SiRNA, nano-preparation for treating androgenetic alopecia and preparation method thereof
By designing siRNA nanoparticles that inhibit androgen receptor expression, the problem of difficult siRNA delivery was solved, achieving rapid and efficient hair growth effects and promoting hair growth speed and length.
Patent Information
- Application Number
- CN202411296975.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-14
- Publication Date
- 2025-10-24
- Estimated Expiration
- 2044-09-14
AI Technical Summary
Current technologies lack siRNA drugs that can rapidly and efficiently promote hair regeneration, and siRNA is unstable and difficult to enter cells, posing delivery challenges.
A siRNA that inhibits androgen receptor expression was designed and encapsulated in lipid nanoparticles to form a nano-formulation. This nano-formulation was then combined with sodium hyaluronate to prepare a gel for local delivery of the siRNA, thereby improving its uptake in skin hair follicle cells and enhancing its therapeutic effect.
It can efficiently and rapidly inhibit androgen receptor expression both in vivo and in vitro, significantly promote hair growth, shorten the hair regeneration time in bald areas, and increase hair growth speed and length.
Smart Images

Figure CN119144604B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of nucleic acid drugs, and particularly relates to siRNA for treating androgenetic alopecia, a nano preparation and a preparation method thereof. BACKGROUND
[0002] Androgenetic alopecia is the most common type of alopecia in clinic. In China, the total prevalence rate of male androgenetic alopecia is 21.3%, and the prevalence rate of female androgenetic alopecia is 6.0%. The prevalence rate in white people is even higher. As a genetic disease, the sensitivity of the local scalp hair follicle of androgenetic alopecia patients to androgens (mainly dihydrotestosterone) increases, and the hair follicle miniaturizes under the action of androgens, the hair shaft becomes thin and short, and the clinical manifestations are hair thinning and hair loss. Androgenetic alopecia does not affect the life and health of patients, but it can cause great mental distress. At present, the number of alopecia patients in China has exceeded 250 million, and the age of alopecia has been reduced by 20 years compared with the previous generation, showing a clear trend of youth. Therefore, the demand for simple and effective treatment methods is also increasing.
[0003] At present, the treatment methods for androgenetic alopecia include surgical treatment (such as hair follicle transplantation and laser irradiation) and drug treatment. Compared with surgical treatment, drug treatment has a smaller economic burden on patients and is easier to operate. The drugs for treating androgenetic alopecia in clinic mainly include minoxidil, finasteride, flutamide, bicalutamide and spironolactone, and the most commonly used are minoxidil and finasteride. The mechanism of minoxidil in promoting hair growth is not clear. It mainly shortens the anagen phase and transits to the anagen phase earlier to increase the length and diameter of hair. It starts to take effect after about 2 months of use and reaches the maximum effect in 4 months. Different adverse reactions may be caused according to the difference in the administration mode of minoxidil. Local application of minoxidil may cause irritant dermatitis and contact dermatitis, etc. Oral administration of low-dose minoxidil may cause excessive hair growth on the face or other parts due to systemic distribution. Finasteride can reduce the serum dihydrotestosterone level by inhibiting 5α-reductase. However, patients treated with oral finasteride may have erectile dysfunction, decreased sexual desire, ejaculation disorder and a higher risk of depression. Local use of finasteride may cause mild or moderate skin reactions.
[0004] Small interfering RNA (siRNA) is a short double-stranded RNA molecule used to mediate RNA interference in mammalian cells, which can bind to the messenger RNA (mRNA) of a specific sequence and degrade it, so that it cannot be translated, to regulate the expression of target genes. Compared with small molecule therapeutic drugs and monoclonal antibody drugs, siRNA has an inherent advantage because siRNA performs its function by complete base pairing with mRNA, while small molecules and monoclonal antibody drugs need to recognize the complex spatial conformation of proteins to function. Due to sequence specificity, any target gene can be targeted by the corresponding siRNA, which makes the siRNA model have a shorter development time and a wider treatment field than small molecule or antibody drugs. For androgenetic alopecia, blocking the binding of androgens to the hair follicles of the scalp of patients can prevent the atrophy and degeneration of hair follicles, thereby inhibiting hair loss.
[0005] Due to the instability of siRNA, it is prone to enzymatic and non-enzymatic degradation, and it is difficult to enter cells due to its negative charge, so there are problems in the delivery of siRNA therapy, and a suitable nanocarrier needs to be designed as a protective shell to deliver siRNA into cells to effectively function. Lipid nanoparticles (LNP) are lipid vesicles with uniform lipid cores, which are widely used for the delivery of nucleic acid drugs due to their ability to isolate nucleic acid degradation caused by the environment through encapsulation. Cationic lipids have permanently positively charged head groups that can adsorb negatively charged siRNA and bind to cell membranes to mediate entry into cells.
[0006] At present, there is still a lack of siRNA drugs that can quickly and efficiently promote hair regeneration in the art. SUMMARY
[0007] Based on this, the purpose of the present application is to improve an siRNA for treating androgenetic alopecia, which can significantly inhibit the expression of androgen receptor genes and quickly and efficiently promote hair regeneration.
