°C final extension for 1 min.

[0071] The PCR reaction solution was subjected to 1% agarose gel electrophoresis, and then the gel was cut to recover the target DNA fragment.

[0072] Primers for the third PCR reaction:

[0073] AhALS-F: 5'-ATGGCTGCCACTGCTTCCA-3' and

[0074] AhALS-R: 5'-TCAATATTTTGTTCTGCCATCGCCT-3';

[0075] PCR amplification was performed using the 2x Phanta Flash Master Kit, and the target DNA fragment was purified and recovered. The reaction system (total volume 40 μL) was as follows: MixPCR 20 μL, AhALS-F and AhALS-R 1 μL each, 2 μL of the DNA mixed solution obtained from the first two PCRs, and 16 μL of ddH2O. The program was: 98°C pre-denaturation for 30 s, 98°C denaturation for 10 s, 60°C amplification for 5 s, 72°C extension for 10 s, a total of 35 cycles, and 72°C final extension for 1 min.

[0076] The PCR reaction solution was subjected to 1% agarose gel electrophoresis, and then the gel was cut to recover the target DNA fragment.

[0077] Sequencing confirmed that the target fragment had undergone site-directed mutation at the corresponding site: T1113A. The mutant gene was named AhALS-376 mutant gene, and its sequence was shown in SEQ ID NO3. The mutation caused the 376th position of the protein sequence to be changed from Asp to Glu, and the sequence of the encoded mutant protein was shown in SEQ ID NO4.

[0078] The remaining nucleotide sequence of the AhALS-376 mutant gene is no different from the nucleotide sequence of the peanut endogenous AhALS gene (shown in sequence SEQ ID NO1), and the sequence SEQ ID NO4 is no different from the sequence SEQ ID NO2 except for the Asp376Glu site, and no mutation has occurred in other sites.

[0079] 3) Construction of plant overexpression vector

[0080] The AhALS gene and the AhALS-376 mutant gene were cloned into the pCAMBIA3301 plant expression vector, and the constitutively expressed CaMV 35S promoter was used to drive the AhALS gene and the AhALS-376 mutant gene to construct a recombinant plasmid expression vector containing the AhALS gene and the AhALS-376 mutant gene.

[0081] S1. Gene-specific primers (with restriction sites and protective bases) were designed according to the restriction sites of the multiple cloning site on the pCAMBIA3301 vector carrying the resistance selection marker gene Bar, and the CDS sequences of the endogenous gene AhALS gene and the AhALS-376 mutant gene (from the start codon to the stop codon) were amplified by PCR from the templates, respectively. Then, they were TA-ligated to the prokaryotic expression vector pMD19-T Simple Vector, and transformed into the competent cell Top10 strain, respectively. The recombinant TA cloning vectors with correct sequences verified by sequencing were named pMD19-AhALS and pMD19-AhALS-376.

[0082] S2. Extract plasmids separately, double-digest the target fragments, digest pCAMBIA3301 with the same endonuclease, recover the exogenous fragments and vector, connect the two fragments, transform the constructed recombinant vector with the target gene into Escherichia coli Top10 strain, pick the resistant positive clones to extract plasmids, and perform double-digestion verification. The results are shown in Figure 2 , Figure 2 The right lane in the middle is 1kbDNAMarker. The sequencing confirmed that the constructed overexpression recombinant vector was completely correct. The verified recombinant vectors containing AhALS and AhALS-376 genes were named pCAMBIA3301-AhALS-Bar and pCAMBIA3301-AhALS376-Bar. The schematic diagram of the constructed plant expression vector pCAMBIA3301-AhALS-Bar and pCAMBIA3301-AhALS376-Bar is shown in the attached figure. Figure 1 .

[0083] The gene-specific primers designed above for constructing the plant expression vectors containing pCAMBIA3301-AhALS-Bar and pCAMBIA3301-AhALS376-Bar are:

[0084] AhALS-T1113AsacF:5'-GGC GAGCTC ATGGCTGCCACTGCTTCCA-3' and

[0085] AhALS-T1113AsmaR:5'-TCC CCCGGG TCAATATTTTGTTCTGCCATCGCCT-3', Note: The underline in the above primers is the SmaI recognition site;

[0086] According to the instructions of the 2x Phanta Flash Master Kit, a 40 μL PCR reaction system was prepared: MixPCR 20 μL, AhALS-T1113AsacF and AhALS-T1113AsmaR 1 μL each, DNA solution 2 μL (20 ng / μL), ddH2O 16 μL. Amplification was performed on the plate with the following program: pre-denaturation at 98°C for 30 s, denaturation at 98°C for 10 s, amplification at 60°C for 5 s, extension at 72°C for 10 s, for a total of 35 cycles, and final extension at 72°C for 1 min.

