CONSTRUCTION OF DOUBLE-CHAINED OLIGONUCLOTIDES COMPRISING THE ANDROGEN RECEPTOR-SPECIFIC SEQUENCE AND A COMPOSITION FOR PREVENTING HAIR LOSS AND PROMOTING HAIR GROWTH COMPRISING THE SAME

Abstract

A double-stranded oligonucleotide construct is disclosed, configured such that a hydrophilic material and a hydrophobic material are conjugated through a single covalent bond or a linker-mediated covalent bond at both ends of a double-stranded oligonucleotide in order to efficiently deliver an androgen receptor-specific oligonucleotide in a cell; a nanoparticle capable of being produced by the self-assembly of double-stranded oligonucleotide constructs in an aqueous solution through hydrophobic interactions; and a composition for preventing hair loss or promoting hair growth containing the double-stranded oligonucleotide construct.The construction of double-stranded oligonucleotides that includes the androgen receptor-specific oligonucleotide and the composition to prevent hair loss or promote hair growth containing the same as an active ingredient can suppress the expression of an androgen receptor with high efficiency without side effects, and can thus exhibit excellent effects in preventing hair loss, particularly androgenetic alopecia, alopecia areata and telogen effluvium, and promoting hair growth.

Description

CONSTRUCTION OF DOUBLE-CHAINED OUGONUCLEOTIDES THAT It comprises the specific sequence of the androgen receptor and a composition to prevent hair loss and promote hair growth comprising the same. TECHNICAL FIELD The present invention relates to a double-stranded oligonucleotide construct that includes a specific sequence for the androgen receptor and a composition for preventing hair loss and promoting hair growth containing it, and more particularly to a double-stranded oligonucleotide construct configured such that a hydrophilic material and a hydrophobic material are conjugated through a single scalar bond or a linker-mediated covalent bond at both ends of a double-stranded oligonucleotide in order to efficiently deliver a nucleotide of a specific sequence for the androgen receptor in a cell, a nanoparticle capable of being produced by the self-assembly of double-stranded oligonucleotide constructs in an aqueous solution through hydrophobic interactions.and a composition to prevent hair loss and promote hair growth containing the construction of double-stranded polynucleotides, 20, BACKGROUND OF THE TECHNIQUE Hair plays an important role in protecting the body and enhancing external beauty, and the purpose of hair care is to protect the scalp, maintain healthy hair, improve one's appearance, and five similar benefits. Hair loss is the natural shedding of hair that has stopped growing according to the growth cycle, and in general, severe hair loss has been recognized as a genetic phenomenon that occurs primarily in men.However, in recent years the importance of environmental factors has emerged, such as hair loss due to work-related stress, environmental pollution, exposure to harmful environments, and poor dietary habits. Alopecia has been recognized as a disease referring to a condition characterized by the absence of hair in areas where it should be present. Alopecia is classified into scarring alopecia, characterized by the destruction of hair follicles and their replacement with fibrous tissue, resulting in permanent hair loss, and non-scarring alopecia, characterized by the absence of fibrous tissue and the preservation of hair follicles. Some examples of non-scarring alopecia are telogen effluvium, hereditary androgenetic alopecia, alopecia areata, and anagen effluvium. Hair goes through a "hair cycle" that includes a growth phase, a degeneration phase, a resting phase, and an exogenous phase. The growth phase typically lasts from 2 to 8 years and represents approximately 90% of all hair at any given time. During this phase, the division of cells in the hair's germinal matrix continues in the lower half of the hair bulb, in contact with the dermal papilla, giving rise to the hair. After the growth phase, there is a period in which hair growth stops for a time, called the degeneration phase. This is when the hair enters a resting phase, characterized by the cessation of hair generation and development. During this phase, the hair roots also change, the activity of the hair's germinal matrix cells and pigment cells ceases, and keratin is no longer produced, thus halting hair growth.In the resting phase, the hair bulb shrinks, and hair only falls out during the exogenous phase, during which proteases are known to be involved. Androgens, estrogens, thyroid hormones, spheroids, prolactin, and growth hormone are all believed to be involved as factors controlling hair growth, with androgens being the most important regulator. The most common example of hormone-related hair loss is temporary hair loss after childbirth. During pregnancy, estrogen levels rise and suppress the progression from the growth phase to the resting phase in the hair cycle. Then, estrogen levels decline rapidly after childbirth, and the progression to the resting phase accelerates, resulting in telogen effluvium.Thus, there is hormone-dependent alopecia, but other causes of hair loss include genetic factors, male hormones, aging, circulatory disorders, stress, superoxide radicals, and so on. In these cases, treatment measures can vary depending on the cause. For hair loss caused by male hormones, DHT blockers are used as medication, and the basic mechanism of the blocker is to prevent the conversion of testosterone into the highly active dihydrotestosterone (DHT) by 5-alpha reductase. Since DHT has at least 5 times the capacity to bind to an androgen receptor (AR) than testosterone, it delays the synthesis of proteins in hair follicles, so a substance that blocks the binding to an androgen receptor is used as a drug, preventing the overproduction of DHT (Dalob AX, et al, 1994. J. Clin. Endocnol. Metab.79, 703-709; Ellsworth, K y Harrís G., 1995, Biochem. Btophys. ά Res, Commum 215, 774-780' Kaufman KD,, 2002. Mol and Cell Endocrinclogy. 198, 85-89). In 1942, Hamilton revealed the relationship between hair loss and male hormones. In androgenetic alopecia (AGA), testosterone present in hair root cells is converted into DHT, a potent metabolite. DHT (dihydrotestosterone) binds to an androgen receptor (AR) in hair follicles, inhibiting the activity of adenylate cidase, which enhances intracellular metabolism. This reduces the concentration of cAMP in cells and decreases sugar metabolism, consequently inhibiting energy supply and delaying protein synthesis. This shortens the growth phase of hair follicles, and during the repetition of this phenomenon, the proportion of hair follicles in the resting phase increases, causing the hair to gradually become thin and short.Briefly, it is known that testosterone present in hair root cells, a DHT receptor, which is a hormonal component associated with androgen receptor overexpression, and 5-alpha-reductase activity are important for the appearance of androgenetic alopecia, and also that testosterone is overproduced into dihydrotestosterone (DHT) by 5-alpha reductase, and this metabolite stimulates the production of hair cycle inhibitors to, in this way, shorten the growth phase and inhibit the ability of hair follicles to produce hair (Kaufman KD, 2002. Mo¿ and C© / / . Sndocnnofogy. 