[0008] The first aspect of the present application is to provide an siRNA for inhibiting the expression of human androgen receptors, which comprises a sense strand and an antisense strand, wherein the sense strand is shown as SEQ ID NO. 1, and the antisense strand is shown as SEQ ID NO. 2.
[0009] The second aspect of the present application is to provide a nano-preparation for inhibiting the expression of androgen receptors, which is composed of a lipid nanoparticle-encapsulated agent for inhibiting the expression of androgen receptors, wherein the agent for inhibiting the expression of androgen receptors comprises the siRNA as described above.
[0010] In some embodiments, the lipid nanoparticles are prepared from raw materials comprising DOTAP, lecithin and cholesterol.
[0011] In some embodiments, the mass ratio of the DOTAP, lecithin and cholesterol is 5:(1-3):(2-4); preferably, the mass ratio of the DOTAP, lecithin and cholesterol is 5:(1-2):(3-4); and / or,
[0012] The mass ratio of the siRNA and DOTAP is 1:(8-15).
[0013] A third aspect of the present application provides a preparation method of the nano-preparation as described above, comprising the following steps: (1) dissolving raw materials for preparing the lipid nanoparticles in a solvent to obtain an organic phase; (2) dissolving the siRNA in a solvent to obtain an aqueous phase; (3) stirring the aqueous phase and slowly dropping the organic phase into the aqueous phase while stirring, thereby obtaining the nano-preparation.
[0014] In some embodiments, the solvent in step (1) is anhydrous ethanol.
[0015] In some embodiments, the solvent in step (2) is a 20mM-30mM aqueous sodium acetate solution or a 20mM-30mM aqueous sodium citrate solution.
[0016] A fourth aspect of the present application provides use of the siRNA as described above or the nano-preparation as described above in the preparation of a medicament for treating androgenetic alopecia.
[0017] A fifth aspect of the present application provides a medicament for treating androgenetic alopecia, which comprises an active ingredient and a pharmaceutically acceptable carrier; the active ingredient comprises the siRNA as described above and / or the nano-preparation as described above.
[0018] In some embodiments, the medicament is in the form of a gel.
[0019] In some embodiments, the gel comprises the nano-preparation and sodium hyaluronate.
[0020] In some embodiments, the sodium hyaluronate has a relative molecular weight of 8x10 5 -13x10 5 .
[0021] The present application provides an siRNA for inhibiting the expression of androgen receptors, which can efficiently and rapidly inhibit the expression of androgen receptor subunit 1 (AR-1) and subunit 2 (AR-2) in vivo and in vitro.
[0022] Further, the present application also provides a nano-preparation which can effectively deliver the siRNA, the nano-preparation is composed of the siRNA wrapped by lipid nanoparticles, the nano-preparation is prepared by suitable raw materials, has suitable particle size and low Zeta potential, is very easy to be taken up by skin follicle cells, and has high biological safety and does not produce obvious side effects. And when the nano-preparation is applied on the surface of the alopecia skin, the siRNA wrapped inside can quickly play a therapeutic role, effectively shortens the time of hair regeneration in the alopecia part, improves the hair growth speed, and increases the length of the regenerated hair. BRIEF DESCRIPTION OF DRAWINGS
[0023] Figure 1 Inhibition effect of four siRNAs on mRNA expression level of androgen receptor subunit 1 (AR-1) and subunit 2 (AR-2) of human hair follicle dermal papilla cells.
[0024] Figure 2 Particle size and Zeta potential of the lipid nanoparticles prepared by different formulations in Example 2.
[0025] Figure 3 Inhibition effect of siRNA-LNP-A and siRNA-LNP-B on mRNA expression level of androgen receptor subunit 1 (AR-1) and subunit 2 (AR-2) of human hair follicle dermal papilla cells.
[0026] Figure 4 Cell safety investigation results of siRNA-LNP-A and siRNA-LNP-B.
[0027] Figure 5 Results of changes of storage modulus and energy dissipation modulus of the gel prepared by different contents of sodium hyaluronate with amplitude.
[0028] Figure 6 Sample chart and results of changes of viscosity of the gel prepared by 3% sodium hyaluronate with shear rate.
[0029] Figure 7 Skin retention detection results of DiR-LNP / Gel and DiR-LNP.
[0030] Figure 8 Therapeutic effect of siRNA-LNP / GelA and siRNA-LNP / GelB on androgenetic alopecia. DETAILED DESCRIPTION
[0031] For the purposes of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided so that the disclosure of the present invention will be thorough and complete.
[0032] The experimental methods in the following examples, unless otherwise specified, are generally performed according to conventional conditions or according to the conditions recommended by the manufacturer. The various common chemical reagents used in the examples are commercially available products.
[0033] Unless otherwise defined, all technical and scientific terms used within the scope of the present invention have the same meanings as commonly understood by one of ordinary skill in the art to which the present invention belongs. The terminology used in the description of the present invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the present invention. As used in the description of the present invention, the term "and / or" includes any and all combinations of one or more of the associated listed items.
