A molecular marker of RGS8 gene related to immune traits of Tibetan sheep and its application

Abstract

The present invention relates to the field of molecular marker technology, and in particular to a molecular marker and application of an RGS8 gene related to Tibetan sheep immune traits. A molecular marker of the RGS8 gene related to Tibetan sheep immune traits, wherein the SNP molecular marker is located at the 61733690th base on chromosome 12 of the international sheep genome Oar_v4.0 version, and the mutant base is C or T. The present invention can determine the immunoglobulin IgA and IgG content of Tibetan sheep individuals by detecting the base at the 61733690C nucleotide site on chromosome 12 of Tibetan sheep, and the present invention provides a new SNP molecular marker resource for Tibetan sheep immune trait marker-assisted selection for non-diagnostic purposes.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and in particular to an RGS8 gene molecular marker related to immune traits of Tibetan sheep and its application. Background Art

[0002] With the continuous development of the sheep industry, there are more and more types of sheep diseases, the complexity is increasing, and the control is becoming more and more difficult. Sheep diseases are becoming more and more harmful to sheep production. At the same time, the use of a large number of drugs will make the animal body resistant to drugs, posing a hidden danger to the safety of livestock products.

[0003] In the long run, starting from the genetic basis of disease resistance, screening resistance genes, carrying out disease-resistant breeding at the molecular level, genetically improving the resistance of sheep to pathogens, and enhancing immunity are important ways to fundamentally solve this problem. Tibetan sheep have lived in the Qinghai-Tibet Plateau for a long time, and the environment is harsh, so they need higher disease resistance to adapt to this environment. Therefore, improving the disease resistance of Tibetan sheep can make sheep more adaptable to harsh natural environments such as high altitude, low pressure, strong ultraviolet rays, hypoxia and cold season nutritional stress.

[0004] Immune indicators can reflect the disease resistance of animals. The disease resistance of animals mainly depends on the health and ability of their immune system. The main function of the immune system is to identify and eliminate pathogens that invade the body, such as bacteria and viruses. When pathogens invade, the immune system will respond quickly and initiate a series of immune response processes to fight and eliminate pathogens.

[0005] Immunoglobulin G (IgG) is closely related to the disease resistance of animals. IgA refers to immunoglobulin A, which ranks second in serum, second only to IgG, and has an anti-infection effect. If the content of IgG and IgA in the body decreases, it is easy to cause low immune function. If the content of IgG and IgA in the body increases, the body's disease resistance will be enhanced. The enhancement of disease resistance can reduce the use of drugs, reduce production costs, and increase breeding benefits. Therefore, it is of great significance to screen SNP molecular markers associated with the immune traits of Tibetan sheep. Moreover, immune indicators can be used as an important reference to evaluate the disease resistance and health status of animals. By monitoring the changes in immune indicators, the immune problems of animals can be discovered in time, and corresponding measures can be taken to improve their disease resistance, prevent and treat diseases.

[0006] The RGS8 gene is a member of the G protein signal transduction (RGS) family of regulators and encodes a protein with a single RGS domain. G protein signal transduction regulator proteins are regulatory and structural components of G protein-coupled receptor complexes. They accelerate transport to GDP through the GTP binding and hydrolysis cycle, thereby terminating signal transduction, but paradoxically, they also accelerate activation of receptor stimulation. However, there is currently no established detection method for the RGS8 gene as a molecular marker for immune traits in Tibetan sheep, and this gene has not been used as a molecular marker for immune traits in Tibetan sheep for assisted selection.

[0007] Therefore, how to use genetics and genetic engineering technology to find the variation sites in the RGS8 gene at the genetic level in Tibetan sheep breeding, discover the relationship between genes and traits through association analysis between genes and traits, and conduct early selection, thereby improving the efficiency and accuracy of selection, has broad application value. Summary of the invention

[0008] The purpose of the present invention is to provide a RGS8 gene molecular marker related to the immune traits of Tibetan sheep and its application.

[0009] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0010] The invention provides an RGS8 gene molecular marker related to the immune traits of Tibetan sheep. The molecular marker is located at the 61733690th base on chromosome 12 of the international sheep genome Oar_v4.0 version, and the mutant base is C or T.

[0011] Preferably, the genotype of the Tibetan sheep with the mutant base C is CC or CT;

[0012] The genotype of Tibetan sheep with the mutant base T is TT;

[0013] The immunoglobulins IgA and IgG of Tibetan sheep with TT genotype were significantly higher than those of those with CC genotype.

[0014] There was no significant difference in immunoglobulin IgA and IgG between CC and CT genotype Tibetan sheep individuals;

[0015] There was no significant difference in immunoglobulin IgA and IgG between Tibetan sheep individuals with TT and CT genotypes.