198, 89-85; Naife et al., 2008. Br. J. Dermatoi, 159, 300-305). DHT is known to have at least five times the capacity of testosterone to bind to an androgen receptor (AR), and in androgen-specific cells and tissues, DHT is known to be more involved in androgenic activity than testosterone. There are two subtypes of 5-alpha reductase responsible for these metabolic processes, and their functions differ somewhat depending on the tissue. Type 1 5-alpha reductase is present in the sebaceous gland, and type 2 5-alpha reductase is primarily found in the genitourinary tract and hair follicles. Finasteride and dutasteride are drugs that target 5-alpha reductase to suppress the overproduction of DHT. Finasteride is known to act only on type 2 5-alpha reductase, while dutasteride acts on both type 1 and type 2 5-alpha reductases, thus having significant effects on prostate-related diseases. Among them, the drug that has been approved by the The FDA-approved therapeutic agent for baldness is Propeda, which contains finasteride as its main ingredient. Hair loss prevention medications developed to date are primarily single-ingredient drugs, such as minoxidil to promote blood circulation, and finasteride and dutasteride, male hormone inhibitors. More recently, JAK inhibitor drugs (ruxolitinib and tofacitinib) have been approved by the FDA. However, research to find a more effective treatment is ongoing. The androgen receptor is a 110 kDa steroid receptor, and one of its important functions is the transcription of androgen-related genes. The androgen receptor plays an important role in diseases related to male hormones, such as prostate cancer, benign prostatic hyperplasia, male pattern baldness, muscle wasting, and hypertrichosis. For this reason, the androgen receptor has been used as a target for the treatment of men's-specific diseases, such as prostate cancer and male pattern baldness. In the case of the male hormones collectively called androgens, testosterone is produced in the pituitary gland, the adrenal gland, and the testes. It enters the cells of the target organ and is reduced to dihydrotestosterone (DHT) by testosterone β-reductase, after which it binds to the receptor and exerts its action as an androgen.Therefore, as mentioned above, the development of a therapeutic agent for the disease is being sought using a method of suppressing DHT production by inhibiting the action of 5-reductase to reduce testosterone to DHT, or a method of suppressing androgen action by inhibiting the binding of DHT, produced from testosterone, to the receptor. The technology to inhibit gene expression is considered important in the development of therapeutic agents for the treatment of diseases and in the verification of targets. In particular, interfering RNA (hereafter referred to as “RNAi”) has been shown to act on sequence-specific mRNA in various types of mammalian cells since its function was discovered (Silence of transcripts; RNA interference in medicine. J Mol Med (2005) 83: 784-773).When a double-stranded long-stranded RNA is delivered to cells, the delivered double-stranded RNA is processed by an endonuclease called dicer and converted into small interfering RNA (hereafter, 'siRNA') of 21 to 23 double strands (base pair, bp), and the siRNA binds to the RNA-induced silencing complex (RISC), and thus a guide (antisense) strand recognizes and degrades the target mRNA to inhibit the expression of the target gene in a sequence-specific manner (NUCLEIC ACID THERAPEUTICS; BASIC PRINCIPLES AND RECENT APPLICATIONS. Nature Reviews Drug Discovery. 2002. 1, 503-514). According to Bertrand's researchers, siRNA for the same target gene has been reported to have a superior inhibitory effect on mRNA expression in vitro and in vivo compared to antisense oligonucleotides (ASOs), and that the effect is long-lasting (Comparison of antisense oligonucleotides and siRNA in cell culture and in vivo. Blochem. Biophys. Res. Commun. 2002. 2S6: 1000-1004). Furthermore, the mechanism of action of siRNA involves siRNA binding complementaryly to the target mRNA to regulate the expression of the target gene in a sequence-specific manner, and compared to existing antibody-based or chemical drugs (small molecule drugs), it has the advantage that the range of applicable targets can be dramatically expanded (Progress Towards In Vivo Use of siRNA. MOLECULAR THERAPY. 2006). 13(4):664-670). 1S Despite the excellent effect and wide range of use of siRNA, to develop siRNA as a therapeutic agent, siRNA has to be delivered effectively to target cells by improving the stability of siRNA in the body and increasing the efficiency of delivery to cells (HRNAessing in vivo RNAip delivery for drug discovery and therapeutic development Drug Discov. Today. 2006 15 Jan: 11 ¢1-2):67-73). With the aim of solving the above problem, the modification of some nucleotides or siRNA skeletons to confer resistance to nucleases in order to improve their stability in the body is being thoroughly investigated, as well as the use of carriers such as viral vectors, liposomes or nanoparticles. Delivery systems using viral vectors, such as an adenovirus or a retrovirus, have high transfection efficiency but also high immunogenicity and oncogenicity. On the other hand, a non-viral delivery system containing nanoparticles has lower delivery efficiency to cells than a viral delivery system, but is advantageous due to its high intracellular stability, the potential for targeted delivery, an enhanced delivery effect such as the uptake and internalization of RNAi oligonucleotides contained within cells or tissues, and almost no cytotoxicity or immune stimulation. Therefore, it is currently considered a more potent delivery method than the viral delivery system (Nonviral delivery of synthetic siRNAs in intracellular environments. J Clin Injectors December 3, 2007; 117(12): 3023-3632). Regarding the method of using a nanocarrier in the non-viral delivery system, nanoparticles are formed using various polymers, such as liposomes, cationic polymer complexes, and the like. The RNAi is loaded onto such a nanoparticle, i.e., a nanocarrier, and delivered to the cells. Among the methods of using a nanocarrier, a polymeric nanoparticle, a polymeric micelle, a lipoplex, etc., can be used. In particular, the lipoplex is composed of cationic lipids and interacts with the ammoniacal lipids of the cell's endosome, causing the destabilizing effect of the endosome to allow intracellular delivery (Proc. Acad. Sol. 15; 93(21):11493-8, 1996). To improve the efficiency of intracellular siRNA delivery, a technology has been developed to achieve siRNA stability and efficient cell membrane permeability using a siRNA conjugate in which a hydrophilic material (e.g., polyethylene glycol (PEG)) as a biocompatible polymer is conjugated to the siRNA through a single covalent bond or a crosslinked covalent bond (Korean patent No. 883471). However, chemical modification of siRNA and conjugation to polyethylene glycol (PEG) (PEGylation) still present drawbacks such as low intracellular stability and inefficient delivery to target organs.To overcome these drawbacks, a double-stranded oligonucleotide construct has been developed, in which hydrophobic and hydrophobic materials are attached to an oligonucleotide, specifically a double-stranded oligonucleotide such as siRNA. The construct then forms self-assembling nanoparticles called SAMIRNA™ (self-assembled micelle inhibitor RNA) through the hydrophobic interaction of the hydrophobic material (Korean patent No. 1224828). SAMIRNA™ technology has the advantage of producing homogeneous nanoparticles of very small size compared to conventional delivery technologies. As for a specific example of SAMiRNA™ technology, it is used PEG (polyethylene glycol) or HEG (hexaethylene glycol) are hydrophilic materials. PEG is a synthetic polymer often used to increase the solubility of pharmaceuticals, particularly proteins, and to control pharmacokinetics. PEG is a polydisperse material, and a batch of polymers is composed of the sum total of different numbers of monomers. It has a Gaussian molecular weight distribution, and the degree of homogeneity of a material is expressed as the polydispersity index (Mw / Mn). Specifically, when PEG has a low molecular weight (3-5 kDa), it exhibits a polydispersity index of approximately 1.01, while the one with a high molecular weight (20 kDa) shows a high polydispersity index, of approximately 1.2, and therefore, the higher the molecular weight, the lower the homogeneity of the material (FM Veronese. Peptide and protein PEGylation: a review of problems and solutions. Biomaterials (2001) 22*405-417).Therefore, the case in which PEG is combined with a pharmaceutical product presents the disadvantage that it is not easy to verify a single material because the characteristic polydispersity of PEG is reflected in the conjugate. Therefore, there is a trend towards producing materials with a low polydispersity index by improving the synthesis and purification processes of PEG. In particular, in the case where PEG is combined with a material that has a low molecular weight, there are problems due to the polydispersity characteristics of the material, such as a point of difficulty in verifying whether the combination is easily achieved (Francesco M. Veronese and Gianfranco Pasut, PEGylation, successful approach to drug delivery). DRUG DISCOVERY TODAY(2005) 10(21): 1451 -1458). Consequently, in recent years, as an improved form of the existing SAMiRNA™ self-assembled nanoparticles, the