[0034] In addition, as used in the present invention, the term "or" is the inclusive "or" and is equivalent to the term "and / or", unless the context clearly indicates otherwise. The term "based on" is not exclusive and allows for being based on other factors not described, unless the context clearly indicates otherwise. In addition, throughout the specification, the meaning of "a", "an", and "the" include plural references. The meaning of "in" includes "in" and "on".
[0035] For androgenetic alopecia, blocking the combination of androgen with the hair follicle of the patient's scalp can prevent the atrophy and degeneration of the hair follicle, thereby inhibiting hair loss. And the combination process is mediated by androgen receptor, and mainly by androgen receptor subunit-1 (AR-1) and assisted by androgen receptor subunit-2 (AR-2). Therefore, the siRNA targeting the mRNA sequences of AR-1 and AR-2 is designed in the present invention, which can bind to the mRNA of AR-1 and AR-2 through sequence specificity and mediate the degradation of the mRNA, down-regulate the expression of androgen receptor, and reduce the sensitivity of the hair follicle of the patient's scalp to androgen.
[0036] Some embodiments of the present invention relate to an siRNA for inhibiting the expression of human androgen receptor, which comprises a sense strand and an antisense strand, the sense strand is shown as SEQ ID NO. 1, and the antisense strand is shown as SEQ ID NO. 2. The siRNA is obtained through a large number of research and screening, and can efficiently and quickly inhibit the expression of androgen receptor subunit 1 (AR-1) and subunit 2 (AR-2) in vivo and in vitro.
[0037] Some embodiments of the present application relate to a nano-preparation, which is composed of an androgen receptor expression inhibiting agent encapsulated by a lipid nanoparticle, wherein the androgen receptor expression inhibiting agent comprises the siRNA as described above.
[0038] In some embodiments, the lipid nanoparticle is prepared from raw materials comprising DOTAP, lecithin and cholesterol.
[0039] In some embodiments, the mass ratio of DOTAP, lecithin and cholesterol is 5:(1-3):(2-4); preferably, the mass ratio of DOTAP, lecithin and cholesterol is 5:(1-2):(3-4); more preferably, the mass ratio of DOTAP, lecithin and cholesterol is 5:1:4.
[0040] Some embodiments of the present application relate to a method for preparing the nano-preparation as described above, comprising the following steps: (1) dissolving raw materials for preparing the lipid nanoparticle in a solvent to obtain an organic phase; (2) dissolving the siRNA in a solvent to obtain an aqueous phase; (3) stirring the aqueous phase and slowly adding the organic phase thereto while stirring.
[0041] In some embodiments, the solvent in step (1) is anhydrous ethanol. The raw materials for preparing the lipid nanoparticle are weighed according to the need, added into the solvent, and fully dissolved and mixed to obtain the organic phase.
[0042] In some embodiments, the solvent in step (2) is a 20mM-30mM sodium acetate aqueous solution or a 20mM-30mM sodium citrate aqueous solution. The siRNA is weighed according to the need, added into the solvent, and fully dissolved and mixed to obtain the aqueous phase.
[0043] The organic phase and the aqueous phase are taken according to the need, the organic phase is slowly added into the aqueous phase while stirring, and after the addition is completed, the stirring is continued for a period of time, for example, 20min-60min, preferably 20min-40min, and more preferably 30min.
[0044] Some embodiments of the present application relate to a medicament for treating androgenetic alopecia, which comprises an active ingredient and a pharmaceutically acceptable carrier; the active ingredient comprises the siRNA as described above and / or the nano-preparation as described above.
[0045] In some embodiments, the dosage form of the medicament is a gel.
[0046] In some embodiments, the drug comprises the nano-preparation and sodium hyaluronate. The nano-preparation and sodium hyaluronate can be prepared into a gel according to conventional methods in the art. For example, the preparation method of the gel comprises the following steps: slowly dropping the organic phase into the water phase while stirring the water phase, continuing to stir and incubate for a period of time, for example, 20 min to 60 min, preferably 20 min to 40 min, more preferably 30 min, after the dropping is completed; then adding sodium hyaluronate to dissolve, stirring to form a gel, and obtaining the gel.
[0047] In some embodiments, the mass percentage of hyaluronic acid in the gel is 2% to 6%.
[0048] In some of the embodiments, the relative molecular weight of the sodium hyaluronate is 8 x 10 5 to 13 x 10 5 .
[0049] The application will be further described in detail below in combination with specific examples.
