Application of pathogenic gene FpMetR for controlling stem rot pathogen Fusarium pseudograminearum

Abstract

The invention relates to the technical field of gene engineering, and particularly discloses application of a pathogenic gene FpMetR for controlling stem rot pathogenic bacteria Fusarium pseudograminearum, specifically, the colony morphology of a deletion mutant strain of the FpMetR gene is changed, the sporulation quantity is reduced, the spore germination rate is reduced, and the pathogenicity of the mutant strain is completely lost, the DNA sequence of the FpMetR gene is as shown in SEQ ID No: 1, and the DNA sequence of the FpMetR gene is as shown in SEQ ID No: 2. According to the invention, the pathogenic mechanism is clarified: a scientific basis is provided for deeply understanding the pathogenic mechanism of pathogenic bacteria by revealing the key effect of the FpMetR gene in the pathogenic process of the fusarium pseudograminearum, and a new thought and a target gene are provided for the field of plant anti-fusarium pseudograminearum genetic engineering by virtue of the effect of the FpMetR gene in the aspects of regulating and controlling the growth and pathogenicity of wheat. By applying the gene or a regulation mechanism thereof to genetic improvement of crops such as wheat, new varieties with disease resistance are expected to be cultivated, dependence on chemical pesticides is reduced, and environmental friendliness is improved.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to the application of a pathogenic gene FpMetR of pseudofusarium graminearum, a pathogenic bacterium of stem base rot, to control the disease. Background Art

[0002] Fusarium crown rot (FCR) is a worldwide soil-borne disease of wheat that not only causes severe yield losses but also produces toxins that are harmful to human and animal health. Since little is known about the occurrence patterns, biological characteristics and pathogenic mechanisms of FCR, prevention and control of the disease is a new scientific issue in wheat production.

[0003] Fusarium pseudograminearum is an important plant pathogen belonging to the kingdom Fungi, phylum Ascomycota, subphylum Deuteromycotina, genus Fusarium. The fungus can cause diseases of a variety of crops, which has a significant impact on agricultural production. The following is a detailed introduction to Fusarium pseudograminearum. Fusarium pseudograminearum mainly causes wheat stem base rot, which is a fungal soil-borne disease. The disease can occur from wheat tillering to wheat yellow maturity, with two main peaks of incidence, from February to early to mid-March and from mid-April to mid-May. The disease rate can reach 84.2% in severe cases, resulting in a serious decline in wheat yield or even a total crop failure. In addition, Fusarium pseudograminearum can also cause diseases of other crops, such as rice bacterial blight.

[0004] By analyzing the pathogenic function of its encoding gene FpMet, the pathogenic mechanism of F. graminearum was explored, providing a clear drug target for finding drugs to prevent and treat the disease. Summary of the invention

[0005] The object of the present invention is to provide an application of the pathogenic gene FpMetR of Fusarium graminearum, a pathogen of stem base rot, to solve the problems raised in the above background technology.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] Application of the pathogenic gene FpMetR in controlling the pathogenic fungus Fusarium graminearum:

[0008] Specifically, by knocking out the FpMetR gene, the colony morphology of the deletion mutant strain changed, the spore production decreased, the spore germination rate decreased, and the pathogenicity of the mutant strain was completely lost.

[0009] The DNA sequence of the FpMetR gene is shown in SEQ ID No: 1.

[0010] The gene FpMet regulates the growth and pathogenicity of wheat and can be used in the field of plant resistance to Fusarium graminearum genetic engineering.

[0011] The gene FpMet is used in the design and screening of anti-Fusarium graminearum agents.

[0012] Compared with the prior art, the present invention has the following beneficial effects:

[0013] Clarify the pathogenic mechanism: By revealing the key role of the FpMetR gene in the pathogenic process of F. graminearum, a scientific basis is provided for a deeper understanding of the pathogenic mechanism of the pathogen. This will help to conduct more in-depth research on the gene and develop corresponding prevention and control strategies.

