Nucleic acid vaccines for respiratory syncytial virus (RSV)

Abstract

Provided herein are therapeutic nucleic acid molecules for the control, prevention and / or treatment of diseases or conditions caused by respiratory syncytial virus or infection with respiratory syncytial virus. Also provided herein are therapeutic compositions, including vaccines and lipid nanoparticles, comprising the therapeutic nucleic acids, as well as related methods of treatment and uses.

Description

1. Technical Field

[0001] The present disclosure generally relates to nucleic acid molecules that can be used to control, prevent and treat diseases or conditions caused by respiratory syncytial virus (RSV) or by infection with respiratory syncytial virus. The present disclosure also relates to lipid-containing compositions (including vaccines) of the nucleic acid molecules. 2. Background technology

[0002] Respiratory syncytial virus (RSV) is a member of the Paramyxoviridae family that causes upper and lower respiratory tract illness worldwide, with a higher incidence in infants, immunocompromised individuals, and the elderly. 1 In 2019, there were 33 million RSV-associated episodes of acute lower respiratory tract infection, 3.6 million RSV-associated acute lower respiratory tract infection hospitalizations, 26,300 RSV-associated acute lower respiratory tract infection hospitalization deaths, and 101,400 overall deaths from RSV among children under 5 years of age. 2 Although RSV infection is often characterized as a pediatric disease, RSV infection in adults represents a substantial health burden. On average, approximately 5% of older adults become infected with RSV each year, resulting in an estimated 1.5 million episodes of RSV-ARI, 214,000 involving hospitalizations and approximately 14,000 in-hospital deaths. 3 .

[0003] There is currently no vaccine against RSV, but such a vaccine is needed due to the high disease burden. In contrast to attachment protein G, the RSV fusion protein (F protein) is well conserved between clinical isolates and between RSV-A and RSV-B antigenic subgroups 4 , making it an attractive target for vaccines and therapeutic antibodies. As a class I membrane fusion protein, RSV F protein exists in a metastable prefusion conformation on the viral surface and rearranges to a more stable postfusion form during the infection process, thereby enabling membrane fusion between the virus and the host cell. 5，6 The crystal structure of the prefusion RSV F protein was determined in complex with the prefusion-specific antibody D25, which recognizes an antigenic site at the vertex of the RSV F trimer. This work enabled structure-based antigen design and led to the introduction of prefusion-stabilizing mutations into the wild-type RSV F protein to develop vaccine candidates. 7-9 .

[0004] One notable construct is DS-Cav1, a soluble RSV F protein stabilized in a trimeric prefusion conformation by incorporating a trimerization motif, cavity-filling mutations, and non-native disulfide bonds. 7DS-Cav 1 shows great potential as an RSV vaccine candidate; it is combined with a panel of prefusion-specific monoclonal antibodies that target multiple epitopes and elicit robust serum neutralization responses in mice and macaques 7 Also reported are preclinical and clinical evaluations of a modified mRNA / lipid nanoparticle-based vaccine formulation expressing RSV prefusion F by utilizing the DS-Cav 1 construct. 10，11 .

[0005] Despite the great medical need and years of research and development, to date, no RSV vaccine has been licensed for use in any population. Vaccines using live attenuated viruses, recombinant vectors, messenger RNA, and recombinant protein subunits are currently in clinical trials. A major challenge in RSV vaccine development is the need to demonstrate vaccine safety. Expression of Th2-related cytokines IL-4, IL-5, and IL-13 is upregulated in animals vaccinated with FI-RSV vaccine but not in unvaccinated controls. Data from Moderna's preclinical and clinical studies indicate that RSV mRNA vaccines prevent RSV infection and the accompanying inflammatory response associated with infection.

[0006] Nucleic acid-based vaccines consisting of in vitro transcribed mRNA encapsulated within lipid nanoparticles (LNPs) for efficient cellular delivery have the potential to transform vaccine research and development. They allow rapid generation of candidate antigens for preclinical evaluation and elicit strong humoral and cellular immune responses, as well as provide a consistent platform for vaccine manufacturing. 3. Summary of the invention

[0007] In one aspect, provided herein are immunogenic mutants of the fusion protein (F protein) of respiratory syncytial virus (RSV).

[0008] In some embodiments, the mutant comprises one or more mutations compared to the wild-type fusion protein (F protein) from the RSV strain. Optionally, the mutant is capable of inducing higher binding titers to the F protein of both RSV A and RSV B and / or higher neutralizing antibody titers to both RSV A and RSV B strains compared to the corresponding wild-type F protein.

[0009] In some embodiments, the mutant is capable of:

[0010] (1) induces higher (e.g., at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 log units higher) binding titers to the RSV A fusion protein compared to the wild-type RSV A fusion protein; and / or

[0011] (2) induces higher (e.g., at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 log units higher) binding titers to the RSV B fusion protein compared to the wild-type RSV A fusion protein; and / or

[0012] (3) induces higher (e.g., at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 log units higher) binding titers to RSV A fusion protein compared to wild-type RSV B fusion protein; and / or

[0013] (4) induces higher (e.g., at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 log units higher) binding titers to RSV B fusion protein compared to wild-type RSV B fusion protein; and / or

[0014] (5) induces higher (e.g., at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 log units higher) neutralizing antibody titers against RSV A strains compared to wild-type RSV A fusion protein; and / or

[0015] (6) inducing higher (e.g., at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 log units higher) neutralizing antibody titers against RSV B strains compared to wild-type RSV A fusion protein; and / or

[0016] (7) inducing higher (e.g., at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 log units higher) neutralizing antibody titers against RSV A strains compared to wild-type RSV B fusion protein; and / or

[0017] (8) inducing higher (e.g., at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 or 1.0 log units higher) neutralizing antibody titers against RSV B strains compared to wild-type RSV B fusion protein.

[0018] In some embodiments, the mutant is capable of:

[0019] (1) a higher (e.g., at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 log units higher) binding titer to the RSV A fusion protein compared to the wild-type RSV A fusion protein; and / or

[0020] (2) a higher (e.g., at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 log units higher) binding titer against RSV B fusion protein compared to wild-type RSV B fusion protein; and / or

[0021] (3) higher (e.g., at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 log units higher) neutralizing antibody titers against RSV A strains compared to wild-type RSV A fusion protein; and / or

[0022] (4) Higher (e.g., at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 or 1.0 log units higher) neutralizing antibody titers against RSV B strain compared to wild-type RSV B fusion protein.

[0023] In some embodiments, the mutant is capable of:

[0024] (1) induces higher (e.g., at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 log units higher) binding titers to the RSV A fusion protein compared to the wild-type RSV A fusion protein; and / or

[0025] (2) inducing higher (e.g., at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 or 1.0 log units higher) neutralizing antibody titers against RSV A strains compared to wild-type RSV A fusion protein.

[0026] In some embodiments, the mutant is capable of:

[0027] (1) induces higher (e.g., at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 log units higher) binding titers to RSV B fusion protein compared to wild-type RSV B fusion protein; and / or

[0028] (2) inducing higher (e.g., at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 log units higher) neutralizing antibody titers against RSV B strains compared to wild-type RSV B fusion protein.

[0029] In some embodiments, the RSV strain is an A-type strain. In some embodiments, the RSV strain is an A2 strain. In some embodiments, the wild-type fusion protein comprises the amino acid sequence of QGW56794.1, for example, as shown in SEQ ID NO: 130, which comprises a natural signal peptide. In some embodiments, the wild-type fusion protein does not comprise a signal peptide. In some embodiments, the wild-type fusion protein does not comprise a signal peptide and comprises the amino acid sequence of SEQ ID NO: 113. In some embodiments, the RSV strain is a B-type strain. In some embodiments, the RSV strain is a B Fujian strain. In some embodiments, the wild-type fusion protein comprises the amino acid sequence of ASU44512.1, for example, as shown in SEQ ID NO: 131, which comprises a natural signal peptide. In some embodiments, the wild-type fusion protein does not comprise a signal peptide. In some embodiments, the wild-type fusion protein does not comprise a signal peptide and comprises the amino acid sequence of SEQ ID NO: 114.

[0030] In some embodiments, the mutant is in a prefusion conformation. In some embodiments, the mutant is in a stable prefusion conformation. In some embodiments, the mutant is in a membrane-bound form. In some embodiments, the mutant is in a secreted form. In some embodiments, commonly used methods (e.g., PMID: 15544812, PMID: 24179220) are used to change membrane-bound proteins into secreted proteins. In some embodiments, the mutant comprises a C-terminal tail for solubilization (e.g., SEQ ID NO: 111), about 24 amino acid residues are deleted from the N-terminus, and / or about 61 or about 267 amino acid residues are deleted from the C-terminus. In some embodiments, the mutant comprises, for example, a ferritin tag at the C-terminus, such as SEQ ID NO: 112. In some embodiments, the mutant is a truncated fusion protein; preferably, the truncated fusion protein comprises only the site For example, it comprises a deletion of the amino acid residue at positions about 98 to about 144 or about 104 to about 144 or a substitution of the amino acid residue with a GS-linker, and / or a deletion of the amino acid residue at positions about 308 to about 529 or about 308 to about 574 or a substitution of the amino acid residue with a GS-linker, or a C-terminal tail or a ferritin tag for solubilization in the case of positions about 308 to about 574. In some embodiments, the term "about" means, for example, ±1, ±2, ±3, ±4, ±5, ±6, ±7, ±8, ±9, or ±10.

[0031] In some embodiments, the mutant comprises one or more of the following mutations: a deletion of the amino acid residues at positions 26 to 49 (del26..49), a substitution of the amino acid residue at position 46 with glycine (46G), a substitution of the amino acid residue at position 51 with cysteine ​​(51C), a substitution of the amino acid residue at position 67 with isoleucine (67I), a substitution of the amino acid residue at position 92 with aspartic acid (92D), a substitution of the amino acid residue at position 95 with methionine (95M), a substitution of the amino acid residue at position 98 with cysteine ​​(98C), a substitution of the amino acid residues at positions 98 to 144 with a GS-linker (e.g., SEQ ID NO: 110) (e.g., SEQ ID NO: 111). NO: 110 to replace 98..144), replacing the amino acid residues at positions 104 to 144 with a GS-linker (e.g., glycine-serine (GS)) (replacing 104..144 with GS), replacing the amino acid residue at position 149 with cysteine ​​(149C), replacing the amino acid residue at position 155 with cysteine ​​(155C), replacing the amino acid residue at position 183 with glycine-cysteine ​​(GC) (183GC), replacing the amino acid residue at position 190 with phenylalanine (190F), replacing the amino acid residue at position 207 with leucine (207L), replacing the amino acid residue at position 215 with proline (215P), replacing the amino acid residue at position 221 with methionine (221M), replacing the amino acid residue at position 290 with cysteine ​​(290C ... The amino acid residue at position 305 is substituted with an acid (305C), the amino acid residue at position 316 is substituted with cysteine ​​(361C), the amino acid residue at position 373 is substituted with arginine (373R), the amino acid residue at position 428 is substituted with cysteine ​​(428C), the amino acid residue at position 429 is substituted with lysine (429K), the amino acid residue at position 458 is substituted with cysteine ​​(458C), the amino acid residue at position 465 is substituted with glutamine (465Q), the amino acid residue at position 486 is substituted with cysteine ​​(486C), the amino acid residue at position 489 is substituted with cysteine ​​(489C), the amino acid residues at positions 308 to 529 are substituted with a GS-linker (e.g., GGS) (replacing 308..529 with GGS), a C-terminal tail for solubilization (e.g., SEQ ID NO: 134) is substituted with a GS-linker (e.g., GGS) (replacing 308..529 with GGS), and a C-terminal tail for solubilization (e.g., SEQ ID NO: 135). ID NO: 111) to replace the amino acid residues at positions 514 to 574 (replacing 514..574 with SEQ ID NO: 111), and replacing the amino acid residues at positions 514 to 574 with a ferritin tag at the C-terminus (e.g., SEQ ID NO: 112) (replacing 514..574 with SEQ ID NO: 112).574), replacing the amino acid residues at positions 308 to 574 with a C-terminal tail for solubilization (e.g., SEQ ID NO: 111) (replacing 308..574 with SEQ ID NO: 111), and replacing the amino acid residues at positions 308 to 574 with a ferritin tag at the C-terminus (e.g., SEQ ID NO: 112) (replacing 308..574 with SEQ ID NO: 112), the positions are numbered based on the full-length sequence of the wild-type F protein. .

[0032] In some embodiments, particularly in the case of type A strains, the mutant comprises one or more of the following mutations: a deletion of the glutamine at position 26 to the arginine at position 49 (delQ26..R49), a substitution of the serine at position 46 with glycine (S46G), a substitution of the glycine at position 51 with cysteine ​​(G51C), a substitution of the asparagine at position 67 with isoleucine (N67I), a substitution of the glutamic acid at position 92 with aspartic acid (E92D), a substitution of the glutamine at position 98 to the valine at position 144 with a GS-linker (e.g., SEQ ID NO: 110), NO:110 substituted with Q98..V144), substitution of asparagine at position 104 to valine at position 144 with a GS-linker (e.g., glycine-serine (GS)) (substitution of N104..V144 with GS), substitution of alanine at position 149 with cysteine ​​(A149C), substitution of serine at position 155 with cysteine ​​(S155C), substitution of asparagine at position 183 with glycine-cysteine ​​(GC) (N183GC), substitution of serine at position 190 with phenylalanine (S190F), substitution of valine at position 207 with leucine (V207L), substitution of serine at position 215 with proline (S215P), substitution of serine at position 290 with cysteine 486C), aspartic acid at position 489 was substituted with cysteine ​​(D489C), valine at position 308 was substituted with threonine at position 529 (V308..T529 was substituted with GGS), a C-terminal tail for solubilization (e.g., SEQ ID NO: 134) was substituted with GS-linker (e.g., GGS), and tyrosine at position 458 was substituted with cysteine ​​(Y458C). Lysine at position 465 was substituted with glutamine (K465Q). Aspartic acid at position 486 was substituted with cysteine ​​(D486C). Aspartic acid at position 489 was substituted with cysteine ​​(D489C). Valine at position 308 was substituted with GS-linker (e.g., GGS) to threonine at position 529 (V308..T529 was substituted with GGS). ID NO: 111) to replace the histidine at position 514 to the asparagine at position 574 (replacing H514..N574 with SEQ ID NO: 111), replacing the histidine at position 514 to the asparagine at position 574 with a ferritin tag at the C-terminus (e.g., SEQ ID NO: 112) (replacing H514..N574 with SEQ ID NO: 112), replacing the valine at position 308 to the asparagine at position 574 with a C-terminal tail for solubilization (e.g., SEQ ID NO: 111) (replacing V308..N574 with SEQ ID NO: 111).N574) and a ferritin tag at the C-terminus (e.g., SEQ ID NO: 112) replacing the valine at position 308 to the asparagine at position 574 (substituting SEQ ID NO: 112 for V308..N574).

[0033] In some embodiments, the mutant comprises any one or more of the following:

[0034] (1) S155C and S290C; and / or

[0035] (2) S190F and V207L; and / or

[0036] (3) A149C and Y458C; and / or

[0037] (4) D486C and D489C; and / or

[0038] (5) G51C and L305C; and / or

[0039] (6) N183GC and N428C; and / or

[0040] (7) Replace N104..V144 with GS; and / or

[0041] (8) replacing Q98..V144 with SEQ ID NO:110; and / or

[0042] (9) delQ26..R49; and / or

[0043] (10) replacing H514..N574 with SEQ ID NO: 111, optionally in combination with delQ26..R49; and / or

[0044] (11) replacing H514..N574 with SEQ ID NO: 112, optionally in combination with delQ26..R49; and / or

[0045] (12) substitution of V308..T529 with GGS, optionally in combination with substitution of N104..V144 with GS or substitution of Q98..V144 with SEQ ID NO: 110, and / or optionally in combination with delQ26..R49; and / or

[0046] (13) substitution of V308..N574 with SEQ ID NO: 111, optionally in combination with substitution of N104..V144 with GS or substitution of Q98..V144 with SEQ ID NO: 110, and / or, optionally in combination with delQ26..R49; and / or

[0047] (14) substitution of V308..N574 with SEQ ID NO: 112, optionally in combination with substitution of N104..V144 with GS or substitution of Q98..V144 with SEQ ID NO: 110, and / or optionally in combination with delQ26..R49; and / or

[0048] (15) One or more of S46G, N67I, E92D, S215P, L373R and K465Q.

[0049] In some embodiments, the mutant comprises one of the following groups of mutations:

[0050] (1) S155C, S190F, V207L ​​and S290C; or

[0051] (2) Substituting GS for N104..V144, S155C, S190F, V207L, S290C and L373R; or

[0052] (3) Substitution of N104..V144, A149C, S155C, S190F, V207L, S290C, L373R and Y458C with GS; or

[0053] (4) replacing Q98..V144, S155C, S190F, V207L, S290C, D486C and D489C with SEQ ID NO: 110; or

[0054] (5) S46G, N67I, E92D, substitution of N104..V144 with GS, A149C, S155C, S190F, V207L, S215P, S290C, L373R, Y458C, and K465Q; or

[0055] (6) S46G, N67I, E92D, substitution of N104..V144 with GS, S155C, N183GC, S190F, V207L, S215P, S290C, L373R, N428C, and K465Q; or

[0056] (7) G51C, N67I, substitution of N104..V144 with GS, S215P, L305C, and substitution of V308..T529 with GGS; or

[0057] (8) S155C, S190F, V207L, S290C and substitution of H514..N574 with SEQ ID NO: 111; or

[0058] (9) replacing N104..V144, A149C, S155C, S190F, V207L, S290C, L373R, Y458C with GS and replacing H514..N574 with SEQ ID NO: 111; or

[0059] (10) S46G, N67I, E92D, substitution of N104..V144 with GS, A149C, S155C, S190F, V207L, S215P, S290C, L373R, Y458C, K465Q, and substitution of H514..N574 with SEQ ID NO: 111; or

[0060] (11) delQ26..R49, G51C, substitution of N104..V144 with GS, S155C, S190F, V207L, S290C, L305C, and substitution of V308..N574 with SEQ ID NO: 111; or

[0061] (12) N104..V144, A149C, S155C, S190F, V207L, S290C, L373R, Y458C are replaced with GS and H514..N574 are replaced with SEQ ID NO: 112; or

[0062] (13) delQ26..R49, G51C, substitution of N104..V144 with GS, S155C, S190F, V207L, S290C, L305C, and substitution of V308..N574 with SEQ ID NO:112.

[0063] In some embodiments, the mutant comprises the amino acid sequence shown in SEQ ID NO:40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52 or 53, or an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence shown in SEQ ID NO:40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52 or 53.

[0064] In some embodiments, the N-terminus of the mutant is fused to the C-terminus of the signal peptide. In some embodiments, the N-terminus of the mutant is fused to the natural signal peptide of the fusion protein of RSV. In some embodiments, the natural signal peptide comprises the amino acid sequence shown in SEQ ID NO:8.

[0065] In some embodiments, particularly in the case of type B strains, the mutant comprises one or more of the following mutations: a deletion of the glutamine at position 26 to the arginine at position 49 (delQ26..R49), a substitution of the serine at position 46 with glycine (S46G), a substitution of the glycine at position 51 with cysteine ​​(G51C), a substitution of the threonine at position 67 with isoleucine (T67I), a substitution of the glutamic acid at position 92 with aspartic acid (E92D), a substitution of the leucine at position 95 with methionine (L95M), a substitution of the glutamine at position 98 with cysteine ​​(Q98C), a substitution of the glutamine at position 98 to the valine at position 144 with a GS-linker (e.g., SEQ ID NO: 110), and a substitution of the threonine at position 67 with isoleucine (T67I). NO:110 substituted Q98..V144), substituted asparagine at position 104 to valine at position 144 with a GS-linker (e.g., glycine-serine (GS)) (substituted N104..V144 with GS), substituted alanine at position 149 with cysteine ​​(A149C), substituted serine at position 155 with cysteine ​​(S155C), substituted asparagine at position 183 with glycine-cysteine ​​(GC) (N183GC), substituted serine at position 190 with phenylalanine (S190F), substituted valine at position 207 with leucine (V207L), substituted serine at position 215 with proline (S215P), substituted isoleucine at position 221 with methionine (I221M), substituted Substitution of serine at position 290 with cysteine ​​(S290C), substitution of isoleucine at position 305 with cysteine ​​(I305C), substitution of glutamine at position 361 with cysteine ​​(Q361C), substitution of leucine at position 373 with arginine (L373R), substitution of asparagine at position 428 with cysteine ​​(N428C), substitution of arginine at position 429 with lysine (R429K), substitution of tyrosine at position 458 with cysteine ​​(Y458C), substitution of lysine at position 465 with glutamine (K465Q), substitution of aspartic acid at position 486 with cysteine ​​(D486C), substitution of aspartic acid at position 489 with cysteine ​​(D489C), substitution of a C-terminal tail for solubilization (e.g., SEQ ID NO: 1). ID NO: 111) to replace the valine at position 308 to the lysine at position 574 (substitution of V308 .. K574 with SEQ ID NO: 111) and to replace the histidine at position 514 to the lysine at position 574 (substitution of H514 .. K574 with SEQ ID NO: 111) with a C-terminal tail for solubilization (e.g., SEQ ID NO: 111).

[0066] In some embodiments, the mutant comprises any one or more of the following:

[0067] (1) S155C and S290C; and / or

[0068] (2) S190F and V207L; and / or

[0069] (3) A149C and Y458C; and / or

[0070] (4) D486C and D489C; and / or

[0071] (5) G51C and I305C; and / or

[0072] (6) Q98C and Q361C; and / or

[0073] (7) N183GC and N428C; and / or

[0074] (8) Substituting GS for N104..V144; and / or

[0075] (9) replacing Q98..V144 with SEQ ID NO:110; and / or

[0076] (10) delQ26..R49; and / or

[0077] (11) replacing H514..K574 with SEQ ID NO: 111, optionally in combination with delQ26..R49; and / or

[0078] (12) substitution of V308..K574 with SEQ ID NO: 111, optionally in combination with substitution of N104..V144 with GS, and / or, optionally in combination with delQ26..R49; and / or

[0079] (13) One or more of S46G, T67I, E92D, L95M, S215P, I221M, L373R, R429K and K465Q.

[0080] In some embodiments, the mutant comprises one of the following groups of mutations:

[0081] (1) S155C, S190F, V207L ​​and S290C; or

[0082] (2) Substituting GS for N104..V144, S155C, S190F, V207L, S290C and L373R; or

[0083] (3) Substitution of N104..V144, A149C, S155C, S190F, V207L, S290C, L373R and Y458C with GS; or

[0084] (4) replacing Q98..V144, S155C, S190F, V207L, S290C, D486C and D489C with SEQ ID NO: 110; or

[0085] (5) S46G, T67I, E92D, substitution of N104..V144 with GS, A149C, S155C, S190F, V207L, S215P, S290C, L373R, Y458C, and K465Q; or

[0086] (6) S46G, T67I, E92D, substitution of N104..V144 with GS, S155C, N183GC, S190F, V207L, S215P, S290C, L373R, N428C, and K465Q; or

[0087] (7) L95M, Q98C, substitution of N104..V144, S155C, S190F, V207L, I221M, S290C, Q361C, L373R and R429K with GS; or

[0088] (8) S46G, E92D, L95M, Q98C, substitution of N104..V144 with GS, S155C, S190F, V207L, S215P, I221M, S290C, Q361C, L373R, R429K and K465Q; or

[0089] (9) S46G, T67I, E92D, L95M, Q98C, substitution of N104..V144 with GS, S155C, S190F, V207L, S215P, I221M, S290C, Q361C, L373R, R429K and K465Q; or

[0090] (10) S155C, S190F, V207L, S290C and substitution of H514..K574 with SEQ ID NO: 111; or

[0091] (11) N104..V144, A149C, S155C, S190F, V207L, S290C, L373R, Y458C are replaced by GS and H514..K574 are replaced by SEQ ID NO: 111; or

[0092] (12) S46G, T67I, E92D, substitution of N104..V144 with GS, S155C, N183GC, S190F, V207L, S215P, S290C, L373R, N428C, K465Q, and substitution of H514..K574 with SEQ ID NO: 111; or

[0093] (13) S46G, E92D, L95M, Q98C, substitution of N104..V144 with GS, S155C, S190F, V207L, S215P, I221M, S290C, Q361C, L373R, R429K, K465Q, and substitution of H514..K574 with SEQ ID NO: 111; or

[0094] (14) delQ26..R49, G51C, substitution of N104..V144 with GS, I305C and substitution of V308..K574 with SEQ ID NO:111.

[0095] In some embodiments, the mutant comprises the amino acid sequence shown in SEQ ID NO:54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66 or 67, or an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence shown in SEQ ID NO:54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66 or 67.

[0096] In some embodiments, the N-terminus of the mutant is fused to the C-terminus of the signal peptide. In some embodiments, the N-terminus of the mutant is fused to the natural signal peptide of the fusion protein of RSV. In some embodiments, the natural signal peptide comprises the amino acid sequence shown in SEQ ID NO:10.

[0097] In some embodiments, the N-terminus of the mutant is fused to the C-terminus of the human IgE signal peptide. In some embodiments, the human IgE signal peptide comprises the amino acid sequence shown in SEQ ID NO: 9. In some embodiments, the N-terminus of the mutant is fused to the C-terminus of the human tPA signal peptide. In some embodiments, the human tPA signal peptide comprises the amino acid sequence shown in SEQ ID NO: 121.

[0098] In some embodiments, the GS-linker is a short stretch of amino acid residues consisting of glycine and serine (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid residues), such as glycine-serine (GS), glycine-glycine-serine (GGS), or (GGGS)3 (SEQ ID NO: 110). In some embodiments, two or more GS-linkers are included, and the GS-linkers can be selected independently of each other.

[0099] In some embodiments, disclosed herein are compositions comprising mutants as described herein. In some embodiments, the composition is a pharmaceutical composition. In some embodiments, the composition is a vaccine.

[0100] In one aspect, provided herein are non-naturally occurring nucleic acid molecules that can be used to prevent, manage, and treat a disease or condition caused by RSV or by infection with RSV.

[0101] In some embodiments, the non-naturally occurring nucleic acid comprises a nucleotide sequence encoding a mutant as described herein.

[0102] In some embodiments, the mutant consists of, consists essentially of, or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the amino acid sequence shown in SEQ ID NO: 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52 or 53. In some embodiments, the mutant consists of, consists essentially of, or comprises an amino acid sequence shown in SEQ ID NO: 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52 or 53. In some embodiments, the encoding nucleotide sequence consists of, consists essentially of, or comprises a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the nucleotide sequence shown in SEQ ID NO: 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, or 81. In some embodiments, the encoding nucleotide sequence consists of, consists essentially of, or comprises a nucleotide sequence shown in SEQ ID NO: 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, or 81. In some embodiments, the encoding nucleotide sequence has been codon optimized for expression in cells of a subject. In some embodiments, the subject is a non-human mammal. In some embodiments, the subject is a human. In some embodiments, the encoding nucleotide sequence consists of, consists essentially of, or comprises a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with the nucleotide sequence shown in SEQ ID NO: 82, 83, 84, 85, 86, 87, 88, 89 or 90. In some embodiments, the encoding nucleotide sequence consists of, consists essentially of, or comprises a nucleotide sequence shown in SEQ ID NO: 82, 83, 84, 85, 86, 87, 88, 89 or 90. In some embodiments, the mutant is fused to a natural signal peptide. In some embodiments, the signal peptide consists of, consists essentially of, or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence shown in SEQ ID NO:8.In some embodiments, the signal peptide consists of, consists essentially of, or comprises the amino acid sequence shown in SEQ ID NO: 8. In some embodiments, the signal peptide is encoded by a coding nucleotide sequence consisting of, consists essentially of, or comprises a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the nucleotide sequence shown in SEQ ID NO: 11, 12, 13, 14, 15, 16, 17, 18, 21 or 22. In some embodiments, the signal peptide is encoded by a coding nucleotide sequence consisting of, consists essentially of, or comprises the nucleotide sequence shown in SEQ ID NO: 11, 12, 13, 14, 15, 16, 17, 18, 21 or 22. In some embodiments, the coding nucleotide sequence has been codon optimized for expression in the cells of the subject. In some embodiments, the subject is a non-human mammal. In some embodiments, the subject is a human. In some embodiments, the signal peptide is encoded by a coding nucleotide sequence consisting of, consisting essentially of, or comprising: a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with the nucleotide sequence listed in SEQ ID NO: 19, 20, 23, 24 or 25. In some embodiments, the signal peptide is encoded by a coding nucleotide sequence consisting of, consisting essentially of, or comprising: a nucleotide sequence shown in SEQ ID NO: 19, 20, 23, 24 or 25.

[0103] In some embodiments, the mutant consists of, consists essentially of, or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the amino acid sequence shown in SEQ ID NO: 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66 or 67. In some embodiments, the mutant consists of, consists essentially of, or comprises an amino acid sequence shown in SEQ ID NO: 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66 or 67. In some embodiments, the encoding nucleotide sequence consists of, consists essentially of, or comprises a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the nucleotide sequence shown in SEQ ID NO: 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, or 104. In some embodiments, the encoding nucleotide sequence consists of, consists essentially of, or comprises a nucleotide sequence shown in SEQ ID NO: 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, or 104. In some embodiments, the coding nucleotide sequence has been codon optimized for expression in the cells of the subject. In some embodiments, the subject is a non-human mammal. In some embodiments, the subject is a human. In some embodiments, the mutant is fused to a natural signal peptide. In some embodiments, the signal peptide is composed of, essentially composed of, or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the amino acid sequence shown in SEQ ID NO: 10. In some embodiments, the signal peptide is composed of, essentially composed of, or comprises an amino acid sequence shown in SEQ ID NO: 10.In some embodiments, the signal peptide is encoded by a coding nucleotide sequence consisting of, consisting essentially of, or comprising a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the nucleotide sequence set forth in SEQ ID NO:55, 56, 57, 58, 59, 60, 61, 62, 64, 65, 66, or 67. In some embodiments, the signal peptide is encoded by a coding nucleotide sequence consisting of, consisting essentially of, or comprising the nucleotide sequence set forth in SEQ ID NO:55, 56, 57, 58, 59, 60, 61, 62, 64, 65, 66, or 67. In some embodiments, the coding nucleotide sequence has been codon optimized for expression in a subject's cells. In some embodiments, the subject is a non-human mammal. In some embodiments, the subject is a human.

[0104] In some embodiments, the mutant is fused to a heterologous polypeptide. In some embodiments, the heterologous polypeptide is selected from the Fc region of a human immunoglobulin, a signal peptide, and a peptide that promotes multimerization of the fusion protein. In some embodiments, the signal peptide is a signal peptide from IgE. In some embodiments, the signal peptide consists of, consists essentially of, or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with the amino acid sequence shown in SEQ ID NO: 9. In some embodiments, the signal peptide is encoded by a coding nucleotide sequence consisting of, consisting essentially of, or comprising a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the nucleotide sequence shown in SEQ ID NO: 26, 27, 119, or 120. In some embodiments, the signal peptide is a signal peptide from tPA. In some embodiments, the signal peptide consists of, consisting essentially of, or comprising an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence shown in SEQ ID NO: 121. In some embodiments, the signal peptide is encoded by a coding nucleotide sequence consisting of, consisting essentially of, or comprising a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the nucleotide sequence shown in SEQ ID NO: 122. In some embodiments, multimerization is dimerization or trimerization. In some embodiments, the non-naturally occurring nucleic acid further comprises a 5' untranslated region (5'-UTR), wherein the 5'-UTR comprises a sequence shown in any one of SEQ ID NO: 2, 3, 4, 5, 123, 124, 125, 132 and 133. In some embodiments, the non-naturally occurring nucleic acid further comprises a 3' untranslated region (3'-UTR), wherein the 3'-UTR comprises a sequence as shown in any one of SEQ ID NOs: 6, 7, 107, 109, 126, and 127. In some embodiments, the 3'-UTR further comprises a poly-A tail or a polyadenylation signal. In some embodiments, the non-naturally occurring nucleic acid comprises one or more functional nucleotide analogs selected from pseudouridine (psd), 1-methyl-pseudouridine (m1), and 5-methylcytosine.In some embodiments, the nucleic acid is DNA or mRNA.

[0105] In some embodiments, disclosed herein are vectors or cells comprising a non-naturally occurring nucleic acid molecule as described herein. In some embodiments, disclosed herein are compositions comprising a non-naturally occurring nucleic acid molecule as described herein.

[0106] In some embodiments of compositions as described herein, compositions also include at least one lipid as described herein.In some embodiments of compositions as described herein, compositions also include at least the first lipid as described herein (e.g., cationic lipid) and optional second lipid as described herein (e.g., polymer lipid).

[0107] In some embodiments, the first lipid is a compound according to series 01, 02, 03 and 04, for example, a compound according to formula (01-I), (01-II), (02-I), (03-I) or (04-I). In some embodiments, the first lipid is a compound listed in Table 01-1, 02-1, 03-1 or 04-1. In some embodiments, the second lipid is a compound according to series 05, for example, a compound according to formula (05-I).

[0108] In some embodiments, the composition is formulated as a lipid nanoparticle that encapsulates the nucleic acid in a lipid shell. In some embodiments, the composition is a pharmaceutical composition. In some embodiments, the composition is a vaccine.

[0109] In one aspect, provided herein is a method for controlling, preventing or treating a disease or condition caused by RSV or infection with RSV in a subject, the method comprising administering to the subject a therapeutically effective amount of a non-naturally occurring nucleic acid described herein or a therapeutically effective amount of a pharmaceutical composition as described herein.

[0110] In some embodiments of the methods described herein, the subject is a human or non-human mammal. In some embodiments, the subject is a human adult, a human child or a human toddler. In some embodiments, the subject suffers from a disease or illness. In some embodiments, the subject is at risk of RSV infection or is susceptible to RSV infection. In some embodiments, the subject is an elderly person. In some embodiments, the subject has been diagnosed as RSV infection positive. In some embodiments, the subject is asymptomatic.

[0111] In some embodiments of the methods described herein, the methods include administering to a subject lipid nanoparticles encapsulating a nucleic acid, wherein the lipid nanoparticles are endocytosed by cells in the subject. In some embodiments, the nucleic acid is expressed by cells in the subject.

[0112] In some embodiments of the methods described herein, an immune response to RSV is elicited in a subject. In some embodiments, the immune response includes the production of cytokines in lymphocytes. In some embodiments, the immune response includes an increase in the proportion of lymphocytes that express cytokines. In some embodiments, the production of cytokines in lymphocytes is increased. In some embodiments, the lymphocytes are CD4 + T cells and / or CD8 + T cells. In some embodiments, the cytokine is one or more of IFN-γ, TNF-α and IL-2. In some embodiments, the immune response includes producing antibodies that specifically bind to the viral F protein encoded by the nucleic acid. In some embodiments, the antibody is a neutralizing antibody against RSV or cells infected by RSV. In some embodiments, the serum titer of the antibody increases in the subject.