[0050] Example 1 siRNA down-regulation of the gene expression level of human androgen receptor of human hair follicle dermal papilla cells
[0051] I. Construction and synthesis of siRNA sequences
[0052] According to the subunit 1 (AR-1) mRNA sequence (NM_000044.6→NP_000035.2 androgen receptor isoform 1) and subunit 2 (AR-2) mRNA sequence (NM_001011645.3→NP_001011645.1 androgen receptor isoform 2) of human androgen receptor (AR androgen receptor [Homo sapiens (human)]), a large number of siRNAs are designed, and only the siRNA (siRNA-A) of the application and three control siRNA sequences therein are listed in this example:
[0053] siRNA-A: sense strand (5'-3') GCUAAAGACUCGGAGGAAG, SEQ ID NO. 1;
[0054] antisense strand (5'-3') CUUCCUCCGAGUCUUUAGC, SEQ ID NO. 2;
[0055] siRNA-B: sense strand (5'-3') GUUCACUUUUGACCUGCUAAU, SEQ ID NO. 3:
[0056] Sense strand (5'-3') UUAGCAGGUCAAAAGUGAAC, SEQ ID NO. 4; Antisense strand (5'-3') UUCUGACUUUGAGCUUAACG, SEQ ID NO. 5;
[0057] siRNA-C: Sense strand (5'-3') GCUCAAGGAUGGAAGUGCA, SEQ ID NO. 5;
[0058] Antisense strand (5'-3') UGCACUUCCAUCCUUGAGC, SEQ ID NO. 6;
[0059] siRNA-D: Sense strand (5'-3') GCACCAUGCAACUCCUUCA, SEQ ID NO. 7;
[0060] Antisense strand (5'-3') UGAAGGAGUUGCAUGGUGC, SEQ ID NO. 8.
[0061] The designed siRNA was synthesized by Genomed, and 2 T were added at the 3'end.
[0062] II. Effect verification of siRNA sequence
[0063] (1) Human hair follicle dermal papilla cells (HFDPC) in the logarithmic growth phase were digested with trypsin to prepare a single cell suspension, and mixed uniformly. 7 x 10 5 cells / well were inoculated into a 6-well plate and cultured overnight at 37°C in 5% CO2 to adhere.
[0064] (2) siRNA-A ~ siRNA-D were transfected into human hair follicle dermal papilla cells using Lipofectamine 3000 transfection reagent. Specifically, 5 μL of Lipo3000 reagent was diluted with 125 μL of serum-free DMEM medium, and 5 μL of siRNA was diluted with 125 μL of serum-free DMEM medium. The diluted Lipo3000 and siRNA were mixed at a ratio of 1:1 by blowing, incubated at room temperature for 5 to 10 min, and added to human hair follicle dermal papilla cells at a volume of 250 μL per well. The cells were further cultured at 37°C in a 5% CO2 incubator for 24 h. 1 mL of Trizol reagent was added to each well to break the cells by blowing, and the subsequent RNA extraction step was performed. The mRNA expression levels of androgen receptor subunit 1 (AR-1) and subunit 2 (AR-2) were detected by RT-qPCR. The RT-qPCR detection primers included detection primers for AR-1 and AR-2. The AR-1 detection primers included: upstream primer: (5'-3') CAGCAGCAGCAGCAAGAGACTAG, SEQ ID NO. 9; downstream primer: (5'-3') CCTCATCCAGGACCAGGTAGCC, SEQ ID NO. 10. The AR-2 detection primers included: upstream primer: (5'-3') GGACGACCAGATGGCTGTCATTC, SEQ ID NO. 11; downstream primer: (5'-3') GCGAAGTAGAGCATCCTGGAGTTG,
[0065] SEQ ID NO. 12. The detection instrument was a LightCycler 480 II fluorescence quantitative PCR instrument (Roche, Switzerland), and the detection reagents were Evo M-MLV RT Reagent Kit and SYBR Green Pro Taq HS kit (AG Scientific, USA), and the operation steps were strictly in accordance with the instructions.
[0066] (3) The experimental results Figure 1 showed that among the four sequences of siRNA, siRNA-A and siRNA-B had a better effect on inhibiting the gene expression of AR-1 and AR-2 in human hair follicle dermal papilla cells than siRNA-C and siRNA-D, and could significantly down-regulate the gene expression levels of AR-1 and AR-2 in human hair follicle dermal papilla cells. Among them, siRNA-A had a better effect on down-regulating the mRNA of human androgen receptor subunit-1 than siRNA-B. This experiment confirmed that siRNA-A and siRNA-B could down-regulate the gene expression of human androgen receptor at the cellular level.
[0067] Prescription screening of androgen receptor siRNA lipid nanoparticles siRNA-LNP of Example 2
[0068] In this example, the raw materials for preparing siRNA-LNP were optimized. The siRNA used in the optimization process was siRNA-A.
[0069] (1) Preparation of raw materials screening
[0070] The corresponding ingredients were calculated and weighed according to the mass ratio of DOTAP: lecithin: DOPE (dioleoyl phosphatidyl ethanolamine): cholesterol of 4:2:2:1, 5:1:0:4, 3:2:3:1, dissolved in anhydrous ethanol (organic phase), and the corresponding siRNA was calculated and taken according to the mass ratio of DOTAP: siRNA of 15:1 and 8:1, dissolved in 25mM sodium acetate buffer solution with pH of 4.85 (aqueous phase), the siRNA solution (aqueous phase) was placed on a magnetic stirring table, and the anhydrous ethanol dissolved with lipid components was slowly dropped while stirring at a speed of 1000 rpm, the volume ratio of aqueous phase to organic phase was 3:1, and after 30 min of continuous stirring and incubation, the siRNA-LNP was collected, passed through a 0.22μm polycarbonate filter 5 times, and the particle size, PDI and Zeta potential were measured by Malvern particle size analyzer.