hydrophilic material of the double-stranded nucleotide construct that constitutes SAMiRNA™ is locked into a basic unit that includes 1 to 15 homogeneous monomers with a specified molecular weight and, as required, a linker, and by using an appropriate number of blocks as required, a new form of delivery carrier technology has been developed that is smaller in size than the existing SAMiRNA™ and has significantly improved polydispermity. Meanwhile, a report indicates that the global market related to hair loss will reach over $11.8 billion by 2024 (Grand View Research, Inc.). Four out of seven American men and one out of five Chinese men are bald, and in 90% or more of cases, the cause is known to be androgenetic alopecia. However, most hair loss prevention drugs developed to date target DHT and 5-β-reductase, and no hair growth drug or product has been developed that targets the androgen receptor, which is directly related to these hormones. Accordingly, the present inventors have made great efforts to develop a hair growth-related product targeting the androgen receptor, which is directly related to androgens, and have found that a certain sequence specific to an androgen receptor can effectively inhibit the expression of the androgen receptor, and that a double-stranded oligonucleotide construct including the same and a composition containing the construct are highly effective in preventing hair loss or promoting hair growth, thus culminating in the present invention. DIVULGATION It is an object of the present invention to provide a novel oligonucleotide sequence that is specific for an androgen receptor and capable of inhibiting the expression thereof with very high efficacy, and a double-stranded oligonucleotide construct for efficiently delivering the sequence to hair root cells. Another object of the present invention is to provide a nanoparticle containing the construction of double-stranded oligonucleotides. Another object of the present invention is to provide a pharmaceutical composition for preventing hair loss or promoting hair growth containing the novel oligonucleotide sequence or the construction of 10 double-stranded oligonucleotides as an active ingredient. Another object of the present invention is to provide a cosmetic composition for preventing hair loss or promoting hair growth that contains the novel oligonucleotide sequence or the double-stranded oligonucleotide construct as an active ingredient. To achieve the above and other objects, the present invention provides a double-stranded oligonucleotide construct having the structure of the following Structural Formula (1). Structural formula (T) AXRYB In Structural Formula (1), A is a hydrophilic material, B is a material! hydrophobic, each of X and Y independently represents a single covalent bond or a linker-mediated covalent bond, and R represents an androgen receptor-specific oligonucleotide that includes a sense strand containing any sequence selected from the group consisting of SEO ID NOS: 6, 58, 68, 99, 107, 109, 260, 270, 284, 298, 348, 358, 359 and 434 and an antisense strand that includes a sequence complementary to the same. Furthermore, the present invention provides a nanoparticle containing the construction of double-stranded oligonucleotides. Furthermore, the present invention provides a pharmaceutical composition for preventing hair loss or promoting hair growth that contains the double-stranded oligonucleotide construct or nanoparticle as active ingredient 10. Furthermore, the present invention provides a cosmetic composition to prevent hair loss or promote hair growth containing the building block of double-stranded oligonucleotides or nanoparticles as an active ingredient. Furthermore, the present invention provides a method for treating hair loss that includes administering the construct, nanoparticle, or pharmaceutical composition according to the present invention to a subject who needs hair growth, or applying the construct, nanoparticle, or pharmaceutical composition according to the present invention to an area that needs hair growth. Furthermore, the present invention provides a method for preventing hair loss or promoting hair growth, comprising the administration or application of the construct, nanoparticle, or pharmaceutical composition according to the present invention to a subject in need of preventing hair loss or promoting hair growth, or on the corresponding area. Furthermore, the present invention provides for the use of double-stranded oligonucleotide construction to prevent hair loss or promote hair growth. Furthermore, the present invention provides the use of double-stranded oligonucleotide construction to manufacture a drug or cosmetic to prevent hair loss or promote hair growth. Description of iOS drawings FIG. 1 shows a common region of isotherms in the exon map of the human androgen receptor mRNA NMm0Q0044.3 (isoform 1,10,661 bp) and NMjJOl 011645,2 (isoform 2, 8112 bp) for the design of a candidate sequence of human androgen receptor-specific oligonucleotides; FIG. 2 shows a selection process of candidate sequences composed of 19 bases using a 2-base sliding window algorithm in the common region of the platform for a candidate oligonucleotide sequence design specific to the human androgen receptor; FIG, 3 shows the size distribution of double-stranded oligonucleotide nanoparticles, including randomly selected androgen receptor-specific oligonucleotides; Figure 4 shows the results of the primary screening of 544 types of SAMINRs directed to the androgen receptor; FIG. 5 shows the results of the selection of SAMíRNAs that include androgen receptor-specific cligonucleotides for 14 sequences, 5 of which have the greatest inhibitory effect on androgen receptor expression among the screening results of FIG. 4; FIG. 6 shows the results of secondary screening for SAMiRHAs including androgen receptor-specific oligonucleophieds selected through primary screening; FIG. 7 shows the results of the confirmation of the protein expression level of the androgen receptor after treatment of the SAMíRNA construct for the 14 selected sequences and the sequences known in the related literature; FIG. 8 shows the results of the confirmation of the inhibition of 1S protein expression after treatment of the SAMíRNA construct for the two sequences selected from the results of FIG. 7 and sequences from the related literature; and FIG, 9 shows the results of the confirmation of the delivery effect of SAMiRNA nanoparticles in hair root cells using a laser scanning confocal microscope. MODE OF THE INVENTION Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those typically understood by those skilled in the art to which the present invention pertains. In general, the nomenclature used herein and the test method described below are well known in the art and are typical. In the present invention, to select an oligonucleotide capable of targeting an androgen receptor and inhibiting its expression, a 2-base sliding window algorithm was applied to the entire androgen receptor to determine a list of candidate sequences. Finally, 468 candidate sequences with 15 or fewer base identity to RNA sequences with other genes were selected, and the degree of androgen receptor inhibition was tested using a total of 544 oligonucleotide sequences, including 76 siRNA sequences disclosed in the known related literature (U.S. Patent Application Publication No. US 2007-0141009). Consequently, 14 types of oligonucleotides were selected as being particularly effective.Furthermore, the oHgonuleotide was able to be manufactured in a double-stranded oligonucleotide construct, thereby increasing the efficiency of intracellular delivery, thus preventing hair loss and improving the hair growth effect. Therefore, one aspect of the present invention relates to an androgen receptor-specific double-stranded oligonucleotide comprising a sense strand comprising any sequence selected from the group consisting of SEQ ID NOS; 6, 5$, 6% 99sW7, 109, 260, 270, 284, 298, 348, 358, 359 and 434 and an antisense strand comprising a sequence complementary thereto. The bionucleotide polynucleotide according to the present invention is a concept that includes all materials having a general RNAi (RNA interference) action, and the androgen receptor-specific sequence also includes androgen receptor-specific siRNA, etc., as will be obvious to those with ordinary knowledge in the art to which the present invention