[0113] In some embodiments of the methods described herein, the antibody binds to the viral particles or infected cells and marks the viral particles or infected cells for destruction by the subject's immune system. In some embodiments, endocytosis of viral particles bound by the antibody is induced or enhanced. In some embodiments, antibody-dependent cell-mediated cytotoxicity (ADCC) for infected cells in the subject is induced or enhanced. In some embodiments, antibody-dependent cellular phagocytosis (ADCP) for infected cells in the subject is induced or enhanced. In some embodiments, complement-dependent cytotoxicity (CDC) for infected cells in the subject is induced or enhanced.

[0114] In some embodiments of the methods described herein, the disease or condition caused by RSV is (a) an upper respiratory tract infection; and / or (b) a lower respiratory tract infection; and / or (c) a sinus infection; and / or (d) bronchiolitis; and / or (e) pneumonia; and / or (f) an acute respiratory tract infection. 4. Description of the drawings

[0115] Figure 1 Shown are IgG titers against RSVA pre-F protein (panels a and b) or RSVB pre-F protein (panels c and d) induced by candidates based on the sequence of RSVA2 F protein (panels a and c) or RSV B F protein (panels b and d).

[0116] Figure 2 Neutralization titers against RSV A strain (panels a and b) or RSV B strain (panels c and d) induced by candidates based on the sequence of RSV A2 F protein (panels a and c) or RSV B F protein (panels b and d) are shown.

[0117] Figure 3IgG titers induced by the candidates against RSV A pre-F protein (Panel a) or RSV B pre-F protein (Panel b) and neutralization titers against RSV A strain (Panel c) or RSV B strain (Panel d) are shown.

[0118] Figure 4 IgG titers induced by the candidates against RSV A pre-F protein (Panel a) or RSV B pre-F protein (Panel b) and neutralization titers against RSV A strain (Panel c) or RSV B strain (Panel d) are shown.

[0119] Figure 5 Results of cellular immune responses induced by the candidates are shown.

[0120] Figure 6-1 and 6-2 Results showing neutralizing antibody titers induced by the candidates.

[0121] Figure 7 IgG titers against RSV Apre-F protein (Panel a) or RSV Bpre-F protein (Panel b) and neutralization titers against RSV A strain (Panel c) or RSV B strain (Panel d) induced by candidates with different lipids are shown.

[0122] Figure 8 Serum IgG titers induced by the candidates against RSV A pre-F protein (Panel a) or RSV B pre-F protein (Panel b) and neutralization titers against RSV A strain (Panel c) are shown.

[0123] Fig. 9 Results of cellular immune responses induced by the candidates are shown. 5. Specific implementation methods

[0124] Provided herein are therapeutic nucleic acid molecules that can be used for preventing, controlling and treating diseases or illnesses caused by RSV or by infecting RSV. Also provided herein are pharmaceutical compositions comprising therapeutic nucleic acid molecules, including pharmaceutical compositions formulated as lipid nanoparticles, and for preventing, controlling and treating diseases or illnesses caused by RSV or by infecting RSV and related methods of treatment and purposes. After considering the following detailed description of a particular embodiment, the additional features of the present disclosure will become apparent to those skilled in the art.

[0125] 5.1 General Technology

[0126] The techniques and procedures described or referenced herein include those generally well understood by those skilled in the art and / or commonly employed using routine methods, such as the widely used methods described in Sambrook et al., Molecular Cloning: A Laboratory Manual (3rd ed., 2001); Current Protocols in Molecular Biology (Ausubel et al., eds., 2003).

[0127] 5.2 Terminology

[0128] Unless otherwise described, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art. For the purpose of interpreting this specification, the following terminology description will be applied, and where appropriate, terms used in the singular will also include the plural form, and vice versa. All patents, applications, published applications and other publications are incorporated by reference in their entirety. If any description of a term set forth conflicts with any document incorporated herein by reference, the term description set forth below shall prevail.

[0129] As used herein and unless otherwise specified, the term "lipid" refers to a group of organic compounds, including but not limited to esters of fatty acids, and is generally characterized by being poorly soluble in water, but soluble in many non-polar organic solvents. Although lipids are generally poorly soluble in water, there are certain classes of lipids (e.g., lipids modified by polar groups, such as DMG-PEG2000) that have limited water solubility and can be soluble in water under certain conditions. Known types of lipids include biomolecules such as fatty acids, waxes, sterols, fat-soluble vitamins, monoglycerides, diglycerides, triglycerides, and phospholipids. Lipids can be divided into at least three categories: (1) "simple lipids", which include fats and oils as well as waxes; (2) "complex lipids", which include phospholipids and glycolipids (e.g., DMPE-PEG2000); and (3) "derivatized lipids", such as steroids. Further, as used herein, lipids also encompass lipid-like compounds. The term "lipid-like compound", also referred to as "lipid-like", refers to a lipid-like compound (e.g., an amphiphilic compound having lipid-like physical properties).

[0130] The term "lipid nanoparticle" or "LNP" refers to a particle with at least one nanometer (nm) size (e.g., 1 to 1,000nm), which contains one or more types of lipid molecules. The LNP provided herein may further contain at least one non-lipid payload molecule (e.g., one or more nucleic acid molecules). In some embodiments, the LNP comprises a non-lipid payload molecule partially or completely encapsulated in a lipid shell. In particular, in some embodiments, wherein the payload is a negatively charged molecule (e.g., mRNA encoding a viral protein), and the lipid component of the LNP comprises at least one cationic lipid. Without being bound by theory, it is expected that cationic lipids can interact with negatively charged payload molecules, and promote payload binding and / or encapsulation in the LNP during LNP formation. Other lipids that can form a part of the LNP as provided herein include but are not limited to neutral lipids and charged lipids, such as steroids, polymer-bound lipids and various zwitterionic lipids. In certain embodiments, LNPs according to the present disclosure comprise one or more lipids of series 01, 02, 03, and 04, for example, one or more lipids of formulas (01-I), (01-II), (02-I), (03-I), and (04-I) (and subformulas thereof) as described herein.

[0131] The term "cationic lipid" refers to a lipid that is positively charged at any pH value or hydrogen ion activity of its environment, or can be positively charged in response to the pH value or hydrogen ion activity of its environment (e.g., the environment of its intended use). Therefore, the term "cation" encompasses "permanent cations" and "cationizable". In certain embodiments, the positive charge in the cationic lipid is derived from the presence of a quaternary nitrogen atom. In certain embodiments, the cationic lipid comprises a zwitterionic lipid that is positively charged in the environment of its intended use (e.g., at physiological pH). In certain embodiments, the cationic lipid is one or more of the lipids of series 01, 02, 03 and 04, such as one or more of the lipids of formulas (01-I), (01-II), (02-I), (03-I) and (04-I) (and their subformulas) as described herein. The term "anionic lipid" refers to a lipid that is negatively charged at any pH value or hydrogen ion activity of its environment, or can be negatively charged in response to the pH value or hydrogen ion activity of its environment (e.g., the environment of its intended use). Exemplary anionic lipids include one or more phosphate groups that are negatively charged, for example at physiological pH.

[0132] The term "polymer-bound lipid" refers to a molecule comprising both a lipid portion and a polymer portion. An example of a polymer-bound lipid is a pegylated lipid (PEG-lipid), wherein the polymer portion comprises polyethylene glycol.

[0133] The term "neutral lipid" encompasses any lipid molecule that exists in an uncharged form or in a neutral zwitterionic form at a selected pH value or within a selected pH range. In some embodiments, the selected useful pH value or range corresponds to the pH conditions in the environment of the intended lipid use, such as a physiological pH value. As non-limiting examples, neutral lipids that can be used in conjunction with the present disclosure include, but are not limited to, phosphatidylcholines, such as 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC); phosphatidylethanolamines, such as 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 2-((2,3-bis(oleyloxy)propyl)dimethylammonio)ethyl hydrogen phosphate (DOCP); sphingomyelin (SM); ceramides; steroids, such as sterols and their derivatives. The neutral lipids provided herein can be synthetic or derived from (isolated or modified from) natural sources or compounds.

[0134] The term "charged lipid" encompasses any lipid molecule present in a positively charged or negatively charged form at a selected pH value or within a selected pH range. In some embodiments, the selected pH value or range corresponds to the pH conditions in the environment of the intended lipid use, such as physiological pH. As a non-limiting example, the neutral lipids that can be used in conjunction with the present disclosure include but are not limited to phosphatidylserine, phosphatidic acid, phosphatidylglycerol, phosphatidylinositol, sterol hemisuccinate, dialkyltrimethylammonium-propane (e.g., DOTAP, DOTMA), dialkyldimethylaminopropane, ethylphosphocholine, dimethylaminoethanecarbamoylsterol (e.g., DC-Chol), 1,2-dioleoyl-sn-glycero-3-phospho-L-serine sodium salt (DOPS-Na), 1,2-dioleoyl-sn-glycero-3-phospho-(1'-racemic-glycerol) sodium salt (DOPG-Na) and 1,2-dioleoyl-sn-glycero-3-phospho-sodium salt (DOPA-Na). Charged lipids as provided herein can be synthetic or derived from (isolated or modified from) natural sources or compounds.

[0135] As used herein and unless otherwise specified, the term "alkyl" refers to a saturated straight or branched hydrocarbon chain group consisting solely of carbon and hydrogen atoms. In one embodiment, an alkyl group has, for example, one to twenty-four carbon atoms (C1-C 24 Alkyl), four to twenty carbon atoms (C4-C 20 Alkyl), six to sixteen carbon atoms (C6-C 16alkyl), six to nine carbon atoms (C6-C9 alkyl), one to fifteen carbon atoms (C1-C 15 Alkyl), one to twelve carbon atoms (C1-C 12 The term "alkyl" refers to a group consisting of a 1- to 2-carbon atom (C1-C8 alkyl), a 1- to 8-carbon atom (C1-C8 alkyl), or a 1- to 6-carbon atom (C1-C6 alkyl) and is connected to the rest of the molecule by a single bond. Examples of alkyls include, but are not limited to, methyl, ethyl, n-propyl, 1-methylethyl (isopropyl), n-butyl, n-pentyl, 1,1-dimethylethyl (tert-butyl), 3-methylhexyl, 2-methylhexyl, etc. Unless otherwise indicated, alkyls are optionally substituted.

[0136] As used herein and unless otherwise indicated, the term "alkenyl" refers to a straight or branched hydrocarbon chain group consisting only of carbon and hydrogen atoms, containing one or more carbon-carbon double bonds. As will be appreciated by those of ordinary skill in the art, the term "alkenyl" also includes groups having "cis" and "trans" configurations, or groups having "E" and "Z" configurations. In one embodiment, an alkenyl group has, for example, two to twenty-four carbon atoms (C2-C 24 alkenyl), four to twenty carbon atoms (C4-C 20 alkenyl), six to sixteen carbon atoms (C6-C 16 alkenyl), six to nine carbon atoms (C6-C9 alkenyl), two to fifteen carbon atoms (C2-C 15 alkenyl), two to twelve carbon atoms (C2-C 12 The term "alkenyl" refers to a group consisting of 1 to 4 carbon atoms (C-C), 2 to 8 carbon atoms (C-C), or 2 to 6 carbon atoms (C-C), and is connected to the rest of the molecule by a single bond. Examples of alkenyl include, but are not limited to, vinyl, prop-1-enyl, but-1-enyl, pent-1-enyl, pent-1,4-dienyl, etc. Unless otherwise indicated, alkenyl is optionally substituted.

[0137] As used herein and unless otherwise indicated, the term "alkynyl" refers to a straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms, containing one or more carbon-carbon triple bonds. In one embodiment, an alkynyl group has, for example, two to twenty-four carbon atoms (C2-C 24 Alkynyl), four to twenty carbon atoms (C4-C 20 Alkynyl), six to sixteen carbon atoms (C6-C 16 alkynyl), six to nine carbon atoms (C6-C9 alkynyl), two to fifteen carbon atoms (C2-C 15 Alkynyl), two to twelve carbon atoms (C2-C 12Alkynyl), two to eight carbon atoms (C2-C8 alkynyl), or two to six carbon atoms (C2-C6 alkynyl) and connected to the rest of the molecule by a single bond. Examples of alkynyl include, but are not limited to, ethynyl, propynyl, butynyl, pentynyl, etc. Unless otherwise indicated, alkynyl is optionally substituted.

[0138] As used herein and unless otherwise indicated, the term "alkylene" or "alkylene chain" refers to a straight or branched divalent hydrocarbon chain that connects the rest of the molecule to a radical, which consists only of carbon and hydrogen and is saturated. In one embodiment, an alkylene group has, for example, one to twenty-four carbon atoms (C1-C 24 Alkylene), one to fifteen carbon atoms (C1-C 15 Alkylene), one to twelve carbon atoms (C1-C 12 The term "alkylene" refers to a group consisting of one to eight carbon atoms (C1-C8 alkylene), one to six carbon atoms (C1-C6 alkylene), two to four carbon atoms (C2-C4 alkylene), one to two carbon atoms (C1-C2 alkylene). Examples of alkylene include, but are not limited to, methylene, ethylene, propylene, n-butylene, etc. The alkylene chain is connected to the rest of the molecule by a single bond and to the radical by a single bond. The point of attachment of the alkylene chain to the rest of the molecule and to the radical may be through one carbon or any two carbons within the chain. Unless otherwise indicated, the alkylene chain is optionally substituted.

[0139] As used herein and unless otherwise indicated, the term "alkenylene" refers to a straight or branched divalent hydrocarbon chain that connects the rest of the molecule to a radical, consisting solely of carbon and hydrogen and containing one or more carbon-carbon double bonds. In one embodiment, an alkenylene group has, for example, two to twenty-four carbon atoms (C2-C 24 alkenyl), two to fifteen carbon atoms (C2-C 15 alkenyl), two to twelve carbon atoms (C2-C 12 The term "alkenylene" refers to a group consisting of two to four carbon atoms (C-C alkenylene), two to eight carbon atoms (C-C alkenylene), two to six carbon atoms (C-C alkenylene) or two to four carbon atoms (C-C alkenylene). Examples of alkenylene include, but are not limited to, vinylene, propenylene, n-butenyl, etc. Alkenylene is connected to the rest of the molecule by a single bond or a double bond, and is connected to the group by a single bond or a double bond. The point of attachment of alkenylene to the rest of the molecule and to the group can be through one carbon or any two carbons in the chain. Unless otherwise indicated, alkenylene is optionally substituted.

[0140] As used herein and unless otherwise indicated, the term "cycloalkyl" refers to a saturated non-aromatic monocyclic or polycyclic hydrocarbon radical consisting only of carbon and hydrogen atoms. Cycloalkyl may include fused or bridged ring systems. In one embodiment, the cycloalkyl has, for example, 3 to 15 ring carbon atoms (C3-C 15cycloalkyl), 3 to 10 ring carbon atoms (C3-C 10 The cycloalkyl group is optionally substituted with 1 to 8 carbon atoms (C3-C8 cycloalkyl) or 3 to 8 ring carbon atoms (C3-C8 cycloalkyl). The cycloalkyl group is connected to the rest of the molecule by a single bond. Examples of monocyclic cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Examples of polycyclic cycloalkyl groups include, but are not limited to, adamantyl, norbornyl, decahydronaphthyl, 7,7-dimethyl-bicyclo[2.2.1]heptyl, etc. Unless otherwise indicated, cycloalkyl groups are optionally substituted.

[0141] As used herein and unless otherwise specified, the term "cycloalkylene" is a divalent cycloalkyl group. Unless otherwise specified, a cycloalkylene group is optionally substituted.

[0142] As used herein and unless otherwise indicated, the term "cycloalkenyl" refers to a non-aromatic monocyclic or polycyclic hydrocarbon radical consisting only of carbon and hydrogen atoms, which contains one or more carbon-carbon double bonds. Cycloalkenyl groups may include fused or bridged ring systems. In one embodiment, a cycloalkenyl group has, for example, 3 to 15 ring carbon atoms (C3-C 15 cycloalkenyl), 3 to 10 ring carbon atoms (C3-C 10 The cycloalkenyl radical is a cycloalkyl radical having 3 to 8 ring carbon atoms (C3-C8 cycloalkenyl). The cycloalkenyl radical is connected to the rest of the molecule by a single bond. Examples of monocyclic cycloalkenyl radicals include, but are not limited to, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl, etc. Unless otherwise indicated, the cycloalkenyl radical is optionally substituted.

[0143] As used herein and unless otherwise specified, the term "cycloalkenylene" is a divalent cycloalkenyl group. Unless otherwise specified, the cycloalkenylene group is optionally substituted.

[0144] As used herein and unless otherwise indicated, the term "heterocyclyl" refers to a non-aromatic monocyclic or polycyclic moiety containing one or more (e.g., one, one or two, one to three, or one to four) heteroatoms independently selected from nitrogen, oxygen, phosphorus, and sulfur. The heterocyclyl may be attached to the main structure at any heteroatom or carbon atom. The heterocyclyl may be a monocyclic, bicyclic, tricyclic, tetracyclic, or other polycyclic system, wherein the polycyclic system may be a fused, bridged, or spirocyclic system. The heterocyclyl polycyclic system may contain one or more heteroatoms in one or more rings. The heterocyclyl may be saturated or partially unsaturated. Saturated heterocycloalkyl may be referred to as "heterocycloalkyl". Partially unsaturated heterocycloalkyl may be referred to as "heterocycloalkenyl" when the heterocyclyl contains at least one double bond, or may be referred to as "heterocycloalkynyl" when the heterocyclyl contains at least one triple bond. In one embodiment, the heterocyclyl group has, for example, 3 to 18 ring atoms (3 to 18-membered heterocyclyl), 4 to 18 ring atoms (4 to 18-membered heterocyclyl), 5 to 18 ring atoms (5 to 18-membered heterocyclyl), 4 to 8 ring atoms (4 to 8-membered heterocyclyl), or 5 to 8 ring atoms (5 to 8-membered heterocyclyl). When appearing in this article, a numerical range, such as "3 to 18" refers to each integer in the given range; for example, "3 to 18 ring atoms" means that the heterocyclyl group can be composed of 3 ring atoms, 4 ring atoms, 5 ring atoms, 6 ring atoms, 7 ring atoms, 8 ring atoms, 9 ring atoms, 10 ring atoms, etc. (up to and including 18 ring atoms). The example of heterocyclic radical includes but is not limited to imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furanyl, tetrahydrofuranyl, thienyl, pyridyl, piperidyl, quinolyl and isoquinolyl. Unless otherwise indicated, heterocyclic radical is optionally substituted. Unless otherwise indicated, heterocyclic radical is optionally substituted.

[0145] As used herein and unless otherwise specified, the term "heterocyclylene" is a divalent heterocyclyl group. Unless otherwise specified, a heterocyclylene group is optionally substituted.

[0146] As used herein and unless otherwise specified, the term "aryl" refers to a monocyclic aromatic group and / or a polycyclic monovalent aromatic group containing at least one aromatic hydrocarbon ring. In certain embodiments, an aryl group has 6 to 18 ring carbon atoms (C6-C 18 aryl), 6 to 14 ring carbon atoms (C6-C 14 aryl) or 6 to 10 ring carbon atoms (C6-C 10The term "aryl" also refers to a bicyclic, tricyclic or other polycyclic hydrocarbon ring, wherein at least one ring is an aromatic ring, and the other rings may be saturated, partially unsaturated or aromatic rings, such as dihydronaphthyl, indenyl, dihydroindenyl or tetrahydronaphthyl (tetrahydronaphthyl / tetralinyl). Unless otherwise indicated, aryl is optionally substituted.

[0147] As used herein and unless otherwise specified, the term "arylene" is a divalent aromatic radical. Unless otherwise specified, an arylene radical is optionally substituted.

[0148] As used herein and unless otherwise indicated, the term "heteroaryl" refers to a monocyclic aromatic group and / or a polycyclic aromatic group containing at least one aromatic ring, wherein at least one aromatic ring contains one or more (e.g., one, one or two, one to three, or one to four) heteroatoms independently selected from O, S, and N. Heteroaryl can be connected to the main structure at any heteroatom or carbon atom. In certain embodiments, heteroaryl has 5 to 20, 5 to 15, or 5 to 10 ring atoms. The term "heteroaryl" also refers to a bicyclic, tricyclic, or other polycyclic ring, wherein at least one ring is an aromatic ring, and the other rings may be saturated, partially unsaturated, or aromatic rings, wherein at least one aromatic ring contains one or more heteroatoms independently selected from O, S, and N. Examples of monocyclic heteroaryls include, but are not limited to, pyrrolyl, pyrazolyl, pyrazolinyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, thiadiazolyl, isothiazolyl, furyl, thienyl, oxadiazolyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl and triazinyl. Examples of bicyclic heteroaryls include, but are not limited to, indolyl, benzothiazolyl, benzoxazolyl, benzothienyl, quinolyl, tetrahydroisoquinolyl, isoquinolyl, benzimidazolyl, benzopyranyl, indolizinyl, benzofuranyl, isobenzofuranyl, chromone, coumarinyl, cinnolinyl, quinoxalinyl, indazolyl, purinyl, pyrrolopyridinyl, furopyridinyl, thienopyridinyl, dihydroisoindolyl and tetrahydroquinolyl. Examples of tricyclic heteroaryl groups include, but are not limited to, carbazolyl, benzindolyl, phenanthrolinyl, acridinyl, phenanthridinyl, and xanthenyl. Unless otherwise specified, heteroaryl groups are optionally substituted.

[0149] As used herein and unless otherwise specified, the term "heteroarylene" is a divalent heteroaryl group. Unless otherwise specified, a heteroarylene group is optionally substituted.

[0150] When a group described herein is referred to as being "substituted", it may be substituted with one or more any suitable substituents. Illustrative examples of substituents include, but are not limited to, those found in the exemplary compounds and embodiments provided herein, as well as: halogen atoms, such as F, Cl, Br or I; cyano; oxo (=O); hydroxyl (-OH); alkyl; alkenyl; alkynyl; cycloalkyl; aryl; -(C=O)OR'; -O(C=O)R'; -C(=O)R'; -OR'; -S(O) x R';-S-SR';-C(=O)SR';-SC(=O)R';-NR'R';-NR'C(=O)R';-C(=O)NR'R';-NR'C(=O)NR'R';-OC(=O)NR'R';-NR'C(=O)OR';-NR'S(O) x NR'R';-NR'S(O) x R'; and -S(O) x NR'R', wherein: R' is independently H, C1-C 15 alkyl or cycloalkyl, and x is 0, 1 or 2. In some embodiments, the substituent is C1-C 12 In other embodiments, the substituent is a cycloalkyl. In other embodiments, the substituent is a halo, such as a fluoro group. In other embodiments, the substituent is an oxo group. In other embodiments, the substituent is a hydroxyl group. In other embodiments, the substituent is an alkoxy group (-OR'). In other embodiments, the substituent is a carboxyl group. In other embodiments, the substituent is an amino group (-NR'R').

[0151] As used herein and unless otherwise indicated, the term "optional" or "optionally" (e.g., optionally substituted) means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where the event or circumstance occurs and instances where the event or circumstance does not occur. For example, "optionally substituted alkyl" means that the alkyl may or may not be substituted, and that the description includes both substituted alkyls and alkyls without substitution.

[0152] As used herein and unless otherwise indicated, the term "prodrug" of a biologically active compound refers to a compound that can be converted into a biologically active compound under physiological conditions or by solvent decomposition. In one embodiment, the term "prodrug" refers to a pharmaceutically acceptable metabolic precursor of a biologically active compound. Prodrugs may be inactive when administered to a subject in need, but are converted into biologically active compounds in vivo. Prodrugs are generally rapidly converted in vivo to produce parent biologically active compounds, such as by hydrolysis in the blood. Prodrug compounds generally provide advantages of solubility, tissue compatibility or delayed release in mammalian organisms (see Bundgard, H., Design of Prodrugs (1985), pp. 7-9, pp. 21-24 (Elsevier, Amsterdam)). Discussions on prodrugs are provided in Higuchi, T. et al., ACSSymposium Series, Vol. 14; and Bioreversible Carriers in Drug Design, Edward B. Roche, ed., American Pharmaceutical Association and Pergamon Press, 1987.

[0153] In one embodiment, the term "prodrug" is also intended to include any covalently bonded carriers that release the active compound in vivo when such prodrugs are administered to mammalian subjects. Prodrugs of a compound can be prepared by modifying the functional groups present in the compound in such a way that the modification can be cleaved in routine operations or in vivo to obtain the parent compound. Prodrugs include compounds in which a hydroxyl, an amino or a sulfhydryl group is bonded to any group that, when the prodrug of the compound is administered to a mammalian subject, is cleaved to form a free hydroxyl, a free amino or a free sulfhydryl group, respectively.

[0154] Examples of prodrugs include, but are not limited to, acetate, formate, and benzoate derivatives of alcohol functional groups or amide derivatives of amine functional groups in the compounds provided herein.

[0155] As used herein and unless otherwise indicated, the term "pharmaceutically acceptable salt" includes both acid addition salts and base addition salts.

[0156] Examples of pharmaceutically acceptable acid addition salts include, but are not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like; and organic acids such as, but not limited to, acetic acid, 2,2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, camphoric acid, camphor-10-sulfonic acid, capric acid, caproic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, cyclamic acid, acid), dodecyl sulfuric acid, ethane-1,2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, galactaric acid, gentisic acid, glucoheptonic acid, gluconic acid, glucuronic acid, glutamic acid, glutaric acid, 2-oxoglutaric acid, glycerophosphoric acid, glycolic acid, hippuric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, mucic acid, naphthalene-1,5-disulfonic acid, naphthalene-2-sulfonic acid, 1-hydroxy-2-naphthoic acid, nicotinic acid, oleic acid, orotic acid, oxalic acid, palmitic acid, pamoic acid, propionic acid, pyroglutamic acid, pyruvic acid, salicylic acid, 4-aminosalicylic acid, sebacic acid, stearic acid, succinic acid, tartaric acid, thiocyanic acid, p-toluenesulfonic acid, trifluoroacetic acid, undecylenic acid, etc.

[0157] Examples of pharmaceutically acceptable base addition salts include, but are not limited to, salts prepared by adding an inorganic base or an organic base to a free acid compound. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts, and the like. In one embodiment, the inorganic salt is an ammonium salt, a sodium salt, a potassium salt, a calcium salt, and a magnesium salt. Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines (including naturally occurring substituted amines), cyclic amines, and basic ion exchange resins, such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, denanol, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, phenethylbenzylamine, benzathine penicillin, ethylenediamine, glucosamine, methylglucamine, theobromine, triethanolamine, tromethamine, purines, piperazine, piperidine, N-ethylpiperidine, polyamine resins, and the like. In one embodiment, the organic base is isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine.

[0158] The compounds provided herein may contain one or more asymmetric centers, and thus may produce enantiomers, diastereomers, and other stereoisomeric forms, which may be defined as (R)- or (S)-, or as (D)- or (L)- for amino acids, according to absolute stereochemistry. Unless otherwise indicated, the compounds provided herein are intended to include all such possible isomers, as well as their racemic and optically pure forms. Optically active (+) and (-), (R)- and (S)-, or (D)- and (L)-isomers may be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques, such as chromatography and fractional crystallization. Conventional techniques for preparing / separating individual enantiomers include chiral synthesis from suitable optically pure precursors or resolution of racemates (or racemates of salts or derivatives) using, for example, chiral high pressure liquid chromatography (HPLC). When the compounds described herein contain olefinic double bonds or other geometrically asymmetric centers, unless otherwise indicated, the compounds are intended to include E and Z geometric isomers. Likewise, all tautomeric forms are also intended to be included.

[0159] As used herein and unless otherwise indicated, the term "isomer" refers to different compounds having the same molecular formula. "Stereoisomers" are isomers that differ only in the arrangement of their atoms in space. "Atropisomers" are stereoisomers resulting from hindered rotation about a single bond. "Enantiomers" are a pair of stereoisomers that are non-superimposable mirror images of each other. A mixture of a pair of enantiomers in any ratio may be referred to as a "racemic" mixture. "Diastereomers" are stereoisomers that have at least two asymmetric atoms but are not mirror images of each other.

[0160] "Stereoisomers" may also include E and Z isomers or mixtures thereof, as well as cis and trans isomers or mixtures thereof. In certain embodiments, the compounds described herein are isolated as E or Z isomers. In other embodiments, the compounds described herein are mixtures of E and Z isomers.

[0161] "Tautomers" refers to isomeric forms of a compound that are in equilibrium with each other. The concentrations of the isomeric forms will depend on the environment in which the compound is located, and may vary depending on, for example, whether the compound is a solid or in an organic or aqueous solution.

[0162] It should also be noted that the compounds described herein may contain unnatural proportions of atomic isotopes at one or more atoms. For example, the compounds may be modified with radioactive isotopes such as tritium ( 3 H), iodine-125 ( 125 I), sulfur-35( 35 S) or carbon-14 ( 14 C) may be radiolabeled, or may be isotopically enriched, such as deuterium ( 2 H), carbon-13 (13 C) or nitrogen-15( 15 N). As used herein, an "isotopologue" is an isotopically enriched compound. The term "isotopically enriched" refers to an atom whose isotopic composition is different from the natural isotopic composition of the atom. "Isotopically enriched" may also refer to a compound containing at least one atom whose isotopic composition is different from the natural isotopic composition of the atom. The term "isotopic composition" refers to the amount of each isotope present in a given atom. Radiolabeled and isotopically enriched compounds can be used as therapeutic agents, such as cancer therapeutics; research reagents, such as binding assay reagents; and diagnostic agents, such as in vivo imaging agents. All isotopic variants of the compounds described herein, whether or not radioactive, are intended to be included within the scope of the embodiments provided herein. In some embodiments, isotopologues of the compounds described herein are provided, for example, isotopologues are enriched in deuterium, carbon-13, and / or nitrogen-15. As used herein, "deuterated" refers to a compound in which at least one hydrogen (H) has been replaced by deuterium (as D or 2 H) substitution, that is, the compound is enriched in deuterium at at least one position.

[0163] It should be noted that if there is a discrepancy between a depicted structure and the name of the structure, the depicted structure shall prevail.

[0164] As used herein and unless otherwise indicated, the term "pharmaceutically acceptable carrier, diluent or excipient" includes, but is not limited to, any adjuvant, carrier, excipient, glidant, sweetener, diluent, preservative, dye / colorant, flavor enhancer, surfactant, wetting agent, dispersant, suspending agent, stabilizer, isotonic agent, solvent or emulsifier approved by the U.S. Food and Drug Administration for acceptable use in humans or livestock.

[0165] The term "composition" is intended to encompass a product containing the specified ingredients (eg, mRNA molecules provided herein), optionally in the specified amounts.

[0166] As used interchangeably herein, the term "polynucleotide" or "nucleic acid" refers to a nucleotide polymer of any length, and includes, for example, DNA and RNA. Nucleotides may be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases and / or analogs thereof, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase or by a synthetic reaction. Polynucleotides may include modified nucleotides, such as methylated nucleotides and their analogs. Nucleic acids may be in single-stranded or double-stranded form. As used herein and unless otherwise indicated, "nucleic acid" also includes nucleic acid mimetics, such as locked nucleic acids (LNA), peptide nucleic acids (PNA) and morpholino nucleic acids. As used herein, "oligonucleotide" refers to a short synthetic polynucleotide, which is generally but not necessarily less than about 200 nucleotides in length. The terms "oligonucleotide" and "polynucleotide" are not mutually exclusive. The above description of polynucleotides is equally and fully applicable to oligonucleotides. Unless otherwise indicated, the left-hand end of any single-stranded polynucleotide sequence disclosed herein is the 5' end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5' direction. The direction of 5' to 3' addition of the nascent RNA transcript is called the transcription direction; the sequence region on the DNA chain that has the same sequence as the RNA transcript and is located 5' relative to the 5' end of the RNA transcript is called the "upstream sequence"; the sequence region on the DNA chain that has the same sequence as the RNA transcript and is located 3' relative to the 3' end of the RNA transcript is called the "downstream sequence".

[0167] As used herein, the term "non-naturally occurring" is intended to mean that the nucleic acid molecule does not exist in nature when used with reference to a nucleic acid molecule as described herein. Non-naturally occurring nucleic acids encoding viral peptides or proteins contain at least one genetic alteration or chemical modification that is not usually present in naturally occurring strains of the virus (including wild-type strains of the virus). Genetic alterations include, for example, modifications of expressible nucleic acid sequences that introduce heterologous peptides or polypeptides encoding the virus, other nucleic acid additions, nucleic acid deletions, nucleic acid substitutions, and / or other functional disruptions to the genetic material of the virus. Such modifications include, for example, modifications of coding regions and functional fragments thereof of heterologous, homologous, or heterologous and homologous polypeptides of viral species. Additional modifications include, for example, modifications of non-coding regulatory regions, wherein the modifications change the expression of a gene or operon. Additional modifications also include, for example, incorporating nucleic acid sequences into vectors such as plasmids or artificial chromosomes. Chemical modifications include, for example, one or more functional nucleotide analogs as described herein.

[0168] "Isolated nucleic acid" refers to nucleic acids that are substantially separated from other genomic DNA sequences and proteins or complexes (such as ribosomes and polymerases) that naturally accompany native sequences, such as RNA, DNA or mixed nucleic acids. "Isolated" nucleic acid molecules are nucleic acid molecules that are separated from other nucleic acid molecules that are present in the natural source of nucleic acid molecules. In addition, when manufactured by recombinant technology, "isolated" nucleic acid molecules, such as mRNA molecules, can be substantially free of other cell materials or culture media, or when chemically synthesized, it can be substantially free of chemical precursors or other chemicals. In a specific embodiment, one or more nucleic acid molecules encoding antigens as described herein are separated or purified. The term includes nucleic acid sequences removed from their naturally occurring environment, and includes recombinant or cloned DNA or RNA isolates and chemically synthesized analogs or analogs synthesized by heterologous systems. Substantially pure molecules can include isolated forms of molecules.

[0169] The term "coding nucleic acid" or its grammatical equivalents when used to refer to nucleic acid molecules include: (a) nucleic acid molecules that can be transcribed to produce mRNA and then translated into peptides and / or polypeptides when in a natural state or by methods well known to those skilled in the art; and (b) mRNA molecules themselves. The antisense strand is the complementary sequence of such nucleic acid molecules, and the coding sequence can be inferred therefrom. The term "coding region" refers to the portion of a coding nucleic acid sequence that is translated into a peptide or polypeptide. The term "untranslated region" or "UTR" refers to the portion of a coding nucleic acid that is not translated into a peptide or polypeptide. Depending on the orientation of the UTR relative to the coding region of the nucleic acid molecule, the UTR is called a 5'-UTR if it is located at the 5' end of the coding region, and the UTR is called a 3'-UTR if it is located at the 3' end of the coding region.

