Gene for regulating and controlling wheat plant height and sub-panicle internode length and application of encoding protein of gene

Abstract

The invention discloses a gene for regulating and controlling wheat plant height and sub-panicle internode length and application of a coding protein of the gene, and belongs to the technical field of biology. The gene capable of regulating and controlling the plant height and the sub-panicle internode length of the wheat is TaSVP-6B (SEQ ID NO: 1), the amino acid sequence of the protein coded by the gene is shown as SEQ ID NO: 26, and the application of the TaSVP-6B gene and the protein coded by the gene in regulating and controlling the plant height and the sub-panicle internode length of the wheat specifically comprises the following steps: deleting the TaSVP-6B gene in a target wheat genome by utilizing a gene editing technology; or the expression of the protein shown as SEQ ID NO: 26 of the target wheat is inhibited, so that the dwarf wheat with shortened plant height and sub-spike internode length is obtained. The gene has the beneficial effects that a gene resource is provided for cultivating new crop varieties adapting to different ecological environments, and meanwhile, the gene has important theoretical and practical significance for knowing the formation of crop plant types.

Description

Technical Field

[0001] The invention relates to an application of a gene and an encoded protein thereof, and in particular to an application of a TaSVP-6B gene and an encoded protein thereof for regulating wheat plant height and internode length below an ear, and belongs to the field of biotechnology. Background Art

[0002] Plant height is an important trait for plant type formation. It affects wheat lodging resistance, harvest index and yield level, and is one of the key factors for high and stable wheat yield. Reducing plant height is conducive to improving plant lodging resistance and increasing plant tolerance to higher nitrogen fertilizer input. Since the 1960s, the use of dwarfing genes such as Rht1 and Rht2 has significantly improved wheat's lodging resistance and yield per unit area, triggering the "green revolution" in agricultural production. At present, there are 26 named wheat dwarfing genes. Except for Rht-B1b, Rht-D1b, Rht8, Rht12, Rht13, Rht18, Rht23, Rht24 and Rht25, which have been precisely located or cloned, most dwarfing genes have only completed preliminary location. In my country's wheat production, only a few dwarfing genes such as Rht-B1b, Rht-D1b, Rht8 and Rht24 play a key role, and the available excellent dwarfing gene resources are relatively scarce. In order to enrich the genetic diversity of wheat dwarfing sources, fine positioning of plant height-related QTLs and cloning of new dwarfing genes with application value are of great significance to promote the genetic improvement of wheat plant type and the breeding of high-yield varieties. Summary of the invention

[0003] The technical problem to be solved by the present invention is: how to regulate the plant height and the internode length below the ear of wheat, and / or how to improve the lodging resistance and unit area yield of wheat.

[0004] In order to solve the above technical problems, the present invention first provides a gene and its encoded protein that can regulate wheat plant height and internode length below the ear. Experiments have confirmed that the gene and its encoded protein can be applied to the cultivation of dwarf wheat.

[0005] The gene that can regulate wheat plant height and internode length below the ear is TaSVP-6B (SEQ ID NO: 1), and the amino acid sequence of the protein encoded by it is shown in SEQ ID NO: 26. The application of the TaSVP-6B gene and its encoded protein in regulating wheat plant height and internode length below the ear is as follows:

[0006] The application of the TaSVP-6B gene shown in SEQ ID NO: 1 in regulating wheat plant height and internode length below the ear, wherein the application is to use gene editing technology to delete the TaSVP-6B gene shown in SEQ ID NO: 1 in the target wheat genome, thereby obtaining dwarf wheat with shortened plant height and internode length below the ear.

[0007] The use of the protein shown in SEQ ID NO: 26 in regulating wheat plant height and internode length below the ear, the use is to inhibit the expression of the protein shown in SEQ ID NO: 26 of the target wheat, and obtain dwarf wheat with shortened plant height and internode length below the ear. Preferably, the method for inhibiting the expression of the protein shown in SEQ ID NO: 26 of the target wheat is: using gene editing technology to delete the gene encoding the protein shown in SEQ ID NO: 26 in the target wheat genome. Preferably, the gene encoding the protein shown in SEQ ID NO: 26 in the wheat genome is the TaSVP-6B gene, and the nucleotide sequence of the TaSVP-6B gene is shown in SEQ ID NO: 1.