[0071] The results are shown in Table 1. When the mass ratio of DOTAP: lecithin: DOPE: cholesterol was 5:1:0:4 and the mass ratio of DOTAP: siRNA was 8:1, the average particle size of siRNA-LNP was 339.1 nm, which was in the range of 300-400 nm, which was beneficial for the penetration of particles into hair follicles; the particle stability was good: the average Zeta potential was 5.3 mV, which carried a small amount of positive charge, had low toxicity to normal cells, and was beneficial for uptake by hair follicle cells. When the mass ratio of DOTAP: lecithin: DOPE: cholesterol containing DOTAP and DOPE was 4:2:2:1, although the average particle size of the prepared siRNA-LNP was in the range of 300-400 nm and the stability was good, the average Zeta potential was too large, which had high toxicity to cells. When the mass ratio of DOTAP: lecithin: DOPE: cholesterol containing DOTAP and DOPE was 3:2:3:1, the stability of the prepared LNP was significantly deteriorated, and precipitates were precipitated after storage.
[0072] The formulation group of the mass ratio of DOTAP: lecithin: DOPE: cholesterol is 5:1:0:4. The mass ratio of DOTAP and siRNA is also studied in this embodiment. The results show that when the mass ratio of DOTAP and siRNA is (8-15):1, the average particle size, average Zeta potential and stability of the prepared siRNA-LNP are all good. When the mass ratio of DOTAP and siRNA is higher than 15:1, the amount of loaded siRNA cannot meet the treatment requirements; when the mass ratio of DOTAP and siRNA is lower than 8:1, the zeta potential of the lipid nanoparticle is difficult to reach a positive charge, that is, the carrier is difficult to load siRNA.
[0073] Table 1
[0074]
[0075]
[0076] (2) The mass ratio of DOTAP, lecithin and cholesterol is studied.
[0077] The mass ratio of DOTAP: lecithin: cholesterol is 5:1:4, 6:0:4, 8:2:0, 2:4:4, 4:3:3, and the corresponding components are calculated and weighed to be dissolved in anhydrous ethanol. The mass ratio of DOTAP: siRNA is 8:1, and the corresponding siRNA is calculated and taken, dissolved in a 25mM sodium acetate buffer solution with a pH of 4.85, and the preparation method of each prescription siRNA-LNP is the same as above. The preparation method of each prescription blank LNP (without siRNA) is the same as that of siRNA-LNP except that an equal volume of 25mM sodium acetate buffer solution with a pH of 4.85 is used as the aqueous phase. The blank LNP and siRNA-LNP of each prescription are collected, and the particle size, PDI and Zeta potential are measured.
[0078] The experimental results are shown in Table 2 and Figure 2As shown, the individual siRNA has a particle size of about 310 nm and carries more negative charge, and the particle size of siRNA after being loaded by the blank LNP of each prescription is significantly increased, wherein the particle size of siRNA-LNP prepared by the prescription with a mass ratio of DOTAP: lecithin: cholesterol of 5:1:4, 6:0:4 and 4:3:3 is between 300-400 nm, which is conducive to the uptake of the siRNA-LNP by the hair follicle cells and is suitable for the local administration of androgen receptor siRNA-LNP on the scalp, but the Zeta potential of siRNA-LNP prepared by the prescription with a mass ratio of DOTAP: lecithin: cholesterol of 6:0:4 and 4:3:3 is high, and the biological toxicity is large; and the particle size of siRNA-LNP prepared by the prescription with a mass ratio of DOTAP: lecithin: cholesterol of 8:2:0 and 2:4:4 is not between 300-400 nm, which is not conducive to the uptake of the siRNA-LNP by the skin hair follicle cells. The particle size of siRNA-LNP prepared by the prescription with a mass ratio of DOTAP: lecithin: cholesterol of 5:1:4 is between 300-400 nm, has good stability, low Zeta potential, still carries a small amount of positive charge, and has low cytotoxicity.
[0079] Table 2
[0080]
[0081] According to the mass ratio of DOTAP: lecithin: cholesterol (5:1:4) obtained by screening, the mass ratios of 5:2:3 and 5:3:2 were also tested. The results show that when the mass ratio of DOTAP: lecithin: cholesterol is 5:2:3 and 5:3:2, the prepared siRNA-LNP also has a suitable particle size, Zeta potential and good stability. It is indicated that the lipid material obtained by combining DOTAP, lecithin and cholesterol with a mass ratio of 5:(1-3):(2-4) is suitable for preparing siRNA-LNP which is easily taken up by skin hair follicle cells.