[0170] As used herein, the term "mRNA" refers to a messenger RNA molecule comprising one or more open reading frames (ORFs), which can be translated by a cell or organism having the mRNA to produce one or more peptides or protein products. The region containing one or more ORFs is referred to as the coding region of the mRNA molecule. In certain embodiments, the mRNA molecule also comprises one or more untranslated regions (UTRs).

[0171] In certain embodiments, mRNA is a monocistronic mRNA comprising only one ORF. In certain embodiments, monocistronic mRNA encodes a peptide or protein comprising at least one epitope of a selected antigen (e.g., a pathogenic antigen or a tumor-associated antigen). In other embodiments, mRNA is a polycistronic mRNA comprising two or more ORFs. In certain embodiments, polycistronic mRNA encodes two or more peptides or proteins that may be identical or different from each other. In certain embodiments, each peptide or protein encoded by polycistronic mRNA comprises at least one epitope of a selected antigen. In certain embodiments, different peptides or proteins encoded by polycistronic mRNA each comprise at least one epitope of a different antigen. In any one of the embodiments described herein, at least one epitope may be at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 epitopes of an antigen.

[0172] The term "nucleobase" encompasses purines and pyrimidines, including the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural or synthetic analogs or derivatives thereof.

[0173] As used herein, the term "functional nucleotide analogue" refers to a modified version of a classical nucleotide A, G, C, U or T that (a) retains the base pairing properties of the corresponding classical nucleotide and (b) contains at least one chemical modification of the (i) nucleobase, (ii) sugar group, (iii) phosphate group or (iv) any combination of (i) to (iii) of the corresponding natural nucleotide. As used herein, base pairing encompasses not only the classical Watson-Crick adenine-thymine, adenine-uracil or guanine-cytosine base pairs, but also base pairs formed between a classical nucleotide and a functional nucleotide analogue or between a pair of functional nucleotide analogues, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors allows hydrogen bonds to be formed between a modified nucleobase and a classical nucleobase or between two complementary modified nucleobase structures. For example, a functional analogue of guanosine (G) retains the ability to base pair with cytosine (C) or a functional analogue of cytosine. An example of such non-classical base pairing is base pairing between modified nucleotides inosine and adenine, cytosine or uracil. As described herein, functional nucleotide analogs can be naturally occurring or non-naturally occurring. Therefore, nucleic acid molecules containing functional nucleotide analogs can have at least one modified nucleobase, sugar group and / or internucleoside linkage. Exemplary chemical modifications to the nucleobase, sugar group or internucleoside linkage of nucleic acid molecules are provided herein.

[0174] As used herein, the terms "translation enhancer element", "TEE" and "translation enhancer" refer to a region in a nucleic acid molecule that is used to promote the translation of a coding sequence of a nucleic acid into a protein or peptide product, such as a region translated into a protein or peptide product via cap-dependent or cap-independent translation. TEEs are typically located in the UTR region of a nucleic acid molecule (e.g., mRNA) and enhance the translation level of a coding sequence located upstream or downstream. For example, a TEE in the 5'-UTR of a nucleic acid molecule may be located between the promoter and the start codon of the nucleic acid molecule. Various TEE sequences are known in the art (Wellensiek et al. Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, August 2013; 10(8):747-750; Chappell et al. PNAS June 29, 2004 101(26)9590-9594). Some TEEs are known to be conserved in multiple species (Pánek et al. Nucleic Acids Research, Vol. 41, No. 16, Sept. 1, 2013, pp. 7625-7634).

[0175] As used herein, the term "stem-loop sequence" refers to a single-stranded polynucleotide sequence having at least two regions that are complementary or substantially complementary to each other when read in opposite directions, and are therefore capable of base pairing with each other to form at least one double helix and an unpaired loop. The resulting structure is called a stem-loop structure, a hairpin, or a hairpin loop, which is a secondary structure found in many RNA molecules.

[0176] As used herein, the term "peptide" refers to a polymer containing from two to fifty (2-50) amino acid residues linked by one or more covalent peptide bonds. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally occurring amino acids (e.g., amino acid analogs or non-natural amino acids).

[0177] The terms "polypeptide" and "protein" are used interchangeably herein to refer to polymers having more than fifty (50) amino acid residues linked by covalent peptide bonds. That is, the description of polypeptides applies equally to the description of proteins, and vice versa. The terms apply to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally occurring amino acids (e.g., amino acid analogs). As used herein, the terms encompass amino acid chains of any length, including full-length proteins (e.g., antigens).

[0178] In the case of peptides or polypeptides, as used herein, the term "derivative" refers to a peptide or polypeptide comprising an amino acid sequence of a viral peptide or protein or a fragment of a viral peptide or protein, which has been changed by introducing an amino acid residue substitution, deletion or addition. As used herein, the term "derivative" also refers to a viral peptide or protein, or a fragment of a viral peptide or protein, which has been chemically modified, for example, by making any type of molecule covalently attached to a polypeptide. For example, but not limited to, a viral peptide or protein or a fragment of a viral peptide or protein can be chemically modified, for example, by glycosylation, acetylation, pegylation, phosphorylation, amidation, by known protective groups / blocking group derivatization, proteolytic cleavage, chemical cleavage, preparation, tunicamycin metabolic synthesis, connection with a cell ligand or other protein, etc. Derivatives are modified in a manner different from naturally occurring or starting peptides or polypeptides in terms of the type or position of the connected molecule. Derivatives also include the absence of one or more chemical groups naturally present in viral peptides or proteins. In addition, the derivatives of viral peptides or proteins or fragments of viral peptides or proteins can contain one or more non-classical amino acids. In a specific embodiment, the derivative is a functional derivative of the native or unmodified peptide or polypeptide from which the derivative is derived.

[0179] The term "functional derivative" refers to a derivative that retains one or more functions or activities of the naturally occurring or starting peptide or polypeptide from which the derivative is derived. For example, a functional derivative of the RSV S protein may retain the ability to bind to one or more of its receptors on a host cell. For example, a functional derivative of the RSV N protein may retain the ability to bind to RNA or package the viral genome.

[0180] The term "fusion protein" has different meanings in different contexts. In general, fusion protein, fusion protein, F protein or F antigen refers to the virus fusion (F) protein that is integrated into the surface lipid bilayer of a virus (such as RSV). As described, RSV fusion protein is very conservative between clinical isolates and subgroups, making it an attractive target for vaccines and therapeutic antibodies. In other cases, "fusion protein" refers to a product formed by connecting two proteins together in different ways, which is well known in the art. For example, fusion protein includes a viral peptide or polypeptide fused to an immunoglobulin Fc region. In some embodiments, fusion protein includes a viral peptide or protein fused to a signal peptide. In some embodiments, fusion protein includes an RSV F protein or a fragment thereof fused to a trimerization peptide. In some embodiments, F protein or a fragment thereof is fused to a trimerization peptide by a peptide linker.

[0181] The term "identity" refers to the relationship between the sequences of two or more polypeptide molecules or two or more nucleic acid molecules, as determined by comparing and comparing the sequences. "Amino acid sequence identity percentage (%)" relative to a reference polypeptide sequence is defined as the percentage of amino acid residues in the candidate sequence that are identical to the amino acid residues in the reference polypeptide sequence after comparing the sequences and, if necessary, introducing spaces (achieving maximum sequence identity percentage) and not treating any conservative substitutions as part of sequence identity. Alignment for the purpose of determining amino acid sequence identity percentage can be achieved in a variety of ways within the technical scope of the art, for example, using publicly available computer software, such as BLAST, BLAST-2, ALIGN or MEGALIGN (DNAStar, Inc.) software. Those skilled in the art can determine the appropriate parameters for aligning sequences, including any algorithm required for achieving maximum alignment within the full length of the compared sequence.

[0182] "Modification" of an amino acid residue / position refers to a change in the primary amino acid sequence as compared to the starting amino acid sequence, wherein the change is caused by a sequence change involving the amino acid residue / position. For example, typical modifications include replacing a residue with another amino acid (e.g., conservative or non-conservative substitutions), inserting one or more (e.g., usually less than 5, 4 or 3) amino acids next to the residue / position, and / or deleting the residue / position.

[0183] In the case of a peptide or polypeptide, as used herein, the term "fragment" refers to a peptide or polypeptide comprising an amino acid sequence that is less than the full length. Such fragments may, for example, come from truncation of the amino terminus, truncation of the carboxyl terminus, and / or internal deletions of residues in the amino acid sequence. Fragments may, for example, be produced by selective RNA splicing or by in vivo protease activity. In certain embodiments, a fragment refers to at least 5 consecutive amino acid residues, at least 10 consecutive amino acid residues, at least 15 consecutive amino acid residues, at least 20 consecutive amino acid residues, at least 25 consecutive amino acid residues, at least 30 consecutive amino acid residues, at least 40 consecutive amino acid residues, at least 50 consecutive amino acid residues, at least 60 consecutive amino acid residues, at least 70 consecutive amino acid residues, at least 80 consecutive amino acid residues, at least 90 consecutive amino acid residues, at least 100 consecutive amino acid residues, at least 110 consecutive amino acid residues, at least 120 consecutive amino acid residues, at least 130 consecutive amino acid residues, at least 140 consecutive amino acid residues, at least 150 consecutive amino acid residues, at least 160 consecutive amino acid residues, at least 170 consecutive amino acid residues, at least 180 consecutive amino acid residues, at least 190 consecutive amino acid residues, at least 200 consecutive amino acid residues, at least 210 consecutive amino acid residues, at least 220 consecutive amino acid residues, at least 230 consecutive amino acid residues, at least 240 consecutive amino acid residues, at least 250 consecutive amino acid residues, at least 260 consecutive amino acid residues, at least 270 consecutive amino acid residues, at least 280 consecutive amino acid residues, at least 290 consecutive amino acid residues, at least 300 consecutive amino acid residues, at least 310 consecutive In some embodiments, the fragment of a polypeptide has an amino acid sequence of at least 100 consecutive amino acid residues, at least 125 consecutive amino acid residues, at least 150 consecutive amino acid residues, at least 175 consecutive amino acid residues, at least 200 consecutive amino acid residues, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900 or at least 950 consecutive amino acid residues. In a specific embodiment, the fragment of a polypeptide retains at least one, at least two, at least three or more functions of the polypeptide.

[0184] As used herein in the context of a peptide or polypeptide (e.g., a protein), the term "immunogenic fragment" refers to a fragment of a peptide or polypeptide that retains the ability of the peptide or polypeptide to elicit an immune response (including an innate immune response and / or an adaptive immune response) when in contact with a mammalian immune system. In some embodiments, an immunogenic fragment of a peptide or polypeptide may be an epitope.

[0185] The term "antigen" refers to a substance that can be recognized by a subject's immune system (including an adaptive immune system) and can trigger an immune response (including an antigen-specific immune response) after contacting the subject with the antigen. In certain embodiments, the antigen is a protein associated with a diseased cell (such as a cell infected by a pathogen) or a neoplastic cell (e.g., a tumor-associated antigen (TAA)).

[0186] "Epitope" is a site on the surface of an antigen molecule that binds to a single antibody molecule, such as a local area on the surface of an antigen that can bind to one or more antigen binding regions of an antibody and has antigenic or immunogenic activity that can trigger an immune response in an animal, such as a mammal (e.g., a human). An epitope with immunogenic activity is a portion of a polypeptide that triggers an antibody response in an animal. An epitope with antigenic activity is a portion of a polypeptide to which an antibody binds, as determined by any method known in the art (including, for example, by immunoassay). Antigenic epitopes are not necessarily immunogenic. Epitopes are usually composed of chemically active surface groups of molecules, such as amino acids or sugar side chains, and have specific three-dimensional structural characteristics and specific charge characteristics. Antibody epitopes can be linear epitopes or conformational epitopes. Linear epitopes are formed by continuous amino acid sequences in proteins. Conformational epitopes are formed by amino acids that are discontinuous in the protein sequence but aggregate together when the protein is folded into its three-dimensional structure. When the three-dimensional structure of a protein is in an altered conformation, such as after activation or binding of another protein or ligand, an inductive epitope is formed. In certain embodiments, an epitope is a three-dimensional surface feature of a polypeptide. In other embodiments, an epitope is a linear feature of a polypeptide. Typically, an antigen has several or many different epitopes and can react with many different antibodies.

[0187] The term "heterologous" refers to an entity not found in nature to be associated with a naturally occurring RSV (e.g., encoded and / or expressed by its genome). The term "homologous" refers to an entity found in nature to be associated with a naturally occurring RSV (e.g., encoded and / or expressed by its genome).

[0188] As used herein, the term "gene vaccine" refers to a therapeutic or preventive composition comprising at least one nucleic acid molecule, the at least one nucleic acid molecule encoding an antigen associated with a target disease (e.g., an infectious disease or a neoplastic disease). Administration of a vaccine to a subject ("vaccination") allows the production of encoded peptides or proteins, thereby inducing an immune response to the target disease in the subject. In certain embodiments, the immune response includes an adaptive immune response, such as the production of antibodies to the encoded antigen, and / or the activation and proliferation of immune cells that can specifically eliminate diseased cells expressing the antigen. In certain embodiments, the immune response also includes an innate immune response. According to the present disclosure, the vaccine may be administered to a subject before or after the onset of clinical symptoms of the target disease. In some embodiments, vaccination of healthy or asymptomatic subjects makes the vaccinated subject immune or less sensitive to the development of the target disease. In some embodiments, vaccination of subjects showing symptoms of the disease improves the disease condition of the vaccinated subject or treats the disease.

[0189] The term "vector" refers to a material for carrying or containing a nucleic acid sequence, including, for example, a nucleic acid sequence encoding a viral peptide or protein as described herein, so that the nucleic acid sequence is introduced into a host cell, or used as a transcription template to perform an in vitro transcription reaction in a cell-free system to produce mRNA. Suitable vectors for use include, for example, expression vectors, plasmids, phage vectors, viral vectors, episomes, and artificial chromosomes, which may include a selection sequence or a marker operable for stable integration into the chromosome of a host cell. In addition, the vector may include one or more selective marker genes and appropriate transcription or translation control sequences. For example, the selective marker gene that may be included provides resistance to antibiotics or toxins, supplements nutritional deficiency or provides key nutrients that are not in the culture medium. Transcription or translation control sequences may include constitutive and inducible promoters, transcription enhancers, transcription terminators, etc., as known in the art. When two or more nucleic acid molecules (for example, nucleic acid molecules encoding two or more different viral peptides or proteins) are co-transcribed or co-translated, the two nucleic acid molecules may be inserted, for example, in the same expression vector or in a separate expression vector. For single vector transcription and / or translation, the encoding nucleic acid can be operably linked to a common transcription or translation control sequence, or to different transcription or translation control sequences, such as an inducible promoter and a constitutive promoter. The introduction of nucleic acid molecules into host cells can be confirmed using methods well known in the art. Such methods include, for example, nucleic acid analysis, such as Northern blot or polymerase chain reaction (PCR) amplification of mRNA; immunoblotting for expression of gene products; or other suitable analytical methods for testing the expression of introduced nucleic acid sequences or their corresponding gene products. It will be understood by those skilled in the art that nucleic acid molecules are expressed in sufficient amounts to produce the desired product (e.g., mRNA transcripts of nucleic acids as described herein), and it will be further understood that expression levels can be optimized using methods well known in the art to obtain sufficient expression.

[0190] The terms "innate immune response" and "innate immunity" are recognized in the art and refer to non-specific defense mechanisms initiated by the body's immune system when pathogen-associated molecular patterns are recognized, which involve different forms of cellular activity, including cytokine production and cell death through various pathways. As used herein, the innate immune response includes, but is not limited to, increased production of inflammatory cytokines (e.g., type I interferon or IL-10 production); activation of the NFκB pathway; increased proliferation, maturation, differentiation and / or survival of immune cells, and in some cases induction of apoptosis. Activation of innate immunity can be detected using methods known in the art, such as measuring (NF)-κB activation.

[0191] The terms "adaptive immune response" and "adaptive immunity" are recognized in the art and refer to antigen-specific defense mechanisms initiated by the body's immune system when it recognizes a specific antigen, including humoral responses and cell-mediated responses. As used herein, an adaptive immune response includes a cellular response triggered and / or enhanced by a vaccine composition, such as a genetic composition described herein. In some embodiments, the vaccine composition comprises an antigen that is a target of an antigen-specific adaptive immune response. In other embodiments, the vaccine composition, upon administration, allows the production of an antigen in an immunized subject that is a target of an antigen-specific adaptive immune response. Activation of an adaptive immune response can be detected using methods known in the art, such as measuring the production of antigen-specific antibodies or the level of antigen-specific cell-mediated cytotoxicity.

[0192] "Antibody-dependent cell-mediated cytotoxicity" or "ADCC" refers to a form of cytotoxicity in which secreted immunoglobulins bound to Fc receptors (FcRs) present on certain cytotoxic cells (e.g., natural killer (NK) cells, neutrophils, and macrophages) enable these cytotoxic effector cells to specifically bind to target cells bearing antigens and subsequently kill the target cells with cytotoxins. Antibodies "arm" cytotoxic cells and are absolutely required for this killing. NK cells (the main cells used to mediate ADCC) express only FcγRIII, while monocytes express FcγRI, FcγRII, and FcγRIII. FcR expression on hematopoietic cells is known (see, e.g., Ravetch and Kinet, 1991, Annu. Rev. Immunol. 9: 457-92). To assess the ADCC activity of a target molecule, an in vitro ADCC assay can be performed (see, e.g., U.S. Pat. Nos. 5,500,362 and 5,821,337). Useful effector cells for such assays include peripheral blood mononuclear cells (PBMC) and natural killer (NK) cells. Alternatively or additionally, the ADCC activity of the target molecule can be evaluated in vivo, for example, in an animal model (see, for example, Clynes et al., 1998, Proc. Natl. Acad. Sci. USA 95: 652-56). Antibodies with little or no ADCC activity can be selected for use.

[0193] "Antibody-dependent cellular phagocytosis" or "ADCP" refers to the destruction of target cells via monocyte- or macrophage-mediated phagocytosis when immunoglobulins bind to Fc receptors (FcRs) present on certain phagocytes (e.g., neutrophils, monocytes, and macrophages) to enable these phagocytes to specifically bind to target cells carrying antigens and subsequently kill target cells. In order to assess the ADCP activity of a target molecule, an in vitro ADCP assay can be performed (see, e.g., Bracher et al., 2007, J. Immunol. Methods 323: 160-71). Useful phagocytes for such assays include peripheral blood mononuclear cells (PBMCs), purified monocytes from PBMCs, or U937 cells differentiated into a mononuclear type. Alternatively or in addition, the ADCP activity of a target molecule can be evaluated in vivo, for example, in an animal model (see, e.g., Wallace et al., 2001, J. Immunol. Methods 248: 167-82). Antibodies with little or no ADCP activity may be selected for use.

[0194] "Fc receptor" or "FcR" describes a receptor that binds to the Fc region of an antibody. An exemplary FcR is a native sequence human FcR. In addition, an exemplary FcR is a receptor that binds to an IgG antibody (e.g., a gamma receptor), and includes receptors of the FcγRI, FcγRII, and FcγRIII subclasses, including allelic variants and alternatively spliced ​​forms of these receptors. FcγRII receptors include FcγRIIA ("activating receptor") and FcγRIIB ("inhibiting receptor"), which have similar amino acid sequences that differ primarily in their cytoplasmic domains (see, e.g., 1997, Annu. Rev. Immunol. 15: 203-34). Various FcRs are known (see, e.g., Ravetch and Kinet, 1991, Annu. Rev. Immunol. 9: 457-92; Capel et al., 1994, Immunomethods 4: 25-34; and de Haas et al., 1995, J. Lab. Clin. Med. 126: 330-41). The term "FcR" herein encompasses other FcRs, including those to be identified in the future. The term also includes the neonatal receptor FcRn, which is responsible for the transfer of maternal IgG to the fetus (see, e.g., Guyer et al., 1976, J. Immunol. 117: 587-93; and Kim et al., 1994, Eu. J. Immunol. 24: 2429-34). Antibody variants with improved or decreased binding to FcRs have been described (see, e.g., WO 2000 / 42072; U.S. Pat. Nos. 7,183,387; 7,332,581; and 7.335,742; Shields et al., 2001, J. Biol. Chem. 9(2):6591-604).

[0195] "Complement dependent cytotoxicity" or "CDC" refers to the lysis of target cells in the presence of complement. Activation of the classical complement pathway is initiated by binding of the first component of the complement system (Clq) to an antibody (of the appropriate subclass) bound to its cognate antigen. To assess complement activation, a CDC assay may be performed (see, e.g., Gazzano-Santoro et al., 1996, J. Immunol. Methods 202:163). Polypeptide variants with altered Fc region amino acid sequences (polypeptides with variant Fc regions) and increased or decreased Clq binding ability have been described (see, e.g., U.S. Patent No. 6,194,551; WO 1999 / 51642; Idusogie et al., 2000, J. Immunol. 164:4178-84). Antibodies with little or no CDC activity may be selected for use.

[0196] The term "antibody" is intended to include polypeptide products of B cells within the polypeptide class of immunoglobulins, which can bind to specific molecular antigens and are composed of two pairs of identical polypeptide chains, each pair having a heavy chain (about 50-70 kDa) and a light chain (about 25 kDa), each amino terminal portion of each chain comprising a variable region of about 100 to about 130 or more amino acids, and each carboxyl terminal portion of each chain comprising a constant region. See, for example, Antibody Engineering (Borrebaeck, ed., 2nd ed., 1995); and Kuby, Immunology (3rd ed., 1997). In a specific embodiment, a specific molecular antigen can be bound by an antibody provided herein, including a polypeptide, a fragment thereof or an epitope. Antibodies also include, but are not limited to, synthetic antibodies, recombinantly produced antibodies, camelized antibodies, intracellular antibodies, anti-idiotype (anti-Id) antibodies, and functional fragments of any of the above, which refers to a portion of the antibody heavy chain or light chain polypeptide that retains part or all of the binding activity of the antibody as the source of the fragment. Non-limiting examples of functional fragments include single-chain Fv (scFv) (e.g., including monospecific, bispecific, etc.), Fab fragments, F(ab') fragments, F(ab)2 fragments, F(ab')2 fragments, disulfide-linked Fv (dsFv), Fd fragments, Fv fragments, diabodies, triabodies, tetrabodies and minibodies. In particular, antibodies provided herein include immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, such as antigen binding domains or molecules containing antigen binding sites (e.g., one or more CDRs of an antibody). Such antibody fragments can be found in, for example, Harlow and Lane, Antibodies: A Laboratory Manual (1989); Mol. Biology and Biotechnology: A Comprehensive Desk Reference (Myers ed., 1995); Huston et al., 1993, Cell Biophysics 22: 189-224; Plückthun and Skerra, 1989, Meth. Enzymol. 178: 497-515; and Day, Advanced Immunochemistry (2nd ed., 1990). The antibodies provided herein can have any class (e.g., IgG, IgE, IgM, IgD, and IgA) of immunoglobulin molecules or any subclass (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2).

[0197] The term "administer" or "administration" refers to the operation of injecting or otherwise physically delivering a substance (e.g., a lipid nanoparticle composition described herein) present in vitro into a patient's body, such as by mucosal, intradermal, intravenous, intramuscular delivery, and / or any other physical delivery method described herein or known in the art. When treating a disease, disorder, illness, or symptom thereof, the administration of the substance is usually performed after the onset of the disease, disorder, illness, or symptom thereof. When preventing a disease, disorder, illness, or symptom thereof, the administration of the substance is usually performed before the onset of the disease, disorder, illness, or symptom thereof.

[0198] "Long-term" administration, as opposed to acute mode, refers to administration of one or more agents in a continuous mode (e.g., for a period of time, such as days, weeks, months or years), thereby maintaining the initial therapeutic effect (activity) over a longer period of time. "Intermittent" administration refers to treatment that is not continuous without interruption, but rather is cyclical in nature.

[0199] As used herein, the term "targeted delivery" or verb form "targeting" refers to a process in which the delivered agent (such as the therapeutic payload molecule in the lipid nanoparticle composition as described herein) reaches a specific organ, tissue, cell and / or intracellular compartment (referred to as the target location) compared to delivery to any other organ, tissue, cell or intracellular compartment (referred to as a non-target location). Targeted delivery can be detected using methods known in the art, such as by comparing the concentration of the delivered agent in the target cell population with the concentration of the delivered agent at the non-target cell population after systemic administration. In certain embodiments, targeted delivery makes the concentration at the target location at least 2 times higher than the concentration at the non-target location.

[0200] An "effective amount" is generally an amount sufficient to reduce the severity and / or frequency of symptoms; eliminate symptoms and / or potential causes; prevent the occurrence of symptoms and / or their potential causes; and / or improve or remedy damage caused by a disease, disorder or condition, including, for example, an infection and neoplasm formation or associated therewith. In some embodiments, an effective amount is a therapeutically effective amount or a prophylactically effective amount.

[0201] As used herein, the term "therapeutically effective amount" refers to an amount of an agent (e.g., a vaccine composition) sufficient to reduce and / or improve the severity and / or duration of a given disease, disorder or condition, and / or its associated symptoms (e.g., infectious diseases, such as those caused by viral infection, or neoplastic diseases, such as cancer). The "therapeutically effective amount" of a substance / molecule / agent disclosed herein (e.g., a lipid nanoparticle composition described herein) may vary according to many factors, such as the disease state, age, sex, and weight of the individual, and the ability of the substance / molecule / agent to elicit a desired response in the individual. A therapeutically effective amount includes an amount in which the therapeutically beneficial effects of a substance / molecule / agent outweigh any toxic or deleterious effects thereof. In certain embodiments, the term "therapeutically effective amount" refers to an amount of a lipid nanoparticle composition as described herein or a therapeutic agent or prophylactic agent (e.g., therapeutic mRNA) contained therein that is effective to "treat" a disease, disorder, or condition of a subject or mammal.

[0202] A "prophylactically effective amount" is an amount of a pharmaceutical composition that, when administered to a subject, will have the intended prophylactic effect, such as preventing a disease, disorder, illness, or related symptoms (e.g., an infectious disease, such as an infectious disease caused by a viral infection, or a neoplastic disease, such as cancer), delaying its onset (or recurrence), or reducing the likelihood of its onset (or recurrence). Typically, but not necessarily, since a prophylactic dose is used for a subject before a disease, disorder, or illness or in its early stages, the prophylactic effective amount may be less than the therapeutically effective amount. A complete therapeutic or prophylactic effect may not occur by administering a single dose, but may only occur after a series of doses are administered. Therefore, a therapeutically or prophylactically effective amount may be administered in one or more administrations.

[0203] The terms "prevent", "preventing" and "prevention" refer to reducing the likelihood of the onset (or recurrence) of a disease, disorder, condition or associated symptoms (e.g., an infectious disease, such as caused by a viral infection, or a neoplastic disease, such as cancer).

[0204] The terms "manage", "managing" and "management" refer to the beneficial effects that a subject obtains from a therapy (e.g., a prophylactic or therapeutic agent) that does not result in a cure of the disease. In certain embodiments, one or more therapies (e.g., a prophylactic or therapeutic agent, such as a lipid nanoparticle composition described herein) are administered to a subject to "manage" an infectious or neoplastic disease, one or more symptoms thereof, thereby preventing progression or worsening of the disease.

[0205] The term "prophylactic agent" refers to any agent that can completely or partially inhibit the development, recurrence, onset, or spread of a disease and / or its associated symptoms in a subject.

[0206] The term "therapeutic agent" refers to any agent useful in treating, preventing or alleviating a disease, disorder or condition, including any agent useful in treating, preventing or alleviating one or more symptoms of a disease, disorder or condition and / or its associated symptoms.

[0207] The term "therapy" refers to any regimen, method and / or agent that can be used to prevent, control, treat and / or improve a disease, disorder or illness. In certain embodiments, the term "therapy" refers to biological therapy, supportive therapy and / or other therapies known to those skilled in the art, such as medical personnel, that can be used to prevent, control, treat and / or improve a disease, disorder or illness.

[0208] As used herein, a "prophylactically effective serum titer" is a serum titer of antibodies in a subject (e.g., a human) that completely or partially inhibits the development, recurrence, onset or spread of a disease, disorder or condition and / or symptoms associated therewith in the subject.

[0209] In certain embodiments, a "therapeutically effective serum titer" is a serum titer of antibodies in a subject (e.g., a human) that reduces the severity, duration, and / or symptoms associated with a disease, disorder, or condition in the subject.

[0210] The term "serum titer" refers to the average serum titer in multiple samples from a subject (e.g., at multiple time points) or in a population of at least 10, at least 20, at least 40 subjects, up to about 100, 1000 or more subjects.

[0211] The term "side effect" encompasses unwanted and / or adverse effects of a therapy (e.g., a preventive or therapeutic agent). Unwanted effects are not necessarily adverse. Adverse effects of a therapy (e.g., a preventive or therapeutic agent) may be harmful, uncomfortable, or risky. Examples of side effects include diarrhea, cough, gastroenteritis, wheezing, nausea, vomiting, anorexia, abdominal cramps, fever, pain, weight loss, dehydration, alopecia, dyspnea, insomnia, dizziness, mucositis, nerve and muscle effects, fatigue, dry mouth, loss of appetite, rash or swelling at the site of administration, flu-like symptoms such as fever, chills, and fatigue, digestive tract problems, and allergic reactions. Other undesirable effects experienced by patients are numerous and known in the art. There are many effects described in Physician's Desk Reference (68th edition, 2014).

[0212] The terms "subject" and "patient" are used interchangeably. As used herein, in certain embodiments, the subject is a mammal, such as a non-primate (e.g., cattle, pigs, horses, cats, dogs, rats, etc.) or a primate (e.g., monkeys and humans). In specific embodiments, the subject is a human. In one embodiment, the subject is a mammal (e.g., a human) suffering from an infectious disease or a neoplastic disease. In another embodiment, the subject is a mammal (e.g., a human) at risk of developing an infectious disease or a neoplastic disease.

[0213] The term "elderly" refers to a person over the age of 65. The term "human adult" refers to a person over the age of 18. The term "human child" refers to a person between the ages of 1 and 18. The term "human toddler" refers to a person between the ages of 1 and 3. The term "human infant" refers to a person between the ages of newborn and 1 year old.

[0214] The term "detectable probe" refers to a composition that provides a detectable signal. The term includes, but is not limited to, any fluorophore, chromophore, radiolabel, enzyme, antibody or antibody fragment, etc. that provides a detectable signal through activity.

[0215] The term "detectable agent" refers to a substance that can be used to determine the presence (existence / presence) of a desired molecule, such as an antigen encoded by an mRNA molecule as described herein, in a sample or subject. A detectable agent can be a substance that can be visually detected or can be otherwise determined and / or measured (e.g., by quantification).

[0216] By "substantially all" is meant at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or about 100%.

[0217] As used herein and unless otherwise indicated, the term "about" or "approximately" means an acceptable error of a particular value determined by one of ordinary skill in the art, which depends in part on the manner in which the value is measured or determined. In certain embodiments, the term "about" or "approximately" means within 1, 2, 3, or 4 standard deviations. In certain embodiments, the terms "about" and "approximately" mean within 20%, within 15%, within 10%, within 9%, within 8%, within 7%, within 6%, within 5%, within 4%, within 3%, within 2%, within 1%, within 0.5%, within 0.05%, or lower of a given value or range.

[0218] As used herein, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise.

[0219] All publications, patent applications, accession numbers and other references cited in this specification are incorporated herein by reference in their entirety, and the extent of their citation is as if each individual publication or patent application is specifically and individually indicated to be incorporated by reference. The publications discussed herein are provided only for their disclosures prior to the filing date of the present application. Nothing herein should be construed as admitting that the present invention is not entitled to be earlier than such publications by virtue of prior invention. In addition, the publication date provided may be different from the actual publication date, and the actual publication date may require independent confirmation.

[0220] A number of embodiments of the present invention have been described. However, it should be understood that various modifications can be made without departing from the spirit and scope of the present invention. Therefore, the descriptions in the experimental section and examples are intended to illustrate rather than limit the scope of the invention described in the claims.

[0221] 5.3 Therapeutic nucleic acids

[0222] In one aspect, provided herein are therapeutic nucleic acid molecules for controlling, preventing and treating RSV infections. In some embodiments, the therapeutic nucleic acid encodes a peptide or polypeptide, which, when administered to a subject in need, is expressed by cells in the subject to produce the encoded peptide or polypeptide. In some embodiments, the therapeutic nucleic acid molecule is a DNA molecule. In other embodiments, the therapeutic nucleic acid molecule is an RNA molecule. In specific embodiments, the therapeutic nucleic acid molecule is an mRNA molecule.

[0223] In some embodiments, the therapeutic nucleic acid molecule is formulated in a vaccine composition. In some embodiments, the vaccine composition is a genetic vaccine as described herein. In some embodiments, the vaccine composition comprises an mRNA molecule as described herein.

[0224] In some embodiments, the mRNA molecules of the present disclosure encode target peptides or polypeptides, including any naturally or non-naturally occurring or otherwise modified polypeptides. The peptides or polypeptides encoded by the mRNA can have any size and can have any secondary structure or activity. In some embodiments, the polypeptides encoded by the mRNA payload can have a therapeutic effect when expressed in a cell.

[0225] In some embodiments, the mRNA molecules of the present disclosure include at least one coding region (e.g., open reading frame (ORF)) encoding a target peptide or polypeptide. In some embodiments, the nucleic acid molecule further includes at least one untranslated region (UTR). In a specific embodiment, the untranslated region (UTR) is located upstream (5' end) of the coding region and is referred to herein as 5'-UTR. In a specific embodiment, the untranslated region (UTR) is located downstream (3' end) of the coding region and is referred to herein as 3'-UTR. In a specific embodiment, the nucleic acid molecule includes both 5'-UTR and 3'-UTR. In some embodiments, the 5'-UTR includes a 5'-cap structure. In some embodiments, the nucleic acid molecule includes a Kozak sequence (e.g., in 5'-UTR). In some embodiments, the nucleic acid molecule includes a poly-A region (e.g., in 3'-UTR). In some embodiments, the nucleic acid molecule includes a polyadenylation signal (e.g., in 3'-UTR). In some embodiments, the nucleic acid molecule includes a stabilizing region (e.g., in 3'-UTR). In some embodiments, the nucleic acid molecule includes a secondary structure. In some embodiments, the secondary structure is a stem-loop. In some embodiments, the nucleic acid molecule comprises a stem-loop sequence (e.g., in a 5'-UTR and / or a 3'-UTR). In some embodiments, the nucleic acid molecule comprises one or more intronic regions that can be excised during splicing. In specific embodiments, the nucleic acid molecule comprises one or more regions selected from a 5'-UTR and a coding region. In specific embodiments, the nucleic acid molecule comprises one or more regions selected from a coding region and a 3'-UTR. In specific embodiments, the nucleic acid molecule comprises one or more regions selected from a 5'-UTR, a coding region, and a 3'-UTR.