[0087] pCAMBIA3301-AhALS-Bar and pCAMBIA3301-AhALS376-Bar were transformed into Agrobacterium GV3101 strain by electric shock to obtain recombinant strains. The plasmids were extracted for PCR and enzyme digestion identification. The recombinant strains containing the endogenous gene AhALS and the plant expression vector with the resistance gene AhALS-376 were named GV-pCAMBIA3301-AhALS-Bar and GV-pCAMBIA3301-AhALS376-Bar, respectively.

[0088] 4) Arabidopsis genetic transformation

[0089] Arabidopsis seeds were first washed with 10% NaClO for 2.5 min, repeated twice, and then washed 5 times with sterilized water. The seeds were then spread on 1 / 2MS medium (pH 6.2) and placed at 4°C for 2 days of vernalization. The culture conditions were 21°C ± 1°C, and the photoperiod was 16h light / 8h dark. After 10 days, the grown seedlings were moved into nutrient soil for cultivation.

[0090] Add 1 mL of the recombinant strains GV-pCAMBIA3301-AhALS-Bar and GV-pCAMBIA3301-AhALS376-Bar into 100 mL of LB medium respectively. Place the LB medium with the recombinant strains on a shaker at 28°C and culture overnight at 220 rpm. When the LB in the flask turns orange, measure the OD value of the bacterial solution with a spectrophotometer and it is OD>1.2.

[0091] According to the OD, collect an appropriate amount of bacterial solution in a bacterial collection bottle, centrifuge at 4000 rpm for 10 min, collect the bacterial solution and discard the supernatant.

[0092] Prepare the dyeing buffer: sucrose 50g / L, Silwet 500μL / L, make the volume to 100mL, and adjust the pH to about 5.7 with KOH.

[0093] After preparation, use 50 mL of buffer to resuspend the Agrobacterium cells in a beaker by pipetting, and continuously add or subtract bacterial solution and buffer to keep the OD of the Agrobacterium infection solution between 0.9 and 1.0 (measured value).

[0094] After the Arabidopsis thaliana blooms, the Arabidopsis thaliana is infected. After the infection, the plant is placed flat on a tray, protected from light and cultured in moist conditions. After 24 hours of dark culture, the Arabidopsis thaliana is routinely cultured under the conditions of 16 hours of light, 22°C / 8 hours of darkness, and 18°C.

[0095] Arabidopsis seeds were harvested after maturity, and mixed according to the target gene to obtain T0 generation seeds of pCAMBIA3301-AhALS-Bar and pCAMBIA3301-AhALS376-Bar, which were naturally air-dried.

[0096] T0 generation Arabidopsis seeds were planted. When the seedlings grew to the size of 2 pairs of true leaves, 9 mg / L glufosinate solution was evenly sprayed on the seedlings. The seedlings were sprayed again after an interval of 7 days. After 10 days of normal growth, the growth of Arabidopsis seedlings was recorded and observed. The pCAMBIA3301-AhALS-Bar and pCAMBIA3301-AhALS376-Bar transgenic Arabidopsis positive seedlings were obtained. The DNA of young rosette leaves was extracted from individual plants using primers:

[0097] Bar-F: 5'-GTCAACTTCCGTACCGAGCCG-3' and

[0098] Bar-R: 5'-GCCAGAAACCCACGTCATGC-3',

[0099] PCR positive plants were identified.

[0100] The length of the amplified product was 400 bp. According to the instructions of the 2x Phanta Flash Master Kit, a 40 μL PCR reaction system was prepared: MixPCR 20 μL, Bar-F and Bar-R 1 μL each, DNA solution 2 μL (20 ng / μL), ddH2O 16 μL. Amplification was performed on the plate with the following program: 98°C deformation for 30 s, 98°C pre-denaturation for 10 s, 59°C extension for 5 s, 72°C extension for 5 s, for a total of 35 cycles, and final extension at 72°C for 1 min.