pertains. Conventional methods for delivering siRNA to target cells remain problematic in that siRNA is delivered to the cell through the cell membrane and, therefore, its activity decreases as it moves from the cell's endosome to the cytoplasm, and it is also readily degraded by lyases present in the cell. Furthermore, a DNA-RNA hybrid, in which antisense oligonucleotide DNA is combined with siRNA to degrade the target mRNA, is more stable than conventional double-stranded oligonucleotide RNA in vivo. The DNA portion of this hybrid has an aptamer base sequence capable of binding to the target protein, thus enabling efficient delivery to target cells. DNA-RNA hybrids have a siRNA base sequence that inhibits the expression of RNA as protein, so they bind to the target mRNA in target cells and suppress gene expression. These DNA-RNA hybrid particles are composed solely of biomaterials, are non-toxic, and are highly resistant to DNase and RNase, which are nucleic acids present in the body, thus they can be considered a new technology for RNAi. Furthermore, provided that the specificity for the androgen receptor 5 is maintained, in the sense strand including any sequence selected from the group consisting of SEQ ID NO; 1 to SEQ ID NO: 468 or the antisense strand complementary thereto, it shall be obvious to those of ordinary knowledge in the art to which the present invention pertains that the androgen receptor-specific siRNA including the sense strand including the sequence characterized in that at least one base is substituted, deleted or inserted and the antisense strand also being incorporated within the scope of the present invention. SEQ ID NOS: 1 to 468 are human androgen receptor-specific sequences, and are RNA sense strand sequences that have 15 or fewer base sequence homology with other androgen receptor mRNA sites (Table 2). In addition, SEQ ID NOS: 469 to 544 represent human androgen receptor-specific siRNA sequences known from an existing patent (US 2007-0141009) (Table 3). According to the present invention, as a result of comparing intracellular activity with the androgen receptor-specific oligonucleotide sequence disclosed in the existing patent, it was possible to discover an RNA sequence that has superior efficiency and lower homology with other human mRNAs. The oligonucleotide according to the present invention is preferably an androgen receptor-specific oligonucleotide comprising any sequence selected from the group consisting of SEQ ID NO: 6, 58, 68, 99, 107, 109, 260, 270, 284, 298, 348, 358, 359, and 434 as the sense strand, and more preferably an androgen receptor-specific oligonucleotide comprising the sequence SEQ ID NO: 68 or 109 as the sense strand. The sense strand or the antisense strand of the polynucleotides according to the present invention is preferably composed of 19 to 31 nucleotides, and the 19th sense strand comprising any sequence selected from SEQID NO: SEQ ID NO: 468 and the antisense strand would complement it. Since the androgen receptor-specific oligonucleotide according to the present invention has a base sequence designed to bind complementarily to the mRNA encoding the corresponding gene, it is characterized in that it is capable of effectively suppressing the expression of the corresponding gene. Furthermore, it may include a protrusion, which is a structure comprising one, two, or more unpaired nucleotides at the 3' end of the oligonucleotide. Furthermore, to improve the stability of the oligonucleotide, various modifications can be included to confer resistance to nucleic acids and reduce non-specific immune responses. These modifications involve the first or second oligonucleotide that constitutes the oligonucleotide.at least one modification selected from a modification characterized in that the -OH group at the carbon 2' position of the sugar structure in at least one nucleotide is replaced by -CH3 (methyl), -OCH5 (methoxy), -NH3, -F (fluorine), -O-2-methoxyethyl-Q, -O-2-methylthioethyl, -O-3-aminopropyl, -O-3-dimethylaminopropyl, -ON-methylacetamido or O-dimethylamidooxyethyl; a modification characterized in that the oxygen of the sugar structure of the nucleotide is replaced by sulfur; and a modification of the nucleotide linkages to phosphorothioate, boranophosphate, or methyl phosphonate linkages, which may be used in combination, and the modification in PNA (peptide nucleic acid), LNA (locked nucleic acid), or UNA (unlocked nucleic acid) may also be used (Ann, Rev. Med. 55, 61-65 2064; US 5,660,985; US 5,958,691; US ​​6,531,584; US 5,808,023; US 6,326,358; US 6,175,001; Bioorg, Med. Chem. Lett. 14:1139-1143,2003: RNA. 9:1034-1048» 2003; Nudeic Acid Res.31:589-595, 2003; Nucleio Adds Research, 38(17) 5761-5773, 2010; Nucteic Acids Research. 39(5) 1823-1832, 2011). The androgen receptor-specific otigonudeotide according to the present invention not only inhibits the expression of the corresponding gene, but also significantly inhibits the expression of the corresponding protein. In an alternative embodiment, the present invention provides a conjugate in which a hydrophilic material and a hydrophobic material are conjugated to both ends of a double-stranded oligonucleotide to improve the stability and efficient delivery of the androgen receptor-specific double-stranded oligonucleotide. As described above, the double-stranded oligonucleotide conjugate in which a hydrophilic and a hydrophobic material are attached to a double-stranded oligonucleotide can be formed into self-assembled nanoparticles through the hydrophobic interaction of the hydrophobic material 5 (Korean patent No. 1224828). Such nanoparticles have the advantages of much higher delivery efficiency in the body and stability therein, as well as excellent particle size uniformity, making quality control easy and the drug manufacturing process simple. Therefore, another aspect of the present invention relates to a double-stranded oligonucleotide construction having the structure of the following Structural Formula (1). Structural Formula (1) AXRYB In Structural Formula (1), A is a hydrophilic material, B is a hydrophobic material, each of X and Y independently represents a single covalent bond or a crosslinked covalent bond, and R represents an androgen receptor-specific nucleotide comprising a sense strand including any sequence selected from the group consisting of SEQ ID NOS: 6, 58, 68, 99, 107, 109, 260, 270, 284, 298, 348, 358, 359 and 434 and an antisense strand comprising a sequence complementary to the same. More preferably, the double-stranded oligonucleotide construction comprising the androgen receptor-specific oligonucleotide 22 according to the present invention has the structure of the following Structural Formula (2). AXSVB Structural formula (2) In Structural Formula (2), A:B, X and Y are as defined in the Structural Formula (1), S represents the sense strand of the androgen receptor-specific oligonucleotide, and AS represents the antisense strand of the androgen receptor-specific oligonucleotide. More preferably, the double-stranded oligonucleotide construct comprising the androgen receptor-specific oligonucleotide has the structure of Structural Formula (3) or (4) shown below. A - X - 5' S r - ¥ - 8 AS Structural formula (3) a ~ x - ® sr - y - a as Structural formula (4) In Structural Formula (3) and in Structural Formula (4), A, 8, S AS, X and Y are as defined in Structural Formula (i), and 5* and 3' represent a 5' end and a 3' end of the sense strand of the androgen receptor-specific oligonucleotide. The double-stranded oligonucleotide construction comprising the androgen receptor-specific oligonucleotide from Structural Formula (1) to Structural Formula (4) can be configured so that one to three 2' phosphate groups are attached to the 5' end of the antisense strand, and hsRNA can be used instead of RNA, as will be obvious to those with ordinary knowledge in the art to which the present invention pertains. The hydrophilic material from Structural Formula (1) to Structural Formula (4) is preferably a polymeric material having a molecular weight of 200 to 10,000 and more preferably a polymeric material having a molecular weight of 1,000 to 2,000. Examples of the hydrophilic polymeric material preferably include, but are not necessarily limited to, non-ionic hydrophilic polymeric compounds such as polyethylene glycol, polyvinylpyrrolidone, polyhydroxyazoline, and the like. In particular, the hydrophilic material A of Structural Formula (1) to