[0226] 5.3.1 Coding region

[0227] In some embodiments, nucleic acid molecules of the present disclosure include at least one coding region. In some embodiments, the coding region is an open reading frame (ORF) encoding a single peptide or protein. In some embodiments, the coding region includes at least two ORFs, each ORF encoding a peptide or protein. In embodiments where the coding region includes more than one ORF, the encoded peptides and / or proteins may be identical or different from each other. In some embodiments, a plurality of ORFs in the coding region are separated by non-coding sequences. In a specific embodiment, the non-coding sequence separating two ORFs includes an internal ribosome entry site (IRES).

[0228] Without being bound by theory, it is expected that an internal ribosome entry site (IRES) can be used as a sole ribosome binding site, or as one of multiple ribosome binding sites of an mRNA. An mRNA molecule containing more than one functional ribosome binding site can encode several peptides or proteins that are independently translated by ribosomes (e.g., polycistronic mRNA). Therefore, in some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure comprise one or more internal ribosome entry sites (IRES). Examples of IRES sequences that can be used in conjunction with the present disclosure include, but are not limited to, those from picornaviruses (e.g., FMDV), pestiviruses (CFFV), polioviruses (PV), encephalomyocarditis virus (ECMV), foot-and-mouth disease virus (FMDV), hepatitis C virus (HCV), swine fever virus (CSFV), murine leukemia virus (MLV), simian immunodeficiency virus (SIV), or cricket paralysis virus (CrPV).

[0229] In various embodiments, the nucleic acid molecules of the present disclosure encode at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 peptides or proteins. The peptides and proteins encoded by the nucleic acid molecules may be the same or different. In some embodiments, the nucleic acid molecules of the present disclosure encode dipeptides (e.g., carnosine and anserine). In some embodiments, the nucleic acid molecules encode tripeptides. In some embodiments, the nucleic acid molecules encode tetrapeptides. In some embodiments, the nucleic acid molecules encode pentapeptides. In some embodiments, the nucleic acid molecules encode hexapeptides. In some embodiments, the nucleic acid molecules encode heptapeptides. In some embodiments, the nucleic acid molecules encode octapeptides. In some embodiments, the nucleic acid molecules encode nonapeptides. In some embodiments, the nucleic acid molecules encode decapeptides. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 15 amino acids. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 50 amino acids. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 100 amino acids. In some embodiments, the nucleic acid molecules encode peptides or polypeptides having at least about 150 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 300 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 500 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide having at least about 1000 amino acids.

[0230] In some embodiments, the length of the nucleic acid molecules of the present disclosure is at least about 30 nucleotides (nt). In some embodiments, the length of the nucleic acid molecules is at least about 35nt. In some embodiments, the length of the nucleic acid molecules is at least about 40nt. In some embodiments, the length of the nucleic acid molecules is at least about 45nt. In some embodiments, the length of the nucleic acid molecules is at least about 50nt. In some embodiments, the length of the nucleic acid molecules is at least about 55nt. In some embodiments, the length of the nucleic acid molecules is at least about 60nt. In some embodiments, the length of the nucleic acid molecules is at least about 65nt. In some embodiments, the length of the nucleic acid molecules is at least about 70nt. In some embodiments, the length of the nucleic acid molecules is at least about 75nt. In some embodiments, the length of the nucleic acid molecules is at least about 80nt. In some embodiments, the length of the nucleic acid molecules is at least about 85nt. In some embodiments, the length of the nucleic acid molecules is at least about 90nt. In some embodiments, the length of the nucleic acid molecules is at least about 95nt. In some embodiments, the length of the nucleic acid molecules is at least about 100nt. In some embodiments, the length of the nucleic acid molecules is at least about 120nt. In some embodiments, the length of the nucleic acid molecule is at least about 140nt. In some embodiments, the length of the nucleic acid molecule is at least about 160nt. In some embodiments, the length of the nucleic acid molecule is at least about 180nt. In some embodiments, the length of the nucleic acid molecule is at least about 200nt. In some embodiments, the length of the nucleic acid molecule is at least about 250nt. In some embodiments, the length of the nucleic acid molecule is at least about 300nt. In some embodiments, the length of the nucleic acid molecule is at least about 400nt. In some embodiments, the length of the nucleic acid molecule is at least about 500nt. In some embodiments, the length of the nucleic acid molecule is at least about 600nt. In some embodiments, the length of the nucleic acid molecule is at least about 700nt. In some embodiments, the length of the nucleic acid molecule is at least about 800nt. In some embodiments, the length of the nucleic acid molecule is at least about 900nt. In some embodiments, the length of the nucleic acid molecule is at least about 1000nt. In some embodiments, the length of the nucleic acid molecule is at least about 1100nt. In some embodiments, the length of the nucleic acid molecule is at least about 1200nt. In some embodiments, the length of the nucleic acid molecule is at least about 1300nt. In some embodiments, the length of the nucleic acid molecule is at least about 1400nt. In some embodiments, the length of the nucleic acid molecule is at least about 1500nt. In some embodiments, the length of the nucleic acid molecule is at least about 1600nt. In some embodiments, the length of the nucleic acid molecule is at least about 1700nt. In some embodiments, the length of the nucleic acid molecule is at least about 1800nt. In some embodiments, the length of the nucleic acid molecule is at least about 1900nt.In some embodiments, the length of the nucleic acid molecule is at least about 2000nt. In some embodiments, the length of the nucleic acid molecule is at least about 2500nt. In some embodiments, the length of the nucleic acid molecule is at least about 3000nt. In some embodiments, the length of the nucleic acid molecule is at least about 3500nt. In some embodiments, the length of the nucleic acid molecule is at least about 4000nt. In some embodiments, the length of the nucleic acid molecule is at least about 4500nt. In some embodiments, the length of the nucleic acid molecule is at least about 5000nt.

[0231] In a specific embodiment, the therapeutic nucleic acid of the present disclosure is formulated as a vaccine composition as described herein (e.g., a gene vaccine). In some embodiments, the therapeutic nucleic acid encoding can induce an immune peptide or protein for one or more target diseases or diseases. In some embodiments, the target disease is associated with or caused by a pathogen infection, such as RSV. In some embodiments, the therapeutic nucleic acid sequence (e.g., mRNA) encodes a pathogen characteristic pathogenic protein or its immunogenic fragment (e.g., epitope) or derivative. After the vaccine is administered to a vaccinated subject, the encoded pathogenic protein (or its immunogenic fragment or derivative) is allowed to be expressed, thereby inducing immunity against the pathogen in the subject.

[0232] In specific embodiments, provided herein are therapeutic compositions (eg, vaccine compositions) for the management, prevention, and treatment of diseases or conditions caused by RSV or by infection with RSV.

[0233] Without being bound by theory, it is believed that RSV, i.e. respiratory syncytial virus, is a negative-stranded single-stranded RNA virus of the subfamily of Pneumovirinae and the family of Paramyxoviridae. RSV has only one serotype and two subtypes, A and B. RSV virions include an internal nucleocapsid, which is composed of viral RNA combined with nucleoprotein (N), phosphoprotein (P) and large polymerase protein (L). The nucleocapsid is surrounded by matrix protein (M), and is wrapped by a lipid bilayer, and viral fusion protein (F) and attachment protein (G) and small hydrophobic protein (SH) are incorporated into the lipid bilayer. The viral genome also encodes two nonstructural proteins (NS1 and NS2), which suppress type I interferon activity and M-2 protein.

[0234] Therefore, in some embodiments, provided herein is a therapeutic nucleic acid encoding a viral peptide or protein derived from RSV. In some embodiments, nucleic acid encoding a viral peptide or protein derived from RSV, wherein the viral peptide or protein is selected from one or more of the following: (a) nucleoprotein (N), (b) phosphoprotein (P), (c) large polymerase protein (L), (d) matrix protein (M), (e) fusion protein (F), (f) attachment protein (G), (g) small hydrophobic protein (SH), (h) nonstructural protein 1 (NS1), (i) nonstructural protein 2 (Ns2), (j) (a) to (i) any one of the immunogenic fragments, and (k) (a) to (j) any one of the functional derivatives.

[0235] Thus, in some embodiments, the therapeutic nucleic acids of the present disclosure encode RSV F protein, or an immunogenic fragment of the F protein, or a functional derivative of the F protein or an immunogenic fragment thereof.Table 1 shows exemplary native RSV F antigen sequences.

[0236] Table 1. Exemplary sequences of RSV F antigen.

[0237]

[0238] In a specific embodiment, the therapeutic nucleic acid of the present disclosure encodes the F protein of RSV, wherein the F protein is from subtype A. In a specific embodiment, the therapeutic nucleic acid of the present disclosure encodes the F protein of RSV, wherein the F protein has the amino acid sequence of SEQ ID NO: 113. In a specific embodiment, the therapeutic nucleic acid of the present disclosure encodes the F protein of RSV, wherein the therapeutic nucleic acid comprises a DNA sequence encoding the amino acid sequence of SEQ ID NO: 113. In a specific embodiment, the therapeutic nucleic acid of the present disclosure encodes the F protein of RSV, wherein the therapeutic nucleic acid comprises an RNA sequence transcribed from a DNA encoding the amino acid sequence of SEQ ID NO: 113. In a specific embodiment, the therapeutic nucleic acid of the present disclosure encodes the ECD of the F protein of RSV, wherein the F protein has the amino acid sequence of SEQ ID NO: 113. In a specific embodiment, the therapeutic nucleic acid of the present disclosure encodes the ECD of the F protein of RSV, wherein the therapeutic nucleic acid comprises a DNA sequence encoding the ECD of the F protein, and the F protein has the amino acid sequence of SEQ ID NO: 113. In certain embodiments, the therapeutic nucleic acid of the present disclosure encodes the ECD of the F protein of RSV, wherein the therapeutic nucleic acid comprises an RNA sequence transcribed from a DNA sequence encoding the ECD of the F protein, the F protein having the amino acid sequence of SEQ ID NO: 113. In some embodiments, the RNA sequence is transcribed in vitro. In certain embodiments, the nucleic acid molecule is an mRNA molecule.

[0239] In specific embodiments, the therapeutic nucleic acids of the present disclosure encode the F protein of RSV, wherein the F protein is from subtype B. In specific embodiments, the therapeutic nucleic acids of the present disclosure encode the F protein of RSV, wherein the F protein has the amino acid sequence of SEQ ID NO: 114. In specific embodiments, the therapeutic nucleic acids of the present disclosure encode the F protein of RSV, wherein the therapeutic nucleic acid comprises a DNA sequence encoding the amino acid sequence of SEQ ID NO: 114. In specific embodiments, the therapeutic nucleic acids of the present disclosure encode the F protein of RSV, wherein the therapeutic nucleic acid comprises an RNA sequence transcribed from a DNA encoding the amino acid sequence of SEQ ID NO: 114. In specific embodiments, the therapeutic nucleic acids of the present disclosure encode the ECD of the F protein of RSV, wherein the F protein has the amino acid sequence of SEQ ID NO: 114. In specific embodiments, the therapeutic nucleic acids of the present disclosure encode the ECD of the F protein of RSV, wherein the therapeutic nucleic acid comprises a DNA sequence encoding the ECD of the F protein, and the F protein has the amino acid sequence of SEQ ID NO: 114. In certain embodiments, the therapeutic nucleic acid of the present disclosure encodes the ECD of the F protein of RSV, wherein the therapeutic nucleic acid comprises an RNA sequence transcribed from a DNA sequence encoding the ECD of the F protein, the F protein having the amino acid sequence of SEQ ID NO: 114. In some embodiments, the RNA sequence is transcribed in vitro. In certain embodiments, the nucleic acid molecule is an mRNA molecule.

[0240] In a specific embodiment, the therapeutic nucleic acid of the present disclosure encodes an immunogenic fragment of the F protein of RSV. In a specific embodiment, the therapeutic nucleic acid of the present disclosure encodes a functional derivative of the F protein of RSV. In a specific embodiment, the therapeutic nucleic acid of the present disclosure encodes a functional derivative of the immunogenic fragment of the F protein of RSV.

[0241] In certain embodiments, the RSV F protein is a mutant.

[0242] Without being bound by theory, it is expected that in some embodiments, the therapeutic nucleic acid encoding of the present disclosure comprises a fusion protein of an RSV F protein or its fragment fused to a trimerization peptide, such that the fusion protein can form a trimer complex comprising three copies of the F protein or its fragment. In some embodiments, the F protein or its fragment is fused to the trimerization peptide via a peptide linker. Table 2 shows exemplary trimerization peptides and linker peptides that can be used in conjunction with the present disclosure, as well as the sequence of the fusion protein.

[0243] Table 2 Exemplary sequences of linker peptides and trimerization peptides.

[0244]

[0245] In some embodiments, the therapeutic nucleic acid encodes a fusion protein comprising an F protein of RSV fused to a trimerization peptide or a functional derivative thereof. In some embodiments, the fusion between the F protein and the trimerization peptide is through a peptide linker. In a specific embodiment, the peptide linker comprises the amino acid sequence of SEQ ID NO: 115. In some embodiments, the trimerization peptide comprises the amino acid sequence of SEQ ID NO: 117.

[0246] In a specific embodiment, the therapeutic nucleic acid encodes a fusion protein comprising the F protein of the RSV fused to the trimerization peptide, wherein the nucleic acid comprises a DNA coding sequence. In a specific embodiment, the therapeutic nucleic acid encodes a fusion protein comprising the F protein of the RSV fused to the trimerization peptide, wherein the nucleic acid comprises an RNA sequence transcribed from the DNA coding sequence. In some embodiments, the RNA sequence is in vitro transcribed. In a specific embodiment, the nucleic acid molecule is an mRNA molecule.

[0247] Without being bound by theory, it is expected that the fusion protein comprising the viral peptide or polypeptide fused to the Fc region of an immunoglobulin can enhance the immunogenicity of the viral peptide or polypeptide. Therefore, in some embodiments, the therapeutic nucleic acid molecule of the present disclosure encodes a fusion protein, and the fusion protein comprises a viral peptide or protein derived from RSV fused to the Fc region of an immunoglobulin. In a specific embodiment, the viral peptide or protein is selected from one or more of the following: (a) nucleoprotein (N), (b) phosphoprotein (P), (c) large polymerase protein (L), (d) matrix protein (M), (e) fusion protein (F), (f) attachment protein (G), (g) small hydrophobic protein (SH), (h) nonstructural protein 1 (NS1), (i) nonstructural protein 2 (Ns2), (j) (a) to (i) any one of the immunogenic fragments, and (k) (a) to (j) any one of the functional derivatives. In a specific embodiment, the immunoglobulin is a human immunoglobulin (Ig). In certain embodiments, the immunoglobulin is human IgG, IgA, IgD, IgE or IgM. In certain embodiments, the immunoglobulin is human IgG1, IgG2, IgG3 or IgG4. In some embodiments, the immunoglobulin Fc is fused to the N-terminus of a viral peptide or polypeptide. In other embodiments, the immunoglobulin Fc is fused to the C-terminus of a viral peptide or polypeptide.

[0248] Without being bound by theory, it is expected that the signal peptide can mediate the transport of the polypeptide fused thereto to a specific location of the cell. Therefore, in some embodiments, the therapeutic nucleic acid molecules of the present disclosure encode a fusion protein comprising a viral peptide or protein fused to a signal peptide. In a specific embodiment, the viral peptide or protein is selected from one or more of the following: (a) nucleoprotein (N), (b) phosphoprotein (P), (c) large polymerase protein (L), (d) matrix protein (M), (e) fusion protein (F), (f) attachment protein (G), (g) small hydrophobic protein (SH), (h) nonstructural protein 1 (NS1), (i) nonstructural protein 2 (Ns2), (j) (a) to (i) any immunogenic fragment, and (k) (a) to (j) any functional derivative. In some embodiments, the signal peptide is fused to the N-terminus of the viral peptide or polypeptide. In other embodiments, the signal peptide is fused to the C-terminus of the viral peptide or polypeptide. Table 3 shows exemplary sequences of signal peptides that can be used in conjunction with the present disclosure.

[0249] Table 3: Exemplary sequences of signal peptides.

[0250]

[0251]

[0252]

[0253] In a specific embodiment, the signal peptide is encoded by the endogenous gene of the RSV from which the viral peptide or polypeptide is derived. In a specific embodiment, the signal peptide encoded by the gene of RSV is fused with the viral peptide or polypeptide encoded by the different genes of RSV. In other embodiments, the signal peptide encoded by the gene of RSV is fused with the viral peptide or polypeptide encoded by the same gene of RSV. For example, in some embodiments, the signal peptide with the amino acid sequence of MELLILKANAITTILTAVTFCFASG (SEQ ID NO:8) or MELLIHRSSAIFLTLAINALYLTSS (SEQ ID NO:10) is fused with the viral peptide or polypeptide encoded by the nucleic acid molecule of the present disclosure. For example, in some embodiments, the viral peptide or protein is the fusion protein (F) of RSV, for example, from subtype A (particularly for SEQ ID NO:8) or from subtype B (particularly for SEQ ID NO:10).

[0254] In other embodiments, the signal peptide is encoded by an exogenous gene sequence that is not present in the RSV from which the viral peptide or polypeptide originates. In some embodiments, the heterologous signal peptide replaces the homologous signal peptide in the fusion protein encoded by the nucleic acid molecule of the present disclosure. In a specific embodiment, the signal peptide is encoded by a mammalian gene. In a specific embodiment, the signal peptide is encoded by a human immunoglobulin gene. In a specific embodiment, the signal peptide is encoded by a human IgE gene. For example, in some embodiments, a signal peptide with an amino acid sequence of MDWTWILFLVAAATRVHS (SEQ ID NO: 9) is fused to a viral peptide or polypeptide encoded by a nucleic acid molecule of the present disclosure. In a specific embodiment, the signal peptide is encoded by a human tPA gene. For example, in some embodiments, a signal peptide with an amino acid sequence of MDAMKRGLCCVLLLCGAVFVSNS (SEQ ID NO: 121) is fused to a viral peptide or polypeptide encoded by a nucleic acid molecule of the present disclosure. In various embodiments, the viral peptide or protein is one or more selected from the following: (a) nucleoprotein (N), (b) phosphoprotein (P), (c) large polymerase protein (L), (d) matrix protein (M), (e) fusion protein (F), (f) attachment protein (G), (g) small hydrophobic protein (SH), (h) non-structural protein 1 (NS1), (i) non-structural protein 2 (Ns2), (j) an immunogenic fragment of any one of (a) to (i), and (k) a functional derivative of any one of (a) to (j), in particular (e) fusion protein (F).

[0255] 5.3.25'-Cap structure

[0256] Without being bound by theory, it is expected that the 5'-cap structure of the polynucleotide is involved in nuclear export and increases polynucleotide stability, and binds to mRNA cap binding protein (CBP), which is responsible for polynucleotide stability in the cell and causes translational competence by forming mature circular mRNA species through the association of CBP with poly-A binding protein. The 5'-cap structure further contributes to the removal of 5'-proximal introns during mRNA splicing. Therefore, in some embodiments, the nucleic acid molecules of the present disclosure include a 5'-cap structure.

[0257] Nucleic acid molecules can be capped at the 5' end by the cell's endogenous transcriptional machinery, thereby generating a 5'-ppp-5'-triphosphate linkage between the terminal guanosine cap residue of the polynucleotide and the sense nucleotide transcribed at the 5' end. This 5'-guanylate cap can then be methylated to generate an N7-methyl-guanylate residue. The ribose of the nucleotides transcribed at the terminal and / or anteterminal of the 5' end of the polynucleotide can also be optionally 2'-O-methylated. 5'-decapping via hydrolysis and cleavage of the guanylate cap structure can target nucleic acid molecules, such as mRNA molecules, for degradation.

[0258] In some embodiments, the nucleic acid molecules of the present disclosure comprise one or more changes to a native 5'-cap structure produced by an endogenous process. Without being bound by theory, modifications to the 5'-cap may increase the stability of the polynucleotide, increase the half-life of the polynucleotide, and may increase the translation efficiency of the polynucleotide.

[0259] Exemplary changes to the natural 5'-cap structure include the production of a non-hydrolyzable cap structure to prevent decapping and thereby increase the half-life of the polynucleotide. In some embodiments, because the hydrolysis of the cap structure requires the cleavage of the 5'-ppp-5' phosphodiester linkage, in some embodiments, modified nucleotides may be used during the capping reaction. For example, in some embodiments, the vaccinia capping enzyme from New England Biolabs (Ipswich, Mass.) may be used for α-thioguanosine nucleotides to produce thiophosphate linkages in the 5'-ppp-5' cap according to the manufacturer's instructions. Additional modified guanosine nucleotides such as α-methylphosphonic acid and selenophosphate nucleotides may be used.

[0260] Additional exemplary changes to the native 5'-cap structure also include modifications at the 2' and / or 3' position of the capped guanosine triphosphate (GTP), replacement of the sugar ring oxygen (producing the oxygen of the carbocyclic ring) with a methylene moiety (CH2), modifications at the triphosphate bridge portion of the cap structure, or modifications at the nucleobase (G) portion.

[0261] Additional exemplary changes to the natural 5'-cap structure include, but are not limited to, 2'-O-methylation of the ribose of the 5'-terminus of the polynucleotide and / or the 5'-terminal nucleotide on the sugar 2'-hydroxyl group (as described above). A plurality of different 5'-cap structures can be used to produce the 5'-cap of a polynucleotide (such as an mRNA molecule). Additional exemplary 5'-cap structures that can be used in conjunction with the present disclosure also include those described in International Patent Publication Nos. WO2008127688, WO2008016473, and WO 2011015347, the entire contents of each of which are incorporated herein by reference.

[0262] In various embodiments, the 5'-terminal cap may include a cap analog. Cap analogs are also referred to herein as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, which have a chemical structure that is different from the natural (i.e., endogenous, wild-type or physiological) 5'-cap while retaining cap function. Cap analogs can be synthesized and / or attached to polynucleotides chemically (i.e., non-enzymatically) or enzymatically.

[0263] For example, the anti-reverse cap analog (ARCA) cap contains two guanosines linked by a 5'-5'-triphosphate group, wherein one of the guanosines contains an N7-methyl group as well as a 3'-O-methyl group (i.e., N7, 3'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, i.e., m7G-3'mppp-G, which can be equivalently referred to as 3'O-Me-m7G(5')ppp(5')G). The 3'-O atom of the other unchanged guanosine is linked to the 5'-terminal nucleotide of the capped polynucleotide (e.g., mRNA). The N7- and 3'-O-methylated guanosines provide the terminal portion of the capped polynucleotide (e.g., mRNA). Another exemplary cap structure is mCAP, which is similar to ARCA, but has a 2'-O-methyl group on the guanosine (i.e., N7, 2'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, i.e., m7Gm-ppp-G).

[0264] In some embodiments, the cap analog may be a dinucleotide cap analog. As a non-limiting example, a dinucleotide cap analog may be modified with a boranophosphate or a phophoroselenoate at different phosphate positions, such as the dinucleotide cap analogs described in U.S. Pat. No. 8,519,110, the entire contents of which are incorporated herein by reference in their entirety.

[0265] In some embodiments, the cap analog may be a N7-(4-chlorophenoxyethyl) substituted dinucleotide cap analog known in the art and / or described herein. Non-limiting examples of N7-(4-chlorophenoxyethyl) substituted dinucleotide cap analogs include N7-(4-chlorophenoxyethyl)-G(5')ppp(5')G and N7-(4-chlorophenoxyethyl)-m3'-OG(5')ppp(5')G cap analogs (see, e.g., various cap analogs and methods for synthesizing cap analogs described in Kore et al. Bioorganic & Medicinal Chemistry 201321:4570-4574; the entire contents of the document are incorporated herein by reference). In other embodiments, the cap analog that can be used in conjunction with the nucleic acid molecules of the present disclosure is a 4-chloro / bromophenoxyethyl analog.

[0266] In various embodiments, the cap analog may include a guanosine analog. Useful guanosine analogs include, but are not limited to, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0267] Without being bound by theory, it is expected that although cap analogs allow simultaneous capping of polynucleotides in in vitro transcription reactions, up to 20% of transcripts remain uncapped. This, along with the structural differences between cap analogs and the natural 5'-cap structure of polynucleotides produced by the cell's endogenous transcription machinery, may lead to reduced translational capacity and reduced cellular stability.

[0268] Therefore, in some embodiments, the nucleic acid molecules of the present disclosure may also be capped after transcription using an enzyme to produce a more authentic 5'-cap structure. As used herein, the phrase "more authentic" refers to a feature that closely reflects or mimics an endogenous or wild-type feature in structure or function. That is, a "more authentic" feature better represents endogenous, wild-type, natural or physiological cell function and / or structure than a synthetic feature or analog of the prior art, or it outperforms the corresponding endogenous, wild-type, natural or physiological feature in one or more aspects. Non-limiting examples of more authentic 5'-cap structures that can be used in conjunction with the nucleic acid molecules of the present disclosure are structures that have enhanced binding to cap-binding proteins, increased half-life, reduced sensitivity to 5'-endonucleases, and / or reduced 5'-decapping, compared to synthetic 5'-cap structures known in the art (or compared to wild-type, natural or physiological 5'-cap structures). For example, in some embodiments, a recombinant vaccinia virus capping enzyme and a recombinant 2'-O-methyltransferase can generate a classic 5'-5'-triphosphate linkage between the 5'-terminal nucleotide of a polynucleotide and a guanosine cap nucleotide, wherein the cap guanosine contains an N7-methylation and the 5'-terminal nucleotide of the polynucleotide contains a 2'-O-methyl group. This structure is referred to as a cap 1 structure. This cap results in higher translational capacity, cellular stability, and reduced activation of cellular proinflammatory cytokines compared to other 5' cap analog structures known in the art, for example. Other exemplary cap structures include 7mG(5')ppp(5')N,pN2p (cap 0), 7mG(5')ppp(5')NlmpNp (cap 1), 7mG(5')-ppp(5')NlmpN2mp (cap 2), and m(7)Gpppm(3)(6,6,2')Apm(2')Apm(2')Cpm(2)(3,2')Up (cap 4).

[0269] Without being bound by theory, it is contemplated that the nucleic acid molecules of the present disclosure can be capped after transcription, and because this method is relatively efficient, nearly 100% of the nucleic acid molecules can be capped.

[0270] 5.3.3 Untranslated Region (UTR)

[0271] In some embodiments, the nucleic acid molecules of the present disclosure include one or more untranslated regions (UTRs). In some embodiments, the UTR is located upstream of the coding region in the nucleic acid molecule and is referred to as the 5'-UTR. In some embodiments, the UTR is located downstream of the coding region in the nucleic acid molecule and is referred to as the 3'-UTR. The sequence of the UTR may be homologous or heterologous to the sequence of the coding region found in the nucleic acid molecule. Multiple UTRs may be included in the nucleic acid molecule and may have the same or different sequences and / or gene origins. According to the present disclosure, any portion of the UTR in the nucleic acid molecule (including without any portion) may be codon optimized, and any portion may contain one or more different structures or chemical modifications independently before and / or after codon optimization.

[0272] In some embodiments, nucleic acid molecules (e.g., mRNA) of the present disclosure comprise UTRs and coding regions that are homologous to each other. In other embodiments, nucleic acid molecules (e.g., mRNA) of the present disclosure comprise UTRs and coding regions that are heterologous to each other. In some embodiments, to monitor the activity of UTR sequences, nucleic acid molecules comprising coding sequences of UTRs and detectable probes may be administered in vitro (e.g., in cell or tissue culture) or in vivo (e.g., to a subject), and the effects of UTR sequences (e.g., regulating expression levels, cellular localization of the encoded product, or half-life of the encoded product) may be measured using methods known in the art.

[0273] In some embodiments, the UTR of the nucleic acid molecule (e.g., mRNA) of the present disclosure includes at least one translation enhancer element (TEE), which plays a role in increasing the amount of the polypeptide or protein produced by the nucleic acid molecule. In some embodiments, the TEE is located in the 5'-UTR of the nucleic acid molecule. In other embodiments, the TEE is located at the 3'-UTR of the nucleic acid molecule. In other embodiments, at least two TEEs are located at the 5'-UTR and 3'-UTR of the nucleic acid molecule, respectively. In some embodiments, the nucleic acid molecule (e.g., mRNA) of the present disclosure may include one or more copies of the TEE sequence or include more than one different TEE sequence. In some embodiments, the different TEE sequences present in the nucleic acid molecule of the present disclosure may be homologous or heterologous relative to each other.

[0274] Various TEE sequences are known in the art and can be used in conjunction with the present disclosure. For example, in some embodiments, the TEE can be an internal ribosome entry site (IRES), HCV-IRES, or an IRES element. Chappell et al. Proc. Natl. Acad. Sci. USA 101: 9590-9594, 2004; Zhou et al. Proc. Natl. Acad. Sci. 102: 6273-6278, 2005. Additional internal ribosome entry sites (IRES) that can be used in conjunction with the present disclosure include, but are not limited to, U.S. Patent No. 7,468,275, U.S. Patent Publication No. 2007 / 0048776, and U.S. Patent Publication No. 2011 / 0124100, and International Patent Publication No. WO2007 / 025008 and International Patent Publication No. WO2001 / 055369, the contents of each of which are incorporated herein by reference in their entirety. In some embodiments, the TEE may be the TEE described in Supplementary Table 1 and Supplementary Table 2 of Wellensiek et al., Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2013 Aug; 10(8):747-750; the contents of which are incorporated herein by reference in their entirety.

[0275] Additional exemplary TEEs that may be used in conjunction with the present disclosure include, but are not limited to, U.S. Patent No. 6,310,197, U.S. Patent No. 6,849,405, U.S. Patent No. 7,456,273, U.S. Patent No. 7,183,395, U.S. Patent Publication No. 2009 / 0226470, U.S. Patent Publication No. 2013 / 0177581, U.S. Patent Publication No. 2007 / 0048776, U.S. Patent Publication No. 2011 / 0124100, U.S. Patent Publication No. 2013 / 0177581, U.S. Patent Publication No. 2013 / 0177582, U.S. Patent Publication No. 2013 / 0177583, U.S. Patent Publication No. 2013 / 0177584, U.S. Patent Publication No. 2013 / 0177585, U.S. Patent Publication No. 2013 / 0177586, U.S. Patent Publication No. 2013 / 0177587 009 / 0093049, International Patent Publication No. WO2009 / 075886, International Patent Publication No. WO2012 / 009644 and International Patent Publication No. WO1999 / 024595, International Patent Publication No. WO2007 / 025008, International Patent Publication No. WO2001 / 055371, European Patent No. 2610341, European Patent No. 2610340, the contents of each of which are incorporated herein by reference in their entirety.

[0276] In various embodiments, nucleic acid molecules (e.g., mRNA) disclosed herein include at least one UTR, which includes at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55 or more than 60 TEE sequences. In some embodiments, the TEE sequence in the nucleic acid molecule UTR is a copy of the same TEE sequence. In other embodiments, at least two TEE sequences in the nucleic acid molecule UTR have different TEE sequences. In some embodiments, a plurality of different TEE sequences are arranged in the UTR region of the nucleic acid molecule in one or more repetitive patterns. For the purpose of illustration only, the repetition pattern may be, for example, ABABAB, AABBAABBAAB, ABCABCABC, etc., wherein in these exemplary patterns, each capital letter (A, B or C) represents a different TEE sequence. In some embodiments, in the UTR of a nucleic acid molecule, at least two TEE sequences are continuous with each other (i.e., without a spacer sequence therebetween). In other embodiments, at least two TEE sequences are separated by a spacer sequence. In some embodiments, UTR may include a TEE sequence-spacer sequence module, which is repeated in UTR at least once, at least twice, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times or more than 9 times. In any embodiment described in this paragraph, UTR may be 5'-UTR, 3'-UTR or both 5'-UTR and 3'-UTR of a nucleic acid molecule.

[0277] In some embodiments, the UTR of nucleic acid molecules (e.g., mRNA) disclosed herein comprises at least one translation inhibition element, which acts to reduce the amount of polypeptide or protein produced by the nucleic acid molecule. In some embodiments, the UTR of nucleic acid molecules comprises one or more miR sequences or fragments thereof (e.g., miR seed sequences (seed sequence)) recognized by one or more microRNAs. In some embodiments, the UTR of nucleic acid molecules comprises one or more stem-loop structures that downregulate the translation activity of nucleic acid molecules. Other mechanisms for inhibiting the translation activity associated with nucleic acid molecules are known in the art. In any embodiment described in this paragraph, UTR may be 5'-UTR, 3'-UTR, or both 5'-UTR and 3'-UTR of nucleic acid molecules. Table 4 shows exemplary 5'-UTR and 3'-UTR sequences that can be used in conjunction with the present disclosure.

[0278] Table 4 Exemplary untranslated region (UTR) sequences.

[0279]

[0280]

[0281] In specific embodiments, the nucleic acid molecules of the present disclosure comprise a 5'-UTR selected from the group consisting of SEQ ID NOs: 2, 3, 4, 5, 123, 124, 125, 132, and 133. In specific embodiments, the nucleic acid molecules of the present disclosure comprise a 3'-UTR selected from the group consisting of SEQ ID NOs: 6, 7, 107, 109, 126, and 127. In specific embodiments, the nucleic acid molecules of the present disclosure comprise a 5'-UTR selected from the group consisting of SEQ ID NOs: 2, 3, 4, 5, 123, 124, 125, 132, and 133 and a 3'-UTR selected from the group consisting of SEQ ID NOs: 6, 7, 107, 109, 126, and 127. In any of the embodiments described in this paragraph, the nucleic acid molecule may further comprise a coding region having a sequence as described herein, such as any of the DNA coding sequences in Tables 1 to 4, or their equivalent RNA sequences. In specific embodiments, the nucleic acid molecules described in this paragraph may be in vitro transcribed RNA molecules.

[0282] 5.3.4 Polyadenylation (Poly-A) Region

[0283] During natural RNA processing, long chains of adenosine nucleotides (poly-A regions) are often added to messenger RNA (mRNA) molecules to increase the stability of the molecule. Immediately after transcription, the 3'-end of the transcript is cleaved to release the 3'-hydroxyl. Next, poly-A polymerase adds a series of adenosine nucleotides to the RNA. The process is called polyadenylation, and poly-A regions between 100 and 250 residues in length are added. Without being bound by theory, it is expected that poly-A regions can confer a number of advantages to the nucleic acid molecules of the present disclosure.

