Primer group, kit and identification method for rapidly identifying genetic sex of siniperca chuatsi and application

Abstract

The invention provides a primer group, a kit and an identification method for rapidly identifying genetic sex of siniperca chuatsi and application, and relates to the technical field of molecular biology. The primer group comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown as SEQ ID NO. 1, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 2. The primer group can accurately distinguish the male and female sex of siniperca chuatsi at the genome level, so that the physiological genetic sex of sex reversal individuals is rapidly identified. The establishment of the method provides an important scientific basis for the development of a subsequent siniperca chuatsi unisexual breeding technology and the research of a sex determination mechanism.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a primer set, a kit, an identification method and an application for rapidly identifying the genetic sex of Siniperca chuatsi. Background Art

[0002] Mandarin fish (Siniperca chuatsi Basilewsky), commonly known as sweet-scented osmanthus fish and seasonal fish, belongs to the order Perciformes, subfamily Sinipercinae, genus Siniperca, and is a rare freshwater fish unique to my country. As a typical carnivorous fish, mandarin fish needs to eat live bait throughout its life from the moment it opens its mouth, which is very rare in the world's aquaculture industry. Compared with conventional economic fish, mandarin fish has a higher nutritional content and more delicious and tender meat, and is deeply favored by consumers at home and abroad. Statistics from the "2023 China Fisheries Yearbook" show that the output of mandarin fish farming in 2022 exceeded 400,000 tons, with an output value of more than 20 billion yuan, and the output value of the entire industry chain is estimated to be 60-70 billion yuan. It has become an important force in driving economic development and revitalizing rural industries. Similar to other economic fish, mandarin fish has sexual dimorphism. There are significant male and female differences in growth rate and individual specifications during mandarin fish farming. Under the same breeding conditions, female mandarin fish grow more than 18.6% faster than male fish in the same year; however, in the breeding season, female mandarin fish are prone to mass death due to the lack of timely induction of ovulation due to the maturation of gonads. Therefore, from the perspective of the industry, it is of great practical significance to carry out all-male or all-female breeding of mandarin fish. It is difficult to distinguish the sex of early embryos, juveniles and large-sized fish before the gonadal development of mandarin fish by external morphological characteristics. More importantly, in the process of single-sex breeding, it is necessary to screen out physiological sex-reversed individuals induced by hormones. Although several studies have reported the screening of sex-specific molecular markers for mandarin fish, in practice, it was found that these markers were either unstable, non-codominant, or group-specific. Therefore, it is urgent to develop a genetic sex identification method that can accurately identify and is easy to operate. Summary of the invention

[0003] In view of this, the object of the present invention is to provide a primer set for rapidly identifying the genetic sex of Siniperca chuatsi, which can accurately distinguish the male and female sexes of Siniperca chuatsi at the genome level, thereby rapidly identifying the physiological genetic sex of sex-reversed individuals.

[0004] Another object of the present invention is to provide a kit for rapidly identifying the genetic sex of Siniperca chuatsi.

[0005] Another object of the present invention is to provide a method for identifying the genetic sex of Siniperca chuatsi. The establishment of this method provides an important scientific basis for the subsequent development of Siniperca chuatsi single-sex breeding technology and the study of the sex determination mechanism.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The invention provides a primer set for rapidly identifying the genetic sex of Siniperca chuatsi. The primer set comprises an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2.

[0008] The invention also provides a kit for rapidly identifying the genetic sex of Siniperca chuatsi, and the kit comprises the primer set.

[0009] Preferably, the kit further comprises 2×Es-Tag MasterMix and DEPC water.

[0010] The present invention also provides a method for rapid identification of genetic sex of Siniperca chuatsi, comprising the following steps:

[0011] Extracting genomic DNA from the sample to be tested;

[0012] The genomic DNA of the sample to be tested is used as a template, and the primer set or the kit is used to perform PCR amplification on the template to obtain an amplified product, and the amplified product is subjected to electrophoresis to identify the genetic sex of the Siniperca chuatsi according to the electrophoresis result.

[0013] Preferably, the identification standard is: if the electrophoresis result shows two amplification bands of 1400bp and 1000bp at the same time, the sample to be tested is judged to be a male individual; if the electrophoresis result shows only one amplification band of 1400bp, the sample to be tested is judged to be a female individual.

[0014] Preferably, the PCR amplification system comprises, in a volume of 20 μL, 10 μL 2×Es-Tag MasterMix, 1 μL upstream primer, 1 μL downstream primer, 1 μL genome template, and DEPC water added to 20 μL.

[0015] Preferably, the reaction procedure of the PCR amplification includes: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 53°C for 30 s, extension at 72°C for 1 min, 30 cycles; extension at 72°C for 10 min.