Structural Formula (4) can be used in the form of a hydrophilic material block, as represented in Structural Formula (5) or Structural Formula (6) below. By using the appropriate number of such hydrophilic material blocks (n in Structural Formula (5) or Structural Formula (6)1 15 depending on the need, the problems due to polydispersity that can occur when using general synthetic polymeric materials can be greatly mitigated. (AW)n Structural Formula I (5) (J-A'm)n Structural Formula (6) In Structural Formula (5) or Structural Formula (6), A* is a monomer of hydrophilic material, J is a linker to connect m monomers of hydrophilic material to each other or to connect m monomers of hydrophilic material and ARÑip among themselves, m is an integer from 1 to 15, n is an integer from 1 to 10, and the repeating unit represented by (A'm-J) or (J-Ab) corresponds to the basic unit of the hydrophilic material block. When using the block of hydrophilic material as in Structural Formula (5) or Structural Formula (6), the double-stranded oligonucleotide construction comprising the androgen receptor-specific oligonucleotide according to the present invention may have the structure of Structural Formula (7) or Structural Formula (8) indicated below. (AW)irX«R*Y*8 Structural formula (7) 1Q (JA mfeX-R~¥-B Structural formula (8) In Structural Formula (7) and in Structural Formula (8), X, R, Y and B are those defined in Structural Formula (1), and A', J, m and n are those defined in Structural Formula (5) and in Structural Formula (6). In Structural Formula (5) and Structural Formula (8), the hydrophilic material monomer A can be used without limitation, provided it fulfills the purpose of the present invention, from among the monomers of a nonionic hydrophilic polymer, and is preferably a monomer selected from Compound (1) and Compound (3) shown in Table 1 below, and more preferably a monomer of Compound (1). In Compound (1), G is preferably selected from CH1, O, S, and NH. In particular, among the monomers of hydrophilic material, the monomer represented by Compound (1) is advantageous because various functional groups can be introduced into it and also because it has good in vivo affinity and excellent biocompatibility, such as inducing a lower immune response, increasing the in vivo stability of the oligonucleotides contained in the construct according to Structural Formula (7) or Structural Formula (8), 5 and increasing the delivery efficiency thereof, making it very suitable for the manufacture of the construct according to the present invention. Board Structure of the hydrophilic material monomer in the present invention It is particularly preferable that the hydrophilic material of Structural Formula (5) to Structural Formula (8) have a total molecular weight in the range of 1,000 to 2,000. Therefore, for example, when hexaethylene glycol is used according to Compound (1) in Structural Formula (7) and Structural Formula (8), i.e., a material in which G is O and m is 6, the molecular weight of the hexaethylene glycol spacer is 344, so the number of repeats n is preferably from 3 to 5. In particular, the present invention is characterized in that the repeating unit of the hydrophilic group, represented as (A'm-J) or (3»A%)L in Structural Formula (5) and in Structural Formula (6), namely, a block of hydrophilic material, can be used in an appropriate number, represented by n, as required.The hydrophilic material monomer A and the linker J included in each of the hydrophilic material blocks can be independently the same or different in the hydrophilic material blocks. Specifically, when three blocks of hydrophilic material (n~3) are used, the first block can include the hydrophilic material monomer according to compound (0), the second block can include the hydrophilic material monomer according to compound (2), and the third block can include the hydrophilic material monomer according to compound (3). Thus, 10 different hydrophilic material monomers can be used for all hydrophilic material blocks, or any hydrophilic material monomer selected from the hydrophilic material monomers according to Compound (1) to Compound (3) can be used identically for all hydrophilic material blocks. Likewise, the linker that mediates the joining of the hydrophilic material monomers can also use the same linker for each hydrophilic material block or a different linker for each hydrophilic material block.Furthermore, m, which is the number of monomers of hydrophilic material, can be the same or different in the blocks of hydrophilic material. Specifically, three monomers of hydrophilic material (m-3) can be connected in the first block of hydrophilic material, five monomers of hydrophilic material (m-5) can be connected in the second block of hydrophilic material, and four monomers of hydrophilic material (m-4) can be connected in the third block of hydrophilic material. Thus, different numbers of monomers of hydrophilic material can be used, or the same number of monomers of hydrophilic material can be used in all blocks of hydrophilic material. Furthermore, in the present invention, the linker J is preferably selected from the group consisting of POy, SO3, and COs, but is not limited to them. Any linker may be used, provided it fulfills the purpose of the present invention depending on the monomer of the hydrophilic material used, as will be obvious to those with ordinary knowledge in the art. The hydrophobic material δ in Structural Formula (1) to Structural Formula (4), Structural Formula (7), and Structural Formula (8) plays a role in the formation of nanoparticles composed of oligonucleotide constructs according to Structural Formula (1) to Structural Formula (4), Structural Formula (7), and Structural Formula (8) through hydrophobic interaction. The hydrophobic material preferably has a molecular weight of 250 to 1,000, and examples thereof may include, but are not limited to, a steroid derivative, a glyceride derivative, glycerol ether, polypropylene glycol, an unsaturated or saturated hydrocarbon, Cn-C6 diacylphosphatidylcholine, fatty acid, phospholipid, lipopolyamin, and the like, and any hydrophobic material may be used as long as it meets the purpose of the present invention, as will be obvious to those of ordinary skill in the art to which the present invention pertains. The steroid derivative may be selected from the group consisting of cholesterol, cholestanol, cholic acid, cholesterol formate, cholestanyl formate, and cholesterol amine, and the glyceride derivative may be selected from mono-, di-, and triglycerides. Here, the fatty acid of the glyceride is preferably an unsaturated or saturated citric acid. In particular, among hydrophobic materials, saturated or unsaturated hydrocarbons or cholesterol are preferred, since they have the advantage of being able to be easily joined in the synthesis stage of the oligonucleotide construction according to the present invention, and a Cay hydrocarbon, in particular a form containing a disulfide bond, is the most preferable. The hydrophobic material is attached to the distal end of the hydrophilic material, and can be attached to any position on the sense or antisense strand of the oligonucleotide. The hydrophilic or hydrophobic material and the androgen receptor-specific oligonucleotide in Structural Formula (1) to Structural Formula (4), Structural Formula (7), and Structural Formula (8) according to the present invention are joined by a single covalent bond or a covalent bond mediated by a linker (X or Y). The linker mediating the covalent bond is covalently attached to the end of the hydrophilic or hydrophobic material and the androgen receptor-specific oligonucleotide, and is not particularly restricted, provided that it provides a cleavage bond in a specific environment as required.Therefore, the linker can be any compound that binds to activate the specific androgen receptor oligonucleotide and / or the hydrophilic (or hydrophobic) material during the manufacturing process of constructing bi-athenane oligonucleotides according to the present invention. The linker can be a non-cleaving or a cleaving bond. In this case, the non-cleaving bond can be an amide bond or a phosphate bond, and the cleaving bond can be a disulfide bond, an acid-cleaving bond, an ester bond, an anhydride bond, a biodegradable bond, or an enzyme-cleaving bond, but the present invention is not limited to this. Furthermore, the androgen receptor-specific