[0284] Therefore, in some embodiments, nucleic acid molecules (e.g., mRNA) of the present disclosure comprise polyadenylation signals. In some embodiments, nucleic acid molecules (e.g., mRNA) of the present disclosure comprise one or more polyadenylation (poly-A) regions. In some embodiments, the poly-A region is entirely composed of adenine nucleotides or functional analogs thereof. In some embodiments, the nucleic acid molecule comprises at least one poly-A region at its 3' end. In some embodiments, the nucleic acid molecule comprises at least one poly-A region at its 5' end. In some embodiments, the nucleic acid molecule comprises at least one poly-A region at its 5' end and at least one poly-A region at its 3' end.

[0285] According to the present disclosure, in different embodiments, the poly-A region may have different lengths. In particular, in some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 30 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 35 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 40 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 45 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 50 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 55 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 60 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 65 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 70 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 75 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 80 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 85 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 90 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 95 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 100 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 110 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 120 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 130 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 140 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 150 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 160 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 170 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 180 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 190 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 200 nucleotides.In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 225 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 250 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 275 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 300 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 350 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 400 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 450 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 500 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 600 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 700 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 800 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 900 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1000 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1100 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1200 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1300 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1400 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1500 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1600 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1700 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1800 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 1900 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 2000 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 2250 nucleotides. In some embodiments, the length of the poly-A region of the nucleic acid molecules of the present disclosure is at least 2500 nucleotides.In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 2750 nucleotides in length. In some embodiments, the poly-A region of the nucleic acid molecules of the present disclosure is at least 3000 nucleotides in length.

[0286] In some embodiments, the length of the poly-A region in the nucleic acid molecule can be selected based on the total length of the nucleic acid molecule or a portion thereof, such as the length of the coding region of the nucleic acid molecule or the length of the open reading frame, etc. For example, in some embodiments, the poly-A region accounts for about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of the total length of the nucleic acid molecule containing the poly-A region.

[0287] Without being bound by theory, it is expected that certain RNA binding proteins can bind to the poly-A region located at the 3' end of the mRNA molecule. These poly-A binding proteins (PABPs) can regulate mRNA expression, for example, interact with the translation initiation machinery in the cell and / or protect the 3'-poly-A tail from degradation. Therefore, in some embodiments, the nucleic acid molecules (e.g., mRNA) of the present disclosure include at least one binding site for a poly-A binding protein (PABP). In other embodiments, before the nucleic acid molecule is loaded into a delivery vehicle (e.g., lipid nanoparticle), it is formed into a conjugate or complex with the PABP.

[0288] In some embodiments, nucleic acid molecules (e.g., mRNA) of the present disclosure comprise poly-AG quadruplexes. G-quadruplexes are circular arrays of four hydrogen-bonded guanosine nucleotides that can be formed by G-rich sequences in DNA and RNA. In this embodiment, the G-quadruplexes are incorporated at the ends of the poly-A region. The stability, protein yield, and other parameters of the resulting polynucleotides (e.g., mRNA) can be determined, including the half-life at different time points. It has been found that the protein yield of the poly-AG quadruplex structure is equal to at least 75% of the protein yield observed using only a poly-A region containing 120 nucleotides.

[0289] In some embodiments, nucleic acid molecules (e.g., mRNA) of the present disclosure may include a poly-A region and may be stabilized by adding a 3'-stabilizing region. In some embodiments, a 3'-stabilizing region that can be used to stabilize nucleic acid molecules (e.g., mRNA) includes a poly-A or poly-AG quadruplex structure as described in International Patent Publication No. WO2013 / 103659, the contents of which are incorporated herein by reference in their entirety.

[0290] In other embodiments, the 3'-stabilizing region that can be used in conjunction with the nucleic acid molecules of the present disclosure includes chain terminating nucleosides such as, but not limited to, 3'-deoxyadenosine (cordycepin); 3'-deoxyuridine; 3'-deoxycytosine; 3'-deoxyguanosine; 3'-deoxythymidine; 2',3'-dideoxynucleosides, such as 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymidine; 2'-deoxynucleosides; or O-methyl nucleosides; 3'-deoxynucleosides; 2',3'-dideoxynucleosides; 3'-O-methyl nucleosides; 3'-O-ethyl nucleosides; 3'-arabinoside, as well as other alternative nucleosides known in the art and / or described herein.

[0291] 5.3.5 Secondary structure

[0292] Without being bound by theory, it is expected that the stem-loop structure can guide RNA folding, protect the structural stability of nucleic acid molecules (e.g., mRNA), provide recognition sites for RNA binding proteins, and serve as substrates for enzymatic reactions. For example, the incorporation of miR sequences and / or TEE sequences will change the shape of the stem-loop region, thereby increasing and / or decreasing translation (Kedde et al. A Pumilio-induced RNA structure switch in p27-3'UTR controls miR-221and miR-222accessibility. Nat Cell Biol., 2010 Oct; 12(10): 1014-20, the contents of which are incorporated herein by reference in their entirety).

[0293] Therefore, in some embodiments, nucleic acid molecules (e.g., mRNA) described herein or a portion thereof may be in a stem-loop structure, such as, but not limited to, histone stem-loops. In some embodiments, the stem-loop structure is formed by a stem-loop sequence having a length of about 25 or about 26 nucleotides, such as, but not limited to, the structure described in International Patent Publication No. WO2013 / 103659, the contents of which are incorporated herein by reference in their entirety. Additional examples of stem-loop sequences include sequences described in International Patent Publication No. WO2012 / 019780 and International Patent Publication No. WO201502667, the contents of which are incorporated herein by reference. In some embodiments, the stem-loop sequence includes TEE as described herein. In some embodiments, the stem-loop sequence includes a miR sequence as described herein. In a specific embodiment, the stem-loop sequence may include a miR-122 seed sequence. In a specific embodiment, the nucleic acid molecule includes a stem-loop sequence CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO: 128). In other embodiments, the nucleic acid molecule comprises the stem-loop sequence CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO: 129).

[0294] In some embodiments, nucleic acid molecules (e.g., mRNA) of the present disclosure include stem-loop sequences located upstream of the coding region (at the 5' end) in the nucleic acid molecule. In some embodiments, the stem-loop sequence is located within the 5'-UTR of the nucleic acid molecule. In some embodiments, nucleic acid molecules (e.g., mRNA) of the present disclosure include stem-loop sequences located downstream of the coding region (at the 3' end) in the nucleic acid molecule. In some embodiments, the stem-loop sequence is located within the 3'-UTR of the nucleic acid molecule. In some cases, the nucleic acid molecule may contain more than one stem-loop sequence. In some embodiments, the nucleic acid molecule includes at least one stem-loop sequence in the 5'-UTR and at least one stem-loop sequence in the 3'-UTR.

[0295] In some embodiments, the nucleic acid molecule comprising a stem-loop structure further comprises a stabilizing region. In some embodiments, the stabilizing region comprises at least one chain terminating nucleoside, which acts to slow degradation and thereby increase the half-life of the nucleic acid molecule. Exemplary chain terminating nucleosides that can be used in conjunction with the nucleic acid molecules of the present disclosure include, but are not limited to, 3'-deoxyadenosine (cordycepin); 3'-deoxyuridine; 3'-deoxycytosine; 3'-deoxyguanosine; 3'-deoxythymidine; 2',3'-dideoxynucleosides, such as 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymidine; 2'-deoxynucleosides; or O-methyl nucleosides; 3'-deoxynucleosides; 2',3'-dideoxynucleosides; 3'-O-methyl nucleosides; 3'-O-ethyl nucleosides; 3'-arabinoside, as well as other alternative nucleosides known in the art and / or described herein. In other embodiments, the stem-loop structure can be stabilized by altering the 3 '-region of the polynucleotide, which alterations can prevent and / or inhibit the addition of oligo(U) (International Patent Publication No. WO2013 / 103659, which is herein incorporated by reference in its entirety).

[0296] In some embodiments, nucleic acid molecules of the present disclosure include at least one stem-loop sequence and a poly-A region or a polyadenylation signal. Non-limiting examples of polynucleotide sequences including at least one stem-loop sequence and a poly-A region or a polyadenylation signal include sequences described in International Patent Publication No. WO2013 / 120497, International Patent Publication No. WO2013 / 120629, International Patent Publication No. WO2013 / 120500, International Patent Publication No. WO2013 / 120627, International Patent Publication No. WO2013 / 120498, International Patent Publication No. WO2013 / 120626, International Patent Publication No. WO2013 / 120499, and International Patent Publication No. WO2013 / 120628, the contents of each of which are incorporated herein by reference in their entirety.

[0297] In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a poly-A region or a polyadenylation signal may encode a pathogen antigen or a fragment thereof, such as the polynucleotide sequences described in International Patent Publication No. WO2013 / 120499 and International Patent Publication No. WO2013 / 120628, the contents of each of which are incorporated herein by reference in their entirety.

[0298] In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a poly-A region or a polyadenylation signal may encode a therapeutic protein, such as the polynucleotide sequences described in International Patent Publication No. WO2013 / 120497 and International Patent Publication No. WO2013 / 120629, the contents of each of which are incorporated herein by reference in their entirety.

[0299] In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a poly-A region or a polyadenylation signal may encode a tumor antigen or a fragment thereof, such as the polynucleotide sequences described in International Patent Publication No. WO2013 / 120500 and International Patent Publication No. WO2013 / 120627, the contents of each of which are incorporated herein by reference in their entirety.

[0300] In some embodiments, a nucleic acid molecule comprising a stem-loop sequence and a poly-A region or a polyadenylation signal may encode a sensitizing antigen or an autoimmune self-antigen, such as the polynucleotide sequences described in International Patent Publication No. WO2013 / 120498 and International Patent Publication No. WO2013 / 120626, the contents of each of which are incorporated herein by reference in their entirety.

[0301] 5.3.6 Functional Nucleotide Analogs

[0302] In some embodiments, the payload nucleic acid molecules described herein contain only classical nucleotides selected from A (adenosine), G (guanosine), C (cytosine), U (uridine), and T (thymidine). Without being bound by theory, it is expected that certain functional nucleotide analogs can confer useful properties on nucleic acid molecules. In the context of the present disclosure, examples of such useful properties include, but are not limited to, increased stability of nucleic acid molecules, reduced immunogenicity of nucleic acid molecules in inducing innate immune responses, increased production of proteins encoded by nucleic acid molecules, increased intracellular delivery and / or retention of nucleic acid molecules, and / or reduced cytotoxicity of nucleic acid molecules, etc.

[0303] Therefore, in some embodiments, the effective load nucleic acid molecule comprises at least one functional nucleotide analog as described herein. In some embodiments, the functional nucleotide analog contains at least one chemical modification for a nucleobase, a sugar group and / or a phosphate group. Therefore, the effective load nucleic acid molecule comprising at least one functional nucleotide analog contains at least one chemical modification for a nucleobase, a sugar group and / or an internucleoside linkage. Exemplary chemical modifications to the nucleobase, sugar group or internucleoside linkage of a nucleic acid molecule are provided herein.

[0304] As described herein, nucleotides ranging from 0% to 100% of all nucleotides in a payload nucleic acid molecule can be functional nucleotide analogs as described herein. For example, in various embodiments, about 1% to about 20%, about 1% to about 25%, about 1% to about 50%, about 1% to about 60%, about 1% to about 70%, about 1% to about 80%, about 1% to about 90%, about 1% to about 95%, about 10% to about 20%, about 10% to about 25%, about 10% to about 50%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 95%, about 10% to about 100%, about 20% to about 25%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 95%, about 10% to about 100%, about 20% to about 25%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70 In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein, and the nucleotides of the present invention are functional nucleotide analogs as described herein. In any of these embodiments, the functional nucleotide analogs can be present in any position of the nucleic acid molecule, including 5'-end, 3'-end and / or one or more internal positions. In some embodiments, a single nucleic acid molecule can contain different sugar modifications, different nucleobase modifications, and / or different types of internucleoside linkages (eg, backbone structures).

[0305] As described herein, ranging from 0% to 100% of all nucleotides of one type (e.g., all purine-containing nucleotides as a type, or all pyrimidine-containing nucleotides as a type, or all A, G, C, T, or U as a type) in a payload nucleic acid molecule can be functional nucleotide analogs as described herein. For example, in various embodiments, about 1% to about 20%, about 1% to about 25%, about 1% to about 50%, about 1% to about 60%, about 1% to about 70%, about 1% to about 80%, about 1% to about 90%, about 1% to about 95%, about 10% to about 20%, about 10% to about 25%, about 10% to about 50%, about 10% to about 60%, about 10% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 95%, about 10% to about 100%, about 20% to about 25%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70%, about 10% to about 80%, about 10% to about 90%, about 10% to about 95%, about 10% to about 100%, about 20% to about 25%, about 20% to about 50%, about 20% to about 60%, about 20% to about 70%, about 10% to about 80%, In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In some embodiments, the nucleotides of the present invention are functional nucleotide analogs as described herein. In some embodiments, a single nucleic acid molecule can contain different sugar modifications, different nucleobase modifications, and / or different types of internucleoside linkages (eg, backbone structures).

[0306] 5.3.7 Modification of Nucleobases

[0307] In some embodiments, the functional nucleotide analogs contain non-classical nucleobases. In some embodiments, the classical nucleobases in the nucleotide (e.g., adenine, guanine, uracil, thymine, and cytosine) can be modified or replaced to provide one or more functional analogs of the nucleotide. Exemplary modifications of nucleobases include, but are not limited to, one or more substitutions or modifications, including, but not limited to, alkyl, aryl, halo, oxo, hydroxyl, alkoxy, and / or thio substitutions; one or more fused rings or ring openings, oxidations, and / or reductions.

[0308] In some embodiments, the non-classical nucleobase is a modified uracil. Exemplary nucleobases and nucleosides having modified uracil include pseudouridine (ψ), pyridin-4-one ribonucleoside, 5-azauracil, 6-azauracil, 2-thio-5-azauracil, 2-thiouracil (s 2 U), 4-thio-uracil (s 4 U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil (ho 5 U), 5-aminoallyl-uracil, 5-halouracil (e.g., 5-iodouracil or 5-bromouracil), 3-methyluracil (m 3 U), 5-methoxyuracil (mo 5 U), uracil 5-oxyacetic acid (cmo 5 U), uracil 5-oxyacetate (mcmo 5 U), 5-carboxymethyl-uracil (cm 5 U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uracil (chm 5 U), 5-carboxyhydroxymethyl-uracil methyl ester (mchm 5 U), 5-methoxycarbonylmethyl-uracil (mcm 5 U), 5-methoxycarbonylmethyl-2-thiouracil (mcm 5 s 2 U), 5-aminomethyl-2-thiouracil (nm 5 s 2 U), 5-methylaminomethyluracil (mnm 5 U), 5-methylaminomethyl-2-thiouracil (mnm 5 s 2 U), 5-methylaminomethyl-2-selenouracil (mnm 5 s 2 U), 5-carbamoylmethyluracil (ncm 5 U), 5-carboxymethylaminomethyl-uracil (cmnm 5 U), 5-carboxymethylaminomethyl-2-thiouracil (cmnm 5 s 2 U), 5-propynyl-uracil, 1-propynyl-pseudouracil, 5-taurine methyl-uracil (τm 5 U), 1-taurine methyl-pseudouridine, 5-taurine methyl-2-thio-uracil (τm 5 5s 2 U), 1-taurine methyl-4-thio-pseudouridine, 5-methyl-uracil (m 5 U, i.e., having the nucleobase deoxythymine), 1-methyl-pseudouridine (m1 ψ), 1-ethyl-pseudouridine (Et 1 ψ), 5-methyl-2-thiouracil (m 5 s 2 U), 1-methyl-4-thio-pseudouridine (m 1 s 4 ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m 3 ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouracil (D), dihydropseudouridine, 5,6-dihydrouracil, 5-methyl-dihydrouracil (m 5 D), 2-thio-dihydrouracil, 2-thio-dihydropseudouridine, 2-methoxy-uracil, 2-methoxy-4-thio-uracil, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl) uracil (acp 3 U), 1-methyl-3-(3-amino-3-carboxypropyl) pseudouridine (acp 3 ψ), 5-(isopentenylaminomethyl)uracil (m 5 U), 5-(isopentenylaminomethyl)-2-thio-uracil (m 5 s 2 U), 5,2'-O-dimethyl-uridine (m 5 Um), 2-thio-2'-O-methyl-uridine (s 2 Um), 5-methoxycarbonylmethyl-2'-O-methyl-uridine (mcm 5 Um), 5-carbamoylmethyl-2'-O-methyl-uridine (ncm 5 Um), 5-carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm 5 Um), 3,2'-O-dimethyl-uridine (m 3 Um) and 5-(isopentenylaminomethyl)-2'-O-methyl-uridine (inm 5 Um), 1-thio-uracil, deoxythymidine, 5-(2-methoxycarbonylvinyl)-uracil, 5-(carbamoylhydroxymethyl)-uracil, 5-carbamoylmethyl-2-thio-uracil, 5-carboxymethyl-2-thio-uracil, 5-cyanomethyl-uracil, 5-methoxy-2-thio-uracil and 5-[3-(1-E-propenylamino)]uracil.

[0309] In some embodiments, the non-classical nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides having modified cytosines include 5-azacytosine, 6-azacytosine, pseudoisocytidine, 3-methylcytosine (m3C), N4-acetylcytosine (ac4C), 5-formylcytosine (f5C), N4-methyl-cytosine (m4C), 5-methyl-cytosine (m5C), 5-halo-cytosine (e.g., 5-iodo-cytosine), 5-hydroxymethyl-cytosine (hm5C), 1-methyl-pseudoisocytidine, pyrrolocytosine, pyrrolopseudoisocytidine, 2-thiocytosine (s2C), 2-thio-5-methylcytosine, 4-thiopseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5 -aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytosine, 2-methoxy-5-methyl-cytosine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysidine (k2C), 5,2'-O-dimethyl-cytidine (m5Cm), N4-ethyl Acyl-2'-O-methyl-cytidine (ac4Cm), N4,2'-O-dimethyl-cytidine (m4Cm), 5-formyl-2'-O-methyl-cytidine (fSCm), N4,N4,2'-O-trimethyl-cytidine (m42Cm), 1-thio-cytosine, 5-hydroxy-cytosine, 5-(3-azidopropyl)-cytosine and 5-(2-azidoethyl)-cytosine.

[0310] In some embodiments, the non-classical nucleobase is a modified adenine. Exemplary nucleobases and nucleosides having an alternative adenine include 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2 ,6-diaminopurine, 1-methyl-adenine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenine (m6A), 2-methylthio-N6-methyl-adenine (ms2m6A), N6-isopentenyl-adenine (i6A), 2-methylthio-N6-isopentenyl-adenine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycylcarbamoyl N6-methyl-N6-threonylcarbamoyl-adenine (m6t6A), 2-methylthio-N6-threonylcarbamoyl-adenine (ms2g6A), N6,N6-dimethyl-adenine (m62A), N6-hydroxynorvalylcarbamoyl-adenine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenine (ms2hn6A), N6-acetyl-adenine (ac6A) , 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, N6,2'-O-dimethyl-adenosine (m6Am), N6,N6,2'-O-trimethyl-adenosine (m62Am), 1,2'-O-dimethyl-adenosine (m1Am), 2-amino-N6-methyl-purine, 1-thio-adenine, 8-azido-adenine, N6-(19-amino-pentaoxanonadecanyl)-adenine, 2,8-dimethyl-adenine, N6-formyl-adenine and N6-hydroxymethyl-adenine.

[0311] In some embodiments, the non-classical nucleobase is a modified guanine. Exemplary nucleobases and nucleosides having a modified guanine include inosine (I), 1-methyl-inosine (m1I), wyosine (imG), methyl wyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wybutosine (yW), peroxy wybutosine (o2yW), hydroxy wybutosine (OHyW), undermodified hydroxy wybutosine (OHyW*), 7-deaza- Guanine, queuosine (Q), epoxyqueuosine (oQ), galactosylqueuosine (galQ), mannosylqueuosine (manQ), 7-cyano-7-deaza-guanine (preQO), 7-aminomethyl-7-deaza-guanine (preQ1), archaeosine (G+), 7-deaza-8-aza-guanine, 6-thio-guanine, 6-thio-7-deaza-guanine, 6-thio-7-deaza-8-aza-guanine, 7-methyl guanine (m7G), 6-thio-7-methyl-guanine, 7-methyl-inosine, 6-methoxy-guanine, 1-methyl-guanine (m1G), N2-methyl-guanine (m2G), N2,N2-dimethyl-guanine (m22G), N2,7-dimethyl-guanine (m2,7G), N2,N2,7-dimethyl-guanine (m2,2,7G), 8-oxo-guanine, 7-methyl-8-oxo-guanine, 1-methyl-6-thio-guanine, N2-methyl-6- Thio-guanine, N2,N2-dimethyl-6-thio-guanine, N2-methyl-2'-O-methyl-guanosine (m2Gm), N2,N2-dimethyl-2'-O-methyl-guanosine (m22Gm), 1-methyl-2'-O-methyl-guanosine (m1Gm), N2,7-dimethyl-2'-O-methyl-guanosine (m2,7Gm), 2'-O-methyl-inosine (Im), 1,2'-O-dimethyl-inosine (m1Im), 1-thio-guanine and O-6-methyl-guanine.

[0312] In some embodiments, the non-classical nucleobase of the functional nucleotide analog can independently be a purine, a pyrimidine, a purine analog, or a pyrimidine analog. For example, in some embodiments, the non-classical nucleobase can be a modified adenine, cytosine, guanine, uracil, or hypoxanthine. In other embodiments, non-classical nucleobases may also include, for example, naturally occurring and synthetic derivatives of bases, including pyrazolo[3,4-d]pyrimidine; 5-methylcytosine (5-me-C); 5-hydroxymethylcytosine; xanthine; hypoxanthine; 2-aminoadenine; 6-methyl and other alkyl derivatives of adenine and guanine; 2-propyl and other alkyl derivatives of adenine and guanine; 2-thiouracil, 2-thiothymine and 2-thiocytosine; 5-propynyluracil and cytosine; 6-azouracil, cytosine and thymine; 5-uracil (pseudouracil); 4-thiouracil; 8-halo (e.g., 8-bromo), 8-amino, 8-thiol , 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines; 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines; 7-methylguanine and 7-methyladenine; 8-azaguanine and 8-azaadenine; deazaguanine, 7-deazaguanine, 3-deazaguanine; deazaadenine, 7-deazaadenine, 3-deazaadenine; pyrazolo[3,4-d]pyrimidine; imidazo[1,5-a]1,3,5-triazinone; 9-deazapurine; imidazo[4,5-d]pyrazine; thiazolo[4,5-d]pyrimidine; pyrazin-2-one; 1,2,4-triazine; pyridazine; or 1,3,5-triazine.

[0313] 5.3.8 Sugar modification

[0314] In some embodiments, the functional nucleotide analogs contain non-classical sugar groups. In various embodiments, the non-classical sugar group can be a 5- or 6-carbon sugar (such as pentose, ribose, arabinose, xylose, glucose, galactose or its deoxy derivatives) with one or more substitutions, such as halogen, hydroxyl, thiol, alkyl, alkoxy, alkenyloxy, alkynyloxy, cycloalkyl, aminoalkoxy, alkoxyalkoxy, hydroxyalkoxy, amino, azido, aryl, aminoalkyl, aminoalkenyl, aminoalkynyl, etc.

[0315] In general, RNA molecules contain a ribose sugar group that is an oxygen-containing 5-membered ring. Exemplary non-limiting alternative nucleotides include replacement of the oxygen in ribose (e.g., with S, Se, or an alkylene group, such as methylene or ethylene); addition of double bonds (e.g., replacement of ribose with a cyclopentenyl or cyclohexenyl group); ring contraction of ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., to form a 6-membered or 7-membered ring with additional carbon or heteroatoms, such as for anhydrohexitol, altritol, mannitol, cyclohexane, cyclohexane, etc.); hexenyl and N-morpholinyl (which also have a phosphoramidate backbone); polycyclic forms (e.g., tricyclic and "unlocked" forms, such as glycol nucleic acids (GNAs) (e.g., R-GNA or S-GNA, in which ribose is replaced by a glycol unit linked to a phosphodiester linkage), threose nucleic acids (TNA, in which ribose is replaced by an α-L-threofuranosyl-(3'→2')) and peptide nucleic acids (PNA, in which 2-amino-ethyl-glycine linkages replace ribose and the phosphodiester backbone)).

[0316] In some embodiments, the sugar group contains one or more carbons having a stereochemical configuration opposite to the corresponding carbon in ribose. Therefore, the nucleic acid molecule may include nucleotides containing, for example, arabinose or L-ribose as sugar. In some embodiments, the nucleic acid molecule includes at least one nucleoside wherein the sugar is L-ribose, 2'-O-methyl ribose, 2'-fluororibose, arabinose, hexitol, LNA or PNA.

[0317] 5.3.9 Modification of internucleoside linkages

[0318] In some embodiments, the disclosed payload nucleic acid molecules may contain one or more modified internucleoside linkages (eg, phosphate backbones). The backbone phosphate groups may be altered by replacing one or more oxygen atoms with different substituents.

[0319] In some embodiments, functional nucleotide analogs may include another internucleoside linkage replacement unchanged phosphate moiety as described herein. Examples of alternative phosphate groups include but are not limited to thiophosphate, selenophosphate, borane phosphate, borane phosphate, hydrogen phosphonate, phosphoramidate, diamino phosphoroester, alkyl or aryl phosphonate and phosphotriester. Two non-connected oxygens of dithiophosphate are replaced by sulfur. Phosphate linkers can also be changed by replacing oxygen with nitrogen (phosphoramidate of bridges), sulfur (phosphorothioate of bridges) and carbon (methylene phosphonate of bridges).

[0320] Alternative nucleosides and nucleotides may include one or more non-bridging oxygens replaced by a borane moiety (BH3), sulfur (thio), methyl, ethyl and / or methoxy. As a non-limiting example, two non-bridging oxygens at the same position (e.g., alpha (α), beta (β) or gamma (γ) position) may be replaced by sulfur (thio) and methoxy. One or more oxygen atoms at the position of a replacement phosphate moiety (e.g., α-thiophosphate) may impart RNA and DNA stability (such as stability against exonucleases and endonucleases) via non-natural thiophosphate backbone linkages. Phosphorothioate DNA and RNA have increased nuclease resistance and therefore have a longer half-life in a cellular environment.

[0321] Other internucleoside linkages that can be used in accordance with the present disclosure are described herein, including internucleoside linkages that do not contain a phosphorus atom.

[0322] Additional examples of nucleic acid molecules (e.g., mRNA), related compositions, formulations, and / or methods that can be used in conjunction with the present disclosure include WO2002 / 098443, WO2003 / 051401, WO2008 / 052770, WO2009127230, WO2006122828, WO2008 / 083949, WO2010088927, WO2010 / 037539, WO2004 / 004743, WO2005 / 016 376. WO2006 / 024518, WO2007 / 095976, WO2008 / 014979, WO2008 / 077592, WO2009 / 030481, WO2009 / 095226, W O2011069586, WO2011026641, WO2011 / 144358, WO2012019780, WO2012013326, WO2012089338, WO201211351 3. WO2012116811, WO2012116810, WO2013113502, WO2013113501, WO2013113736, WO2013143698, WO2013143 699. WO2013143700, WO2013 / 120626, WO2013120627, WO2013120628, WO2013120629, WO2013174409, WO2014 Those described in WO2015 / 027917, WO2015 / 024669, WO2015 / 024668, WO2015 / 024667, WO2015 / 024665, WO2015 / 024666, WO2015 / 024664, WO2015101415, WO2015101414, WO2015024667, WO2015062738, WO2015101416, the contents of each of which are incorporated herein in their entirety.

[0323] Therapeutic nucleic acid molecules as described herein can be isolated or synthesized using methods known in the art. In some embodiments, the DNA or RNA molecules used in conjunction with the present disclosure are chemically synthesized. In other embodiments, the DNA or RNA molecules used in conjunction with the present disclosure are isolated from natural sources.

[0324] In some embodiments, the mRNA molecules used in conjunction with the present disclosure are biosynthesized using host cells. In specific embodiments, mRNA is produced by transcribing the corresponding DNA sequence using a host cell. In some embodiments, the DNA sequence encoding the mRNA sequence is incorporated into an expression vector using methods known in the art, and the vector is then introduced into a host cell (e.g., Escherichia coli). The host cell is then cultured under suitable conditions to produce mRNA transcripts. Other methods of producing mRNA molecules from coding DNA are known in the art. For example, in some embodiments, a cell-free (in vitro) transcription system comprising an enzyme of the transcriptional machinery of a host cell can be used to produce mRNA transcripts. An exemplary cell-free transcription reaction system is described in the present disclosure.

[0325] 5.4 Nanoparticle Composition

[0326] In one aspect, nucleic acid molecules as described herein are formulated for in vitro and in vivo delivery. In particular, in some embodiments, nucleic acid molecules are formulated to contain lipid compositions. In some embodiments, lipid compositions are formed to enclose nucleic acid molecules in lipid nanoparticles in lipid shells. In some embodiments, lipid shells protect nucleic acid molecules from degradation. In some embodiments, lipid nanoparticles also promote the transport of enclosed nucleic acid molecules to intracellular compartments and / or mechanisms to exert expected treatment or preventive functions. In certain embodiments, when present in lipid nanoparticles, nucleic acid resists degradation of nucleases in aqueous solution. Lipid nanoparticles comprising nucleic acids and methods for making the same are known in the art, such as those disclosed in, for example, U.S. Patent Publication No. 2004 / 0142025, U.S. Patent Publication No. 2007 / 0042031, PCT Publication No. WO 2017 / 004143, PCT Publication No. WO 2015 / 199952, PCT Publication No. WO 2013 / 016058, and PCT Publication No. WO 2013 / 086373, the complete disclosure of each of which is incorporated herein by reference in its entirety for all purposes.

[0327] In some embodiments, the maximum size of the nanoparticle composition provided herein is 1 μm or shorter (e.g., ≤1 μm, ≤900nm, ≤800nm, ≤700nm, ≤600nm, ≤500nm, ≤400nm, ≤300nm, ≤200nm, ≤175nm, ≤150nm, ≤125nm, ≤100nm, ≤75nm, ≤50nm or shorter), such as when measured by dynamic light scattering (DLS), transmission electron microscopy, scanning electron microscopy or another method. In one embodiment, the lipid nanoparticle provided herein has at least one dimension in the range of about 40nm to about 200nm. In one embodiment, the at least one dimension is in the range of about 40nm to about 100nm.

[0328] Nanoparticle compositions that can be used in conjunction with the present disclosure include, for example, lipid nanoparticles (LNPs), nanolipoprotein particles, liposomes, lipid vesicles, and lipid complexes. In some embodiments, the nanoparticle composition is a vesicle comprising one or more lipid bilayers. In some embodiments, the nanoparticle composition comprises two or more concentric bilayers separated by aqueous compartments. The lipid bilayers can be functionalized and / or cross-linked to each other. The lipid bilayer can include one or more ligands, proteins, or channels.

[0329] In some embodiments, the nanoparticle composition comprises a lipid component comprising at least one lipid, such as a compound according to one of lipid series 01, 02, 03, and 04 as described herein, for example, a compound according to one of formulas (01-I), (01-II), (02-I), (03-I), and (04-I) (and subformulae thereof). For example, in some embodiments, the nanoparticle composition may comprise a lipid component comprising one of the compounds provided herein. The nanoparticle composition may further comprise one or more other lipid or non-lipid components as described below.

[0330] 5.4.1 Cationic lipids

[0331] Cationic lipids include the following lipid series 01-04 (and subformulae thereof).

[0332] Lipid Series 01

[0333] In one embodiment, the cationic lipid contained is a cationic lipid described in International Patent Publication No. WO2021204175, the entire contents of which are incorporated herein by reference.

[0334] In one embodiment, provided herein is a compound of formula (01-I):

[0335]

[0336] or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof, wherein:

[0337] G 1 and G 2 Each independently is a bond, C2-C 12 Alkylene or C2-C 12 Alkenylene, wherein one or more -CH2- in the alkylene or alkenylene is optionally replaced by -O-;

[0338] L 1 Yes-OC(=O)R 1 、-C(=O)OR 1 、-OC(=O)OR 1 、-C(=O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(=O)SR 1 、-SC(=O)R 1 、-NR a C(=O)R 1 、-C(=O)NR b R c 、-NR a C(=O)NR b R c 、-OC(=O)NR b R c 、-NR a C(=O)OR 1 、-SC(=S)R 1 、-C(=S)SR 1 、-C(=S)R 1 、-CH(OH)R 1 、-P(=O)(OR b )(OR c )、-(C6-C 10 Arylene)-R 1 , -(6- to 10-membered heteroarylene)-R 1 or R 1 ;

[0339] L 2 Yes-OC(=O)R 2 、-C(=O)OR 2 、-OC(=O)OR 2 、-C(=O)R 2 、-OR 2 、-S(O) x R2 、-S-SR 2 、-C(=O)SR 2 、-SC(=O)R 2 、-NR d C(=O)R 2 、-C(=O)NR e R f 、-NR d C(=O)NR e R f 、-OC(=O)NR e R f 、-NR d C(=O)OR 2 、-SC(=S)R 2 、-C(=S)SR 2 、-C(=S)R 2 、-CH(OH)R 2 、-P(=O)(OR e )(OR f )、-(C6-C 10 Arylene)-R 2 , -(6- to 10-membered heteroarylene)-R 2 or R 2 ;

[0340] R 1 and R 2 Each independently is C6-C 32 Alkyl or C6-C 32 alkenyl;

[0341] R a , R b , R d and R e Each independently is H, C1-C 24 Alkyl or C2-C 24 alkenyl;

[0342] R c and R f Each independently is C1-C 32 Alkyl or C2-C 32 alkenyl;

[0343] G 3 It is C2-C 24 Alkylene, C2-C 24 Alkenylene, C3-C8 cycloalkylene or C3-C8 cycloalkenylene;

[0344] R 3 Yes-N(R 4 )R 5 ;

[0345] R 4 is a C3-C8 cycloalkyl, a C3-C8 cycloalkenyl, a 4- to 8-membered heterocyclic group or a C6-C 10 Aryl; or R 4 , G 3 or G 3 A portion of together with the nitrogen to which they are attached forms a ring portion;

[0346] R 5 It is C1-C 12 Alkyl or C3-C8 cycloalkyl; or R 4 , R 5 Together with the nitrogen to which they are attached they form a ring portion;

[0347] x is 0, 1, or 2; and

[0348] wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocyclyl, aryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, arylene, heteroarylene and cyclic moiety is independently optionally substituted.