[0101] The amplified products were electrophoresed on 1.2% agarose gel and the band sizes were observed using a gel imaging system after staining with nucleic acid stain.

[0102] Finally, 16 strains were selected as positive transgenic strains. The identification results are shown in the attached Figure 3As shown, attached Figure 3 The last lane in the table is a negative control.

[0103] Select transgenic positive plants carrying the target gene, choose seeds of the T3 generation and inoculate them on the culture medium (containing glufosinate ammonium). If all the seedlings are resistant, they are homozygous plants.

[0104] The genetically stable T3 generation homozygous transgenic strains of pCAMBIA3301-AhALS-Bar and pCAMBIA3301-AhALS376-Bar were obtained by multiplication.

[0105] 5) Identification of herbicide resistance in transgenic Arabidopsis lines

[0106] Wild-type Arabidopsis thaliana Col-0 and T3 transgenic pure line Arabidopsis thaliana seeds pCAMBIA3301-AhALS-Bar and pCAMBIA3301-AhALS376-Bar were planted on 1 / 2MS medium, 1 / 2MS+9mg / L glufosinate-ammonium and 1 / 2MS+1mg / L imidazole acetylcholine medium respectively to observe the growth of the plants.

[0107] Col-0, pCAMBIA3301-AhALS-Bar and pCAMBIA3301-AhALS376-Bar all grew normally on 1 / 2MS medium, and the growth of roots and leaves was consistent. The results are shown in the attached Figure 4 .

[0108] On the 1 / 2MS+9mg / L glufosinate medium, Col-0 seeds could not germinate and their growth was severely inhibited, while pCAMBIA3301-AhALS-Bar and pCAMBIA3301-AhALS376-Bar could grow normally, and their root and leaf growth were basically the same, indicating that the genomes of the two transgenic lines were integrated with the Bar gene and acquired resistance to glufosinate. The results are shown in the attached Figure 5 .

[0109] On 1 / 2MS+1mg / L imidazole acetylcholine medium, the pure line seeds of Col-0 and pCAMBIA3301-AhALS-Bar could not germinate normally, while the pure line seeds of pCAMBIA3301-AhALS376-Bar germinated normally and the seedlings grew normally, indicating that the transgenic strain carried the AhALS376 resistance gene in its genome and had resistance to imidazole acetylcholine herbicide. The results are shown in the attached Figure 6 .

[0110] The degree of herbicide inhibition on root length and fresh weight of Col-0, pCAMBIA3301-AhALS-Bar and pCAMBIA3301-AhALS376-Bar seedlings grown on 1 / 2MS medium, 1 / 2MS + 9 mg / L glufosinate ammonium and 1 / 2MS + 1 mg / L imidazole acetonitrile medium was compared. Three groups of biological replicates were set up, and the average values ​​of root length inhibition rate and fresh weight inhibition rate were taken.

[0111] The root length or fresh weight inhibition rate formula is: Wherein y is the inhibition rate of herbicide on root length or fresh weight (%), a is the root length or fresh weight of Col-0 seedlings (mg), and c is the root length or fresh weight of pCAMBIA3301-AhALS376-Bar transgenic seedlings (mg).

[0112] After calculation and analysis, the inhibition rate of 9 mg / L glufosinate on the root length of pCAMBIA3301-AhALS376-Bar transgenic seedlings was 3.85%, while the inhibition rate of 1 mg / L imazethapyr on the root length was 7.69%, indicating that 1 mg / L imazethapyr has a stronger inhibitory effect on root length than 9 mg / L glufosinate. The results are shown in the attached Figure 8 .

[0113] The inhibition rate of 9 mg / L glufosinate on the fresh weight of pCAMBIA3301-AhALS376-Bar transgenic seedlings was 36.98%, while the inhibition rate of 1 mg / L imazethapyr on the fresh weight of transgenic seedlings was 29.03%, indicating that pCAMBIA3301-AhALS376-Bar was more resistant to 1 mg / L imazethapyr. The results are shown in the attached Fig. 9 .