oligonucleotide 10 represented by R (or S and AS) in Structural Formula (i) to Structural Formula (4), Structural Formula (7), and Structural Formula (8) may be used without limitation, provided it is a sequence capable of specifically binding to the androgen receptor mRNA. In the present invention, the androgen receptor-specific oligonucleotide preferably comprises a forward strand comprising any sequence selected from the group consisting of SEQ ID NOS: 6, 58, 68, 99, 107, 109, 260, 270, 284, 298, 348, 358, 359, and 434, and an antisense strand comprising a sequence complementary thereto. In particular, the siRNA contained in the structural formula (1) to the Structural Formula (4), Structural Formula (7) and Structural Formula (8) according to the present invention is preferably an androgen receptor-specific oligonucleotide comprising a sense strand comprising any sequence selected from the group consisting of SEQ ID NOS; 6, 58, 68, 99, 107, W9, 200, 270, 284, 298, 348, 358, 359 and 434 and an antisense strand comprising a sequence complementary thereto. In the construction of double-stranded oligonucleotides including the androgen receptor-specific oligonucleotide 5 according to the present invention, an amine group or a polyhistidine group may be additionally introduced into an end portion of the hydrophilic material opposite an end portion attached to the oligonucleotide. This serves to facilitate the intracellular introduction of the carrier of the double-stranded oligonucleotide construct 19, which includes the androgen receptor-specific oligonucleotide according to the present invention, and its escape from the endosome. To facilitate the intracellular introduction of the carrier, such as a quantum dot, dendrimer, liposome, etc., and its escape from the endosome, the use of an amine group and a polyhistidine group 15, and their effects, have been reported. Specifically, the modified primary amine group at the end or on the outside of the carrier forms a conjugate through electrostatic interaction with a negatively charged gene while protonated at the pH m in vivo, and after intracellular introduction of the same, the carrier can be protected from lysosomal degradation because escape from the endosome is facilitated due to the buffering effect of the internal tertiary amine at the low pH of the endosome (Gene transfer and expression inhibition using polymer-based hybrid). 31, materials. Polymer Sci. TechnoL, Vol. 23, No. 3, pp. 254–259). Furthermore, histidine, a non-essential amino acid, has imidazoline (pKa3 6.04) at the (-R) residue, thus effectively increasing the buffering capacity in endosomes and lyscosomes. Therefore, modification of histidine is known to be used to increase the efficiency of endosome escape in non-viral gene carriers, including liposomes (Novel histidine-conjugated galalootosyiated oationic liposomes for efficient hepatocyte selective gene transfer in human hepatoma HepG2 cells. J. Controlled Release 116, pp. 262–270). The amine group or the polyhistidine group can be connected to a hydrophilic material or to a block of hydrophilic material through at least one linker. When an amine group or a polyhistidine group is introduced into the hydrophilic material of the bi-athenane oligonucleotide construction according to the structural formula (1) of the present invention, the structure of the structural formula (9) can be represented. P-JvJa-AXRYB Structural Formula (9) In Structural Formula (9), A, B, R, X and Y are as defined in the Structural formula (1). P represents an amine group or a polyhistidine group, di and Js are linkers, 2 or J iy J¿ can be selected independently from a single-valued bond, POa-, SO3(COs, alkyl Cz-a alkenyl and alkynyl, but are not limited to this, and depending on the type of hydrophilic material used, any bonded? for di and Js can be used, provided it meets the purpose of the present invention, as will be obvious to those with ordinary knowledge in the field. When an amine group is introduced, Ja is preferably a single covalent bond or PO3-, and di is preferably Ce alkylated, but the present invention is not limited to this. Likewise, when a polyhistidine group is introduced, in the Structural Formula (9), Js is preferably a Single covalent bond or POs-, and Ji is preferably the following Compound (4), but the present invention is not limited to this. Pi-t» -*w / \ f \ / Compound (4) Furthermore, when the hydrophilic material of the construction of bicaphenary oligonucleotides according to Structural Formula (9) is a block of hydrophilic material according to Structural Formula (5) or Structural Formula (6), and also when an amine group or a polyhistidine group is introduced into it, the structure of Structural Formula (10) or Structural Formula (11) can be represented. P-Jx-Js-fA'nvJin-XRYB Structural formula (10) PJ<-J2-(JA%)nX*R-Yd3 Structural formula (11) 3 In Structural Formula (10) and in Structural Formula (11), X, R, Y, B. A\ J, my π are those defined in Structural Formula (5) or in Structural Formula (6), and P, Ji and Ja are those defined in Structural Formula (9). In particular, in Structural Formula (10) and in Structural Formula 5 (11), the hydrophilic material is preferably provided in the form of attachment to the 3' end of the sense strand of the androgen receptor-specific pygonucleotide. Here, Structural Formula (9) to Structural Formula (11) can have the form of Structural Formula (12) to Structural Formula (14) below. FM.-J^AXB* S rYB AS Structural formula (12) Structural formula (13) S 5'^8 - Structural formula (14) In Structural Formula (1¿) to Structural Formula (14), X, R, Y, B, A. A\ J, m, η, P, Ji and Js are as defined in Structural Formula (9) to Structural Formula (11), and 5' and 3' represent a 5' end and a 3' end of the 15 sense strand of the androgen receptor-specific oligonucleotide. The amino group that can be introduced in the present invention can be primary to tertiary amino groups, with the use of a primary amino group being particularly preferable. The introduced amino group can be provided as an amine salt, and, for example, the salt of the primary amino group can be provided in the form of NH₄⁺. Furthermore, the polyhistidine group that may be introduced in the present invention preferably comprises from 3 to 10 histidines, particularly preferably from 5 to 8 histidines, and more preferably 6 histidines. Additionally, at least one cisterna may be included, in addition to the histidine. Meanwhile, when the double-stranded oligonucleotide construct comprising the androgen receptor-specific oligonucleotide according to the present invention and the nanoparticle formed therefrom are provided with an orientation fraction, the delivery thereof to the target cells is efficiently promoted, and therefore it can be delivered even at a relatively low dose to the target cells to exhibit a high function of regulating the expression of the target gene, and is able to prevent the delivery of non-androgen receptor-specific oligonucleotides to other organs and cells. Accordingly, the present invention provides a double-stranded oligonucleotide construct configured such that a ligand L, in particular a ligand having the property of specifically binding to a receptor that promotes internalization of the target cell via receptor-mediated endocytosis (RME), is further bound to the construct according to Structural Formula (1), Structural Formula (4), Structural Formula (7), and Structural Formula (8). For example, the form characterized in which the ligand binds to the double-stranded oligonucleotide construct according to Structural Formula (1) has the structure of the following Structural Formula (15). (UZ)-AX-RRAB Structural formula (15) In Structural Formula (15), A, B, X and Y are as defined in Structural Formula (1), L is a ligand that has the property of specifically binding to a receptor that promotes the internalization of the target cell through receptor-mediated endocytosis (RME), er is an integer from 1 to 5, preferably an integer from 1 to 3. The ligand of Structural Formula (15) is preferably selected from target receptor-specific antibodies, aptamers, and peptides or having RIME properties capable of promoting cell internalization in a manner specific to the target cell, and chemical materials including folate (the terms folate and folic acid are generally used interchangeably, and folate, as used herein, means folate in a natural state or an activated state in the human