[0349] In one embodiment, provided herein is a compound of formula (01-II):

[0350]

[0351] or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof, wherein:

[0352] is a single bond or a double bond;

[0353] G 1 and G 2 Each independently is a bond, C2-C 12 Alkylene or C2-C 12 Alkenylene, wherein one or more -CH2- in the alkylene or alkenylene is optionally replaced by -O-;

[0354] L 1 Yes-OC(=O)R 1 、-C(=O)OR 1 、-OC(=O)OR 1 、-C(=O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(=O)SR 1 、-SC(=O)R 1 、-NR a C(=O)R 1、-C(=O)NR b R c 、-NR a C(=O)NR b R c 、-OC(=O)NR b R c 、-NR a C(=O)OR 1 、-SC(=S)R 1 、-C(=S)SR 1 、-C(=S)R 1 、-CH(OH)R 1 、-P(=O)(OR b )(OR c )、-(C6-C 10 Arylene)-R 1 , -(6- to 10-membered heteroarylene)-R 1 or R 1 ;

[0355] L 2 Yes-OC(=O)R 2 、-C(=O)OR 2 、-OC(=O)OR 2 、-C(=O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(=O)SR 2 、-SC(=O)R 2 、-NR d C(=O)R 2 、-C(=O)NR e R f 、-NR d C(=O)NR e R f 、-OC(=O)NR e R f 、-NR d C(=O)OR 2 、-SC(=S)R 2 、-C(=S)SR 2 、-C(=S)R 2 、-CH(OH)R 2 、-P(=O)(OR e )(OR f )、-(C6-C 10 Arylene)-R 2 , -(6- to 10-membered heteroarylene)-R2 or R 2 ;

[0356] R 1 and R 2 Each independently is C6-C 32 Alkyl or C6-C 32 alkenyl;

[0357] R a , R b , R d and R e Each independently is H, C1-C 24 Alkyl or C2-C 24 alkenyl;

[0358] R c and R f Each independently is C1-C 32 Alkyl or C2-C 32 alkenyl;

[0359] G 4 Yes key, C1-C 23 Alkylene, C2-C 23 Alkenylene, C3-C8 cycloalkylene or C3-C8 cycloalkenylene;

[0360] R 3 Yes-N(R 4 )R 5 ;

[0361] R 4 It is C1-C 12 Alkyl, C3-C8 cycloalkyl, C3-C8 cycloalkenyl, 4- to 8-membered heterocyclic group or C6-C 10 Aryl; or R 4 , G 3 or pG 3 A portion of together with the nitrogen to which they are attached forms a ring portion;

[0362] R 5 It is C1-C 12 Alkyl or C3-C8 cycloalkyl; or R 4 , R 5 Together with the nitrogen to which they are attached they form a ring portion;

[0363] x is 0, 1, or 2; and

[0364] wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocyclyl, aryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, arylene, heteroarylene and cyclic moiety is independently optionally substituted.

[0365] In one embodiment, the compound is a compound in Table 01-1, or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

[0366] Table 01-1.

[0367]

[0368]

[0369] Lipid Series 02

[0370] In one embodiment, provided herein is a compound of formula (02-1):

[0371]

[0372] or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof, wherein:

[0373] G 1 and G 2 Each independently is C2-C 12 Alkylene or C2-C 12 Alkenylene, where G 1 and G 2 One or more -CH2- in is optionally replaced by -O-, -C(=O)O- or -OC(=O)-;

[0374] Each L 1 are independently -OC(=O)R 1 、-C(=O)OR 1 、-OC(=O)OR 1 、-C(=O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(=O)SR 1 、-SC(=O)R 1 、-NR a C(=O)R 1 、-C(=O)NR b R c 、-NR a C(=O)NR b R c 、-OC(=O)NR b R c 、-NR a C(=O)OR 1 、-SC(=S)R 1 、-C(=S)SR 1 、-C(=S)R1 、-CH(OH)R 1 、-P(=O)(OR b )(OR c ),-NR a P(=O)(OR b )(OR c );

[0375] Each L 2 are independently -OC(=O)R 2 、-C(=O)OR 2 、-OC(=O)OR 2 、-C(=O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(=O)SR 2 、-SC(=O)R 2 、-NR d C(=O)R 2 、-C(=O)NR e R f 、-NR d C(=O)NR e R f 、-OC(=O)NR e R f 、-NR d C(=O)OR 2 、-SC(=S)R 2 、-C(=S)SR 2 、-C(=S)R 2 、-CH(OH)R 2 、-P(=O)(OR e )(OR f ),-NR d P(=O)(OR e )(OR f );

[0376] R 1 and R 2 Each independently is C6-C 24 Alkyl or C6-C 24 alkenyl;

[0377] R a , R b , R d and R e Each independently is H, C1-C 24 Alkyl or C2-C 24 alkenyl;

[0378] R c and R f Each independently is C1-C 24 Alkyl or C2-C 24 alkenyl;

[0379] G 3 It is C2-C 12 Alkylene or C2-C 12 Alkenylene, wherein part or all of the alkylene or alkenylene groups are optionally replaced by C3-C8 cycloalkylene or C3-C8 cycloalkenylene;

[0380] R 3 Yes-N(R 4 )R 5 、-OR 6 or -SR 6 ;

[0381] R 4 It is C1-C 12 Alkyl, C2-C 12 C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C6-C 10 Aryl or 4- to 8-membered heterocycloalkyl;

[0382] R 5 Yes H, C1-C 12 Alkyl, C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C6-C 10 Aryl or 4- to 8-membered heterocycloalkyl;

[0383] R 6 is hydrogen, C1-C 12 Alkyl, C3-C8 cycloalkyl, C3-C8 cycloalkenyl or C6-C 10 Aryl;

[0384] x is 0, 1, or 2; and

[0385] wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, alkylene, alkenylene, cycloalkylene and cycloalkenylene is independently optionally substituted.

[0386] In one embodiment, the compound is a compound in Table 02-1, or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

[0387] Table 02-1.

[0388]

[0389] Lipid Series 03

[0390] In one embodiment, the cationic lipid contained is a cationic lipid described in International Patent Publication No. WO2022152109, the entire contents of which are incorporated herein by reference.

[0391] In one embodiment, provided herein is a compound of formula (03-I):

[0392]

[0393] or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof, wherein:

[0394] G 1 and G 2 Each independently is a bond, C2-C 12 Alkylene or C2-C 12 Alkenylene, where G 1 and G 2 One or more -CH2- in are optionally replaced by -O-;

[0395] Each L 1 are independently -OC(=O)R 1 、-C(=O)OR 1 、-OC(=O)OR 1 、-C(=O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(=O)SR 1 、-SC(=O)R 1 、-NR a C(=O)R 1 、-C(=O)NR b R c 、-NR a C(=O)NR b R c 、-OC(=O)NR b R c 、-NR a C(=O)OR 1 、-SC(=S)R 1 、-C(=S)SR 1 、-C(=S)R 1 、-CH(OH)R 1 、-P(=O)(OR b )(OR c ),-NR a P(=O)(OR b )(OR c )、-(C6-C10 Arylene)-R 1 , -(6- to 10-membered heteroarylene)-R 1 、-(4- to 8-membered heterocyclylene)-R 1 or R 1 ;

[0396] Each L 2 are independently -OC(=O)R 2 、-C(=O)OR 2 、-OC(=O)OR 2 、-C(=O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(=O)SR 2 、-SC(=O)R 2 、-NR d C(=O)R 2 、-C(=O)NR e R f 、-NR d C(=O)NR e R f 、-OC(=O)NR e R f 、-NR d C(=O)OR 2 、-SC(=S)R 2 、-C(=S)SR 2 、-C(=S)R 2 、-CH(OH)R 2 、-P(=O)(OR e )(OR f ),-NR d P(=O)(OR e )(OR f )、-(C6-C 10 Arylene)-R 2 , -(6- to 10-membered heteroarylene)-R 2 、-(4- to 8-membered heterocyclylene)-R 2 or R 2 ;

[0397] R 1 and R 2 Each independently is C6-C 24 Alkyl or C6-C 24 alkenyl;

[0398] R a , R b , Rd and R e Each independently is H, C1-C 24 Alkyl or C2-C 24 alkenyl;

[0399] R c and R f Each independently is C1-C 24 Alkyl or C2-C 24 alkenyl;

[0400] G 3 It is C2-C 12 Alkylene or C2-C 12 Alkenylene, wherein part or all of the alkylene or alkenylene is optionally replaced by C3-C8 cycloalkylene, C3-C8 cycloalkenylene, C3-C8 cycloalkynylene, 4- to 8-membered heterocyclylene, C6-C 10 arylene or 5- to 10-membered heteroarylene;

[0401] R 3 is hydrogen, C1-C 12 Alkyl, C2-C 12 Alkenyl, C2-C 12 Alkynyl, C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C3-C8 cycloalkynyl, 4- to 8-membered heterocyclic group, C6-C 10 aryl or 5- to 10-membered heteroaryl; or R 3 , G 1 or G 1 together with the nitrogen to which they are attached, form a cyclic moiety; or R 3 , G 3 or G 3 Together with the nitrogen to which they are attached, they form a ring

[0402] R 4 It is C1-C 12 Alkyl or C3-C8 cycloalkyl;

[0403] x is 0, 1, or 2;

[0404] n is 1 or 2;

[0405] m is 1 or 2; and

[0406] wherein each alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, heterocyclyl, aryl, heteroaryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, cycloalkynylene, heterocyclylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.

[0407] In one embodiment, the compound is a compound in Table 03-1, or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

[0408] Table 03-1.

[0409]

[0410] Lipid Series 04

[0411] In one embodiment, the cationic lipid contained is a cationic lipid described in International Patent Publication No. WO2022247755, the entire contents of which are incorporated herein by reference.

[0412] In one embodiment, provided herein is a compound of formula (04-I):

[0413]

[0414] (04-I),

[0415] or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof, wherein:

[0416] G 1 and G 2 Each independently is a bond, C2-C 12 Alkylene or C2-C 12 alkenylene;

[0417] L 1 Yes-OC(=O)R 1 、-C(=O)OR 1 、-OC(=O)OR 1 、-C(=O)R 1 、-OR 1 、-S(O) x R 1 、-S-SR 1 、-C(=O)SR 1 、-SC(=O)R 1 、-NR a C(=O)R 1 、-C(=O)NR b R c 、-NR a C(=O)NR b R c 、-OC(=O)NR b R c 、-NR a C(=O)OR 1 、-SC(=S)R 1 、-C(=S)SR 1、-C(=S)R 1 、-CH(OH)R 1 、-P(=O)(OR b )(OR c )、-(C6-C 10 Arylene)-R 1 , -(6- to 10-membered heteroarylene)-R 1 or R 1 ;

[0418] L 2 Yes-OC(=O)R 2 、-C(=O)OR 2 、-OC(=O)OR 2 、-C(=O)R 2 、-OR 2 、-S(O) x R 2 、-S-SR 2 、-C(=O)SR 2 、-SC(=O)R 2 、-NR d C(=O)R 2 、-C(=O)NR e R f 、-NR d C(=O)NR e R f 、-OC(=O)NR e R f 、-NR d C(=O)OR 2 、-SC(=S)R 2 、-C(=S)SR 2 、-C(=S)R 2 、-CH(OH)R 2 、-P(=O)(OR e )(OR f )、-(C6-C 10 Arylene)-R 2 , -(6- to 10-membered heteroarylene)-R 2 or R 2 ;

[0419] R 1 and R 2 Each independently is C5-C 32 Alkyl or C5-C 32 alkenyl;

[0420] R a , R b , R d and R eEach independently is H, C1-C 24 Alkyl or C2-C 24 alkenyl;

[0421] R c and R f Each independently is C1-C 32 Alkyl or C2-C 32 alkenyl;

[0422] R 0 It is C1-C 12 Alkyl, C2-C 12 C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C6-C 10 Aryl or 4- to 8-membered heterocycloalkyl;

[0423] G 3 It is C2-C 12 Alkylene or C2-C 12 alkenylene;

[0424] R 4 It is C1-C 12 Alkyl, C2-C 12 C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C6-C 10 Aryl or 4- to 8-membered heterocycloalkyl;

[0425] R 5 It is C1-C 12 Alkyl, C3-C8 cycloalkyl, C3-C8 cycloalkenyl, C6-C 10 Aryl or 4- to 8-membered heterocycloalkyl;

[0426] x is 0, 1, or 2.

[0427] s is 0 or 1; and

[0428] wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, alkylene, alkenylene, arylene and heteroarylene is independently optionally substituted.

[0429] In one embodiment, the compound is a compound in Table 04-1, or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.

[0430] Table 04-1.

[0431]

[0432]

[0433] It should be understood that any embodiment of the compound provided herein as stated above, and any specific substituent and / or variable of the compound provided herein as stated above can be independently combined with other embodiments and / or substituents and / or variables of the compound to form the above embodiments not specifically stated. In addition, in the case of listing the substituent and / or variable list of any specific group or variable, it should be understood that each individual substituent and / or variable can be deleted from specific embodiments and / or claims, and the remaining substituent and / or variable list will be considered to be within the scope of the embodiment provided herein.

[0434] It is understood that in the present specification, combinations of substituents and / or variables in the various formulae depicted are permissible only if such contributions result in stable compounds.

[0435] 5.4.2 Other ionizable lipids

[0436] As described herein, in some embodiments, the nanoparticle compositions provided herein include one or more charged or ionizable lipids in addition to compounds according to Series 01, 02, 03, and 04, such as lipids according to Formula (01-I), (01-II), (02-I), (03-I), and (04-I) (and subformulae thereof). Without being bound by theory, it is expected that certain charged or zwitterionic lipid components of the nanoparticle compositions are similar to lipid components in cell membranes, thereby improving cellular uptake of the nanoparticles. Exemplary charged or ionizable lipids that can form part of the nanoparticle compositions of the present invention include, but are not limited to, 3-(didodecylamino)-N1,N1,4-tridodecyl-1-piperazineethylamine (KL10), N1-[2-(didodecylamino)ethyl]-N1,N4,N4-tridodecyl-1,4-piperazinediethylamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraaza-trioctadecane (KL25), 1,2-dilinoleyloxy-N,N -dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), 4-(dimethylamino)butyric acid tritriacontahedral-6,9,28,31-tetraen-19-yl ester (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-dioleyloxy-N,N-dimethylaminopropane (DO DMA), 2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadec-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA), (2R)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadec-9,12-dien-1-yloxy]propan-1-amine (octyl-CLin DMA(2R)), (2S)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z-,12Z)-octadec-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA(2S)), (12Z,15Z)-N,N-dimethyl-2-nonylheneicosadeca-12,15-dien-1-amine, N,N-dimethyl-1-{(1S,2R)-2-octylcyclopropyl}heptadecan-8-amine.Additional exemplary charged or ionizable lipids that can form part of the nanoparticle compositions of the invention include lipids (e.g., lipid 5) described in Sabnis et al., “A Novel Amino Lipid Series form RNA Delivery: Improved Endosomal Escape and Sustained Pharmacology and Safety in Non-human Primates,” Molecular Therapy, Vol. 26, No. 6, 2018, the entire contents of which are incorporated herein by reference.

[0437] In some embodiments, suitable cationic lipids include N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA); N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP); 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine (DOEPC); 1,2-dilauroyl-sn-glycero-3-ethylphosphocholine (DLEPC); 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (DMEPC); 1,2-dimyristoleoyl-sn-glycero-3-ethylphosphocholine (14:1); N1-[2-((1S)-1-[(3-aminopropyl)amino]-4- [Bis(3-amino-propyl)amino]butylformamido)ethyl]-3,4-di[oleyloxy]-benzamide (MVL5); dioctadecylamido-glycyl tetramine (DOGS); 3b-[N-(N',N'-dimethylaminoethyl)carbamoyl]cholesterol (DC-Chol); dioctadecyldimethylammonium bromide (DDAB); SAINT-2,N-methyl-4-(dioleyl)methylpyridinium; 1,2-dimyristyloxypropyl-3-dimethylhydroxyethylammonium bromide (DMRIE); 1,2-dioleoyl-3-dimethyl-hydroxyethylammonium bromide (DORIE); 1,2-dioleoyloxypropyl-3-dimethylhydroxyethylammonium chloride (DORI); dialkylated amino acids (DILA 2)(e.g., C18:1-norArg-C16); dioleyldimethylammonium chloride (DODAC); 1-palmitoyl-2-oleoyl-sn-glycero-3-ethylphosphocholine (POEPC); 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (MOEPC); (R)-5-(dimethylamino)pentane-1,2-diyl dioleate hydrochloride (DODAPen-Cl); (R)-5-guanidinopentane-1,2-diyl dioleate hydrochloride (DOPen-G); and (R)-N,N,N-trimethyl-4,5-bis(oleoyloxy)pentan-1-amineium chloride (DOTAPen). Cationic lipids with charged head groups at physiological pH are also suitable, such as primary amines (e.g., DODAG N', N'-dioctadecyl-N-4,8-diaza-10-aminodecanoyl glycine amide) and guanidinium head groups (e.g., bis-guanidinium-spermtriamine-cholesterol (BGSC), bis-guanidinium-tren-cholesterol (BGTC), PONA, and (R)-5-guanidinopentane-1,2-diyl dioleate hydrochloride (DOPen-G)). Another suitable cationic lipid is (R)-5-(dimethylamino)pentane-1,2-diyl dioleate hydrochloride (DODAPen-Cl). In certain embodiments, the cationic lipid is a specific enantiomer or racemic form, and includes various salt forms (e.g., chlorides or sulfates) of the above cationic lipids. For example, in some embodiments, the cationic lipid is N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTAP-Cl) or N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium sulfate (DOTAP-sulfate). In some embodiments, the cationic lipid is an ionizable cationic lipid, such as dioctadecyl dimethyl ammonium bromide (DDAB); 1,2-dilinoleyloxy-3-dimethylaminopropane (DLinDMA); 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA); 4-(dimethylamino)butyric acid triheptadecanoyl-6,9,28,31-tetraen-19-yl ester (DLin-MC3-DMA); 1,2-dioleoyloxy-3-dimethylaminopropane (DODAP); 1,2-dioleyloxy-3-dimethylaminopropane (DODMA); and N-morpholinyl cholesterol (Mo-CHOL). In certain embodiments, the lipid nanoparticle comprises a combination of two or more cationic lipids (e.g., two or more of the above cationic lipids).

[0438] In addition, in some embodiments, the charged or ionizable lipids that may form part of the nanoparticle compositions of the present invention are lipids comprising cyclic amine groups. Additional cationic lipids suitable for the formulations and methods disclosed herein include those described in WO2015199952, WO2016176330, and WO2015011633, the entire contents of each of which are incorporated herein by reference in their entirety. In addition, in some embodiments, the charged or ionizable lipids that may form part of the nanoparticle compositions of the present invention are lipids comprising cyclic amine groups. Additional cationic lipids suitable for the formulations and methods disclosed herein include those described in WO2015199952, WO2016176330, and WO2015011633, the entire contents of each of which are incorporated herein by reference in their entirety.

[0439] 5.4.3 Polymer-bound lipids

[0440] In some embodiments, the lipid component of the nanoparticle composition may include one or more polymer-bound lipids, such as pegylated lipids (PEG lipids). Without being bound by theory, it is expected that the polymer-bound lipid component in the nanoparticle composition can improve colloidal stability and / or reduce the protein absorption of nanoparticles. The lipid bound by the exemplary polymers that can be used in conjunction with the present disclosure includes but is not limited to PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol and mixtures thereof. For example, PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, PEG-DSPE, ceramide-PEG2000 or Chol-PEG2000.

[0441] In one embodiment, the polymer-bound lipid is a pegylated lipid. For example, some embodiments include pegylated diacylglycerol (PEG-DAG), such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG); pegylated phosphatidylethanolamine (PEG-PE); PEG succinate diacylglycerol (PEG-S-DAG), such as 4-O-(2',3'-di-tetradecanoyloxy)propyl-1-O-(ω-methoxy(polyethoxy)ethyl)succinate (PEG-S-DMG); pegylated ceramide (PEG-cer); or PEG dialkoxypropyl carbamate, such as ω-methoxy(polyethoxy)ethyl-N-(2,3-di-tetradecanoyloxy)propyl)carbamate or 2,3-di-tetradecanoyloxy)propyl-N-(ω-methoxy)(polyethoxy)ethyl)carbamate.

[0442] In one embodiment, the polymer-bound lipid is present at a concentration within the range of 1.0 mol % to 2.5 mol %. In one embodiment, the polymer-bound lipid is present at a concentration of about 1.7 mol %. In one embodiment, the polymer-bound lipid is present at a concentration of about 1.5 mol %.

[0443] In one embodiment, the molar ratio of the cationic lipid to the polymer-bound lipid is in the range of about 35: 1 to about 25: 1. In one embodiment, the molar ratio of the cationic lipid to the polymer-bound lipid is in the range of about 100: 1 to about 20: 1.

[0444] In one embodiment, the molar ratio of the cationic lipid to the polymer-bound lipid is in the range of about 35: 1 to about 25: 1. In one embodiment, the molar ratio of the cationic lipid to the polymer-bound lipid is in the range of about 100: 1 to about 20: 1.

[0445] In one embodiment, the PEGylated lipid has the formula:

[0446]

[0447] or a pharmaceutically acceptable salt, tautomer or stereoisomer thereof, wherein:

[0448] R 12 and R 13 Each is independently a linear or branched saturated or unsaturated alkyl chain containing 10 to 30 carbon atoms, wherein the alkyl chain is optionally interrupted by one or more ester bonds; and

[0449] w has an average value in the range of 30 to 60. In one embodiment, R12 and R13 are each independently a linear saturated alkyl chain containing 12 to 16 carbon atoms. In other embodiments, w has an average value in the range of 42 to 55, for example, w has an average value of 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 or 55. In some specific embodiments, w has an average value of about 49.

[0450] In one embodiment, the PEGylated lipid has the formula:

[0451]

[0452] The average w is about 49.

[0453] Lipid Series 05

[0454] In one embodiment, provided herein is a compound of formula (05-I):

[0455]

[0456] (05-I),

[0457] or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:

[0458] L is lipid;

[0459] X is a linker;

[0460] Each R 3 are independently H or C1-C6 alkyl;

[0461] Each Y 1 are independently a bond, O, S or NR a ;

[0462] Each G 4 independently a bond or C1-C 12 Alkylene, wherein one or more -CH2- are independently optionally replaced by -O-, -S- or -NR a - Substitution;

[0463] Each G 5 independently a bond or C1-C 12 Alkylene, wherein one or more -CH2- are independently optionally replaced by -O-, -S- or -NR a - Substitution;

[0464] Each R a are independently H, C1-C 12 Alkyl or C2-C 12 alkenyl;

[0465] Z 1 and Z 2 One of them is positively charged, and Z 1 and Z 2 The other in is the negatively charged part;

[0466] n is an integer from 2 to 100;

[0467] T is hydrogen, halogen, alkyl, alkenyl, -OR", -SR", -COOR", -OCOR", -NR"R", -N + (R”)3, -P + (R")3, -SC(=S)-SR", -SC(=S)-OR", -SC(=S)-NR"R", -SC(=S)-aryl, cyano, azido, aryl, heteroaryl or targeting group, wherein R" is independently hydrogen or alkyl at each occurrence; and wherein each alkyl, alkenyl, alkylene, aryl and heteroaryl is independently optionally substituted.

[0468] 5.4.4 Structural lipids

[0469] In some embodiments, the lipid component of the nanoparticle composition may include one or more structural lipids. Without being bound by theory, it is expected that the structural lipids can stabilize the amphiphilic structure of the nanoparticle, such as but not limited to the lipid bilayer structure of the nanoparticle. Exemplary structural lipids that can be used in conjunction with the present disclosure include but are not limited to cholesterol, coprosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, tomatine, ursolic acid, alpha-tocopherol and mixtures thereof. In certain embodiments, the structural lipid is cholesterol. In some embodiments, the structural lipid includes cholesterol and corticosteroids (such as prednisolone, dexamethasone, prednisone and hydrocortisone) or a combination thereof.

[0470] In one embodiment, the lipid nanoparticle provided herein comprises a steroid or a steroid analog. In one embodiment, a steroid or a steroid analog is cholesterol. In one embodiment, a steroid exists with a concentration within the range of 39 mol % to 49 mol %, 40 mol % to 46 mol %, 40 mol % to 44 mol %, 40 mol % to 42 mol %, 42 mol % to 44 mol % or 44 mol % to 46 mol %. In one embodiment, a steroid exists with a concentration of 40 mol %, 41 mol %, 42 mol %, 43 mol %, 44 mol %, 45 mol % or 46 mol %.

[0471] In one embodiment, the molar ratio of cationic lipid to steroid is in the range of 1.0:0.9 to 1.0:1.2, or 1.0:1.0 to 1.0:1.2. In one embodiment, the molar ratio of cationic lipid to cholesterol is in the range of about 5:1 to 1:1. In one embodiment, the steroid is present at a concentration in the range of 32 mol% to 40 mol% steroid.

[0472] In one embodiment, the molar ratio of cationic lipid to steroid is in the range of 1.0:0.9 to 1.0:1.2, or 1.0:1.0 to 1.0:1.2. In one embodiment, the molar ratio of cationic lipid to cholesterol is in the range of about 5:1 to 1:1. In one embodiment, the steroid is present at a concentration in the range of 32 mol% to 40 mol% steroid.

[0473] 5.4.5 Phospholipids

[0474] In some embodiments, the lipid component of the nanoparticle composition may include one or more phospholipids, such as one or more (poly)unsaturated lipids. Without being bound by theory, it is expected that the phospholipids can assemble into one or more lipid bilayer structures. Exemplary phospholipids that can form part of the nanoparticle compositions of the present invention include, but are not limited to, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0Diether PC), 1-oleoyl-2-cholesteryl hemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16Lyso PC), 1,2-dialinolenoyl-sn-glycero-3-phosphocholine, 1,2-arachidonoyl-sn-glycero-3-phosphocholine, 1,2-di(docosahexaenoyl)-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-di(docosahexaenoyl)-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-racem-(1-glycerol) sodium salt (DOPG) and sphingomyelin. In certain embodiments, the nanoparticle composition comprises DSPC. In certain embodiments, the nanoparticle composition comprises DOPE. In some embodiments, the nanoparticle composition comprises both DSPC and DOPE.

[0475] Additional exemplary neutral lipids include, for example, dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylethanolamine (POPE) and dioleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoylphosphatidylethanolamine (SOPE) and 1,2-ditransoleoyl-sn-glycero-3-phosphoethanolamine (trans-DOPE). In one embodiment, the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC). In one embodiment, the neutral lipid is selected from the group consisting of DSPC, DPPC, DMPC, DOPC, POPC, DOPE and SM.

[0476] In one embodiment, the neutral lipid is phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylserine (PS), phosphatidic acid (PA), or phosphatidylglycerol (PG).

[0477] In addition, phospholipids that may form part of the nanoparticle compositions of the present invention also include those described in WO2017 / 112865, the entire contents of which are incorporated herein by reference in their entirety.

[0478] 5.4.6 Preparation

[0479] According to the present disclosure, the nanoparticle compositions described herein may include at least one lipid component and one or more additional components, such as therapeutic and / or prophylactic agents (e.g., therapeutic nucleic acids described herein). The nanoparticle compositions may be designed for one or more specific applications or targets. The ingredients of the nanoparticle compositions may be selected based on a specific application or target, and / or based on the efficacy, toxicity, cost, ease of use, availability, or other characteristics of one or more ingredients. Similarly, the specific formulation of the nanoparticle composition may be selected for a specific application or target, based on, for example, the efficacy and toxicity of a specific combination of each ingredient.

[0480] The nanoparticle composition is an aqueous formulation or a frozen formulation thereof (e.g., an aqueous formulation stored at about -20°C or lower, such as about -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, or -80°C).

[0481] The lipid component of the nanoparticle composition may include, for example, lipids according to one of series 01, 02, 03 and 04, for example compounds according to one of formulas (01-I), (01-II), (02-I), (03-I) and (04-I) (and subformulas thereof), phospholipids (such as unsaturated lipids, for example DOPE or DSPC), PEG lipids and structural lipids. The ingredients of the lipid component may be provided in specific fractions.

[0482] In one embodiment, provided herein is a nanoparticle composition comprising a cationic or ionizable lipid compound, a therapeutic agent, and one or more excipients as provided herein. In one embodiment, the cationic or ionizable lipid compound comprises a compound according to series 01, 02, 03, and 04 as described herein, for example, a compound according to one of formulas (01-I), (01-II), (02-I), (03-I), and (04-I) (and its subformula), and optionally one or more other ionizable lipid compounds. In one embodiment, one or more excipients are selected from neutral lipids, steroids, and polymer-bound lipids as described herein. In one embodiment, the therapeutic agent is encapsulated in or associated with lipid nanoparticles.

[0483] In one embodiment, provided herein is a nanoparticle composition (lipid nanoparticle) comprising:

[0484] i) a cationic lipid (ie, a first lipid);

[0485] ii) neutral lipids (e.g., phospholipids);

[0486] iii) steroids;

[0487] iv) a polymer-bound lipid (ie, a second lipid); and

[0488] v) Therapeutic agents.

[0489] As used herein, "mol %" refers to the molar percentage of a component relative to the total moles of all lipid components in the LNP (ie, the total moles of cationic lipids, neutral lipids, steroids, and polymer-bound lipids).

[0490] In one embodiment, the lipid nanoparticle comprises about 20 mol % to about 65 mol %, about 30 mol % to about 60 mol %, about 40 mol % to about 55 mol %, 45 mol % to 50 mol %, 50 mol % to 55 mol %, 55 mol % to 60 mol %, 60 mol % to 65 mol %, 40 mol % to 45 mol %, 35 mol % to 40 mol %, 30 mol % to 35 mol %, 25 mol % to 30 mol % or 20 mol % to 25 mol % of cationic lipid. In one embodiment, the lipid nanoparticle comprises about 40 mol %, 41 mol %, 42 mol %, 43 mol %, 44 mol %, 45 mol %, 46 mol %, 47 mol %, 48 mol %, 49 mol %, 50 mol %, 51 mol %, 52 mol %, 53 mol %, 54 mol % or 55 mol % of cationic lipid. In one embodiment, the lipid nanoparticle comprises about 47.5 mol%, 47.6 mol%, 47.7 mol%, 47.8 mol%, 47.9 mol%, 48.0 mol%, 48.1 mol%, 48.2 mol%, 48.3 mol%, 48.4 mol% or 48.5 mol% of cationic lipid. In one embodiment, the lipid nanoparticle comprises about 48.0 mol% of cationic lipid.

[0491] In one embodiment, neutral lipid (for example, phospholipid) exists with the concentration in the range of about 5 mol% to about 40 mol%, 6 mol% to 30 mol%, about 7 mol% to about 20 mol% or 8 mol% to 15 mol%. In one embodiment, neutral lipid (for example, phospholipid) exists with the concentration of about 5 mol%, 6 mol%, 7 mol%, 8 mol%, 9 mol%, 10 mol%, 11 mol%, 12 mol%, 13 mol%, 14 mol% or 15 mol%. In one embodiment, neutral lipid (for example, phospholipid) exists with the concentration of about 9.5 mol%, 10 mol% or 10.5 mol%. In one embodiment, lipid nanoparticle comprises about 9.5 mol%, 9.6 mol%, 9.7 mol%, 9.8 mol%, 9.9 mol%, 10.0 mol%, 10.1 mol%, 10.2 mol%, 10.3 mol%, 10.4 mol% or 10.5 mol% phospholipid. In one embodiment, lipid nanoparticles include about 10.0 mol % of phospholipids. In one embodiment, the molar ratio of cationic lipids to neutral lipids (e.g., phospholipids) is in the range of about 13:1 to about 1:2, about 10:1 to about 5:1 or about 7.5:1 to 5:1. In one embodiment, the molar ratio of cationic lipids to neutral lipids (e.g., phospholipids) is 7.5:1, 7.25:1, 7.0:1, 6.75:1, 6.5:1, 6.25:1, 6.0:1, 5.75:1, 5.5:1, 5.25:1 or 5.0:1. In one embodiment, the molar ratio of cationic lipids to neutral lipids (e.g., phospholipids) is in the range of about 4.1:1.0 to about 4.9:1.0, about 4.5:1.0 to about 4.8:1.0 or about 4.7:1.0 to 4.8:1.0.

[0492] In one embodiment, steroid exists with the concentration in the scope of about 20 mol % to about 50 mol %, about 30 mol % to about 45 mol %, about 35 mol % to about 43 mol %, 37 mol % to 42 mol %, 30 mol % to 35 mol %, 35 mol % to 40 mol %, 40 mol % to 45 mol % or 45 mol % to 50 mol %. In one embodiment, steroid exists with the concentration of 35 mol %, 36 mol %, 37 mol %, 48 mol %, 39 mol %, 40 mol %, 41 mol %, 42 mol %, 43 mol %, 44 mol % or 45 mol %. In one embodiment, the mol ratio of cationic lipid and steroid is in the scope of 1.0:0.9 to 1.0:1.2 or 1.0:1.0 to 1.0:1.2. In one embodiment, the lipid nanoparticle comprises about 40.0 mol%, 40.1 mol%, 40.2 mol%, 40.3 mol%, 40.4 mol%, 40.5 mol%, 40.6 mol%, 40.7 mol%, 40.8 mol%, 40.9 mol% or 41.0 mol% of the steroid. In one embodiment, the lipid nanoparticle comprises about 40.5 mol% of the steroid.

[0493] In one embodiment, the polymer-bound lipid is present in a concentration within the range of about 0.1 mol % to about 10 mol %, about 0.2 mol % to about 7.5 mol %, 0.3 mol % to 5 mol %, 0.4 mol % to 2.5 mol %, 0.5 mol % to 2 mol % or 1 mol % to 2 mol %. In one embodiment, the polymer-bound lipid is present in a concentration of 0.5 mol %, 0.75 mol %, 1 mol %, 1.25 mol %, 1.5 mol %, 1.75 mol %, 2 mol %, 2.25 mol % or 2.5 mol %. In one embodiment, the lipid nanoparticle comprises the polymer-bound lipid of about 1.0 mol %, 1.1 mol %, 1.2 mol %, 1.3 mol %, 1.4 mol %, 1.5 mol %, 1.6 mol %, 1.7 mol %, 1.8 mol %, 1.9 mol % or 2.0 mol %. In one embodiment, the lipid nanoparticle comprises the polymer-bound lipid of about 1.5 mol %.

[0494] In one embodiment, the ratio of therapeutic agent to lipid in the LNP (i.e., N / P, where N represents the number of moles of cationic lipid and P represents the number of moles of phosphate present as part of the nucleic acid backbone) is in the range of 2: 1 to 30: 1, for example, in the range of 3: 1 to 22: 1. In one embodiment, N / P is in the range of 6: 1 to 20: 1 or 2: 1 to 12: 1. Exemplary N / P ranges include about 3: 1, about 6: 1, about 12: 1, and about 22: 1.