[0008] The benefits of the present invention lie in that: through experiments, the present invention found that overexpression of the TaSVP-6B gene can significantly increase the internode length under the wheat ear and the plant height, and knocking out the TaSVP-6B gene can significantly reduce the internode length under the wheat ear and the plant height. The present invention provides genetic resources for breeding new crop varieties that can adapt to different ecological environments, and at the same time has important theoretical and practical significance for understanding the formation of crop plant types. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Figure 1 This is the result of PCR amplification of TaSVP gene;

[0010] Figure 2 This is the expression pattern of TaSVP gene in different tissues at different stages in parental strains Nong 9204 and Jing 411;

[0011] Figure 3 It is a schematic diagram of the structure of the transgenic vector pJIT163;

[0012] Figure 4 It is a schematic diagram of the structure of the editing vector pLGYE-003;

[0013] Figure 5 The phenotypic identification results of the transgenic strains of Kenong 199 and TaSVP-6B overexpression are shown in Figure 1, where A is the identification result of plant height and B is the identification result of internodes;

[0014] Figure 6 This is the statistical result of plant height of Kenong 199 and TaSVP-6B overexpression transgenic lines, ** represents P < 0.01 (t test);

[0015] Figure 7 This is the statistical result of the internode length below the ear of the transgenic lines of Kenong 199 and TaSVP-6B overexpression, * represents P < 0.01;

[0016] Figure 8 This is the statistical result of the second internode length of the transgenic lines of Kenong 199 and TaSVP-6B overexpression, ns means no significant difference;

[0017] Fig. 9 This is the statistical result of the length of the third internode of the transgenic lines of Kenong 199 and TaSVP-6B overexpression, ns means no significant difference;

[0018] Fig.10 This is the statistical result of the length of the fourth internode of the transgenic lines of Kenong 199 and TaSVP-6B overexpression, ns means no significant difference;

[0019] Fig.11 This is the statistical result of the fifth internode length of the transgenic lines of Kenong 199 and TaSVP-6B overexpression, ns means no significant difference;

[0020] Fig.12 These are the phenotypic identification results of the gene-edited strains of Kenong 199 and TaSVP-6B, where A is the identification result of the plant height and B is the identification result of the internodes below the ear. DETAILED DESCRIPTION

[0021] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0022] 1. TaSVP gene cloning

[0023] 1. Materials

[0024] The material used was the wheat variety Jing 411. Jing 411 seeds were sampled about 2 weeks after germination, and RNA from leaves was extracted using RNAprep Pure Plant Total RNA Extraction Kit (brand: Tiangen, item number: DP432), and RNA was reverse transcribed into cDNA using FastKing One-Step RT-PCR Kit (brand: Tiangen, item number: KR123).

[0025] The method for extracting RNA from leaves is as follows:

[0026] (1) 50-100 mg of plant leaves were quickly ground into powder in liquid nitrogen, 450 μL of RL lysis solution (with β-mercaptoethylase) was added to the powder, and vortexed vigorously to mix;

[0027] (2) Transfer all the solution to the filter column CS, place the filter column CS in the collection tube, centrifuge at 12000 rpm for 5 min, carefully pipette the supernatant in the collection tube into an RNase-Free centrifuge tube, and try to avoid the pipette tip from contacting the cell debris precipitate in the collection tube;

[0028] (3) Slowly add 0.5 times the volume of the supernatant anhydrous ethanol to the centrifuge tube, mix well, transfer the obtained solution and precipitate into the adsorption column CR3, place the adsorption column CR3 in the collection tube, centrifuge at 12000 rpm for 45 seconds, pour out the waste liquid in the collection tube, and place the adsorption column CR3 back into the collection tube;