body), hexoamine such as N-acetylgalactosamine (NAG), a sugar or carbohydrate such as glucose or mannose, and the like, but not limited to. Furthermore, the hydrophilic material A of Structural Formula (15) can be used in the form of a hydrophilic material block according to Structural Formula (5) and Structural Formula (6). In another aspect of the present invention, it pertains to a nanoparticle comprising the construction of a double-stranded oligonucleotide comprising the androgen receptor-specific oligonucleotide. As previously described, the bio-atomized oligonucleotide construct comprising the androgen receptor-specific oligonucleotide is amphiphilic because it contains both hydrophobic and hydrophilic materials. The hydrophilic portion has an affinity for water molecules present in the body through interactions such as hydrogen bonds and is therefore oriented outwards. The hydrophobic materials are oriented inwards through hydrophobic interactions between them, thus forming a thermodynamically stable nanoparticle. Specifically, the hydrophobic material is located in the center of the nanoparticle, and the hydrophilic material is located in the outward direction of the androgen receptor-specific oligonucleotide, resulting in a nanoparticle with a shape that protects the androgen receptor-specific oligonucleotide.The nanoparticle thus formed improves intracellular delivery of the androgen receptor-specific oligonucleotide and increases the oligonucleotide's effectiveness. The nanoparticle according to the present invention can be formed solely from a double-stranded oligonucleotide construct comprising an oligonucleotide having the same sequence, or it can also be composed of a double-stranded oligonucleotide construct comprising an oligonucleotide having a different sequence. In the present invention, the oligonucleotide having the different sequence can be an oligonucleotide specific for a different androgen receptor as the target gene, and different sequences can be incorporated while maintaining the same target gene specificity. Also, a double-stranded oligonucleotide construct comprising siRNA specific for other genes related to hair loss, in addition to the oligonucleotide specific for the androgen receptor, may be included in the scope of nanoparticles according to the present invention. Another aspect of the present invention relates to a pharmaceutical composition for preventing hair loss, in particular androgenetic alopecia, or for promoting hair growth, containing, as an active ingredient, a double-stranded oligonucleotide specific to the androgen receptor, a double-stranded oligonucleotide construct including the same, and / or a nanoparticle including the double-stranded oligonucleotide construct. The pharmaceutical composition may be used for a formulation selected from, but is not limited to, ointment, paste, gel, jelly, serum, aerosol, non-aerosol aerosol, foam, cream, lotion, solution and suspension formulations. The composition according to the present invention has a hair loss prevention effect or an effect of inducing hair growth by inhibiting the binding of DHT, which is a metabolite of testosterone, to an androgen receptor. In addition to the double-stranded oligonucleotide according to the present invention or the construction thereof, the composition according to the present invention may also include a double-stranded oligonucleotide specific to a gene related to hair loss disease other than the androgen receptor or a double-stranded oligonucleotide construct comprising the same, The composition according to the present invention can be applied to hair loss associated with a gene involved in the uplink or downlink signaling of the androgen receptor, in particular androgenetic alopecia, but is not limited to it. The composition of the present invention may be manufactured to include at least one pharmaceutically acceptable carrier in addition to the active ingredient. The pharmaceutically acceptable carrier must be compatible with the active ingredient of the present invention and may include saline solution, sterile water, Ringer's solution, buffered saline solution, dextrose solution, maltodextrin solution, glycerol, and ethanol, which may be used alone or in combinations of two or more of them. Other typical additives, such as antioxidants, inhibitors, bacteriostatic agents, and the like, may be added as required. Furthermore, diluents, dispersants, surfactants, binders, and lubricants may be added to manufacture injectable formulations such as aqueous solutions, suspensions, emulsions, and the like. In particular, a lyophilized formulation is preferred.To manufacture a lyophilized formulation, a method commonly known in the art to which the present invention belongs may be used, and a stabilizer for lyophilization may be added. In addition, a formulation is preferably manufactured according to each disease or component using an appropriate method in the art or using a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, 5 Easton PA). The quantity and method of administration of the active ingredient, etc., contained in the composition of the present invention can be determined by a person skilled in the art based on the symptoms and severity of an individual's hair loss. Furthermore, the composition of the present invention can be formulated in various forms, such as powders, tablets, injections, ointments, and the like, and can be supplied in unit-dose or multi-dose containers, such as ampoules and sealed vials. In another aspect of the present invention, it provides a cosmetic composition for preventing hair loss, particularly androgenetic alopecia 15, or for promoting hair growth, containing, as an active ingredient, a double-stranded oligonucleotide specific for the androgen receptor, a double-stranded oligonucleotide construct comprising the same, and / or a nanoparticle including the double-stranded oligonucleotide construct. The composition can be used for a selected formulation from among hair tonic, hair conditioner, hair essence, hair lotion, hair nutrition lotion, hair shampoo, hair rinse, hair treatment, cream. hair, hair nutrition cream, hair hydration cream, hair massage cream, hair wax, hair spray, hair pack, hair nutrition pack, hair soap, hair cleansing foam, hair oil, hair drying agent, hair preservative, hair dye, hair waving agent, hair bleach, hair gel 5, hair polish, hair dressing, hairspray, hair moisturizing cream, hair foam and hair spray formulations, but not limited to it. Another aspect of the present invention provides a method for treating hair loss comprising administering the construct, nanoparticle, or pharmaceutical composition according to the present invention to a subject who needs hair growth, or applying the construct, nanoparticle, or pharmaceutical composition according to the present invention to an area that needs hair growth. Furthermore, the present invention relates to a method of preventing hair loss or promoting hair growth comprising administering or applying the construct, nanoparticle, or pharmaceutical composition according to the present invention to a subject who needs to prevent hair loss or promote hair growth, or on the relevant area. Furthermore, the present invention relates to the use of the construct of 20 double-stranded oligonucleotides to prevent hair loss or promote hair growth. Furthermore, the present invention relates to the use of the construction of double-stranded oligonucleotides to manufacture a drug or a cosmetic to prevent hair loss or promote hair growth. Hair loss in the present invention includes androgenetic alopecia, alopecia amata, and telogen effluvium. A better understanding of the present invention may be obtained through the following examples. These examples are set forth simply to illustrate the present invention and should not be construed as limiting the scope of the present invention, as will be evident to those of ordinary knowledge in the art. Example 1. Algorithm and selection of candidate sequences for the screening of oligonucleotides targeting the androgen receptor A high-throughput drug screening method based on siRNA is able to generate all possible candidate sequences by applying a 1 or 2 base sliding window algorithm to the total mRNA and also to eliminate the 15 unnecessary candidate sequences by homology filtering, thus confirming the degree of gene expression inhibition for all the finally selected oligonucleotides. First, the