[0114] Embodiment 2

[0115] The implementation method is the same as that of the first embodiment, except that:

[0116] In “1) Cloning of AhALS gene S3”, in PCR amplification, the program was: 97°C denaturation for 32 s, 99°C pre-denaturation for 8 s, 62°C amplification for 4 s, 74°C extension for 8 s, a total of 32 cycles, and final extension at 74°C for 0.8 min.

[0117] In “2) Obtaining the AhALS-376 mutant gene”, the first PCR reaction procedure was: pre-denaturation at 99°C for 28 s, denaturation at 99°C for 8 s, amplification at 60°C for 4 s, extension at 70°C for 12 s, for a total of 32 cycles, and final extension at 70°C for 0.8 min;

[0118] The second PCR reaction program was as follows: pre-denaturation at 98°C for 28 s, denaturation at 98°C for 8 s, amplification at 60°C for 4 s, extension at 70°C for 9 s, for a total of 34 cycles, and final extension at 74°C for 0.8 / 1.2 min;

[0119] The third PCR reaction program was: 97°C pre-denaturation for 28 / 32s, 97°C denaturation for 8s, 60°C amplification for 4s, 70°C extension for 8s, a total of 34 cycles, and 74°C final extension for 0.8min.

[0120] The PCR amplification program in “3) Construction of plant overexpression vector” was: pre-denaturation at 98°C for 28 s, denaturation at 98°C for 8 s, amplification at 60°C for 4 s, extension at 70°C for 9 s, for a total of 34 cycles, and final extension at 74°C for 0.8 / 1.2 min.

[0121] In “4) Arabidopsis genetic transformation”, the cells were washed with sterile water for 6 times; the PCR program was as follows: pre-denaturation at 97°C for 28 s, denaturation at 97°C for 8 s, amplification at 60°C for 4 s, extension at 70°C for 8 s, for a total of 34 cycles, and final extension at 74°C for 0.8 min.

[0122] In "5) Identification of herbicide resistance of transgenic Arabidopsis strains" of this embodiment, after calculation and analysis, the inhibition rate of 9 mg / L glufosinate on the root length of pCAMBIA3301-AhALS376-Bar transgenic seedlings was 3.86%, while the inhibition rate of 1 mg / L imidazolin on the root length was 7.65%; the inhibition rate of 9 mg / L glufosinate on the fresh weight of pCAMBIA3301-AhALS376-Bar transgenic seedlings was 37.02%, and the inhibition rate of 1 mg / L imidazolin on the fresh weight of transgenic seedlings was 29.10%.

[0123] Embodiment 3

[0124] The implementation method is the same as that of the first embodiment, except that:

[0125] In “1) Cloning of AhALS gene S3”, in PCR amplification, the program was: 99°C denaturation for 28s, 97°C pre-denaturation for 12s, 58°C amplification for 6s, 70°C extension for 12s, a total of 38 cycles, and final extension at 70°C for 1.2min.

[0126] In “2) Obtaining the AhALS-376 mutant gene”, the first PCR reaction procedure was: 97°C pre-denaturation for 32 s, 97°C denaturation for 12 s, 62°C amplification for 6 s, 74°C extension for 8 s, a total of 38 cycles, and 74°C final extension for 1.2 min;

[0127] The second PCR reaction program was as follows: pre-denaturation at 97°C for 32 s, denaturation at 97°C for 12 s, amplification at 62°C for 6 s, extension at 72°C for 8 s, for a total of 36 cycles, and final extension at 70°C for 1.2 min;

[0128] The third PCR reaction program was: 98°C pre-denaturation for 32 s, 98°C denaturation for 12 s, 62°C amplification for 6 s, 72°C extension for 9 s, a total of 36 cycles, and 70°C final extension for 1.2 min.

[0129] The PCR amplification program in “3) Construction of plant overexpression vector” was: pre-denaturation at 97°C for 32 s, denaturation at 97°C for 12 s, amplification at 62°C for 6 s, extension at 72°C for 8 s, for a total of 36 cycles, and final extension at 70°C for 1.2 min.

[0130] The PCR program in “4) Arabidopsis genetic transformation” was: pre-denaturation at 98°C for 32 s, denaturation at 98°C for 12 s, amplification at 62°C for 6 s, extension at 72°C for 9 s, for a total of 36 cycles, and final extension at 71°C for 1.2 min.