[0029] (4) Add 350 μL of deproteinized solution RW1 to the adsorption column CR3, centrifuge at 12,000 rpm for 45 s, discard the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube;

[0030] (5) Take 10 μL of DNase I storage solution and place it in a new RNase-Free centrifuge tube, add 70 μL of RDD buffer, and mix gently to obtain DNase I working solution;

[0031] (6) Add 80 μL of DNase I working solution to the adsorption column CR3 and leave at room temperature for 15 min;

[0032] (7) Add 350 μL of deproteinized solution RW1 to the adsorption column CR3 again, centrifuge at 12,000 rpm for 45 s, pour out the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube;

[0033] (8) Add 500 μL of rinse solution RW (with ethanol) to the adsorption column CR3, let it stand at room temperature for 2 min, centrifuge at 12000 rpm for 45 s, pour out the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube;

[0034] (9) Repeat step (8);

[0035] (10) Centrifuge at 12000 rpm for 2 min, discard the waste liquid in the collection tube, and place the adsorption column CR3 at room temperature for several minutes until the residual rinse liquid in the adsorption material is completely dried;

[0036] (11) Place the adsorption column CR3 into a new RNase-Free centrifuge tube, add 100 μL RNase-Free ddH2O to the middle of the adsorption membrane, leave it at room temperature for 2 min, centrifuge it at 12000 rpm for 2 min, retain the supernatant, and obtain the RNA template.

[0037] The method for reverse transcription of RNA into cDNA is as follows:

[0038] (1) Add 2 μg RNA template and 2 μL 5×g DNA Buffer to a centrifuge tube and add RNase-Free H2O to make up the volume of the reaction system to 10 μL;

[0039] (2) Place the reaction system in a 42°C water bath for 3 min, then add 2 μL 10× King RT Buffer, 1 μL FarstKing RT Enzyme Mix, and 2 μL FQ-RT Primer Mix, and make up the volume of the reaction system to 20 μL with RNase-Free H2O;

[0040] (3) The reaction system was placed in a 42°C water bath for 15 min, then placed in a 95°C water bath for 3 min, and finally cooled on ice to obtain a DNA template.

[0041] 2. Acquisition of TaSVP gene

[0042] The primers for TaSVP gene were designed mainly based on the reference sequence in Jing 411. The upstream primer included the translation start codon ATG, and the downstream primer included the stop codon TGA. Then, the reverse transcribed Chinese spring leaf cDNA was used as a template and PCR amplification was performed using primers TaSVP-CDS-F and TaSVP-CDS-R.

[0043] The sequences of primers TaSVP-CDS-F and TaSVP-CDS-R are as follows:

[0044] TaSVP-CDS-F: ATGGCACAGCACGACGGCAAGCCAT (SEQ ID NO: 2);

[0045] TaSVP-CDS-R: TCATGTTGAAGACCCATGGCCGT (SEQ ID NO: 3).

[0046] The PCR reaction system is shown in Table 1.

[0047] Table 1 PCR reaction system

[0048] Element Dosage 2×pfuPCR premix 5μL dNTP 0.24μL TaSVP-CDS-F (10 μM) 0.5μL TaSVP-CDS-R (10μM) 0.5μL DNA template 2μL PCR Enhancer 5μL <![CDATA[ddH2O]]> 11.76μL Total volume 25μL

[0049] The specific PCR reaction procedure is as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, 36 cycles; extension at 72°C for 10 min; end amplification and store at 12°C.

[0050] After the PCR amplification product was electrophoresed on 1.5% agarose at 140V for 20 minutes, an amplification band was found at the 687bp position ( Figure 1), cut the band and use agarose gel DNA recovery kit (brand: Tiangen, item number: DP219) to recover the PCR amplification product. The recovered PCR amplification product was connected to the vector pEASY-Blunt Cloning Kit (Beijing Quanshijin Biotechnology Co., Ltd.) for 15 minutes, and then transformed into Escherichia coli competent cells TransT1 (Beijing Quanshijin Biotechnology Co., Ltd.). After overnight culture, a single clone was picked, and the single clone was sequenced after PCR identification to obtain the nucleotide sequence of the TaSVP-6B gene. The nucleotide sequence of the gene is specifically shown in SEQ ID NO: 1, and the amino acid sequence of the protein encoded by the gene is specifically shown in SEQ ID NO: 26.