[0016] The present invention also provides an application of the primer set, the kit or the rapid identification method in the parthenogenetic breeding of Siniperca chuatsi. Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention uses the published genome of Siniperca chuatsi as a reference, and the accession number of the genome of Siniperca chuatsi is GCA_020085105.1. The genome resequencing data of male and female Siniperca chuatsi are analyzed by comparative genomic bioinformatics, and a large number of insertion and deletion markers are found. The present invention performs primer design and PCR verification on candidate Contig markers, and screens to obtain the primer set of the present invention. The primer set of the present invention can accurately distinguish the male and female sexes of Siniperca chuatsi at the genome level, thereby quickly identifying the physiological genetic sex of sex-reversed individuals. The present invention also establishes a method for rapid identification of the genetic sex of Siniperca chuatsi, which provides an important scientific basis for the subsequent development of the single-sex breeding technology of Siniperca chuatsi and the study of the sex determination mechanism. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the electrophoresis amplification result of an embodiment of the present invention. In the figure, M is the standard molecular weight, and the sizes of M from top to bottom are 1600bp, 1400bp, 1200bp, 1000bp, and 800bp, respectively; ♂ is a male individual; ♀ is a female individual; I-III are samples from different collection sites. DETAILED DESCRIPTION

[0019] The invention provides a primer set for rapidly identifying the genetic sex of mandarin fish. The primer set comprises an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is TGAAGGAATACAGAGAAAGAGAG (SEQ ID NO.1), and the nucleotide sequence of the downstream primer is GGCCTGGCTGCCTTTTGATTCCT (SEQ ID NO.2).

[0020] In the present invention, the screening method of the primer set preferably includes the following steps: collecting 10 male and female Siniperca chuatsi of known sex, dissecting on ice to collect muscle tissue, and extracting genomic DNA from tissue samples. In the present invention, the genomic DNA is preferably extracted from the tissue sample genome according to the method in the instruction manual of the genomic DNA extraction kit Tiangen DP305-03; the genomic sample is subjected to ultrasonic fragmentation to obtain a fragment of about 350 bp in length, which is then terminally modified, A-tailed and connected to an Illumina HiSeq4000 platform for whole genome resequencing to obtain high-throughput raw sequencing data; using the published Siniperca chuatsi genome as a reference, the accession number of the Siniperca chuatsi genome is GCA_020085105.1, and analyzing the resequencing data of the male and female Siniperca chuatsi genomes through comparative genomic bioinformatics, a large number of insertion and deletion markers are found. Primer design and PCR verification are performed on the candidate Contig markers, and the primer sets SEQ ID NO.1 and SEQ ID NO.2 of the present invention are screened.

[0021] The present invention also provides a kit for rapidly identifying the genetic sex of Siniperca chuatsi, the kit comprising the primer set. In the present invention, the kit also comprises 2×Es-Tag MasterMix and DEPC water.

[0022] The present invention also provides a method for rapid identification of genetic sex of Siniperca chuatsi, comprising the following steps:

[0023] Extracting genomic DNA from the sample to be tested;

[0024] The genomic DNA of the sample to be tested is used as a template, and the primer set or the kit is used to perform PCR amplification on the template to obtain an amplified product, and the amplified product is subjected to electrophoresis to identify the genetic sex of the Siniperca chuatsi according to the electrophoresis result.

[0025] In the present invention, the identification standard is: if the electrophoresis results show two amplification bands of 1400bp and 1000bp at the same time, the sample to be tested is judged to be a male individual; if the electrophoresis results show only one amplification band of 1400bp, the sample to be tested is judged to be a female individual.

[0026] In the present invention, the PCR amplification system includes, in a volume of 20 μL, 10 μL 2×Es-Tag Master Mix, 1 μL upstream primer, 1 μL downstream primer, 1 μL genome template, and DEPC water added to 20 μL.

[0027] In the present invention, the reaction procedure of PCR amplification includes: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 53°C for 30 s, extension at 72°C for 1 min, 30 cycles; extension at 72°C for 10 min.

[0028] The present invention also provides an application of the primer set or the kit or the rapid identification method in the parthenogenetic breeding of Siniperca chuatsi. The technical solution provided by the present invention is described in detail below in conjunction with the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0029] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available products unless otherwise specified.

[0030] Example 1

[0031] A primer set for rapid identification of genetic sex of Siniperca chuatsi, the sequence of the primer set is as follows:

[0032] SEQ ID NO.1: TGAAGGAATACAGAGAAAGAGAG;

[0033] SEQ ID NO. 2: GGCCTGGCTGCCTTTTGATTCCT.

[0034] The primer set of the present invention is obtained in the following manner:

[0035] Ten male and female Siniperca chuatsi of known sex were collected, and muscle tissue was collected by dissection on ice. The genome of tissue samples was extracted according to the instructions of the genomic DNA extraction kit Tiangen DP305-03;

[0036] The genomic samples were fragmented by ultrasonication to obtain fragments of about 350 bp in length, which were then terminally modified, A-tailed, and connected to adapters for whole-genome resequencing on the Illumina HiSeq4000 platform to obtain high-throughput raw sequencing data;

[0037] The published genome of Siniperca chuatsi was used as a reference. The accession number of the genome of Siniperca chuatsi is GCA_020085105.1. The genome resequencing data of male and female Siniperca chuatsi were analyzed by comparative genomic bioinformatics, and a large number of insertion and deletion markers were found. Primers were designed and PCR verified for the candidate contig markers, and the primer set of the present invention was screened and obtained.