[0014] Promoting the development of plant genetic engineering: The role of the FpMetR gene in regulating wheat growth and pathogenicity provides new ideas and target genes for plant resistance to Fusarium graminearum genetic engineering. By applying this gene or its regulatory mechanism to the genetic improvement of crops such as wheat, it is expected that new varieties with disease resistance will be cultivated, thereby reducing dependence on chemical pesticides and improving the sustainability and environmental friendliness of agricultural production.

[0015] Promoting the development and screening of drugs: The application of the FpMetR gene can also be extended to the design and screening of drugs against Fusarium graminearum. By targeting this gene, more efficient, low-toxic and environmentally friendly drugs can be designed and screened, providing new options for the chemical prevention and control of stem rot. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a schematic diagram of the change in bacterial colony morphology of the present invention;

[0017] Figure 2 This is a relationship diagram of spore germination rate of the present invention;

[0018] Figure 3 This is an observation diagram showing the loss of pathogenicity of the mutant of the present invention. DETAILED DESCRIPTION

[0019] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0020] Embodiment 1:

[0021] according to Figure 1 - Figure 3

[0022] MoMetR is a bZIP transcription factor reported in rice blast fungus. In order to identify its homologous gene in F. graminearum, based on the Fungal Transcription Factor Database (FTFP) data that includes 163 fungal species and 6 oomycete species, large biological databases such as NCBI, EBI and DDBJ, which can provide relevant data of transcription factors, were used to identify that there are 21 bZIP transcription factors in F. graminearum. Then, BioEdit and Mega5 software were used to identify the homologous gene of MoMetR in F. graminearum as FpTF01 (FpMetR) through local alignment and phylogenetic tree analysis.

[0023] Construction of knockout cassette

[0024] PCR amplification:

[0025] Primers 1F+2R and 3F+4R were used to amplify the upstream and downstream flanking sequences of the target gene, respectively.

[0026] Primers 1F+HYG / R and 4R+HYG / F were used to amplify the hph fragment (hygromycin resistance gene fragment).

[0027] The PCR product of the second step was used as a template and primers 1F+HYR and 4R+YGF were used for amplification to obtain a gene knockout cassette.

[0028] PCR product concentration:

[0029] The PCR product was concentrated through the steps of isopropanol precipitation, ethanol washing and sterile water dissolution for subsequent use.

[0030] 2. Gene Knockout

[0031] (1) Inoculate the PDA plate with the Fusarium graminearum (2035) cake into a 250 ml Erlenmeyer flask containing 100 ml CMC liquid culture medium and culture at 25°C and 170 rpm for 2 to 3 days.

[0032] (2) The spores were transferred to a 250 ml Erlenmeyer flask containing 100 ml YEPD liquid medium and shaken on a shaker at 25°C and 170 rpm for 24 h.

[0033] (3) Filter the culture medium with sterile filter cloth, wash with KCl 2-3 times, collect the mycelium, mix the two at a ratio of 0.33g / 10ml lysis solution, shake at 31℃, 100rpm for 2-2.5h, and all the protoplasts are in the microscopic field of view. (Note: Preparation of lysis solution: measure 10ml 1.2M KCl in a 50ml centrifuge tube; weigh 0.3g of lysase and add it to KCl, then weigh 0.1g (100μL) of lysase and add it, shake at 30℃, 100rpm for 30min; sterilize with a 0.22nm bacterial filter.

[0034] (4) Filter the enzymatic hydrolysis mixture through a layer of sterile filter cloth and two layers of lens paper into a sterile 250 ml Erlenmeyer flask, and rinse with 1.2 M KCl into a centrifuge tube. Centrifuge at 4°C, 4000 rpm for 5 min.

[0035] (5) Discard the supernatant, add 10 ml of STC Buffer to slightly suspend the precipitate, and centrifuge at 4000 rpm for 6 min.

[0036] (6) Discard the supernatant, add 10 ml of STC Buffer to lightly suspend the precipitate, and centrifuge at 4000 rpm for 6 min.

[0037] (7) Discard the supernatant and gently resuspend the precipitate with 1 ml (depending on the number of genes) of STC Buffer.