[0051] 2. Expression pattern of TaSVP-6B

[0052] 1. Organize the expression material

[0053] Roots (SR) at seedling stage, leaves (SS) at seedling stage, stems (JS) at jointing stage, leaves (JSL) at jointing stage, ears at jointing stage (JSS), leaves (BSL) at booting stage, stems (BS) at booting stage, ears at booting stage (BSS), lower nodes of ears at booting stage (BSP), leaves (HSF) at heading stage, stems (HS) at heading stage, ears at heading stage (HSS), grains at 7 days after anthesis (7DPA), grains at 14 days after anthesis (14DPA), grains at 21 days after anthesis (21DPA) and grains at 28 days after anthesis (28DPA) of Kenong 9204 (KN9204) and Jing 411 (J411) were selected to extract tissue RNA, and cDNA was obtained after reverse transcription.

[0054] Based on the obtained TaSVP-6B gene sequence (SEQ ID NO: 1), a pair of TaSVP-6B qRT-PCR primers (TaSVP-qPCR-F and TaSVP-qPCR-R) were designed. The specific primer sequences are as follows:

[0055] TaSVP-qPCR-F:TTAGAGCATAGCAAGTATGC (SEQ ID NO: 4);

[0056] TaSVP-qPCR-R: CTGTTCCAAGAATTGTTGATC (SEQ ID NO: 5).

[0057] The qRT-PCR reaction system is shown in Table 2.

[0058] Table 2 qRT-PCR reaction system

[0059] Element Dosage <![CDATA[SYBR @ TaqEx]]> 10μL TaSVP-qPCR-F (10 μM) 0.4μL TaSVP-qPCR-R (10 μM) 0.4μL DNA template 2μL <![CDATA[ddH2O]]> 7.2μL Total volume 20μL

[0060] The specific qRT-PCR reaction procedure was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, 40 cycles; extension at 72°C for 7 min; end amplification and store at 12°C.

[0061] 2. Expression pattern of TaSVP-6B

[0062] Tissue expression pattern analysis revealed that TaSVP-6B had similar expression patterns in Kenong 9204 and Jing 411. Figure 2 As shown, the relative expression level of TaSVP-6B was the highest in the leaves (SS) of Jing 411 at the seedling stage, followed by the stems (JS) at the jointing stage and the stems (BS) at the booting stage, and the expression level was lower in the grains during the development process (7DAP, 14DAP, 21DAP and 28DAP). The relative expression levels of this gene in different tissues of Jing 411 at different stages were higher than those in the same tissue of Kenong 9204 at the same stage.

[0063] 3. Construction of TaSVP-6B transgenic overexpression vector

[0064] The transgenic vector pJIT163 was provided by Li Genying, a researcher at the Institute of Crop Sciences, Shandong Academy of Agricultural Sciences. Figure 3 As shown. The transgenic vector was double-digested with HindIII and BamHI, and the gel was cut and recovered. The cloned TaSVP-6B CDS was used as a template, and the restriction sites HindIII and BamHI were introduced by primers TaSVP-HindIII-F and TaSVP-BamHI-R for PCR amplification. The PCR reaction system is shown in Table 1. The PCR reaction program is as follows: 94℃ pre-denaturation for 3min; 94℃ denaturation for 30s, 60℃ annealing for 30s, 72℃ extension for 30s, 36 cycles; 72℃ extension for 10min; end amplification, and store at 12℃. The PCR amplification product was recovered, and the transgenic vector pJIT163 was double-digested with HindIII and BamHI. The digestion product was recovered and connected with T4 DNA ligase (Beijing Jingke Hongda Biotechnology Co., Ltd.). The connection system is shown in Table 3, and then transformed into Escherichia coli competent cells (Trans) to obtain positive clones. After extracting the plasmid, sequencing verification was performed, and the correct clone was transformed into Agrobacterium EHA105 competent cells.