[0016] The present invention also provides the use of the molecular marker in the marker-assisted selection of Tibetan sheep immune traits for non-diagnostic purposes.

[0017] The present invention also provides the application of the molecular marker in Tibetan sheep assisted breeding.

[0018] The present invention also provides a primer pair for amplifying the molecular marker, and the primer pair is shown as SEQ ID NO. 2 and 3.

[0019] The present invention also provides the use of the primer pair in preparing a Tibetan sheep immune trait marker-assisted selection product for non-diagnostic purposes.

[0020] The present invention also provides application of the primer pair in preparing products for auxiliary breeding of Tibetan sheep.

[0021] The present invention also provides a method for marker-assisted selection of Tibetan sheep immune traits for non-diagnostic purposes, characterized in that it comprises the following steps:

[0022] (1) Extracting Tibetan sheep genomic DNA;

[0023] (2) using the Tibetan sheep genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair to obtain an amplified product;

[0024] (3) Performing genotyping analysis on the amplified products to obtain Tibetan sheep with different genotypes; correlating the genotypes of the Tibetan sheep with immune indicators; the immune indicators include IgA and / or IgG.

[0025] Preferably, the amplification system in step (2) is: 22 μL of Gold Mix (green), 1 μL of upstream and downstream primers, and 1 μL of template DNA;

[0026] The amplification program of step (2) is: 98°C for 2 min; 98°C for 10 s, 57.5°C for 10 s, 72°C for 10 s, for a total of 40 cycles; and extension at 72°C for 2 min.

[0027] The present invention also provides a kit for non-diagnostic purpose Tibetan sheep immune trait marker-assisted selection and / or Tibetan sheep assisted breeding, comprising a reagent for detecting the molecular marker or the primer pair.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] The SNP molecular marker described in the present invention is located at the 61733690C base on chromosome 12 of the international sheep reference genome Oar_v4.0 version; the variation type is C / T, named g61733690C>T, and there are three genotypes. When the 61733690C base on chromosome 12 is C, the genotype is CC or CT; when the 61733690C base on chromosome 12 is T, the genotype is TT.

[0030] The present invention analyzes the association between different genotypes and the content of immunoglobulins IgA and IgG, and finds that the immunoglobulins IgA and IgG of Tibetan sheep individuals with the TT genotype are significantly higher than those of individuals with the CC genotype (p<0.05), the immunoglobulins IgA and IgG of Tibetan sheep individuals with CC and CT genotypes are not significantly different (p>0.05), and the immunoglobulins IgA and IgG of Tibetan sheep individuals with TT and CT genotypes are not significantly different (p>0.05). The present invention can determine the content of immunoglobulins IgA and IgG of Tibetan sheep individuals by detecting the base of the 61733690C nucleotide site on chromosome 12 of Tibetan sheep. The present invention provides a new SNP molecular marker resource for marker-assisted selection of Tibetan sheep immune traits for non-diagnostic purposes. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0032] Figure 1 is the PCR amplification product; M represents Marker; 1, 2, and 3 represent three groups of repetitions.

[0033] Figure 2 The peak diagram and sequence are obtained after the PCR product is purified and sequenced. DETAILED DESCRIPTION

[0034] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0035] Example 1

[0036] 1. Sample Collection

[0037] The samples came from Tibetan sheep populations under natural grazing conditions, including 60 samples from Gannan Tibetan Autonomous Prefecture, Gansu Province, 40 samples from Yushu Tibetan Autonomous Prefecture, Qinghai Province, and 49 samples from Shigatse City, Tibet Autonomous Region. 5 mL of blood samples were collected from 149 fasting Tibetan sheep and placed in a clean pro-coagulant vacuum blood collection tube, left to stand for 30 minutes, and then centrifuged at 3500r / min for 15 minutes. The supernatant was aspirated into a clean PE tube, which was sealed and stored in a -20℃ low-temperature refrigerator. Another 5 mL of blood sample was collected in a blood collection tube with EDTA-K2 anticoagulant added. After the blood sample was collected, it was quickly mixed and temporarily stored in a sampling box containing ice packs. After being transported back to the laboratory, it was frozen in a -20℃ refrigerator for extraction of genomic DNA.

[0038] 2. Main reagents and instruments

[0039] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; blood genomic DNA extraction kits were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; NaNODrop2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL2000 Marker, agarose, and nucleic acid dyes were purchased from Beijing Solebaugh Technology Co., Ltd.; Gold Mix (green) was purchased from Beijing Qingke Biotechnology Co., Ltd.; electrophoresis instrument was purchased from Beijing Liuyi Instrument Factory; PCR instrument was purchased from BioRad. Immunoglobulin A (IgA) (E027-1-1) and immunoglobulin G (IgG) (E026-1-1) detection kits were purchased from Nanjing Jiancheng Bioengineering Institute.