[0038] (8) Count the protoplasts using a hemocytometer to determine the protoplast yield and calculate the yield.

[0039] (9) Add the two labeled DNA fusion fragments (5-10 μg each) to a 50 ml centrifuge tube containing 200 μl of protoplasts and mix well. Let stand at room temperature for 20 min without shaking.

[0040] (10) Add 1 ml of PTC, swirl diagonally, and let stand at room temperature for 20 min without shaking.

[0041] (11) Add 10 ml TB3 and 5 μl ampicillin and incubate the tube at 25°C, 90 rpm, with shaking for 1 h.

[0042] (12) Melt Bottom Agar in a microwave oven and cool to below 60°C. Transfer 40 ml TB3 to a 50 ml centrifuge tube containing revived protoplasts. Add hygromycin (100 μl per 100 ml TB3) and ampicillin (50 μl per 100 ml TB3) to the TB3 and quickly pour onto a plate. After blowing on a clean bench for 0.5 h, pour Top Agar containing 200 μl hygromycin and continue to culture at 25°C until a single colony grows. Pick the single colonies one by one and inoculate them on PDA medium for rescreening. The colonies that can finally grow are transformants.

[0043] (13) Mutant detection: genomic DNA of transformants was extracted and PCR detection was performed using four pairs of primers: 5F / 6R was used to detect whether each transformant contained the target gene; H850 / H852 was used to detect whether each transformant contained the hph gene; 7F / H855R and H856F / 8R were used to detect whether homologous recombination occurred upstream and downstream of the target gene.

[0044] The condition for determining that the transformant is a positive transformant is that only when 5F / 6R cannot detect the target band, while H850 / H852, 7F / H855R and H856F / 8R primers can all detect the correct target band.

[0045] Phenotypic analysis and pathogenicity determination of gene mutants

[0046] Colony growth rate assay

[0047] (1) Activate the wild-type strain and mutant strain using PDA plates and culture them in a 25°C incubator for 3-4 days.

[0048] (2) Use a 5 mm diameter puncher to punch the bacterial cakes at the same distance from the center of the colony. Punch three each for the wild type and mutant strains.

[0049] (3) Place the bacterial cakes at the center of a 9-cm culture dish containing 15 ml of PDA medium, with the front of the bacterial cakes facing downward and ensuring that the bacterial cakes are in even contact with the plate. Repeat three times for each step.

[0050] (4) Invert the plate and incubate at 25°C for 72 h and 120 h. Measure the diameter of the colonies and take photos.

[0051] 3.2 Determination of conidia production rate

[0052] (1) Use a 5 mm diameter punch to punch holes in the plate that has been activated for 3-4 days.

[0053] (2) The bacterial cake was transferred into a 250 ml Erlenmeyer flask containing 100 ml CMC medium. The wild type and mutant strains were replicated three times.

[0054] (3) After culturing at 25°C and 170 rpm for 72 h and 120 h, the spore yield was counted using a hemocytometer after filtration.

[0055] Pathogenicity assay

[0056] (1) Select Shixin 828 wheat seeds with full grains, soak them in 1% sodium hypochlorite solution for 5 minutes, wash them three times with sterile water, soak them for 4 hours, and then place them on a plate covered with filter paper or absorbent paper for 24 hours to germinate.

[0057] (2) Use tweezers to place seeds on water agar medium, with 10 seeds placed on each dish. Cover with a perforated plastic cup, seal with sealing film, and place in a 22°C constant temperature and light incubator for 2 days. Each dish is a replicate, and each strain is inoculated with 3 replicates.

[0058] (3) Punch holes along the edge of the colony and inoculate the fungus block at the base of the bud. Cover the cup with a perforated plastic cup and seal it with a sealing film. Place the cup in a 22°C constant temperature and light incubator and culture for 6 days. Observe the disease incidence of the control.