[0131] In "5) Identification of herbicide resistance of transgenic Arabidopsis strains" of this embodiment, after calculation and analysis, the inhibition rate of 9 mg / L glufosinate on the root length of pCAMBIA3301-AhALS376-Bar transgenic seedlings was 3.88%, while the inhibition rate of 1 mg / L imidazolin on the root length was 7.62%; the inhibition rate of 9 mg / L glufosinate on the fresh weight of pCAMBIA3301-AhALS376-Bar transgenic seedlings was 37.01%, and the inhibition rate of 1 mg / L imidazolin on the fresh weight of transgenic seedlings was 29.05%.

[0132] It can be seen from the results of Examples 1 to 3 that both 1 / 2MS + 9 mg / L glufosinate and 1 / 2MS + 1 mg / L imidazolin can be used for the screening of Arabidopsis transgenic positive plants, and compared with 1 / 2MS + 9 mg / L glufosinate, the inhibition rate of 1 / 2MS + 1 mg / L imidazolin on the root length of pCAMBIA3301-AhALS376-Bar transgenic plants is slightly stronger, and the fresh weight is higher. It can be seen that under the screening conditions of 1 mg / L imidazolin, the adverse effect on the growth of transgenic offspring plants is relatively small, which is more suitable for the needs of transgenic screening and the growth and reproduction of offspring.

[0133] Embodiment 4

[0134] 1) Genome extraction of AhALS-376 transgenic offspring plants

[0135] S1. Take a small amount of young leaves and place them in a mortar. Grind them into powder with liquid nitrogen. Add them to 700 μL of 2% CTAB and 0.2 β-mercaptoethanol extraction buffer preheated in a 65°C water bath and mix gently.

[0136] S2. Place in a 65°C water bath, gently shake and mix every 10 minutes, and take out after 40 minutes; after cooling at room temperature for 5 minutes, add 300 μL of chloroform-isoamyl alcohol with a volume ratio of 24:1, and shake vigorously to mix thoroughly for 2 minutes to 3 minutes;

[0137] S3. Centrifuge at 10000rpm for 10min. At the same time, add 600μL of 4℃ pre-cooled isopropanol into another new sterilized centrifuge tube. Gently aspirate the supernatant of the centrifuge tube with a pipette and transfer it into the centrifuge tube containing isopropanol. Slowly shake the centrifuge tube up and down for 30sec to fully mix the isopropanol and water layers until DNA flocs can be seen. Place at -20℃ for 30min.

[0138] S4. Centrifuge at 10,000 rpm for 1 minute, then pour out the liquid immediately, being careful not to pour out the white DNA precipitate. Wash the precipitate 2 to 3 times with 70% ethanol, and invert the centrifuge tube on a spread paper towel to air dry at room temperature.

[0139] S5. Add 50 μL of 0.5×TE buffer to dissolve the DNA and place in a 37°C incubator for 1 hour to digest the RNA. Take 0.5 μL of the sample and use a UV spectrophotometer to detect the concentration and purity of the DNA. The results show that the A260 / A280 ratio of the extracted sample DNA is between 1.8 and 2.0, indicating that the extracted DNA has a high purity. According to the measured concentration value, the sample concentration is uniformly adjusted to 20 ng / μL.

[0140] 2) Development of high-throughput molecular marker primers for detecting AhALS-376 gene

[0141] The KASP molecular marker sequence used for high-throughput detection is as follows:

[0142] AhALS-376F / a: 5'-GCATTTGGGGTGAGATTTGATGAa-3';

[0143] For the target gene mutation site, the 3' end of the above primer is the allele variant base a. The corresponding universal adapter sequence (fluorescent label sequence) is added to the 5' end of the specific primer.

[0144] Tag sequence: 5'-gaaggtgaccaagttcatgct-3' (FAM fluorescent tag sequence);

[0145] The corresponding KASP high-throughput detection molecular marker primer sequences were further obtained as follows:

[0146] 5'-gaaggtgaccaagttcatgct GCATTTGGGGTGAGATTTGATGAa-3'.