[0040] 3. Methods

[0041] 3.1 Immunoglobulin IgA and IgG detection

[0042] The IgA and IgG detection kits of Nanjing Jiancheng Bioengineering Institute were used for the determination using the spectrophotometer method. First, the standard product was used to establish the standard curve; secondly, distilled water, standard solution and 7 μL of the sample to be tested were added to the blank tube, standard tube and measurement tube respectively, and R1 solution was added to 900 μL, incubated at 37°C for 5 minutes, and the reading at a wavelength of 340 nm was recorded as A1; then 180 μL of R1 solution was added to each tube, incubated at 37°C for 5 minutes, and the reading at a wavelength of 340 nm was recorded as A2; finally, △A=A2-A1 was calculated, and △A was substituted into the standard curve equation to calculate the sample IgA and IgG concentrations.

[0043] 3.2 Extraction of genomic DNA from blood

[0044] The blood genome extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract genomic DNA from the blood samples. The extracted DNA was placed under an ultraviolet spectrophotometer to detect the concentration and purity. The concentration was greater than 20 ng / μL and OD260 / OD280 was between 1.7 and 1.9, which met the experimental requirements. It was stored at -20°C for future use.

[0045] 3.3 Primer design

[0046] Referring to the chromosome 12 gene sequence of the international sheep genome Oar_v4.0 version (GenBank accession number: NC_019469.2), a pair of specific primers including the g61733690C>T SNP site were designed using primerpremier5.0 software.

[0047] Primer sequences:

[0048] F: 5'-ACAAAGTACGACCACTAACCA-3' (as shown in SEQ ID NO: 2);

[0049] R: 5'-TCTTGGAGATCACCGGCTTC-3' (as shown in SEQ ID NO: 3).

[0050] The length of the amplified fragment was 216 bp, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0051] 3.4 PCR amplification and sequencing

[0052] PCR amplification system 25 μL: Gold Mix (green) 22 μL, upstream and downstream primers 1 μL each, template 1 μL.

[0053] PCR amplification program: 98°C for 2 min; 98°C for 10 s, 57.5°C for 10 s, 72°C for 10 s, for a total of 40 cycles; extension at 72°C for 2 min.

[0054] The PCR product was detected by 1.5% agarose gel electrophoresis. After the PCR product was qualified by agarose gel electrophoresis, it was sequenced by direct sequencing, and the sequencing was completed by Beijing Qingke Biotechnology Co., Ltd. The amplified nucleotide sequence is shown in SEQ ID NO.1, and the SNP marker is located at position 125 of the nucleotide sequence shown in SEQ ID NO.1.

[0055] The biological analysis software MEGA6.0 was used to compare the sequencing results of PCR products, analyze the sequencing peak graph, and complete the typing.

[0056] 4. Statistical Analysis

[0057] According to the genotyping results, the number of individuals with different genotypes at each site was counted. Popgen32 software was used to calculate the g61733690C>T gene frequency, genotype frequency, effective allele number (Ne), site heterozygosity (He), and Hardy-Weinberg equilibrium test, and PIC (polymorphism information content, referred to as PIC) calculation software was used to calculate the polymorphic information content. The general linear model in IBM SPSS Statistics 22 software was used to analyze the association between different genotypes of Tibetan sheep and immunoglobulins IgA and IgG, and the results were expressed as "mean ± standard error".

[0058] 5. Results

[0059] 5.1 PCR amplification and sequencing results

[0060] The amplified product of the g61733690C>T SNP site on chromosome 12 of Tibetan sheep was detected by 1.5% agarose gel (see Figure 1 ), the bands were clear without any other bands, the specificity was good, and the size of the PCR product fragment was 216 bp, which was in line with the expected size, so the next step of the experiment could be carried out.

[0061] SEQ ID NO.1

[0062] ACAAAGTACGACCACTAACCAAAACACAAGGTAAAGGGGGCAGGACAGAGTCCGAGCTCTGGTGGCTGGATCAGACTTTGGAATGGCCCTTCATCCGTTCCTCACTCCTGGCCTCCCAACCTAATCGCCACTGCTTTTGAACACCTACAACACTTCACATTAGAATATGGTCTTGGCAGCAAGGGGAGGGGGAAGCCGGTGATCTCCAAGA.