[0065] Table 3 Infusion seamless cloning connection system

[0066] Element Dosage T4 DNA Ligase Buffer 1μL T4 DNA ligase 1μL Transgenic vector pJIT163 2μL PCR amplification products 6μL Total volume 10μL

[0067] The sequences of primers TaSVP-HindIII-F and TaSVP-BamHI-R are as follows:

[0068] TaSVP-HindⅢ-F: CCCAAGCTTTATGGCGCGGGAGCGGAGGG (SEQ ID NO: 6);

[0069] TaSVP-BamHI-R: CGGGATCCTTACTTCCACGGAAGGCAG (SEQ ID NO: 7).

[0070] 4. Construction of TaSVP-6B gene editing vector

[0071] The sgRNA was designed for the conserved region of the first exon of TaSVP-6B, and the sequence in the 5'-3' direction was CCGAGGAGCTCTCCGTCCTCTGC (SEQ ID NO: 8). The sequence was cloned into the editing vector pLGYE-003 (provided by Li Genying, Researcher of the Institute of Crop Sciences, Shandong Academy of Agricultural Sciences, with the structure as shown in Figure 4 The ligation reaction was carried out on a PCR instrument. The ligation system is shown in Table 4. The reaction conditions are as follows: first maintain at 37°C for 5 minutes, then maintain at 16°C for 10 minutes, for a total of 40 cycles, and then maintain at 16°C for 1 hour. The ligation product was then transformed into E. coli competent cells (Trans), and positive clones were screened on LB+Kan solid medium.

[0072] Table 4 Infusion seamless cloning connection system

[0073] Element Dosage Editing vector pLGYE-003 50ng PCR amplification products 300ng 10×T4 Ligase Buffer 1μL BSA 1μL T4 Ligase 0.5μL Restriction endonuclease BsaI 0.5μL <![CDATA[ddH2O]]> Complement to 10μ

[0074] 5. Genetic transformation of TaSVP-6B transgenic overexpression vector and TaSVP-6B gene editing vector

[0075] 1. Agrobacterium transformation

[0076] The steps of Agrobacterium transformation are as follows:

[0077] (1) Add about 1 μg of the constructed TaSVP-6B transgenic overexpression vector and TaSVP-6B gene editing vector plasmids into Agrobacterium EHA105 competent cells, gently mix the competent cells, and place them on ice for 5 min;

[0078] (2) Place the competent cells containing the plasmid in liquid nitrogen for 5 min, then heat shock them in a 37°C water bath for 5 min, and then place them on ice for 5 min;

[0079] (3) Add 800 μL LB liquid medium to the competent cells containing the plasmid, shake and incubate at 30°C and 180 rpm for 3 h, then centrifuge at 5000 rpm for 2 min, retain the precipitate (bacteria) and 200 μL supernatant, resuspend the bacteria and spread them on the corresponding resistance LB solid medium and incubate at 30°C for 60 h to obtain Agrobacterium strains.

[0080] 2. Callus induction of wheat immature embryos

[0081] The specific method for inducing wheat immature embryo callus is as follows:

[0082] Young wheat seeds that have been pollinated for 10-15 days are placed in a conical flask, first disinfected with 70% ethanol for 60 seconds, then soaked in 0.1% mercuric chloride solution for 10 minutes, and the conical flask is continuously shaken during the soaking period to allow the mercuric chloride to fully contact the wheat seeds, and then the wheat seeds are rinsed with sterile water for 3-4 times, and the rinsed wheat seeds are placed in a culture dish, the embryo tips are cut off, and then the young embryos are placed in an induction culture medium with the shield plates facing upwards, and cultured in the dark at 25°C for 15 days to obtain wheat young embryo explants with induced callus tissue.