[0147] The reverse universal primer AhALS-376R / common used in allelic difference detection was designed as the forward sequence of the gene, and the specific sequence design is as follows:

[0148] The sequence of the universal primer AhALS-376R / common is as follows:

[0149] 5'-CTATTGATCCCACTCAAGGCCAGCT-3';

[0150] All the above primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0151] 3) PCR amplification reaction

[0152] The PCR reaction system (5 μL) for KASP detection includes 2 μL template DNA (concentration of about 20 ng / μL), 0.07 μL primer mixture, 2.5 μL 2×KASP Master Mix, and 0.43 μL ddH2O. The final concentration of the primer AhALS-376F / a in the primer mixture is 12 μM, and the final concentration of the universal primer AhALS-376R / common is 25 μM. The LGC product 2×KASPMaster Mix consists of fluorescent probes, quenching probes, high-fidelity Taq enzymes, dNTPs, etc.

[0153] The KASP reaction was performed in an LGC SNPline XL water bath PCR instrument. The KASP genotyping PCR reaction procedure was as follows: 94°C pre-denaturation for 15 min; the first amplification reaction: 94°C denaturation for 20 s, 55°C-60°C gradient annealing and extension for 60 s, 10 cycles, with the annealing and extension temperature decreasing by 0.6°C in each cycle; the second amplification reaction: 94°C denaturation for 20 s, 55°C annealing and extension for 60 s, 27 cycles.

[0154] A negative control (NTC) without template DNA was set up in the PCR reaction system. When the PCR reaction was completed, the reaction temperature dropped below 4°C and the fluorescence data of the KASP reaction product was read using a BIO-RAD CFX fluorescence quantitative PCR instrument. The FAM excitation wavelength was 485nm and the emission wavelength was 520nm. Kraken software was used to analyze the fluorescence results of the KASP amplification reaction, and the AhALS-376 gene SNP of the sample to be tested was detected according to the principle of no specific amplification of the negative control NTC. When FAM fluorescence was detected, the material was a transgenic positive plant; when no specific amplification was found, the material genome did not contain the AhALS-376 gene and was a non-transgenic material. For results, see Fig.10In the figure, the rhombus-shaped dots represent the plants to be tested that contain the AhALS-376 gene, i.e., transgenic positive plants (a:a), the hollow circles represent non-transgenic plants with no signal of KASP PCR amplification products (?), and the black solid dots represent no-template controls (NTC).

[0155] In summary, the present invention achieves site-directed mutagenesis of the endogenous ALS gene of peanut, and successfully applies the peanut acetolactate synthase (ALS) gene as a screening marker gene in the cultivation of transgenic plants (taking the model plant Arabidopsis thaliana as an example). The present invention uses the imidazolinone herbicide-resistant peanut ALS gene as a transgenic screening marker gene, thereby expanding the scope of transgenic screening markers.

[0156] At the same time, because the genes screened by the present invention are endogenous genes of plants, they are safer for humans and animals during application.

Claims

1. Peanut imidazolin resistance gene sequence, characterized in that: The base sequence of the peanut acetolactate synthase encoding gene is shown in SEQ ID NO1, named as the AhALS gene, the peanut imidazole acetolactate synthase resistance gene sequence is the peanut acetolactate synthase mutant gene shown in SEQ ID NO3, named as the AhALS-376 mutant gene, and the AhALS-376 mutant gene consists of 2001 bases; the protein sequence of the acetolactate synthase encoded by the AhALS gene is shown in SEQ ID NO2, named as the ALS protein sequence, and the AhALS-376 mutant gene encodes a mutant acetolactate synthase as shown in SEQ ID NO4.

2. The peanut imidazolin-resistant gene sequence according to claim 1, characterized in that: The AhALS-376 mutant gene is derived from the site-directed mutation of the peanut acetolactate synthase encoding gene, and the site-directed mutation refers to the introduction of a mutation site at the 1113th base in the coding region of the AhALS gene sequence, so that T mutates to A; the protein sequence of the mutant acetolactate synthase is derived from the mutation of the 376th amino acid of the ALS protein sequence from Asp to Glu.

3. The peanut imidazolin-resistant gene sequence according to claim 1, characterized in that: The site-directed mutagenesis refers to performing PCR-mediated site-directed mutagenesis on the peanut endogenous AhALS gene sequence to obtain the AhALS-376 mutant gene.