[0082] Example 3 Influence of Androgen Receptor siRNA-LNP on the Expression of Androgen Receptor Gene at Cell Level
[0083] (1) The human hair follicle dermal papilla cells (HFDPC) in the logarithmic growth phase were digested with trypsin to prepare a single cell suspension, which was mixed uniformly. The cells were inoculated into a 6-well plate at a density of 7x10 5 cells / well, and cultured overnight at 37°C in a 5% CO2 incubator to adhere.
[0084] (2) Preparation of siRNA-LNP-A and siRNA-LNP-B with mass ratio of DOTAP: cholesterol: lecithin of 5:4:1 and mass ratio of DOTAP: siRNA of 8:1, using NC-siRNA (provided by Genomed) as control, and the preparation method is the same as above. Add 40 μL of siRNA-LNP-A and siRNA-LNP-B with siRNA concentration of 2.5 μM to 6-well plates, so that the final concentration of the two siRNA-LNPs in each well is 50 nM, and incubate with HFDPC at 37°C in 5% CO2 for 24 h. Add 1 mL of Trizol reagent to each well to break the cells by repeatedly blowing, and then perform the subsequent RNA extraction step, and detect the mRNA expression levels of AR-1 and AR-2 by RT-qPCR, and the detection method is the same as in Example 1.
[0085] (3) The experimental results Figure 3 ) show that siRNA-LNP-A and siRNA-LNP-B carrying two sequences of androgen receptor siRNA can significantly down-regulate the gene expression levels of AR-1 and AR-2 in human hair follicle dermal papilla cells, confirming the successful preparation of siRNA-LNP, and siRNA-LNP-A and siRNA-LNP-B have obvious down-regulation effect on the gene expression of human androgen receptor at the cellular level.
[0086] Example 4 Cell safety investigation of androgen receptor siRNA-LNP
[0087] (1) Human hair follicle dermal papilla cells (HFDPC) in the logarithmic growth phase were digested with trypsin to prepare a single cell suspension, and mixed uniformly. Seed 1 x 10 4 cells / well into a 96-well plate, and incubate at 37°C in 5% CO2 overnight to adhere.
[0088] (2) Preparation of siRNA-LNP-A and siRNA-LNP-B with mass ratio of DOTAP: cholesterol: lecithin of 5:4:1 and mass ratio of DOTAP: siRNA of 8:1, and the preparation method is the same as above. Add siRNA-LNP-A and siRNA-LNP-B to the 96-well plate at a final concentration of 1 nM, 5 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM and 100 nM per well, and incubate with HFDPC for 24 h, and the total system in each well is 200 μL.
[0089] (3) Each well was added 20 μL thiazolyl blue (MTT) solution with a concentration of 5 mg / mL, and after 4 h of incubation in the dark, the culture supernatant was discarded, 150 μL DMSO was added to dissolve the formazan crystals, and the absorbance of each well at 490 nm was determined by an enzyme-labeled instrument, and the cell survival rate of HFDPC was calculated, and the calculation formula was as follows:
[0090]
[0091] (4) The experimental results( Figure 4 ) showed that siRNA-LNP-A and siRNA-LNP-B had no obvious toxicity to HFDPC cells at a concentration of 100 nM, and the survival rate of HFDPC cells was more than 80%, which proved the good cell safety of siRNA-LNP of the application.
[0092] Example 5 Hyaluronic acid content screening of androgen receptor siRNA-LNP gel siRNA-LNP / Gel
[0093] In this example, siRNA-LNP was prepared into a gel, and siRNA used in the preparation process was siRNA-A, and the method was as follows:
[0094] (1) siRNA-LNP with a mass ratio of DOTAP: cholesterol: lecithin of 5:4:1 and a mass ratio of DOTAP: siRNA of 8:1 was prepared, and the preparation method was the same as above. The corresponding sodium hyaluronate powder (purchased from Shandong Furuida Company, item number: 0906262, molecular weight: 8 x 10 5 ~ 13 x 10 5 ) was calculated and weighed, and mixed with siRNA-LNP to make the mass percentage of hyaluronic acid (HA) in all raw materials 2%, 3%, 4%, 5%, and 6%, and dissolved and stirred to become a gel, that is, siRNA-LNP / Gel.
[0095] (2) The stress scanning of siRNA-LNP / Gel with different HA contents was performed by Anton Paar rotary rheometer, the measurement interval was set to 0.200 mm, the temperature was 37℃, the strain amplitude was 0.01%-100%, the change law was "logarithmic change", and the frequency was constant at 10 rad / s, and the results of the change of sample storage modulus and energy dissipation modulus with amplitude were obtained.
[0096] The experimental results( Figure 5) shows that the siRNA-LNP / Gel of each HA content has a storage modulus (G') greater than a loss modulus (G") at a strain amplitude of 0.01%, indicating that a stable gel can be formed. The siRNA-LNP / Gel with a HA content of 4%, 5%, and 6% has a G' greater than a G" in a strain range of 0.01%-100%, indicating that the siRNA-LNP / Gel with a HA content of 4%, 5%, and 6% has good mechanical properties. For the siRNA-LNP / Gel with a HA content of 2% and 3%, the gel G' is always greater than the G" in a strain range of 0.01%-60%, indicating that the siRNA-LNP / Gel has good elasticity and is in a gel state. When the strain increases to 100%, the G' gradually decreases and the G" gradually increases. When the gel G" is greater than the G', the siRNA-LNP / Gel gradually loses elasticity and the viscosity dominates. Therefore, the 2% and 3% HA gels have certain viscosity and fluidity. The G' value of the currently commercially available hydrogel for skin coating is between 200 Pa and 300 Pa. Therefore, the siRNA-LNP / Gel with a HA content of 3% is selected for subsequent experiments.