[0083] 3. Agrobacterium culture

[0084] The specific method of cultivating Agrobacterium is as follows:

[0085] (1) Take the Agrobacterium strain obtained above and streak it with an inoculation loop into a solid LB medium containing 30 μg / mL rifampicin and 100 μg / mL spectinomycin, and culture it for 2-3 days until a bacterial lawn is formed;

[0086] (2) Pick a 0.5 cm bacterial lawn and inoculate it into 50 mL of liquid LB medium containing 30 μg / mL rifampicin and 100 μg / mL spectinomycin, and culture it overnight at 28°C until the OD 600 Reach 0.6-0.8.

[0087] 4. Vector genetic transformation

[0088] The method of vector genetic transformation is as follows:

[0089] (1) Place the Agrobacterium obtained by overnight culture in a 50 mL centrifuge tube, collect the cells by centrifugation at 5000 rpm, dry the cells with sterilized filter paper, and then add an equal volume of resuspension solution to resuspend the cells to obtain resuspended Agrobacterium;

[0090] (2) Immerse the wheat immature embryo explants with induced callus tissue obtained above into the resuspended Agrobacterium, infect at room temperature for 20 minutes, then transfer to a culture dish covered with sterilized filter paper, culture in the dark at 25°C for 48 hours, then transfer to an antibacterial medium, culture under light at 25°C, and subculture every 10-15 days;

[0091] (3) The callus tissue that has been subcultured several times and has good growth condition is transferred to a differentiation medium and cultured at 25°C in the light until seedlings emerge, and then transferred to a rooting medium and cultured at 25°C in the light until multiple strong roots grow to obtain T1 seedlings;

[0092] (4) Planting the T1 seedlings in the field to obtain T1 strains, taking samples from each individual plant for PCR positive identification, and obtaining T1 TaSVP-6B overexpression transgenic strains and T1 TaSVP-6B gene-edited strains;

[0093] (5) self-pollinating the T1 generation lines to obtain T2 generation seeds;

[0094] (6) Planting T2 seeds in the field to obtain T2 strains, and similarly taking samples from each individual plant for PCR positive identification to obtain T2 TaSVP-6B overexpression transgenic strains and T2 TaSVP-6B gene-edited strains;

[0095] (7) Self-pollinate the T2 generation lines to obtain T3 generation seeds.

[0096] Among them, the PCR primers used for positive identification of TaSVP-6B overexpression transgenic strains were JIT163-F and TaSVP-R, and the PCR primers used for positive identification of TaSVP-6B gene-edited strains were TaSVP-6A-F / R, TaSVP-6B-F / R, and TaSVP-6D-F / R. The sequences of each PCR primer are as follows:

[0097] JIT163-F: GCAGCATCTATTCATATGCTC (SEQ ID NO:9);

[0098] TaSVP-R: CTGTTCCAAGAATTGTTGATC (SEQ ID NO: 10);

[0099] TaSVP-6A-F: ACGGTGCTCCGAGCCTGCCTG (SEQ ID NO: 11);

[0100] TaSVP-6A-R: GAGAGGCGGGTAGATCTACGGA (SEQ ID NO: 12);

[0101] TaSVP-6B-F:GAGCCGCGCCAGCACGGTAT (SEQ ID NO: 13);

[0102] TaSVP-6B-R: GAAGAGAGGCGGGCAGATCTACAT (SEQ ID NO: 14);

[0103] TaSVP-6D-F: ACGGTGCTCCGAGCCTGCCTC (SEQ ID NO: 15);

[0104] TaSVP-6D-R: GCGAGAAGACGAGGCGAGAAA (SEQ ID NO: 16).

[0105] The specific PCR reaction procedure was as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 10 min; end amplification, and store at 12°C.

[0106] VI. Phenotypic identification of TaSVP-6B transgenic wheat

[0107] like Figures 5 to 11 As shown, the phenotypes (plant height and internodes) of the T2 generation TaSVP-6B overexpression transgenic lines (TaSVP-OX#1, TaSVP-OX#2, and TaSVP-OX#3) obtained previously were identified and it was found that compared with the wild-type Kenong 199 (KN199), the internode length and plant height below the ear of the TaSVP-6B overexpression transgenic lines were significantly increased.