[0495] In one embodiment, provided herein is a lipid nanoparticle comprising:

[0496] i) a cationic lipid having an effective pKa greater than 6.0 (ie, a first lipid);

[0497] ii) 5 mol% to 15 mol% of neutral lipids (e.g., phospholipids);

[0498] iii) 1 mol % to 15 mol % of anionic lipids;

[0499] iv) 30 mol% to 45 mol% of a steroid;

[0500] v) 0.5 mol % to 3 mol % of a polymer-bound lipid (ie, a second lipid); and

[0501] vi) a therapeutic agent or a pharmaceutically acceptable salt or prodrug thereof, wherein the mole % is determined based on the total moles of lipid present in the lipid nanoparticle.

[0502] In one embodiment, the cationic lipid can be any of a variety of lipid species with a net positive charge at a selected pH, such as a physiological pH. Exemplary cationic lipids are described below. In one embodiment, the pKa value of the cationic lipid is greater than 6.25. In one embodiment, the cationic lipid has a pKa greater than 6.5. In one embodiment, the pKa value of the cationic lipid is greater than 6.1, greater than 6.2, greater than 6.3, greater than 6.35, greater than 6.4, greater than 6.45, greater than 6.55, greater than 6.6, greater than 6.65 or greater than 6.7.

[0503] In one embodiment, the lipid nanoparticle comprises 40 mol% to 45 mol% of the cationic lipid. In one embodiment, the lipid nanoparticle comprises 45 mol% to 50 mol% of the cationic lipid.

[0504] In one embodiment, the molar ratio of cationic lipid to neutral lipid ranges from about 2: 1 to about 8: 1. In one embodiment, the lipid nanoparticles comprise 5 mol% to 10 mol% neutral lipid.

[0505] Exemplary anionic lipids include, but are not limited to, phosphatidylglycerol, dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), or 1,2-distearoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DSPG).

[0506] In one embodiment, the lipid nanoparticle comprises 1 mol % to 10 mol % of anionic lipids. In one embodiment, the lipid nanoparticle comprises 1 mol % to 5 mol % of anionic lipids. In one embodiment, the lipid nanoparticle comprises 1 mol % to 9 mol %, 1 mol % to 8 mol %, 1 mol % to 7 mol % or 1 mol % to 6 mol % of anionic lipids. In one embodiment, the molar ratio of anionic lipids to neutral lipids is in the range of 1:1 to 1:10.

[0507] In one embodiment, the steroid is cholesterol. In one embodiment, the molar ratio of cationic lipid to cholesterol is in the range of about 5:1 to 1:1. In one embodiment, the lipid nanoparticles comprise 32 mol% to 40 mol% of the steroid.

[0508] In one embodiment, the sum of the mol% of neutral lipids and the mol% of anionic lipids is in the range of 5 mol% to 15 mol%. In one embodiment, the sum of the mol% of neutral lipids and the mol% of anionic lipids is in the range of 7 mol% to 12 mol%.

[0509] In one embodiment, the molar ratio of anionic lipid to neutral lipid is in the range of 1: 1 to 1: 10. In one embodiment, the sum of the molar % of neutral lipid and the molar % of steroid is in the range of 35 molar % to 45 molar %.

[0510] In one embodiment, the lipid nanoparticle comprises:

[0511] i) about 20 mol % to about 65 mol % of a cationic lipid (i.e., a first lipid);

[0512] ii) from about 5 mol % to about 40 mol % of phospholipids;

[0513] iii) from about 20 mole % to about 50 mole % of a steroid; and

[0514] iv) a polymer-bound lipid (ie, a second lipid).

[0515] In one embodiment, the lipid nanoparticle comprises:

[0516] i) about 40 mol % to about 55 mol % of a cationic lipid (i.e., a first lipid);

[0517] ii) from about 5 mol % to about 15 mol % of phospholipids;

[0518] iii) from about 35 mol % to about 50 mol % of a steroid; and

[0519] iv) about 2 mol % to about 10 mol % of a polymer-bound lipid (ie, a second lipid).

[0520] In one embodiment, the lipid nanoparticle comprises:

[0521] i) about 45 mol % to about 55 mol % of a cationic lipid (i.e., a first lipid);

[0522] ii) from about 6 mol % to about 10 mol % of phospholipids;

[0523] iii) from about 40 mol % to about 48 mol % of a steroid; and

[0524] iv) about 1 mol % to about 2.5 mol % of a polymer-bound lipid (ie, a second lipid).

[0525] In one embodiment, the lipid nanoparticles comprise 1.0 mol% to 2.5 mol% polymer-bound lipid.

[0526] In one embodiment, the neutral lipid is present at a concentration in the range of 5 mol % to 15 mol %, 7 mol % to 13 mol % or 9 mol % to 11 mol %. In one embodiment, the neutral lipid is present at a concentration of about 9.5 mol %, 10 mol % or 10.5 mol %. In one embodiment, the molar ratio of cationic lipid to neutral lipid is in the range of about 4.1: 1.0 to about 4.9: 1.0, about 4.5: 1.0 to about 4.8: 1.0 or about 4.7: 1.0 to 4.8: 1.0.

[0527] In one embodiment, steroid is cholesterol.In some embodiments, steroid exists with the concentration in the scope of 39 mol % to 49 mol %, 40 mol % to 46 mol %, 40 mol % to 44 mol %, 40 mol % to 42 mol %, 42 mol % to 44 mol % or 44 mol % to 46 mol %.In one embodiment, steroid exists with the concentration of about 40 mol %, 40.5 mol %, 41 mol %, 41.5 mol %, 42 mol %, 42.5 mol %, 43 mol %, 43.5 mol %, 44 mol %, 44.5 mol %, 45 mol %, 45.5 mol % or 46 mol %.In certain embodiments, the molar ratio of cationic lipid and steroid is in the scope of 1.0:0.9 to 1.0:1.2 or 1.0:1.0 to 1.0:1.2.

[0528] In one embodiment, the molar ratio of cationic lipid to steroid is in the range of 5:1 to 1:1.

[0529] In one embodiment, the lipid nanoparticle comprises 1.0 mol% to 2.5 mol% polymer-bound lipid. In one embodiment, the polymer-conjugated lipid is present at a concentration of about 1.5 mol%.

[0530] In one embodiment, the molar ratio of the cationic lipid to the polymer-bound lipid is in the range of about 100: 1 to about 20: 1. In one embodiment, the molar ratio of the cationic lipid to the polymer-bound lipid is in the range of about 35: 1 to about 25: 1.

[0531] In one embodiment, the molar ratio of the cationic lipid to the polymer-bound lipid is in the range of about 100: 1 to about 20: 1. In one embodiment, the molar ratio of the cationic lipid to the polymer-bound lipid is in the range of about 35: 1 to about 25: 1.

[0532] In one embodiment, the average diameter of the lipid nanoparticles is in the range of 50 nm to 100 nm or 60 nm to 85 nm.

[0533] In one embodiment, compositions comprise cationic lipid, DSPC, cholesterol and PEG-lipid provided herein, and mRNA.In one embodiment, cationic lipid, DSPC, cholesterol and PEG-lipid provided herein are in the molar ratio of about 50:10:38.5:1.5.

[0534] Nanoparticle compositions can be designed for one or more specific applications or targets. For example, nanoparticle compositions can be designed for delivering therapeutic and / or prophylactic agents, such as RNA, to specific cells, tissues, organs or systems or groups thereof in mammals. The physicochemical properties of nanoparticle compositions can be changed to increase selectivity for specific body targets. For example, the particle size can be adjusted based on the window size of different organs. The therapeutic and / or prophylactic agents contained in the nanoparticle compositions can also be selected based on one or more desired delivery targets. For example, therapeutic and / or prophylactic agents can be selected for specific indications, illnesses, diseases or conditions and / or for delivery to specific cells, tissues, organs or systems or groups thereof (e.g., local or specific delivery). In certain embodiments, nanoparticle compositions can include mRNA encoding a polypeptide of interest, which can be translated intracellularly to produce a polypeptide of interest. Such compositions can be designed to be specifically delivered to a specific organ. In certain embodiments, the composition can be designed to be specifically delivered to the liver of a mammal.

[0535] The amount of therapeutic and / or preventive agents in the nanoparticle composition can depend on the size, composition, desired target and / or application of the nanoparticle composition, or other characteristics, and the characteristics of the therapeutic and / or preventive agents. For example, the amount of RNA that can be used in the nanoparticle composition can depend on the size, sequence and other characteristics of the RNA. The relative amount of therapeutic and / or preventive agents and other ingredients (such as lipids) in the nanoparticle composition can also vary. In some embodiments, the wt / wt ratio of lipid components and therapeutic and / or preventive agents in the nanoparticle composition can be about 5:1 to about 60:1, such as about 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 22:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1 and 60:1. For example, the wt / wt ratio of the lipid component to the therapeutic and / or prophylactic agent can be about 10: 1 to about 40: 1. In certain embodiments, the wt / wt ratio is about 20: 1. The amount of the therapeutic and / or prophylactic agent in the nanoparticle composition can be measured, for example, using absorption spectroscopy (e.g., UV-visible spectroscopy).

[0536] In some embodiments, the nanoparticle composition comprises one or more RNAs, and one or more RNAs, lipids and amounts thereof can be selected to provide a specific N:P ratio. The N:P ratio of the composition refers to the molar ratio of the number of nitrogen atoms in one or more lipids to the number of phosphate groups in the RNA. In some embodiments, a lower N:P ratio is selected. One or more RNAs, lipids and amounts thereof can be selected to provide an N:P ratio of about 2:1 to about 30:1, such as 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 12:1, 14:1, 16:1, 18:1, 20:1, 22:1, 24:1, 26:1, 28:1 or 30:1. In certain embodiments, the N:P ratio can be about 2:1 to about 8:1. In other embodiments, the N:P ratio is about 5:1 to about 8:1. For example, the N:P ratio can be about 5.0: 1, about 5.5: 1, about 5.67: 1, about 6.0: 1, about 6.5: 1, or about 7.0: 1. For example, the N:P ratio can be about 5.67:1.

[0537] The physical properties of a nanoparticle composition can depend on its components. For example, a nanoparticle composition comprising cholesterol as a structural lipid can have different characteristics than a nanoparticle composition comprising a different structural lipid. Similarly, the characteristics of a nanoparticle composition can depend on the absolute or relative amounts of its components. For example, a nanoparticle composition comprising a higher mole fraction of phospholipids can have different characteristics than a nanoparticle composition comprising a lower mole fraction of phospholipids. Characteristics can also vary depending on the method and conditions of preparation of the nanoparticle composition.

[0538] Nanoparticle compositions can be characterized by a variety of methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of nanoparticle compositions. Zeta potential can be measured using dynamic light scattering or potentiometric methods (e.g., potentiometric titration). Dynamic light scattering can also be used to determine particle size. Instruments such as Zetasizer Nano ZS (Malvem Instruments Ltd, Malvem, Worcestershire, UK) can also be used to measure multiple features of nanoparticle compositions, such as particle size, polydispersity index, and zeta potential.

[0539] In various embodiments, the average size of the nanoparticle composition can be between tens of nanometers and hundreds of nanometers. For example, the average size can be about 40nm to about 150nm, such as about 40nm, 45nm, 50nm, 55nm, 60nm, 65nm, 70nm, 75nm, 80nm, 85nm, 90nm, 95nm, 100nm, 105nm, 110nm, 115nm, 120nm, 125nm, 130nm, 135nm, 140nm, 145nm or 150nm. In some embodiments, the average size of the nanoparticle composition may be from about 50nm to about 100nm, from about 50nm to about 90nm, from about 50nm to about 80nm, from about 50nm to about 70nm, from about 50nm to about 60nm, from about 60nm to about 100nm, from about 60nm to about 90nm, from about 60nm to about 80nm, from about 60nm to about 70nm, from about 70nm to about 100nm, from about 70nm to about 90nm, from about 70nm to about 80nm, from about 80nm to about 100nm, from about 80nm to about 90nm, or from about 90nm to about 100nm. In certain embodiments, the average size of the nanoparticle composition may be from about 70nm to about 100nm. In some embodiments, the average size may be about 80nm. In other embodiments, the average size may be about 100nm.

[0540] The nanoparticle composition can be relatively homogeneous. The polydispersity index can be used to indicate the uniformity of the nanoparticle composition, such as the particle size distribution of the nanoparticle composition. A small (e.g., less than 0.3) polydispersity index generally indicates a narrow particle size distribution. The nanoparticle composition can have a polydispersity index of about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24 or 0.25. In some embodiments, the polydispersity index of the nanoparticle composition can be about 0.10 to about 0.20.

[0541] The zeta potential of a nanoparticle composition can be used to indicate the zeta potential of the composition. For example, the zeta potential can describe the surface charge of a nanoparticle composition. Nanoparticle compositions with relatively low positive or negative charges are generally desirable because higher charged materials can interact undesirably with cells, tissues, and other components in the body. In some embodiments, the zeta potential of the nanoparticle composition may be from about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, about -10 mV to about +5 mV, about -10 mV to about 0 mV, about -10 mV to about -5 mV, about -5 mV to about +20 mV, about -5 mV to about +15 mV, about -5 mV to about +10 mV, about -5 mV to about +5 mV, about -5 mV to about 0 mV, about 0 mV to about +20 mV, about 0 mV to about +15 mV, about 0 mV to about +10 mV, about 0 mV to about +5 mV, about +5 mV to about +20 mV, about +5 mV to about +15 mV, or about +5 mV to about +10 mV.

[0542] The encapsulation efficiency of therapeutic and / or prophylactic agents describes the amount of therapeutic and / or prophylactic agents encapsulated or otherwise associated with nanoparticle compositions after preparation relative to the initial amount provided. It is desirable that the encapsulation efficiency is high (e.g., close to 100%). The encapsulation efficiency can be measured, for example, by comparing the amount of therapeutic and / or prophylactic agents in a solution containing nanoparticle compositions before and after the nanoparticle compositions are destroyed with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free therapeutic and / or prophylactic agents (e.g., RNA) in a solution. For nanoparticle compositions described herein, the encapsulation efficiency of therapeutic and / or prophylactic agents can be at least 50%, e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In certain embodiments, the encapsulation efficiency may be at least 90%.

[0543] The nanoparticle composition may optionally include one or more coatings. For example, the nanoparticle composition may be formulated into a capsule, film, or tablet having a coating. The capsule, film, or tablet containing the composition described herein may have any useful size, tensile strength, hardness, or density.

[0544] 5.4.7 Pharmaceutical Compositions

[0545] According to the present disclosure, the nanoparticle composition can be formulated in whole or in part as a pharmaceutical composition. The pharmaceutical composition can include one or more nanoparticle compositions disclosed herein. For example, the pharmaceutical composition can include one or more nanoparticle compositions, and the one or more nanoparticle compositions include one or more different therapeutic agents and / or preventive agents. The pharmaceutical composition may also include one or more pharmaceutically acceptable excipients or auxiliary ingredients, such as those described herein. General guidelines for the preparation and manufacture of pharmaceutical compositions and agents can be found in, for example, Remington's The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro; Lippincott, Williams & Wilkins, Baltimore, Md., 2006. Conventional excipients and auxiliary ingredients can be used in any pharmaceutical composition, unless any conventional excipient or auxiliary ingredient is incompatible with one or more components of the nanoparticle composition. If the combination of the excipient or auxiliary ingredient with the components of the nanoparticle composition will result in any undesirable biological effect or other harmful effect, the excipient or auxiliary ingredient is incompatible with the components of the nanoparticle composition.

[0546] In some embodiments, the one or more excipients or auxiliary ingredients may constitute more than 50% of the total mass or volume of the pharmaceutical composition comprising the nanoparticle composition. For example, the one or more excipients or auxiliary ingredients may constitute 50%, 60%, 70%, 80%, 90% or higher percentages of the pharmaceutical convention. In some embodiments, the pharmaceutically acceptable excipient is at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% pure. In some embodiments, the excipient is approved for human and veterinary use. In some embodiments, the excipient is approved by the U.S. Food and Drug Administration. In some embodiments, the excipient is pharmaceutical grade. In some embodiments, the excipient meets the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia and / or the International Pharmacopoeia.

[0547] The relative amounts of one or more nanoparticle compositions, one or more pharmaceutically acceptable excipients, and / or any additional ingredients in a pharmaceutical composition according to the present disclosure will vary depending on the identity, size, and / or condition of the subject being treated and further on the route of administration of the composition. For example, a pharmaceutical composition may include between 0.1% and 100% (wt / wt) of one or more nanoparticle compositions.

[0548] In some embodiments, nanoparticle compositions and / or pharmaceutical compositions of the present disclosure are stored and / or transported refrigerated or frozen (for example, stored at 4°C or lower, such as between about -150°C and about 0°C, or between about -80°C and about -20°C (for example, about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C)). For example, a pharmaceutical composition comprising a compound according to Series 01, 02, 03 and 04, e.g., a compound of any of Formulas (01-I), (01-II), (02-I), (03-I) and (04-I) (and subformulae thereof) is a solution for storage and / or transportation refrigerated at, e.g., about -20°C, 30°C, -40°C, -50°C, -60°C, -70°C or -80°C. In certain embodiments, the disclosure is also directed to a method of increasing the stability of a nanoparticle composition and / or a pharmaceutical composition comprising a compound according to Series 01, 02, 03, and 04, e.g., a compound of any of Formula (01-I), (01-II), (02-I), (03-I), and (04-I) (and subformulae thereof), by storing the nanoparticle composition and / or the pharmaceutical composition at a temperature of 4°C or lower, such as between about -150°C and about 0°C or between about -80°C and about -20°C (e.g., about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C). For example, nanoparticle compositions and / or pharmaceutical compositions disclosed herein are stable for about at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 1 month, at least 2 months, at least 4 months, at least 6 months, at least 8 months, at least 10 months, at least 12 months, at least 14 months, at least 16 months, at least 18 months, at least 20 months, at least 22 months, or at least 24 months at a temperature of, for example, 4° C. or less (e.g., between about 4° C. and -20° C.). In one embodiment, the formulation is stable for at least 4 weeks at about 4° C.

[0549] In certain embodiments, the pharmaceutical compositions of the present disclosure comprise a nanoparticle composition disclosed herein and a pharmaceutically acceptable carrier selected from one or more of the following: Tris, acetate (e.g., sodium acetate), citrate (e.g., sodium citrate), saline, PBS, and sucrose. In certain embodiments, the pH value of the pharmaceutical compositions of the present disclosure is between about 7 and 8 (e.g., 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0, or between 7.5 and 8, or between 7 and 7.8). In certain embodiments, the pharmaceutical compositions of the present disclosure comprise a nanoparticle composition disclosed herein, Tris, saline, and sucrose, and have a pH of about 7.5-8, which is suitable for storage and / or transportation at, for example, about -20°C. For example, the pharmaceutical compositions of the present disclosure comprise a nanoparticle composition disclosed herein and PBS, and have a pH of about 7-7.8, suitable for storage or transportation at, for example, about 4°C or lower. In the context of the present disclosure, "stability", "stabilized" and "stable" refer to the resistance of the nanoparticle compositions and / or pharmaceutical compositions disclosed herein to chemical or physical changes (e.g., degradation, particle size changes, aggregation, changes in encapsulation, etc.) under given manufacturing, preparation, transportation, storage and / or use conditions, for example, when stress is applied, such as shear force, freeze / thaw stress, etc.

[0550] In some embodiments, a pharmaceutical composition of the present disclosure (eg, an aqueous composition or a frozen composition) comprises a nanoparticle composition disclosed herein and a buffer. Representative buffers include, but are not limited to, acetic acid, adipic acid, aqueous ammonia, ammonium phosphate, ammonium sulfate, arginine, asparagine, boric acid, calcium carbonate, calcium lactate, tricalcium phosphate, citric acid monohydrate, dipotassium hydrogen phosphate, disodium hydrogen phosphate, diethanolamine, glycine, histidine, hydroxyethylpiperazineethanesulfonic acid, lysine acetate, lysine hydrochloride, maleic acid, malic acid, meglumine, methionine, sodium dihydrogen phosphate, monoethanolamine, monosodium glutamate, phosphoric acid, potassium citrate, potassium metaphosphate, sodium acetate, sodium bicarbonate, sodium borate, sodium carbonate, sodium citrate, sodium lactate, triethanolamine, tromethamine, phosphate buffers (e.g., sodium dihydrogen phosphate monohydrate, disodium hydrogen phosphate anhydrous), acetate buffers, citrate buffers, borate buffers and HBSS (Hank's Balanced Salt Solution), trisaminomethane buffers, trisaminomethane hydrochloride buffers, tris(hydroxymethyl)-aminomethane (Tris) buffers, borate buffers and diethylamine buffers, and the like.

[0551] In some embodiments, a pharmaceutical composition of the present disclosure (e.g., an aqueous composition or a frozen composition) comprises a nanoparticle composition disclosed herein and a buffer, and further comprises one or more cryoprotectants, including but not limited to sugars, surfactants, polyols, amino acids, peptides, proteins, and / or the like.

[0552] Representative carbohydrates include monosaccharides, disaccharides and polysaccharides. Representative monosaccharides include glucose, fructose, galactose, arabinose, xylose, mannose, lactulose, allose, altrose, gulose, idose, talose, ribose, lyxose, etc. Representative disaccharides include sucrose, trehalose, lactose, maltose, isomaltose, cellobiose, etc. Representative polysaccharides include starch and starch derivatives, cellulose and cellulose derivatives (e.g., methylcellulose, ethylcellulose, hydroxycellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose), chitosan and its derivatives, chitin, inulin, chitin, glycogen, pectin and hyaluronic acid.

[0553] Surfactants include nonionic surfactants, specifically polyoxyethylene fatty alcohol ethers (Brij), polysorbates (e.g., Tween 80, Tween 60, Tween 20, Tween 40), polyoxyethylene fatty acid esters (OEO), polyoxyethylene castor oil derivatives, polyoxyethylene polypropylene glycol copolymers, sucrose fatty acid esters, polyethylene glycol fatty acid esters, polyoxyethylene sorbitan monofatty acid esters, polyoxyethylene sorbitan difatty acid esters, polyoxyethylene glycerol monofatty acid esters, polyoxyethylene glycerol difatty acid esters, polyglycerol fatty acid esters, polypropylene glycol monoesters, aryl alkyl polyether alcohols, polyoxyethylene-polyoxypropylene copolymers (poloxamers), polyvinyl alcohol (PVA) derivatives, and polyvinyl pyrrolidone (PVP).

[0554] Polyols include sugar alcohols, polymerized polyols, low molecular weight polyols, etc. Representative sugar alcohols include maltitol, sorbitol, xylitol, erythritol, isomalt, maltitol, etc., mannitol, polyglycitol, etc. Representative polymerized polyols include: polyvinyl alcohol, polyethylene glycol, polyether polyols, polyester polyols, polypropylene glycol, etc. Representative low molecular weight polyols include: ethanol, ethylene glycol, propylene glycol, glycerol, trimethylolpropane, butanediol, etc.

[0555] In one embodiment, the pharmaceutical composition of the present disclosure (e.g., aqueous composition or frozen composition) comprises propylene glycol. For example, the concentration of propylene glycol in the pharmaceutical composition is in the range of about 0.05% w / v to about 50% w / v, about 0.05% w / v to about 25% w / v, about 0.5% w / v to 10% w / v, or about 1% w / v to about 5% w / v. For example, the concentration of glycerol in the formulation is in the range of about 1.5% w / v to about 3% w / v or about 2% w / v to about 2.5% w / v.

[0556] Representative amino acids include alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine.

[0557] Representative peptides include di-Gly and tri-Gly. Proteins include albumin, collagen, casein and gelatin.

[0558] Nanoparticle compositions and / or pharmaceutical compositions comprising one or more nanoparticle compositions can be administered to any patient or subject, including patients or subjects who can benefit from the therapeutic effect provided by delivering therapeutic and / or prophylactic agents to one or more specific cells, tissues, organs or systems or groups thereof, such as the renal system. Although the description of nanoparticle compositions and pharmaceutical compositions comprising nanoparticle compositions provided herein is mainly directed to compositions suitable for administration to humans, it will be understood by those skilled in the art that such compositions are generally suitable for administration to any other mammal. Improvements to compositions suitable for administration to humans in order to make the compositions suitable for administration to various animals are well known, and veterinary pharmacologists with ordinary skills can design and / or perform such improvements only through ordinary experiments (if any). It is contemplated that subjects to whom the compositions are administered include, but are not limited to, humans, other primates, and other mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, dogs, mice, and / or rats.

[0559] Pharmaceutical compositions comprising one or more nanoparticle compositions can be prepared by any method known or later developed in the art of pharmacology. In general, such preparation methods include combining the active ingredient with an excipient and / or one or more other auxiliary ingredients, and then, if desired or necessary, dividing, shaping and / or packaging the product into desired single or multiple dosage units.

[0560] Pharmaceutical compositions according to the present disclosure can be prepared, packaged and / or sold in bulk, as a single unit dose and / or as multiple single unit doses. As used herein, a "unit dose" is a discrete amount of a pharmaceutical composition containing a predetermined amount of an active ingredient (e.g., a nanoparticle composition). The amount of the active ingredient is generally equal to the dose of the active ingredient to be administered to the subject and / or a convenient portion of such a dose, such as half or one-third of such a dose.

[0561] Pharmaceutical compositions can be prepared into various forms suitable for various routes and methods of administration. For example, pharmaceutical compositions can be prepared into liquid dosage forms (e.g., emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups and elixirs), injectable forms, solid dosage forms (e.g., capsules, tablets, pills, powders and granules), dosage forms for topical and / or transdermal administration (e.g., ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants and patches), suspensions, powders and other forms.

[0562] Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups and / or elixirs. In addition to the active ingredient, the liquid dosage form may also contain inert diluents commonly used in the art, such as water or other solvents, solubilizers and emulsifiers, such as ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil and sesame oil), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycol and sorbitan fatty acid esters, and mixtures thereof. In addition to inert diluents, oral compositions may also contain additional therapeutic and / or prophylactic agents, additional agents, such as wetting agents, emulsifiers and suspending agents, sweeteners, flavoring agents and / or flavoring agents. In certain embodiments for parenteral administration, the composition is mixed with a solubilizer, such as Cremophor TM , alcohols, oils, modified oils, glycols, polysorbates, cyclodextrins, polymers and / or combinations thereof.

[0563] Injectable preparations, such as sterile injectable aqueous or oily suspensions, can be prepared according to known techniques using suitable dispersants, wetting agents and / or suspending agents. Sterile injectable preparations can be sterile injectable solutions, suspensions and / or emulsions in nontoxic parenterally acceptable diluents and / or solvents, such as solutions in 1,3-butanediol. Acceptable vehicles and solvents that can be used include water, Ringer's solution, USP and isotonic sodium chloride solution. Sterile fixed oils are generally used as solvents or suspending media. For this purpose, any mild fixed oil can be used, including synthetic monoglycerides or diglycerides. Fatty acids such as oleic acid can be used to prepare injections.

[0564] The injectable formulations can be sterilized, for example, by filtration through a bacteria-retaining filter and / or by incorporating sterilizing agents in the form of sterile solid compositions that can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.

[0565] The present disclosure provides methods for delivering therapeutic and / or prophylactic agents to mammalian cells or organs, producing target polypeptides in mammalian cells, and treating diseases or disorders in mammals in need thereof, the methods comprising administering a nanoparticle composition comprising a therapeutic and / or prophylactic agent to a mammal and / or contacting mammalian cells with the nanoparticle composition.

[0566] 5.5 Methods

[0567] In one aspect, the present invention also provides a method for controlling, preventing and treating a disease or condition caused by RSV or by infection RSV in a subject. In some embodiments, the disease or condition controlled, prevented or treated with the methods described herein is caused by RSV or by infection RSV.

[0568] In specific embodiments, the disease or condition managed, prevented or treated using the methods described herein is one or more of: (a) upper respiratory tract infection; and / or (b) lower respiratory tract infection; and / or (c) sinus infection; and / or (d) bronchiolitis; and / or (e) pneumonia; and / or (f) acute respiratory tract infection.

[0569] In some embodiments, the method for controlling, preventing and treating a disease or condition caused by RSV or by infection with RSV in a subject of the present invention comprises administering to the subject a therapeutically effective amount of a therapeutic nucleic acid as described herein. In a specific embodiment, the therapeutic nucleic acid is an mRNA molecule as described herein.

[0570] In some embodiments, the method for controlling, preventing and treating a disease or condition caused by RSV or by infection with RSV in a subject of the present invention comprises administering to the subject a therapeutic composition comprising a therapeutic nucleic acid as described herein in a therapeutically effective amount. In a specific embodiment, the therapeutic nucleic acid is an mRNA molecule as described herein.

[0571] In some embodiments, the method of the present invention for controlling, preventing and treating a disease or condition caused by RSV or by infection with RSV in a subject comprises administering to the subject a therapeutically effective amount of a vaccine composition comprising a therapeutic nucleic acid as described herein. In a specific embodiment, the therapeutic nucleic acid is an mRNA molecule as described herein.

[0572] In some embodiments, the method of the present invention for controlling, preventing and treating a disease or condition caused by RSV or by infection with RSV in a subject comprises administering to the subject a therapeutically effective amount of a lipid-containing composition comprising a therapeutic nucleic acid as described herein. In a specific embodiment, the therapeutic nucleic acid is an mRNA molecule as described herein.

[0573] In some embodiments, the method for controlling, preventing and treating a disease or condition caused by RSV or by infecting RSV in a subject of the present invention includes administering to the subject a therapeutically effective amount of a lipid composition comprising a therapeutic nucleic acid as described herein, wherein the lipid composition is formulated as a lipid nanoparticle encapsulating the therapeutic nucleic acid in a lipid shell. In a specific embodiment, the therapeutic nucleic acid is an mRNA molecule as described herein. In a specific embodiment, the cells in the subject effectively take in a lipid composition (e.g., lipid nanoparticle) as described herein after administration. In a specific embodiment, a lipid composition (e.g., lipid nanoparticle) as described herein is endocytosed by the cells of the subject.

[0574] In some embodiments, after administering a therapeutic nucleic acid as described herein, a vaccine composition comprising a therapeutic nucleic acid as described herein, or a lipid-containing composition (e.g., lipid nanoparticle) comprising a therapeutic nucleic acid as described herein to a subject in need, cells in the subject take up and express the administered therapeutic nucleic acid to produce a peptide or polypeptide encoded by the nucleic acid. In some embodiments, the encoded peptide or polypeptide is derived from an RSV that causes a disease or condition that is controlled, prevented, or treated by the method.

[0575] 5.5.1 Immune response

[0576] In some embodiments, after administering therapeutic nucleic acids as described herein, vaccine compositions comprising therapeutic nucleic acids as described herein, lipid compositions (e.g., lipid nanoparticles) comprising therapeutic nucleic acids as described herein to a subject in need, one or more immune responses to RSV are induced in the subject. In some embodiments, the immune response induced includes one or more adaptive immune responses to RSV. In some embodiments, the immune response induced includes one or more innate immune responses to RSV. One or more immune responses may be in the form of, for example, antibody responses (humoral responses) or cellular immune responses such as cytokine secretion (e.g., interferon-γ), auxiliary activity, or cytotoxicity. In some embodiments, induction, activation and / or enhancement of activation marker expression on immune cells, expression of costimulatory receptors on immune cells, expression of costimulatory receptor ligands, cytokine secretion, infiltration of infected cells by immune cells (e.g., T lymphocytes, B lymphocytes and / or NK cells), production of antibodies specifically recognizing one or more viral proteins (e.g., viral peptides or proteins encoded by therapeutic nucleic acids), effector functions, T cell activation, T cell differentiation, T cell proliferation, B cell differentiation, B cell proliferation and / or NK cell proliferation. In some embodiments, activation and proliferation of suppressor cells (MDSC) and Treg cells of myeloid origin are suppressed.

[0577] In some embodiments, after administering a therapeutic nucleic acid as described herein, a vaccine composition comprising a therapeutic nucleic acid as described herein, or a lipid-containing composition (e.g., lipid nanoparticle) comprising a therapeutic nucleic acid as described herein to a subject in need thereof.

[0578] In some embodiments, after administering a therapeutic nucleic acid as described herein, a vaccine composition comprising a therapeutic nucleic acid as described herein, or a lipid-containing composition (e.g., lipid nanoparticle) comprising a therapeutic nucleic acid as described herein to a subject in need thereof, one or more lymphocyte populations producing cytokines in the subject are increased. In some embodiments, the lymphocytes are CD4 + T cells and / or CD8 + T cells. In some embodiments, the cytokine is one or more of IFN-γ, TNF-α, and IL-2. In some embodiments, the proportion of CD4+ cells expressing IFN-γ, TNF-α, and / or IL-2 increases. In some embodiments, the proportion of CD8+ cells expressing IFN-γ, TNF-α, and / or IL-2 increases.

[0579] In specific embodiments, the neutralizing antibodies specifically bind to one or more epitopes of an RSV fusion protein and inhibit or reduce the function or activity of one or more fusion proteins.

[0580] In a specific embodiment, the neutralizing antibody binds to one or more viral proteins present on the surface of the virus particle or infected cell, and marks the virus particle or infected cell to be destroyed by the subject's immune system. In some embodiments, endocytosis of virus particles by leukocytes (e.g., macrophages) is induced or enhanced. In some embodiments, antibody-dependent cell-mediated cytotoxicity (ADCC) for infected cells in the subject is induced or enhanced. In some embodiments, antibody-dependent cellular phagocytosis (ADCP) for infected cells in the subject is induced or enhanced. In some embodiments, complement-dependent cytotoxicity (CDC) for infected cells in the subject is induced or enhanced.

[0581] 5.5.2 Combination therapy

[0582] In some embodiments, the composition of the present disclosure may also include one or more additional therapeutic agents. In some embodiments, the additional therapeutic agent is an adjuvant that can enhance the immunogenicity of the composition (e.g., a gene vaccine). In some embodiments, the additional therapeutic agent is an immunomodulator that enhances the immune response in the subject. In some embodiments, the adjuvant and therapeutic nucleic acid in the composition can have a synergistic effect in eliciting an immune response in the subject.

[0583] In some embodiments, the additional therapeutic agent and the therapeutic nucleic acid of the present disclosure can be co-formulated in a composition. For example, the additional therapeutic agent can be formulated as part of a composition comprising the therapeutic nucleic acid of the present disclosure. Alternatively, in some embodiments, the additional therapeutic agent and the therapeutic nucleic acid of the present disclosure can be formulated as separate compositions or dosage units for co-administration to a subject sequentially or simultaneously.

[0584] In certain embodiments, the therapeutic nucleic acids of the present disclosure are formulated as part of a lipid-containing composition as described in Section 5.4, and the additional therapeutic agent is formulated as a separate composition. In certain embodiments, the therapeutic nucleic acids of the present disclosure are formulated as part of a lipid-containing composition as described in Section 5.4, wherein the additional therapeutic agent is also formulated as part of the lipid-containing composition.