[0097] The siRNA-LNP / Gel with a HA content of 3% is subjected to a shear rate scanning by an Anton Paar rotary rheometer. The temperature is set to 37°C, the shear rate is 0.1-100 / s, and the change law is a logarithmic change law. The change of the sample viscosity with the shear rate can be obtained.
[0098] The experimental results Figure 6 ) show that the siRNA-LNP / Gel with a HA content of 3% is white and opaque, has moderate consistency, and has good gel forming properties. The shear rate scanning results show that the siRNA-LNP / Gel with a HA content of 3% has a certain viscosity and has a shear thinning property, that is, the viscosity can be reduced for skin diffusion.
[0099] Example 6 Androgen receptor siRNA-LNP / Gel improves the skin retention performance of siRNA-LNP
[0100] (1) The LNP / Gel with a mass ratio of DOTAP: cholesterol: lecithin of 5:4:1 and a HA content of 3% is prepared by the above method. The LNP / Gel and LNP are mixed with a DiR dye with a final concentration of 10 μg / mL for fluorescence labeling to obtain DiR-LNP / Gel and DiR-LNP.
[0101] (2) Take C57BL / 6 mice with a week age of 6-8 weeks, randomly divide them into two groups after removing the back hair, evenly apply DiR-LNP / Gel and DiR-LNP on the back skin of the mice respectively, incubate in the dark for 30 min, then wipe off the residual DiR-LNP / Gel and DiR-LNP on the back of the mice, and observe the fluorescence intensity of the residual DiR-LNP / Gel and DiR-LNP on the back of the mice by using small animal live imaging.
[0102] The experimental results Figure 7 show that the fluorescence of the back of the mice in the DiR-LNP / Gel group is significantly stronger than that in the DiR-LNP group, that is, compared with the liquid form of LNP, the gel form of LNP / Gel enhances the retention of DiR on the back skin of the mice after incubation for 30 min, indicating that the preparation of siRNA-LNP into siRNA-LNP / Gel containing 3% HA can significantly improve the skin retention of siRNA.
[0103] Example 7 Androgen receptor siRNA-LNP / Gel treatment of androgenetic alopecia
[0104] The siRNA of the present application is designed to select the gene sequence fragment of the androgen receptor of human and mouse, which can simultaneously target and inhibit the androgen receptor gene of human and mouse, therefore, the present example uses a mouse model to study the effect of siRNA-LNP / Gel in treating androgenetic alopecia.
[0105] (1) Select 6-8 week old male C57BL / 6 mice, and randomly divide them into a healthy group, a model group, an siRNA-LNP / Gel A treatment group, an siRNA-LNP / Gel B treatment group, a minoxidil treatment group, and a finasteride treatment group. Remove the back hair of the mice with depilatory cream, and mark the same designated area with a marker pen. Prepare a 0.1% dihydrotestosterone solution with anhydrous ethanol, and apply 500 μL of the 0.1% dihydrotestosterone solution to the mice in the rest groups with a cotton swab, except for the healthy group.
[0106] (2) On the 1st, 4th, 7th, 10th, 13th, 16th, and 19th day after modeling, administer the drugs to the mice in the rest groups in the marked designated area, except for the healthy group. First, apply 500 μL of 0.1% dihydrotestosterone to the mice in the rest groups with a cotton swab, wait for 30 min for the dihydrotestosterone to be completely absorbed, then administer the drugs according to the grouping, apply 500 μL of the gel to the mice in the siRNA-LNP / Gel A group and the siRNA-LNP / Gel B group with a cotton swab, apply 500 μL of 2% minoxidil liniment to the mice in the minoxidil group with a cotton swab, and give the mice in the finasteride group 200 μL of finasteride solution (diluted according to 1 mg / kg per mouse) by gavage.
[0107] (3) On the 1st, 4th, 7th, 10th, 13th, 16th, 19th, and 22nd day after modeling, the back hair growth of each mouse was photographed to record the hair growth and coverage before administration, and three back hairs were randomly pulled out, measured with a vernier caliper, and the average hair length was calculated.
[0108] The experimental results show that both siRNA-LNP / GelA and siRNA-LNP / GelB have a certain effect on promoting mouse hair growth, specifically, the hair growth rate, hair length, and hair coverage of mice are close to those of the healthy group, and the effect is better than that of the positive control drugs minoxidil and finasteride group, and is much higher than that of the model group.