[0108] The TaSVP-6B gene-edited strain was self-pollinated and sequenced to obtain the three-gene homozygous edited strain TaSVP-aabbdd in which the TaSVP-6B gene was located on the A, B and D subgenomes and the homozygous edited strain TaSVP-6B gene TaSVP-AAbbDD. The genotypes of the TaSVP-6B gene-edited strains are shown in Table 5.

[0109] Table 5 Genotypes of TaSVP-6B gene-edited strains

[0110] Material Name Editing target genotype KN199-A CCGAGGAGCTCTCCGTCCTCTGC (SEQ ID NO:17) KN199-B CCGAGGAGCTCTCCGTCCTCTGC (SEQ ID NO:18) KN199-D CCGAGGAGCTCTCCGTCCTCTGC(SEQ ID NO:19) TaSVP-aabbdd-A CCGAGG-----TCCGTCCTCTGC(SEQ ID NO:20) TaSVP-aabbdd-B CCGAGG-GCTCTCCGTCCTCTGC (SEQ ID NO:21) TaSVP-aabbdd-D CCGAG--GCTCTCCGTCCTCTGC(SEQ ID NO:22) TaSVP-AAbbDD-A CCGAGGAGCTCTCCGTCCTCTGC(SEQ ID NO:23) TaSVP-AAbbDD-B CCGAGG-GCTCTCCGTCCTCTGC (SEQ ID NO:24) TaSVP-AAbbDD-D CCGAGGAGCTCTCCGTCCTCTGC(SEQ ID NO:25)

[0111] like Fig.12 As shown, the phenotypes (plant height and internodes below the ear) of the homozygous edited lines TaSVP-aabbdd and TaSVP-AAbbDD obtained previously were identified and it was found that compared with the transgenic negative control Kenong 199, the homozygous edited lines TaSVP-aabbdd and TaSVP-AAbbDD both showed varying degrees of shortening of the internodes below the ear and reduction in plant height.

[0112] In summary, the TaSVP-6B gene shown in SEQ ID NO: 1 and the protein encoded by it (SEQ ID NO: 26) can regulate the plant height and internode length below the ear of wheat. Knocking out the TaSVP-6B gene shown in SEQ ID NO: 1 from the wheat chromosome or inhibiting the expression of the protein shown in SEQ ID NO: 26 (for example: inhibiting the expression of the protein by knocking out the gene encoding the protein) can significantly reduce the internode length below the ear and plant height of wheat, thereby obtaining dwarf wheat with better lodging resistance.

[0113] It should be noted that the above embodiments are merely examples for clearly illustrating the present invention, and are not intended to limit the embodiments of the present invention. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is impossible to list all the embodiments here. Any obvious changes or modifications derived from the technical solution of the present invention are still within the scope of protection of the present invention.

Claims

1. Application of the TaSVP-6B gene shown in SEQ ID NO: 1 in regulating wheat plant height and internode length below the ear, the application comprising using gene editing technology to delete the TaSVP-6B gene shown in SEQ ID NO: 1 in the target wheat genome, thereby obtaining dwarf wheat with shortened plant height and internode length below the ear.

2. Application of the protein shown in SEQ ID NO: 26 in regulating wheat plant height and internode length below the ear, wherein the application is to inhibit the expression of the protein shown in SEQ ID NO: 26 in target wheat to obtain dwarf wheat with shortened plant height and internode length below the ear.

3. The use according to claim 2, characterized in that: The method for inhibiting the expression of the protein shown in SEQ ID NO: 26 of the target wheat is: using gene editing technology to delete the gene encoding the protein shown in SEQ ID NO: 26 in the target wheat genome.

4. The use according to claim 3, characterized in that: The gene encoding the protein shown in SEQ ID NO: 26 in the wheat genome is the TaSVP-6B gene, and the nucleotide sequence of the TaSVP-6B gene is shown in SEQ ID NO: 1.

Images