[0585] In certain embodiments, the therapeutic nucleic acids of the present disclosure are formulated such that the therapeutic nucleic acids are encapsulated in the lipid shell of the lipid nanoparticles as described in Section 5.4, and the additional therapeutic agent is formulated as a separate composition. In certain embodiments, the therapeutic nucleic acids of the present disclosure are formulated such that the therapeutic nucleic acids are encapsulated in the lipid shell of the lipid nanoparticles as described in Section 5.4, wherein the lipid nanoparticles also encapsulate additional therapeutic agent molecules or nucleic acids encoding additional therapeutic agent molecules. In certain embodiments, the therapeutic nucleic acids of the present disclosure are formulated such that the therapeutic nucleic acids are encapsulated in the lipid shell of the lipid nanoparticles as described in Section 5.4, wherein the lipid nanoparticles and the additional therapeutic agent are formulated as a single composition.

[0586] In specific embodiments, the additional therapeutic agent is an adjuvant. In some embodiments, the adjuvant comprises an agent that promotes maturation of dendritic cells (DCs) in a vaccinated subject, such as, but not limited to, lipopolysaccharide, TNF-α, or CD40 ligand. In some embodiments, the adjuvant is an agent that is recognized as a "danger signal" by the immune system of the vaccinated subject, such as LPS, GP96, etc.

[0587] In some embodiments, the adjuvant comprises an immunostimulatory cytokine such as, but not limited to, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, INF-α, IFN-β, INF-γ, GM-CSF, G-CSF, M-CSF, LT-β, ​​or TNF-α, a growth factor such as hGH.

[0588] In some embodiments, adjuvants include compounds known to trigger innate immune responses. An exemplary class of such compounds is a Toll-like receptor ligand, such as a ligand of human Toll-like receptor TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, and a ligand of mouse Toll-like receptor TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, TLR11, TLR12 or TLR13. Another exemplary class of such compounds is an immunostimulatory nucleic acid, such as an oligonucleotide containing a CpG motif. CpG-containing nucleic acids can be DNA (CpG-DNA) or RNA (CpG-RNA) molecules. CpG-RNA or CpG-DNA can be single-stranded CpG-DNA (ss CpG-DNA), double-stranded CpG-DNA (dsDNA), single-stranded CpG-RNA (ss CpG-RNA) or double-stranded CpG-RNA (ds CpG-RNA). In some embodiments, CpG nucleic acid is in the form of CpG-RNA. In specific embodiments, CpG nucleic acid is in the form of single-stranded CpG-RNA (ss CpG-RNA). In some embodiments, CpG nucleic acid contains at least one or more (mitogenic) cytosine / guanine dinucleotide sequences (CpG motifs). In some embodiments, at least one CpG motif contained in these sequences (i.e., C (cytosine) and / or G (guanine) forming the CpG motif) is not methylated.

[0589] In some embodiments, the additional therapeutic agent is an immunomodulator that activates, strengthens or restores normal immune function. In a specific embodiment, the immunomodulator is an agonist of a costimulatory signal of an immune cell, such as a T lymphocyte, a NK cell, or an antigen presenting cell (e.g., a dendritic cell or a macrophage). In a specific embodiment, the immunomodulator is an antagonist of an inhibitory signal of an immune cell, such as a T lymphocyte, a NK cell, or an antigen presenting cell (e.g., a dendritic cell or a macrophage).

[0590] Various immune cell stimulators known to those skilled in the art can be used in conjunction with the present disclosure. In certain embodiments, the agonist of the costimulatory signal is an agonist of a costimulatory molecule (e.g., a costimulatory receptor) found on an immune cell such as a T lymphocyte (e.g., CD4+ or CD8+ T lymphocyte), a NK cell, and / or an antigen presenting cell (e.g., a dendritic cell or a macrophage). Specific examples of co-stimulatory molecules include glucocorticoid-induced tumor necrosis factor receptor (GITR), inducible T cell co-stimulator (ICOS or CD278), OX40 (CD134), CD27, CD28, 4-IBB (CD137), CD40, lymphotoxin alpha (LTα), LIGHT (lymphotoxin-like, showing inducible expression and competing with herpes simplex virus glycoprotein D for HVEM (a receptor expressed by T lymphocytes)), CD226, cytotoxic and regulatory T cell molecule (CRT AM), death receptor 3 (DR3), lymphotoxin beta receptor (LTBR), transmembrane activator and CAML interactor (TACI), B cell activating factor receptor (BAFFR) and B cell maturation protein (BCMA).

[0591] In a specific embodiment, the agonist of a co-stimulatory receptor is an antibody or an antigen binding fragment thereof that specifically binds to the co-stimulatory receptor. Specific examples of co-stimulatory receptors include GITR, ICOS, OX40, CD27, CD28, 4-1BB, CD40, LTα, LIGHT, CD226, CRT AM, DR3, LTBR, ​​TACI, BAFFR and BCMA. In certain specific embodiments, the antibody is a monoclonal antibody. In other specific embodiments, the antibody is a sc-Fv. In a specific embodiment, the antibody is a bispecific antibody that is bound to two receptors on an immune cell. In other embodiments, the bispecific antibody is bound to another receptor on a receptor on an immune cell and a virus-infected diseased cell. In a specific embodiment, the antibody is a human or humanized antibody.

[0592] In another embodiment, the agonist of the costimulatory receptor is a ligand of the costimulatory receptor or a functional derivative thereof. In certain embodiments, the ligand is a fragment of a natural ligand. Specific examples of natural ligands include ICOSL, B7RP1, CD137L, OX40L, CD70, herpes virus invasion mediator (HVEM), CD80 and CD86. The nucleotide sequence encoding the natural ligand and the amino acid sequence of the natural ligand are known in the art.

[0593] In a specific embodiment, the antagonist is an antagonist of an inhibitory molecule (e.g., inhibitory receptor) found on an immune cell such as a T lymphocyte (e.g., CD4+ or CD8+ T lymphocyte), a NK cell, and / or an antigen presenting cell (e.g., a dendritic cell or a macrophage). Specific examples of inhibitory molecules include cytotoxic T lymphocyte-associated antigen 4 (CTLA-4 or CD52), programmed cell death protein 1 (PD1 or CD279), B and T lymphocyte attenuator (BTLA), killer cell immunoglobulin-like receptor (KIR), lymphocyte activation gene 3 (LAG3), T cell membrane protein 3 (TIM3), CD 160, adenosine A2a receptor (A2aR), T cell immune receptor with immunoglobulin and ITIM domains (TIGIT), leukocyte-associated immunoglobulin-like receptor 1 (LAIR1), and CD 160.

[0594] In another embodiment, the antagonist of an inhibitory receptor is an antibody (or antigen binding fragment) that specifically binds to the natural ligand of the inhibitory receptor and prevents the natural ligand from binding to the inhibitory receptor and transducing an inhibitory signal. In certain specific embodiments, the antibody is a monoclonal antibody. In other specific embodiments, the antibody is a sc-Fv. In a specific embodiment, the antibody is a bispecific antibody that binds to two receptors on an immune cell. In other embodiments, the bispecific antibody binds to a receptor on an immune cell and another receptor on a diseased cell infected by a virus. In a specific embodiment, the antibody is a human or humanized antibody.

[0595] In another embodiment, the antagonist of the inhibitory receptor is a soluble receptor or a functional derivative thereof, which specifically binds to the natural ligand of the inhibitory receptor and prevents the natural ligand from binding to the inhibitory receptor and transducing the inhibitory signal. Specific examples of natural ligands of inhibitory receptors include PDL-1, PDL-2, B7-H3, B7-H4, HVEM, Gal9 and adenosine. Specific examples of inhibitory receptors that bind to natural ligands include CTLA-4, PD-1, BTLA, KIR, LAG3, TIM3 and A2aR.

[0596] In another embodiment, the antagonist of an inhibitory receptor is an antibody (or antigen binding fragment) or a ligand that binds to an inhibitory receptor but does not transduce an inhibitory signal. Specific examples of inhibitory receptors include CTLA-4, PD1, BTLA, KIR, LAG3, TIM3, and A2aR. In certain specific embodiments, the antibody is a monoclonal antibody. In other specific embodiments, the antibody is a scFv. In a specific embodiment, the antibody is a human or humanized antibody. A specific example of an antibody of an inhibitory receptor is an anti-CTLA-4 antibody (Leach DR, et al. Science 1996; 271: 1734-1736). Another example of an antibody of an inhibitory receptor is an anti-PD-1 antibody (Topalian SL, NEJM 2012; 28: 3167-75).

[0597] 5.5.3 Patient groups

[0598] In some embodiments, a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is administered to a subject in need thereof.

[0599] In some embodiments, therapeutic nucleic acids as described herein, vaccine compositions comprising therapeutic nucleic acids as described herein, lipid compositions (e.g., lipid nanoparticles) comprising therapeutic nucleic acids as described herein, or combination therapies as described herein are administered to human subjects. In some embodiments, the subject of administering therapeutic nucleic acids as described herein, vaccine compositions comprising therapeutic nucleic acids as described herein, lipid compositions (e.g., lipid nanoparticles) comprising therapeutic nucleic acids as described herein, or combination therapies as described herein is an elderly person. In some embodiments, the subject of administering therapeutic nucleic acids as described herein, vaccine compositions comprising therapeutic nucleic acids as described herein, lipid compositions (e.g., lipid nanoparticles) comprising therapeutic nucleic acids as described herein, or combination therapies as described herein is a human adult. In some embodiments, the subject of administering therapeutic nucleic acids as described herein, vaccine compositions comprising therapeutic nucleic acids as described herein, lipid compositions (e.g., lipid nanoparticles) comprising therapeutic nucleic acids as described herein, or combination therapies as described herein is a human child. In some embodiments, the subject of administering therapeutic nucleic acids as described herein, vaccine compositions comprising therapeutic nucleic acids as described herein, lipid compositions (e.g., lipid nanoparticles) comprising therapeutic nucleic acids as described herein, or combination therapies as described herein is a human toddler. In some embodiments, the subject administered a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is a human infant.

[0600] In some embodiments, the subject to which a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy described herein is administered is a non-human mammal.

[0601] In some embodiments, the subject of the therapeutic nucleic acid described herein, the vaccine composition comprising the therapeutic nucleic acid described herein, the lipid composition comprising the therapeutic nucleic acid described herein (e.g., lipid nanoparticles), or the combination therapy described herein is a subject showing at least one symptom associated with RSV infection. In some embodiments, the subject receiving the therapeutic nucleic acid described herein, the vaccine composition comprising the therapeutic nucleic acid described herein, the lipid composition comprising the therapeutic nucleic acid described herein (e.g., lipid nanoparticles), or the combination therapy described herein shows (a) upper respiratory tract infection; and / or (b) lower respiratory tract infection; and / or (c) sinus infection; and / or (d) bronchiolitis; and / or (e) pneumonia; and / or (f) one or more symptoms of acute respiratory tract infection.

[0602] In some embodiments, a therapeutic nucleic acid described herein, a vaccine composition comprising a therapeutic nucleic acid described herein, a lipid-containing composition (e.g., lipid nanoparticle) comprising a therapeutic nucleic acid described herein, or a combination therapy as described herein is administered to a subject who has no symptoms of RSV infection.

[0603] In some embodiments, therapeutic nucleic acids as described herein, vaccine compositions comprising therapeutic nucleic acids as described herein, lipid compositions (e.g., lipid nanoparticles) comprising therapeutic nucleic acids as described herein, or combination therapies as described herein are applied to subjects in RSV infection risk or susceptible to RSV infection. In some embodiments, subjects in RSV infection risk or susceptible to RSV infection are elderly. In some embodiments, subjects in RSV infection risk or susceptible to RSV infection are human adults. In some embodiments, subjects in RSV infection risk or susceptible to RSV infection are human children. In some embodiments, subjects in RSV infection risk or susceptible to RSV infection are human infants. In some embodiments, subjects in RSV infection risk or susceptible to RSV infection are human infants. In some embodiments, subjects in RSV infection risk or susceptible to RSV infection are human subjects with existing health disorders affecting the immune system of subjects. In some embodiments, subjects in RSV infection risk or susceptible to RSV infection are human subjects with existing health disorders affecting the major organs of subjects. In some embodiments, the subject that is in RSV infection risk or is susceptible to RSV infection is a human subject with an existing health disorder of the pulmonary function that affects the subject. In some embodiments, the subject that is in RSV infection risk or is susceptible to RSV infection is an elderly subject with an existing health disorder of the immune system or major organs (such as pulmonary function) that affects the subject. In each embodiment described in this paragraph, the subject that is in RSV infection risk o...

Claims

1. An immunogenic mutant of a fusion protein (F protein) of a respiratory syncytial virus (RSV), wherein the mutant comprises one or more mutations compared to a wild-type F protein from an RSV strain, and optionally, the mutant is capable of inducing higher binding titers to the F protein of both RSV A and RSV B and / or higher neutralizing antibody titers to both RSV A and RSV B strains compared to the corresponding wild-type F protein.

2. The mutant of claim 1, wherein the RSV strain is a type A strain.

3. The mutant of claim 2, wherein the RSV strain is an A2 strain.

4. The mutant according to claim 2 or 3, wherein the wild-type F protein does not comprise a signal peptide. 5 . The mutant of claim 4 , wherein the wild-type F protein comprises the amino acid sequence of SEQ ID NO:

113.

6. The mutant of claim 2 or 3, wherein the wild-type F protein comprises the amino acid sequence of SEQ ID NO:

130.

7. The mutant of claim 1, wherein the RSV strain is a type B strain.

8. The mutant of claim 7, wherein the RSV strain is the B Fujian strain.

9. The mutant according to claim 7 or 8, wherein the wild-type F protein does not comprise a signal peptide. 10 . The mutant of claim 9 , wherein the wild-type F protein comprises the amino acid sequence of SEQ ID NO:

114.

11. The mutant of claim 7 or 8, wherein the wild-type F protein comprises the amino acid sequence of SEQ ID NO:

131.

12. The mutant of any one of claims 1 to 11, wherein the mutant is in a pre-fusion conformation.

13. The mutant of claim 12, wherein the mutant is in a stable pre-fusion conformation.

14. The mutant according to any one of claims 1 to 13, wherein the mutant is in a membrane-bound form.

15. The mutant according to any one of claims 1 to 13, wherein the mutant is in a secreted form.

16. The mutant of any one of claims 1 to 15, wherein the mutant comprises a ferritin tag.

17. The mutant according to any one of claims 1 to 16, wherein the mutant is a truncated fusion protein; preferably, the truncated fusion protein only comprises the site 18. The mutant of any one of claims 1 to 17, wherein the mutant comprises one or more of the following mutations: del26..49, 46G, 51C, 67I, 92D, 95M, 98C, substitution of 98..144 with SEQ ID NO: 110, substitution of 104..144 with GS, 149C, 155C, 183GC, 190F, 207L, 215P, 221M, 290C, 305C, 361C, 373R, 428C, 429K, 458C, 465Q, 486C, 489C, substitution of 308..529 with GGS, substitution of 514..574 with SEQ ID NO: 111, substitution of 514..574 with SEQ ID NO: 112, substitution of 308..574 with SEQ ID NO: 111, and substitution of 514..574 with SEQ ID NO:

113. NO:112 replaces 308..574, and the position is numbered based on the full-length sequence of wild-type protein F.

19. The mutant of any one of claims 1 to 6 and 12 to 18, wherein the mutant comprises one or more of the following mutations: delQ26..R49, S46G, G51C, N67I, E92D, substitution of Q98..V144 with SEQ ID NO: 110, substitution of N104..V144 with GS, A149C, S155C, N183GC, S190F, V207L, S215P, S290C, L305C, L373R, N428C, Y458C, K465Q, D486C, D489C, substitution of V308..T529 with GGS, substitution of H514..N574 with SEQ ID NO: 111, substitution of H514..N574 with SEQ ID NO: 112, substitution of NO:111 replaces V308..N574 and SEQ ID NO:112 replaces V308..N574, and the positions are numbered based on the full-length sequence of wild-type protein F; optionally, the full-length sequence of wild-type protein F is as shown in SEQ ID NO:

130.

20. The mutant of claim 19, wherein the mutant comprises any one or more of the following: (1) S155C and S290C; and / or (2) S190F and V207L; and / or (3) A149C and Y458C; and / or (4) D486C and D489C; and / or (5) G51C and L305C; and / or (6) N183GC and N428C; and / or (7) Replace N104..V144 with GS; and / or (8) replacing Q98..V144 with SEQ ID NO:110; and / or (9) delQ26..R49; and / or (10) replacing H514..N574 with SEQ ID NO: 111, optionally in combination with delQ26..R49; and / or (11) replacing H514..N574 with SEQ ID NO: 112, optionally in combination with delQ26..R49; and / or (12) substitution of V308..T529 with GGS, optionally in combination with substitution of N104..V144 with GS or substitution of Q98..V144 with SEQ ID NO: 110, and / or optionally in combination with delQ26..R49; and / or (13) substitution of V308..N574 with SEQ ID NO: 111, optionally in combination with substitution of N104..V144 with GS or substitution of Q98..V144 with SEQ ID NO: 110, and / or, optionally in combination with delQ26..R49; and / or (14) substitution of V308..N574 with SEQ ID NO: 112, optionally in combination with substitution of N104..V144 with GS or substitution of Q98..V144 with SEQ ID NO: 110, and / or optionally in combination with delQ26..R49; and / or (15) One or more of S46G, N67I, E92D, S215P, L373R and K465Q.

21. The mutant of claim 19, wherein the mutant comprises one of the following groups of mutations: (1) S155C, S190F, V207L ​​and S290C; or (2) Substituting GS for N104..V144, S155C, S190F, V207L, S290C and L373R; or (3) Substitution of N104..V144, A149C, S155C, S190F, V207L, S290C, L373R and Y458C with GS; or (4) replacing Q98..V144, S155C, S190F, V207L, S290C, D486C and D489C with SEQ ID NO: 110; or (5) S46G, N67I, E92D, substitution of N104..V144 with GS, A149C, S155C, S190F, V207L, S215P, S290C, L373R, Y458C, and K465Q; or (6) S46G, N67I, E92D, substitution of N104..V144 with GS, S155C, N183GC, S190F, V207L, S215P, S290C, L373R, N428C, and K465Q; or (7) G51C, N67I, substitution of N104..V144 with GS, S215P, L305C, and substitution of V308..T529 with GGS; or (8) S155C, S190F, V207L, S290C and substitution of H514..N574 with SEQ ID NO: 111; or (9) replacing N104..V144, A149C, S155C, S190F, V207L, S290C, L373R, Y458C with GS and replacing H514..N574 with SEQ ID NO: 111; or (10) S46G, N67I, E92D, substitution of N104..V144 with GS, A149C, S155C, S190F, V207L, S215P, S290C, L373R, Y458C, K465Q, and substitution of H514..N574 with SEQ ID NO: 111; or (11) delQ26..R49, G51C, substitution of N104..V144 with GS, S155C, S190F, V207L, S290C, L305C, and substitution of V308..N574 with SEQ ID NO: 111; or (12) N104..V144, A149C, S155C, S190F, V207L, S290C, L373R, Y458C are replaced with GS and H514..N574 are replaced with SEQ ID NO: 112; or (13) delQ26..R49, G51C, substitution of N104..V144 with GS, S155C, S190F, V207L, S290C, L305C, and substitution of V308..N574 with SEQ ID NO:

112.

22. The mutant of claim 1, wherein the mutant comprises an amino acid sequence as set forth in SEQ ID NO:40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, or 53, or an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to an amino acid sequence as set forth in SEQ ID NO:40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, or 53.

23. The mutant according to any one of claims 1 to 6 and 12 to 22, wherein the N-terminus of the mutant is fused to the C-terminus of a signal peptide.

24. A mutant as described in claim 23, wherein the N-terminus of the mutant is fused to the natural signal peptide of the fusion protein of RSV.

25. The mutant of claim 24, wherein the native signal peptide comprises the amino acid sequence shown in SEQ ID NO:

8.

26. The mutant of any one of claims 1 and 7 to 18, wherein the mutant comprises one or more of the following mutations: delQ26..R49, S46G, G51C, T67I, E92D, L95M, Q98C, substitution of Q98..V144 with SEQ ID NO: 110, substitution of N104..V144 with GS, A149C, S155C, N183GC, S190F, V207L, S215P, 1221M, S290C, 1305C, Q361C, L373R, N428C, R429K, Y458C, K465Q, D486C, D489C, substitution of V308..K574 with SEQ ID NO: 111, and substitution of V308..K574 with SEQ ID NO: NO:111 replaces H514..K574, and the position is numbered based on the full-length sequence of wild-type protein F; optionally, the full-length sequence of wild-type protein F is as shown in SEQ ID NO:

131.

27. The mutant of claim 26, wherein the mutant comprises any one or more of the following: (1) S155C and S290C; and / or (2) S190F and V207L; and / or (3) A149C and Y458C; and / or (4) D486C and D489C; and / or (5) G51C and I305C; and / or (6) Q98C and Q361C; and / or (7) N183GC and N428C; and / or (8) Substituting GS for N104..V144; and / or (9) replacing Q98..V144 with SEQ ID NO:110; and / or (10) delQ26..R49; and / or (11) replacing H514..K574 with SEQ ID NO: 111, optionally in combination with delQ26..R49; and / or (12) substitution of V308..K574 with SEQ ID NO: 111, optionally in combination with substitution of N104..V144 with GS, and / or, optionally in combination with delQ26..R49; and / or (13) One or more of S46G, T67I, E92D, L95M, S215P, I221M, L373R, R429K and K465Q.

28. The mutant of claim 26, wherein the mutant comprises one of the following groups of mutations: (1) S155C, S190F, V207L ​​and S290C; or (2) Substituting GS for N104..V144, S155C, S190F, V207L, S290C and L373R; or (3) Substitution of N104..V144, A149C, S155C, S190F, V207L, S290C, L373R and Y458C with GS; or (4) replacing Q98..V144, S155C, S190F, V207L, S290C, D486C and D489C with SEQ ID NO: 110; or (5) S46G, T67I, E92D, substitution of N104..V144 with GS, A149C, S155C, S190F, V207L, S215P, S290C, L373R, Y458C, and K465Q; or (6) S46G, T67I, E92D, substitution of N104..V144 with GS, S155C, N183GC, S190F, V207L, S215P, S290C, L373R, N428C, and K465Q; or (7) L95M, Q98C, substitution of N104..V144, S155C, S190F, V207L, I221M, S290C, Q361C, L373R and R429K with GS; or (8) S46G, E92D, L95M, Q98C, substitution of N104..V144 with GS, S155C, S190F, V207L, S215P, I221M, S290C, Q361C, L373R, R429K and K465Q; or (9) S46G, T67I, E92D, L95M, Q98C, substitution of N104..V144 with GS, S155C, S190F, V207L, S215P, I221M, S290C, Q361C, L373R, R429K and K465Q; or (10) S155C, S190F, V207L, S290C and substitution of H514..K574 with SEQ ID NO: 111; or (11) N104..V144, A149C, S155C, S190F, V207L, S290C, L373R, Y458C are replaced by GS and H514..K574 are replaced by SEQ ID NO: 111; or (12) S46G, T67I, E92D, substitution of N104..V144 with GS, S155C, N183GC, S190F, V207L, S215P, S290C, L373R, N428C, K465Q, and substitution of H514..K574 with SEQ ID NO: 111; or (13) S46G, E92D, L95M, Q98C, substitution of N104..V144 with GS, S155C, S190F, V207L, S215P, I221M, S290C, Q361C, L373R, R429K, K465Q, and substitution of H514..K574 with SEQ ID NO: 111; or (14) delQ26..R49, G51C, substitution of N104..V144 with GS, I305C and substitution of V308..K574 with SEQ ID NO:

111.

29. The mutant of claim 1, wherein the mutant comprises the amino acid sequence shown in SEQ ID NO:54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66 or 67, or an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence shown in SEQ ID NO:54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66 or 67.

30. The mutant of any one of claims 1, 7 to 18, and 26 to 30, wherein the N-terminus of the mutant is fused to the C-terminus of a signal peptide.

31. The mutant of claim 30, wherein the N-terminus of the mutant is fused to the native signal peptide of the fusion protein of RSV.

32. The mutant of claim 31, wherein the native signal peptide comprises the amino acid sequence shown in SEQ ID NO:

10.

33. The mutant of any one of claims 1 to 23 and 26 to 30, wherein the N-terminus of the mutant is fused to the C-terminus of a human IgE signal peptide.

34. The mutant of claim 33, wherein the human IgE signal peptide comprises the amino acid sequence shown in SEQ ID NO:

9.

35. The mutant of any one of claims 1 to 23 and 26 to 30, wherein the N-terminus of the mutant is fused to the C-terminus of a human tPA signal peptide.

36. The mutant of claim 35, wherein the human tPA signal peptide comprises the amino acid sequence shown in SEQ ID NO:

121.

37. A non-naturally occurring nucleic acid comprising a nucleotide sequence encoding the mutant of any one of claims 1 to 36.

38. The non-naturally occurring nucleic acid of claim 37, wherein the mutant consists of the nucleotide sequence set forth in SEQ ID NO: 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, or 104, or a sequence identical to that set forth in SEQ ID NO: The nucleotide sequence shown in NO:68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103 or 104 has a nucleotide sequence encoding at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

39. A non-naturally occurring nucleic acid as described in claim 37 or 38, wherein the natural signal peptide of the fusion protein of RSV is encoded by a nucleotide sequence shown in 11, 12, 13, 14, 15, 16, 17, 18, 21, 22, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38 or 39, or a nucleotide sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with the nucleotide sequence shown in SEQ ID NO:11, 12, 13, 14, 15, 16, 17, 18, 21, 22, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38 or 39.

40. The non-naturally occurring nucleic acid of claim 37, wherein the nucleotide sequence has been codon-optimized for expression in a cell of a subject, optionally wherein the subject is a non-human mammal or a human.

41. The non-naturally occurring nucleic acid of claim 40, wherein the mutant is encoded by the nucleotide sequence shown in 82, 83, 84, 85, 86, 87, 88, 89 or 90, or a nucleotide sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence shown in SEQ ID NO: 82, 83, 84, 85, 86, 87, 88, 89 or 90.

42. A non-naturally occurring nucleic acid as described in claim 40 or 41, wherein the natural signal peptide of the fusion protein of RSV is encoded by a nucleotide sequence shown in SEQ ID NO:19, 20, 23, 24 or 25, or a nucleotide sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with the nucleotide sequence shown in SEQ ID NO:19, 20, 23, 24 or 25.

43. The non-naturally occurring nucleic acid of claim 37 or 38, wherein the human IgE native signal peptide is encoded by the nucleotide sequence shown in SEQ ID NO: 26, 27, 119 or 120, or a nucleotide sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence shown in SEQ ID NO: 26, 27, 119 or 120.

44. The non-naturally occurring nucleic acid of claim 37 or 38, wherein the human tPA native signal peptide is encoded by the nucleotide sequence shown in SEQ ID NO: 122, or a nucleotide sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence shown in SEQ ID NO:

122.

45. The non-naturally occurring nucleic acid of any one of claims 37 to 44, It further comprises a 5' untranslated region (5'-UTR), wherein the 5'-UTR comprises the sequence shown in SEQ ID NO: 2, 3, 4, 5, 123, 124, 125, 132 or 133, and / or, It further comprises a 3' untranslated region (3'-UTR), wherein the 3'-UTR comprises the sequence shown in SEQ ID NO: 6, 7, 107, 109, 126 or 127, Optionally, the 3'-UTR further comprises a poly-A tail or a polyadenylation signal.

46. ​​The non-naturally occurring nucleic acid of any one of claims 37 to 45, wherein the nucleic acid consists of, consists essentially of, or comprises a nucleotide sequence selected from the group consisting of: 1)m 7 GpppG 2’OMe p, SEQ ID NO:2, SEQ ID NO:11, SEQ ID NO:68, SEQ ID NO:6; 2)m 7 GpppG 2’OMe p, SEQ ID NO:2, SEQ ID NO:12, SEQ ID NO:69, SEQ ID NO:6; 3)m 7 GpppG 2’OMe p, SEQ ID NO:2, SEQ ID NO:13, SEQ ID NO:70, SEQ ID NO:6; 4)m 7 GpppG 2’OMe p, SEQ ID NO:3, SEQ ID NO:13, SEQ ID NO:71, SEQ ID NO:6; 5)m 7GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:14、SEQ ID NO:72、SEQ ID NO:6; 6)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:15、SEQ ID NO:73、SEQ ID NO:6; 7)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:16、SEQ ID NO:74、SEQ ID NO:6; 8)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:17、SEQ ID NO:75、SEQ ID NO:6; 9)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:18、SEQ ID NO:76、SEQ ID NO:6; 10)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:19、SEQ ID NO:77、SEQ ID NO:6; 11)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:20、SEQ ID NO:78、SEQ ID NO:6; 12)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:21、SEQ ID NO:79、SEQ ID NO:6; 13)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:22、SEQ ID NO:80、SEQ ID NO:6; 14)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:21、SEQ ID NO:81、SEQ ID NO:6; 15)m 7 GpppG2’OMe p、SEQ ID NO:2、SEQ ID NO:26、SEQ ID NO:91、SEQ ID NO:6; 16)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:28、SEQ ID NO:92、SEQ ID NO:6; 17)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:29、SEQ ID NO:93、SEQ ID NO:6; 18)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:30、SEQ ID NO:94、SEQ ID NO:6; 19)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:31、SEQ ID NO:95、SEQ ID NO:6; 20)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:32、SEQ ID NO:96、SEQ ID NO:6; 21)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:33、SEQ ID NO:97、SEQ ID NO:6; 22)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:34、SEQ ID NO:98、SEQ ID NO:6; 23)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:35、SEQ ID NO:99、SEQ ID NO:6; 24)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:27、SEQ ID NO:100、SEQ ID NO:6; 25)m 7 GpppG2’OMe p、SEQ ID NO:2、SEQ ID NO:36、SEQ ID NO:101、SEQ ID NO:6; 26)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:37、SEQ ID NO:102、SEQ ID NO:6; 27)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:38、SEQ ID NO:103、SEQ ID NO:6; 28)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:39、SEQ ID NO:104、SEQ ID NO:6; 29)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:19、SEQ ID NO:87、SEQ ID NO:6; 30)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:24、SEQ ID NO:88、SEQ ID NO:6; 31)m 7 GpppG 2’OMe p、SEQ ID NO:5、SEQ ID NO:19、SEQ ID NO:89、SEQ ID NO:6; 32)m 7 GpppG 2’OMe p、SEQ ID NO:4、SEQ ID NO:25、SEQ ID NO:90、SEQ ID NO:6; 33)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:23、SEQ ID NO:82、SEQ ID NO:6; 34)m 7 GpppG 2’OMe p、SEQ ID NO:2、SEQ ID NO:20、SEQ ID NO:83、SEQ ID NO:6; 35)m 7GpppG 2’OMe p, SEQ ID NO:2, SEQ ID NO:20, SEQ ID NO:84, SEQ ID NO:6; 36)m 7 GpppG 2’OMe p, SEQ ID NO:4, SEQ ID NO:23, SEQ ID NO:85, SEQ ID NO:6; 37)m 7 GpppG 2’OMe p, SEQ ID NO:4, SEQ ID NO:20, SEQ ID NO:86, SEQ ID NO:6; 38)m 7 GpppAmpU, SEQ ID NO:132, SEQ ID NO:19, SEQ ID NO:87, SEQ ID NO:6; and 39)m 7 GpppAmpU, SEQ ID NO:133, SEQ ID NO:20, SEQ ID NO:86, SEQ ID NO:109, wherein in all SEQ ID NOs 1) to 39) above, thymine (T) is substituted by uracil (U) or N1-methylpseudouridine.

47. The non-naturally occurring nucleic acid of any one of claims 37 to 46, wherein the nucleic acid is DNA or mRNA.

48. The non-naturally occurring nucleic acid of any one of claims 37 to 47, wherein the nucleic acid comprises one or more functional nucleotide analogs.

49. The non-naturally occurring nucleic acid of claim 48, wherein the nucleic acid comprises one or more functional nucleotide analogs selected from pseudouridine, 1-methyl-pseudouridine, and 5-methylcytosine.

50. A vector comprising the non-naturally occurring nucleic acid of any one of claims 37 to 49; preferably, the vector is an IVT (in vitro transcription) plasmid.

51. A cell comprising the non-naturally occurring nucleic acid of any one of claims 37 to 49 or the vector of claim 50.

52. A pharmaceutical composition comprising the mutant of any one of claims 1 to 36.

53. A pharmaceutical composition comprising the non-naturally occurring nucleic acid of any one of claims 37 to 49 and at least a first lipid, optionally wherein the first lipid is a compound according to Formula 01-I or Formula 01-II; or a compound listed in Table 01-1; Or a compound according to formula 02-I; or the compounds listed in Table 02-1; Or a compound according to formula 03-I; or the compounds listed in Table 03-1; Or a compound according to formula 04-I; Or the compounds listed in Table 04-1.

54. A pharmaceutical composition as described in claim 53, further comprising a second lipid, optionally, wherein the second lipid is a compound according to Formula 05-I.

55. The pharmaceutical composition of claim 53 or 54, formulated as lipid nanoparticles encapsulating the nucleic acid in a lipid shell.

56. A pharmaceutical composition as described in any one of claims 53 to 55, wherein the composition is a vaccine.

57. A method for controlling, preventing or treating a disease or condition caused by RSV or infection with RSV in a subject, the method comprising administering to the subject a therapeutically effective amount of a mutant as described in any one of claims 1 to 36, a non-naturally occurring nucleic acid as described in any one of claims 37 to 49, or a pharmaceutical composition as described in any one of claims 52 to 56.

58. The method of claim 57, wherein an immune response against the RSV is elicited in the subject.

59. The method of claim 58, wherein the immune response comprises producing antibodies that specifically bind to RSV F and / or inducing RSV neutralizing antibody titers.

60. The method of claim 58, wherein the immune response comprises production of cytokines in lymphocytes.

61. The method of claim 60, wherein the immune response comprises an increase in the proportion of lymphocytes expressing cytokines.

62. The method of claim 60 or 61, wherein cytokine production in lymphocytes is increased.

63. The method of any one of claims 60 to 62, wherein the lymphocytes are CD4 + T cells and / or CD8 + T cells, and / or, wherein the cytokine is one or more of IFN-γ, TNF-α and IL-2.

64. The method of any one of claims 57 to 63, wherein the disease or condition caused by RSV is (a) upper respiratory tract infection; and / or (b) lower respiratory tract infection; and / or (c) sinus infection; and / or (d) bronchiolitis; and / or (e) pneumonia; and / or (f) Acute respiratory tract infection.

Images