[0063] The peak diagram and sequence obtained after the PCR product was purified and sequenced are shown in Figure 2 .Depend on Figure 2 It can be seen that the g61733690C>TSNP site has a CT mutation, and there are three genotypes: CC, CT, and TT.

[0064] 5.2 Statistical analysis results

[0065] The genotype and allele frequencies of the g61733690C>T SNP site on chromosome 12 of Tibetan sheep were analyzed from the perspective of population genetics. As shown in Table 1, at the g61733690C>T SNP site, the CC genotype frequency was the highest, which was the dominant genotype, and the C allele frequency was 94.0%, which was the dominant allele. The χ2 fitness test showed that the SNP site deviated significantly from the Hardy-Weinberg equilibrium state (P<0.05) (Table 1). The expected heterozygosity of this site was 0.114, the PIC was 0.107, and the PIC was <0.25, which was a low degree of polymorphism.

[0066] Table 1 Polymorphism of the g61733690C>T SNP locus on chromosome 12 of Tibetan sheep

[0067]

[0068]

[0069] 5.3 Analysis of association between different genotypes and immunoglobulins IgA and IgG

[0070] The general linear model in IBM SPSS Statistics 22 software was used to analyze the association between different genotypes of Tibetan sheep and the content of immunoglobulin IgA and IgG. The results showed that the immunoglobulin IgA and IgG of Tibetan sheep individuals with TT genotype were significantly higher than those with CC genotype (p<0.05), and the immunoglobulin IgA and IgG of Tibetan sheep individuals with CC and CT genotypes were not significantly different (p>0.05). The immunoglobulin IgA and IgG of Tibetan sheep individuals with TT and CT genotypes were not significantly different (p>0.05), indicating that the base of the g61733690C>T SNP site on chromosome 12 of Tibetan sheep is significantly associated with IgA and IgG of Tibetan sheep, and is a SNP marker related to IgA and IgG of Tibetan sheep. The results are shown in Table 2.

[0071] Table 2 Correlation analysis between different genotypes and immunoglobulin IgA and IgG

[0072]

[0073] Note: Different lowercase letters between data in the same row indicate significant differences (P<0.05).

[0074] In summary, the SNP molecular marker described in the present invention is located at the 61733690C base on chromosome 12 of the international sheep reference genome Oar_v4.0 version; the variation type is C / T, named g61733690C>T, and there are three genotypes. When the 61733690C base on chromosome 12 is C, the genotype is CC or CT; when the 61733690C base on chromosome 12 is T, the base The genotype is TT; through the association analysis between different genotypes and the immunoglobulin IgA and IgG content, it was found that the immunoglobulin IgA and IgG of the Tibetan sheep individuals with the TT genotype were significantly higher than those of the CC genotype individuals (p<0.05), the immunoglobulin IgA and IgG of the Tibetan sheep individuals with CC and CT genotypes were not significantly different (p>0.05), and the immunoglobulin IgA and IgG of the Tibetan sheep individuals with TT and CT genotypes were not significantly different (p>0.05). The present invention can determine the immunoglobulin IgA and IgG content of Tibetan sheep individuals by detecting the base of the 61733690C nucleotide site on the chromosome 12 of Tibetan sheep. The present invention provides a new SNP molecular marker resource for marker-assisted selection of Tibetan sheep immune traits for non-diagnostic purposes.

[0075] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting molecular markers related to immune traits of Tibetan sheep in the preparation of a product for detecting immunity of Tibetan sheep, characterized in that: The molecular marker is located at the 61733690th base on chromosome 12 of the international sheep genome Oar_v4.0 version, and the mutant base is C or T; The immunoglobulins IgA and IgG of Tibetan sheep with TT genotype were significantly higher than those of those with CC genotype. There was no significant difference in immunoglobulin IgA and IgG between CC and CT genotype Tibetan sheep individuals; There was no significant difference in immunoglobulin IgA and IgG between Tibetan sheep individuals with TT and CT genotypes.

2. Application of a reagent for detecting molecular markers of Tibetan sheep immunity in the preparation of products for assisting breeding of Tibetan sheep with high immunity, characterized in that: The molecular marker is located at the 61733690th base on chromosome 12 of the international sheep genome Oar_v4.0 version, and the mutant base is C or T; The immunoglobulins IgA and IgG of Tibetan sheep with TT genotype were significantly higher than those of those with CC genotype. There was no significant difference in immunoglobulin IgA and IgG between CC and CT genotype Tibetan sheep individuals; There was no significant difference in immunoglobulin IgA and IgG between Tibetan sheep individuals with TT and CT genotypes.

3. The use according to claim 1 or 2, characterized in that: The reagent is a primer pair; The primer pair is shown in SEQ ID NO.1~2.

Images