[0038] Example 2

[0039] A kit for quickly identifying the genetic sex of Siniperca chuatsi, comprising the primer set of Example 1, 2×Es-Tag MasterMix and DEPC water.

[0040] Example 3

[0041] A method for rapid identification of genetic sex of Siniperca chuatsi, comprising the following specific steps:

[0042] Extracting genomic DNA from the Siniperca chuatsi sample to be tested;

[0043] The genomic DNA of the above-mentioned Siniperca chuatsi sample to be tested is used as a template, and the template is amplified by PCR using the primer set of Example 1 to obtain an amplified product. The amplified product is subjected to electrophoresis, and the genetic sex of the Siniperca chuatsi is identified according to the electrophoresis result.

[0044] The PCR amplification system includes 10 μL 2×Es-Tag MasterMix, 1 μL 2.5 μM upstream primer, 1 μL 2.5 μM downstream primer, 1 μL genomic template, and DEPC water added to 20 μL in a volume of 20 μL;

[0045] The reaction procedure of PCR amplification included: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 53°C for 30 s, extension at 72°C for 1 min, 30 cycles; extension at 72°C for 10 min;

[0046] The identification standard is: if the electrophoresis results show two amplification bands of 1400bp and 1000bp at the same time, the sample to be tested is judged to be a male individual; if the electrophoresis results show only one amplification band of 1400bp, the sample to be tested is judged to be a female individual.

[0047] Test Example 1

[0048] 1. Test materials

[0049] Ten male and female samples of Siniperca chuatsi with known sex were collected from three Siniperca chuatsi breeding sites in Huzhou, and the genetic sex of the Siniperca chuatsi samples was rapidly identified according to the method of Example 3. The specific steps are as follows:

[0050] The genomic DNA of the above samples was extracted, and the genomic DNA was used as a template for gender marker PCR verification. The PCR reaction amplification system included 10 μL 2xEs-Tag MasterMix, 1 μL upstream primer, 1 μL downstream primer, 1 μL genomic template, and DEPC water was added to 20 μL. The PCR amplification conditions were set as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 53°C annealing for 30 s, 72°C extension for 1 min, 30 cycles; 72°C extension for 10 min.

[0051] The PCR products were analyzed by 1.5% agarose gel electrophoresis. The results showed that the samples that could amplify two genomic fragments of 1400 bp and 1000 bp were judged as male individuals, and the samples that could only amplify the 1400 bp fragment were judged as female individuals ( Figure 1 ).

[0052] In summary, the accuracy of sex identification of Siniperca chuatsi using the method of the present invention reaches 100%, and the method of the present invention has important significance and application value for subsequent research on the single-sex breeding technology and sex determination mechanism of Siniperca chuatsi.

[0053] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A primer set for rapid identification of the genetic sex of Siniperca chuatsi, characterized in that: The primer set includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

2.

2. A kit for rapidly identifying the genetic sex of Siniperca chuatsi, characterized in that: The kit comprises the primer set according to claim 1.

3. The kit according to claim 2, wherein The kit also includes 2×Es-Tag Master Mix and DEPC water.

4. A method for rapid identification of genetic sex of Siniperca chuatsi, characterized in that: The steps include: Extracting genomic DNA from the sample to be tested; The genomic DNA of the sample to be tested is used as a template, and the template is amplified by PCR using the primer set described in claim 1 or the kit described in any one of claims 2 to 3 to obtain an amplified product. The amplified product is subjected to electrophoresis, and the genetic sex of the mandarin fish is identified based on the electrophoresis results.

5. The rapid identification method according to claim 4, characterized in that The identification criteria are: if two amplified bands of 1400 bp and 1000 bp appear simultaneously in the electrophoresis results, the sample to be tested is determined to be a male individual; If only one amplified band of 1400 bp appears in the electrophoresis results, the sample to be tested is determined to be a female individual.

6. The rapid identification method according to claim 4, characterized in that The PCR amplification system includes, in a volume of 20 μL, 10 μL 2×Es-Tag MasterMix, 1 μL upstream primer, 1 μL downstream primer, 1 μL genome template, and DEPC water added to 20 μL.

7. The rapid identification method according to claim 4, characterized in that The PCR amplification reaction procedure includes: pre-denaturation at 94° C. for 5 min; denaturation at 94° C. for 30 s, annealing at 53° C. for 30 s, and extension at 72° C. for 1 min, 30 cycles; and extension at 72° C. for 10 min.

8. Use of the primer set according to claim 1, the kit according to any one of claims 2 to 3, or the rapid identification method according to any one of claims 4 to 7 in parthenogenetic breeding of Siniperca chuatsi.

Images