4. The peanut imidazolin-resistant gene sequence according to claim 3, characterized in that: Before the PCR-mediated site-directed mutagenesis, the AhALS gene must be cloned. The specific operation is as follows: S1. Determine the AhALS gene sequence of peanut by querying the gene database; S2, design gene-specific primers; S3. The genomic DNA of peanut leaves was extracted by CTAB method, the AhALS gene sequence was cloned by PCR and the obtained AhALS sequence was sequenced and identified.

5. The peanut imidazolin-resistant gene sequence according to claim 3, characterized in that: The PCR-mediated site-directed mutagenesis refers to achieving site-directed mutagenesis by three PCR-mediated steps to obtain the AhALS-376 mutant gene. The primers for the first PCR reaction are: AhALS-F: 5'-ATGGCTGCCACTGCTTCCA-3' and AhALS_T1113a-R: 5'-ACACGTTCATCAAATCTCACCCCA-3'; The second PCR reaction primers are: AhALS_T1113a-F: 5'-TGTGACGGGGAAAGCTTGAGG-3' and AhALS-R: 5'-TCAATATTTTGTTCTGCCATCGCCT-3'; The primers for the third PCR reaction are the primer AhALS-F and the primer AhALS-R; The program of the three-step PCR is: deformation at 97°C to 99°C for 28s to 32s, pre-denaturation at 97°C to 99°C for 8s to 12s, amplification at 58°C to 62°C for 4s to 6s, extension at 70°C to 74°C for 8s to 12s, a total of 32 to 38 cycles, and final extension at 70°C to 74°C for 0.8min to 1.2min.

6. The peanut imidazolin-resistant gene sequence according to claim 5, wherein the gene-specific primers in step S2 are the primer AhALS-F and the primer AhALS-R; The PCR program of the S3 step is: deformation at 97°C to 99°C for 28s to 32s, pre-denaturation at 97°C to 99°C for 8s to 12s, amplification at 58°C to 62°C for 4s to 6s, extension at 70°C to 74°C for 8s to 12s, a total of 32 to 38 cycles, and final extension at 70°C to 74°C for 0.8min to 1.2min.

7. Application of a peanut imidazolin-resistant gene sequence in plant transgenics, wherein the peanut imidazolin-resistant gene sequence is the gene sequence according to any one of claims 1 to 5, characterized in that: The AhALS-376 mutant gene is used as a screening marker gene in transgenic plants.

8. The use of the peanut imidazolin-resistant gene sequence in plant transgenic according to claim 6, characterized in that: The AhALS-376 mutant gene was introduced into transgenic plants, and the transgenic plants were obtained by screening with imidazolinone herbicides.

9. The use of the peanut imidazolin-resistant gene sequence in plant transgenic according to claim 6, characterized in that: Introducing the AhALS-376 mutant gene into Arabidopsis means inserting the AhALS-376 mutant gene into a plant expression vector as a screening marker gene for resistance to imidazolinone herbicides, constructing a recombinant expression vector, and then transforming the recombinant expression vector into Arabidopsis plants through an Agrobacterium-mediated method; the Arabidopsis plants are screened on a screening medium containing glufosinate and imidacloprid, the glufosinate screening concentration is 9 mg / L, and the imidacloprid concentration is 1 mg / L.

10. The use of the peanut imidazolin-resistant gene sequence in plant transgenic according to claim 9, characterized in that: The specific method for constructing the recombinant expression vector is as follows: cloning the AhALS gene and the AhALS-376 mutant gene into the pCAMBIA3301 plant expression vector, using the constitutively expressed CaMV 35S promoter to drive the AhALS gene and the AhALS-376 mutant gene, constructing a recombinant plasmid expression vector containing the AhALS gene and the AhALS-376 mutant gene, transforming the recombinant plasmid expression vector into the Agrobacterium GV3101 strain by electric shock to obtain a recombinant strain, extracting the plasmid for PCR and enzyme digestion identification, and obtaining a recombinant strain of the plant expression vector containing the endogenous gene AhALS gene and the resistance gene AhALS-376 mutant gene; The gene-specific primers designed in the specific method of constructing a recombinant expression vector are: AhALS-T1113AsacF: 5'-GC GAGCTC ATGGCTGCCACTGCTTCCA-3' and AhALS-T1113AsmaR: 5'-TCC CCCGGG TCAATATTTTGTTCTGCCAT CGCCT-3'.

Images