[0059] (4) Investigate and record the severity level of each strain, and calculate the disease index of each strain. Disease index = ∑ (number of diseased plants at each level × value of the disease level) / (total number of plants investigated × highest level value) × 100 Data processing and statistical analysis

[0060] WPS Office spreadsheet software was used for basic data processing and IBM SPSS 19.0 software was used for one-way analysis of variance.

[0061] Figure 1 Comparison of the growth of three different strains (CK, ΔfptF01, ΔfptF01-C) on the plate and their colony diameters. By comparison, it can be clearly seen that the CK strain has the fastest growth rate and the largest colony diameter; the ΔfptF01-C strain grows the slowest, but its colony diameter is the largest among the three; and the growth rate and colony diameter of the ΔfptF01 strain are between the two.

[0062] This indicates that knocking out the ΔfptF01 gene significantly affected the growth of the strain, while the ΔfptF01-C strain may have partially restored its growth ability through some mechanism, but it still did not reach the normal level. This reveals the important role of the ΔfptF01 gene in the growth process of the strain.

[0063] Figure 2 The growth of three different treatment conditions is shown. From the bar graph, it can be clearly seen that the number of cells in the CK group is the largest, while the number of cells in the ΔfPTf01 group is reduced to 80%, and the ΔfptF01-C group is further reduced. The microscope images intuitively show the morphological changes of cells (or bacteria) under these treatment conditions.

[0064] Figure 3 It can be clearly seen that the percentage of lesions of mutants ΔfptF01 and ΔfptF01-C is significantly reduced compared with wild-type CK0 and CK, which directly reflects the loss of pathogenicity of the mutants. Although the embodiments of the present invention have been shown and described, it is understood by those skilled in the art that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and the scope of the present invention is defined by the appended claims and their equivalents.

[0065] FqV

[0066] ATGTCAAACTTCAACGGCCGCCGCGGCCCCAACGTGTCGCAGTATCTCCGCGACCTCAACGCCATCAACCGTCAGGAGAATGCTCACGACGAGCCTTTCAACATGGAGGAGGACCTTGCTCTCTTCACCAACACTCAATTCTTTGATTTTGAGACTGGCCAGAACACCGACTACCAGGCCCATCCTGCCAAGGTCGACTTGGAGGCTTCCCAAAGCACTTCCCCTTCGGATGGAATGACCCCGGCTCCCTCTGTCGTGGGTGATATCGCTGCTGGCAACTTTGATTTCATGCAGGGCGACTTCAACTTCCCCGACTTCACTGGCCCTTATCCATCAACCCCCATGACCGCCTTTGCCGATGGCGCTCAGAACTTTGCTCCTCTGCAGCCCAATGCTCCTGCCAACTACCAGCCTGTGCCACAGCAGCAGCAAGCTCCCCAATTTGCTCAACCAGCTGCACCTCAGCCTTCACTCGAGAAGCGCAACTCTGAGAGTGCCGGCAGTTCCGGACGCGGATCCCTGAACTTTGAAGAAGCCTCCCGCCATGCTGCTGAGGAGGACAAGCGAAGGCGCAACACTGCCGCCAGTGCTCGCTTCCGCATCAAGAAGAAGCAGCGCGAGCAAGCCCTCGAGAAGTCCGCCAAGGAGATGTCTGAAAAGGTGTCTGTCCTGGAGAGCAAGGTGTCACAACTCGAGACCGAGAACAAGTGGCTCAAGAACCTTTTGGTTGACAAGAACGAGGGCAACGACGAGATCATTGCTCTCTGGAAAGAGTTTGCCGCATCCAAAACCGCCAACAAGCCCGAGTCAAAAGCCAAGTCTTCCGTCAAGGATGAGACAAGGTGA。

Claims

1. The application of controlling the pathogenic gene FpMetR of the pathogenic fungus Fusarium graminearum of stem base rot is characterized in that: Specifically, the colony morphology of the deletion mutant strain by knocking out the FpMetR gene changes, the spore production decreases, the spore germination rate decreases, and the pathogenicity of the mutant strain is completely lost. The DNA sequence of the FpMetR gene is shown in SEQ ID No: 1.

Images