[0109] According to the back photographing of mice every 3 days, Figure 8 ), the siRNA-LNP / GelA treatment group grew hair on the back significantly on the 13th day, which is faster than the siRNA-LNP / GelB treatment group (16th day), the healthy group (16th day), the minoxidil group (16th day), the finasteride group (19th day), and the model group (19th day). The hair length of the new hair was measured with a vernier caliper, and the results showed that at the end of the experiment, the average hair length of the siRNA-LNP / GelA treatment group reached 10 mm, and the average hair length of the siRNA-LNP / GelB treatment group was 9.5 mm, both of which were longer than the healthy group (8 mm), the minoxidil group (7 mm), the finasteride group (5.5 mm), and the model group (4 mm). According to the photographing record, the coverage rate of the new hair at the end of the experiment was calculated, and the results showed that the hair coverage rate of the siRNA-LNP / GelA treatment group reached 90%, and the hair coverage rate of the siRNA-LNP / GelB treatment group reached 92%, which was close to the healthy group (93%) and higher than the minoxidil group (82%), the finasteride group (60%), and the model group (36%). The coverage rate calculation formula is as follows:
[0110]
[0111] Therefore, siRNA-LNP / GelA and siRNA-LNP / GelB have certain advantages in treating androgenic alopecia, and are better than the positive drugs minoxidil and finasteride in promoting the speed, length, and hair coverage of mouse hair growth, which confirms that the androgen receptor siRNA-LNP / Gel can inhibit the stimulation of androgens on skin hair follicles and promote hair growth.
[0112] Compared with siRNA-LNP / GelB, siRNA-LNP / GelA can improve the hair regrowth speed at the alopecia site, and the mice in the siRNA-LNP / GelA treatment group grow hair obviously on the back on the 13th day, while the mice in the siRNA-LNP / GelB treatment group grow hair on the 16th day; and the average hair length of the mice in the siRNA-LNP / GelA treatment group is also greater than that of the mice in the siRNA-LNP / GelB treatment group at the end of the experiment. Although siRNA-B also has a good inhibitory effect on the androgen receptor gene in the in vitro experiment, the time required for promoting hair regrowth at the alopecia site is obviously greater when the siRNA-LNP / GelB is prepared and applied on the skin surface for treatment than when the siRNA-LNP / GelA is prepared and applied on the skin surface for treatment. This shows that when applied on the skin surface of the alopecia, siRNA-A can exert a therapeutic effect more quickly, shorten the time for hair regrowth at the alopecia site, and better promote hair growth.
[0113] The above-described embodiments only express several embodiments of the present application, and the description is more specific and detailed, but it should not be understood as limiting the scope of the patent. It should be noted that for ordinary skilled in the art, several modifications and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the present application should be subject to the appended claims.
Claims
1. An siRNA that inhibits the expression of androgen receptor, characterized in that, The siRNA comprises a sense strand and an antisense strand, the sense strand is shown as SEQ ID NO. 1, and the antisense strand is shown as SEQ ID NO.
2.
2. A nanoformulation for inhibiting the expression of androgen receptor characterized in that, The siRNA comprises a sense strand and an antisense strand, the sense strand is shown as SEQ ID NO. 1, and the antisense strand is shown as SEQ ID NO.
2.
3. The nanoformulation of claim 2, wherein, The lipid nanoparticles are prepared from raw materials comprising DOTAP, lecithin and cholesterol.
4. The nanoformulation of claim 3, wherein, The mass ratio of the DOTAP, lecithin and cholesterol is 5: (1-3): (2-4). The mass ratio of the siRNA and DOTAP is 1: (8-15).
5. The nanoformulation of claim 4, wherein, The mass ratio of the DOTAP, lecithin and cholesterol is 5: (1-2): (3-4).
6. The method of claim 2 to 5, wherein the nanosized preparation is prepared by a method comprising the steps of: The method comprises the following steps: (1) dissolving the raw materials for preparing the lipid nanoparticles in a solvent to obtain an organic phase; (2) dissolving the siRNA in a solvent to obtain an aqueous phase; (3) stirring the aqueous phase and slowly adding the organic phase thereto while stirring, thereby obtaining the lipid nanoparticles.
7. The method of claim 6, wherein the nanoformulation is prepared by, The solvent in step (1) is anhydrous ethanol; and / or The solvent in step (2) is a 20 mM-30 mM sodium acetate aqueous solution or a 20 mM-30 mM sodium citrate aqueous solution.
8. Use of the siRNA of claim 1 or the nano-preparation of any one of claims 2-5 in the preparation of a medicament for treating androgenetic alopecia.
9. A medicament for treating androgenic alopecia, characterized by, The medicament comprises an active ingredient and a pharmaceutically acceptable carrier; the active ingredient comprises the siRNA of claim 1 and / or the nano-preparation of any one of claims 2-5. The dosage form of the medicament is a gel.
10. The medicament according to claim 9, wherein The gel comprises the nano-preparation and sodium hyaluronate.
Citation Information
Patent Citations
Lna antagonists targeting the androgen receptor
CN101932709A
Double stranded oligonucleotide construct comprising androgen receptor specific sequence, and composition for preventing hair loss and promoting hair growth comprising same
CN113271980A