candidate oligonucleotide sequence design process for the androgen receptor was carried out by extracting the common 20 isotherm region from the exon map of the human androgen receptor mRNA NM_000044.3 (isotherm 1, 10,661 bp) and NMJ)Q 1011645.2 (isotherm 2, 8112 bp), and applying a 2-base sliding window algorithm to the common region of the extracted isoform, thereby selecting 3,956 candidate sequences composed of 19 bases. From the list of selected oligonucleotide candidate sequences, 468 candidate sequences were ultimately selected that had an identity of 5 to 15 bases or less to RNA sequences with other genes when the BLAST e-value for the total human reference RNA sequence was 100 or less. Here, an experiment was performed on the extent of androgen receptor expression inhibition using a total of 544 oligonucleotide sequences that included 76 siRNA sequences mentioned in the previously known related literature (U.S. Patent Application Publication No. US 2007-0141009). Table 2 Candidate androgen receptor-specific oligonucleotide sequence selected by 2-base sliding window screening SEQ ID NO; Accession No. Position Sense strand sequence 1 NMJ00044.3 2730757 ACTGCCÁGGGACCÁTGTTT 2 NM_000044.3 2741-2759 TGCCAGGGACGATGTTTTG 3 NMJ3000443-2716 CCAGGGACCATGTTTTGCC 4 NM_00Q044.3 2745-2763 AGGGACCATGTTTTGCCCA 5 NM„000044,3 2755-2773 TTTTGCCCATTGACTATTA 6 NM_000044.3 2757575GCCATTATTGATT 7 Ν ΙΟ00044 3 2763-2781 ATTGACTATTACTTTCCAC 8 ΝΜ_0000443 2765-2783 TGACTATTACTTTCCACCC | δ ΝΜ„000044.3 2767-2785 AGTATTACTTTGCACGCGA 10 ΝΙΟ000443 2760-2787 TATTACWCCACCCCAGÁ of ΝΜ„000044.3 2785-2885-28AC03 AGTATGCTGCTG ΝΜ„000044.3 2861-2879 CTTCTTCAAAAGAGCCGCT 13 ΝΜ„000044.3 2921-2939 CACTATTGATAAATTCCGA 14 NIOQO0443 2923-2941 CTATTGATAAA140000Μ 2947-2965 ATTGTCCATCTTGTCGTCT 16 ÑO00044.3 2959-2977 GTCGTCTTCGGAMTGTTA 17 NIO0Q044.3 2965-2983 tfCGGAAATGTTATGAAGC Ϊ8 ÑM ÑM ÑM00400494-2987. AATGTTATGAAGCAGGAT 19 NMJ300044J 3093-3111 CTGACAGTGTCACACATTG 20 ΝΜ„000044,3 3111-3129 GAAGGCTATGAATGTCAGC 21 NMj00044(3 3 ϊ 69-3 877 ϊGGACTGGACT22 ΝΜ„000044.3 3171-3189 GTGfGtGCTGGACACGACÁ 23 ΝΜ„000044.3 3189-3207 AACAACCAGCCCGACTCCT 24 ΝΜ„ΟΟΟΟ443 3171-3171-CCCCGTCCTGCTG ΝΜ 000044,3 3217-3235 TGCTCTCTAGGCTCAATGA 26 ΝΜ 000044,3 3243-3261 gagAgacágcttgtacacg faith 27 NMJOO044.3 3251-3269 gcttgtacacgtggtcaag 28 NM_000Q44.3 3253-3271 TTGTACACGTGGTCAAGTG 29 NMJ00044.3 3255-3273 GTACACGTCAGGGGGG3253-3273 NM_000044.3 3257'3275 ACACGTGGTCAAGTGGGCC 31 NMm000044.3 3259-3277 ACGTGGTCAAGTGGGCCAA 32 NMJ00044.3 3263'3281 GGCAAGGGCCG3.3259-3277 NM„000044.3 3285-3303 CCTGGCTTCCGCAACTTAC 34 NM„000044,3 3287-3305 TGGCTTCCGCAACTTACAC 35 NM„Q00044.3 3289-3307 gcttccgca„3 3291-3309 TTCCGGAACTTACACGTGG 37 NM_000044.3 3293-3311 GCGCÁACfTAQACGTGGAC 38 NM„000044.3 3295-3313 GCAACTTACACGTGGACGA 39 NM„3003034 CACGTGGACGACCAGATGG 40 NM„0OOO44.3 3309’3327 GACGACCAGATGGCTGTCA 41 NM„000044J 3325-3343 TCATTCAGTACTCCTGGAT 42 NMJ00044.3 3347-3365 gctcatggtgtttgccatg 43 NMm0Ó0Q44.3 3361-3379 CCATGGGCTGGCGATCCTT 44 NM„000044.3 3369-3387 TGGCGATCCTTCACCAATG 45 NM 000044.3 3385’3403 atgtcaactccaggatgct 46 NMJ)00044.3 3391-3409 ACTCCAGGATGCTCTACTT 47 NMJ00044.3 3395-3413 CAGGATGCTCTACTTCGCC 48 NMJ)00Q443 3397-3415 GGATGCTCTACTTCGCCCG 49 NM_000044.3 3399-3417 atggtctacttcgcccctg 50 NM_000044.3 3401-3419 GCTCTACTTGGCCCCTGAT 51 ÑM„000Ó44.3 3403-3421 TCTACTTCGCCCCTO 52 NMJ00044.3 3405-3423 TACnCGCCCCTGATCTGG 53 5 NM„000044.3 3407-3425 CTTCGGCCCTGATCTGGTT 54 NIO0Q044.3 3409-3427 TCGCCCCTGATC^ 55 NM_OQ0044,3 3411-3429 GCCQCTGATQTGGTm 56 NM„00QQ44.3 3413-3431 CCGTGATCTGGTTnCAAT 57 NM„00Q044.3 3427-3445 TGAATGAGTACCGCATGCA 58 NM„000044í3 3429-3447 aAtgagtaccgcatgcaca 59 NM„00Q044.3 3435-3453 TACCGGATGCAGAAGTCCC 60 NMj00Q44Í 3437-3455 CCGCATGCACAAGTCCCGG 61 NMmOO0O44.3 3439-3457 GCATGCACAAGTCCCGGAT 62 NMm000044.3 3451-3469 GGCGGATGTACAGCCAGTG 63 NM_000044.3 3461-3479 CAGTCCGTCCGAGT64 NM„OOO044.3 3463-3481 GCCAGTGfGTCCdAATGAG 1 65 NM„000044.3 3465-3483 CAGTGTGTCCGAATGAGGC |66 1 NM„000044.3 3469-3487 GGTGATCGAATGGTCCGAATGAGGC 67 NMJ300044.3 3470-3497 GAGGCACCTCTCTCAÁGAG 68 ΝΜ 000044.3 3495-3613 GAGTTTGGATGGCfGGAAA 69 NMJ00044.3 3507-3525 CAATCCAGATCCAGATCCG NMJ00044.3 3509-3527 CCAAATGACCGCCCAGGAA 71 ΝΜ„000044.3 3527-3545 ATTCCTGTGCATGAAAGCA 72 ΝΜ„000044,3 3567-3585 cgaggatgagggata ΝΜ_000044.3 3569-3587 AGTGGATGGGCTGAAAAAT 74 NMJ00044.3 3601-3619 ATGAAGTTCGAATGAACTA 75 ΝΜ„000044,3 3603-3621 GAACTTCAG ATGA76 ΝΜ„000044.3 3605-3623 ACTTCGAATGAAGTACATG 77 ΝΜ„000044.3 3607-3625 TTCGAATGAACTA6ATCAA 78 ΝΜ„000044.3 3609-36 aggaat cgaaggtacat ΝΜ_000044.3 3621-3639 ATCAAGGAAQTGGATCGTA 80 ΝΜ_000040 3623-3641 CAAGGAACTCGATCGTATC 81 NMfe00044,3 3625-3643 AGGAACTGATGATGATGAT 82 NMJ3Q0044.3 3627-3645 GAAGTCGATGGTATGATTG 83 NM„000044.3 3629-3647 ACTCGATCGTATCATTGCA 84 NMfe00044.3 3631-3649 TGmTCGWCATfGCATG 85 NM_000044.3 3633-3651 GATCGTATCATTGCATGCA 86 NM„000044,3 .......... 3669-3687 TCGTGCTCAAGACGCTTCT 87 NIO00044.3 3671-3689 CTGCTCAAGAGGCTTCTAC 88 NM_000044.3 3709-3727 AGTCCGTGCAGCCTATTGC 89 NM300044.3 3711-3729 TCCGTGCAGCCTATTGCGA 90 NM_000044.3 3713-3731 CGTGCAGCGTATTGCGAGA 91 NM_000044.3 3715-3733 TGGAGCCTATTGCGAGAGA 92 NMJ00m3 3717-3735 CAGCCTATTGGGAGAGÁGC 93 NMJ000443 3719-3737 GGCTATTGCGAGAGAGCTG 94 NM„0Q0044.3 3749-3767 ΊΊ Π GACCTGCTAATCAAG 95 ÑMj^®43 3759-3777 CTAATCAAGTCACAGATGG 96 NM_0OOO44.3 3765-3783 AAGTCACACATGGTGAGCG 97 NM_000044.3 3781-3799 GCGTGGACTTTCCGGAAAT 98 ÑM„Ó0ÓÓ44.3 3789-3807 TTTCCGGAAATGATGGCAG 99 NM_00Q044J 3845-3863 GAAAGTCAAGCCCATCTAT 100 NM„000044.3 3847-3865 AAGTCAAGCCCATCTATTT 101 NM_000044.3 3937-3955 CTGTTATAACTCTGCACTA 102 NM 000044.3 3939-3957 GTTATAACTCT GCACTACT 103 NM_000044.3 3941-3959 TATAACTCTGCACTACTCC 104 NM_0Q0044.3 3947-3965 TCTGCACTACTCGTCTGCA Ϊ05 NM_000044.3 3971-3989 TTGGGGAATTTCGTOTATT 106 NM^000044.3 3973-3991 GGGGAATTTCGTCTATTGA 107 ΝΜ_000044.3 3987-4005 ATTGATGTACAGTCTGTCA 108 NM„0ÓÓÓ44.3 3989-4007 TGATGTACAGTCTGTCATG 109 ΝΜ_000044.3 3991-4009 ATGTAGAGTCTGTCATGAA 110 ΝΜ„000044<3 3993-4011 GTACAGTCTGTCATGAACA 111 Ν000044,3 4021-4039 ATTCTATTTGCTGGGCTTT 112 NMJJÓ0044.3 4071-4089 TTCCCTCCCTATCTAACCC 113 ΝΜ_000044>3 4073-4001 CCCTCCCTATCTAACCCTC 114 IW000044,3 4075-4093 CTCCCTATCTAACCCTCCC 115 NMJJ00044.3 4077-4095 CCCTATCTAACCCTCCCAT 116 ΝΜ_000044.3 4079-4097 CTATCTMCCCTCCCATGG 117 ΝΜ JJ00044.3 4089-4107 CTCCCATGGCACCTTCAGA 118 ΝΜ„000044.3 4091-4109 CCCATGGCACCTTCAGACT ΝΜ_000044.3 4117-4135 CCATTGTGGCTCCTATCTG 120 ΝΜ„000044.3 4119-4137 ATTGTGG CTCCTATCTGTG 121 ΝΜ„000044.3 4125-4143 GCTCCTATCTGTGTTTTGA 122 ΝΜ 000044.3 — ........... ! 4179-4197 CATATGGCCCAGTGTCAAG 123 |ΝΜ„000044.3 4181-4199 TATGGCCCAGTGTCAAGTT 124 NM„000044.3 4205-4223 TGTTTACAGCACTACTCTG 125 NM_000044.3 4229-4247 GCCACACAAACGTTTACTT 126 NM„000044.3 4243-4261 TAGCCACTTACTGTCGT 127 Ν 0000444 42454263 CTTATCTTATGC^ 128 ΝΜ„000044.3 42534271 ATGCCACGGGAAGTTTAGA 129 NMJ300044.3 42634281 AAGTTGAGATA 13000 ΝΜ__000044.3 42654283 GTTTAGAGAGCTAAGATTA 131 ΝΜ_0000443 42674285 TTAGAGAGCTAAGATTATC 132 NMJ900044.3 42694287 AGAGAATGACTAGATTG133 ΝΜ_0000443 44514469 gaggccaatagtgácgaga 134 ί NMJJ00044.3 44614479 GTGACGAGAAGGTGAAAAT 135 ΝΜ„000044,3 44634481 GACGAAGGAATGGAAT136 ΝΜ_00Ρ044.3 44874505 CCATGGGGAGTTACTGATT 137 ΝΜ„000044.3 45214539 TCCACGGGAGACTTTATTT ¡138 ΝΜTT_000044.3 452 4523453445344534505 ÑMj30ÓÓÓ44.3 45494567 GGCTÁiTGCCAtTAGAGGG 140 ÑMJ)O0^ 45514569 CTÁTTGCCÁtTAGAGGGCÁ 141 ÑM„0ÓÓÓÓ44.3 44.3 44.3 44.3 44.3 44.3 44.3 44.3 44.3 44.3 44.3 44.3 44.3 . GGCAATGGAGCATCAGTAC 145 NM„000044.3 46414659 AGTACCTGCCCAGAGCCTT 146 NM_000044.3 46614679 GTCCCTGGGGGCTAGACTG 147 ΝΙΟ00040 4667-4685 GGGGGCTAGÁCTGCTCAAC 148 ΝΜ„000044.3 4691-4709 AGCAATTGATTATACTGAA 149 Ν Μ... 000044.3 4713-4731 GTGCTTGTTGTTGAAAATT 150 ΝΜ 000044.3 4735-4753 CTGCATGTTAATGCCTCAC 151 ΝΜ ,00004 4783-4801 CCTCÓAACTTCAGATTGAC 152 ΝΜ„000044,3 4785-4803 TCCAACTTCAGATTGACTT 153 NMJ00044.3 4817-4835 TAAGACCTTTGAACTGAAT 154 ΝΜ„000044.3 4819’4837 AGACCTTTGAACTGAATGT 155 ΝΜ„000044.3 4853-4871 CTTGGCGACTTCCACAGAA 150 NMJ500044.3 4855’4873 TGGGGACTTCCACAGAAAA 157 ΝΜ_000044.3 4877’4895 TGACCACTGAGAAGAAGGA 158 ΝΜ„000044 3 4935-4953 CAGGTCTGCTTTCTCATGT 159 NMJJ00044.3 4947-4965 CTCATGTGTGAGTCAGGGA 460 ΝΜ_000044 3 5019-5037 GACACTGACTGAATAGTTA 161 ΝΜ„δθδθ44.3 5037-5055 AAACTCTCACTGCCACTAC 162 ΝΜ_000044.3 5041-5059 TCTCACTGCCACTACC ΪΠ 163 ΝΜΜ00044.3 5099-5117 ÁCTCOGTGAAGGCACAAGC 164 ΝΜ__000044.3 5105-5123 TGAAGCCACAAGCACCTTA 165 ΝΜ„000044.3 5111-5129 CACAAGCACCTTATGTCCT |ΐ6β NMJJ00044.3 15199-5217 TTCTTTTGGGCATGTTCAC | 167 NM000044.3 5201-5219 CTTTTGGGCATGTTCACAG 168 NM..O00044.3 5241-5250 CGACCAAGAAGGTTAGCAG 169 N1O00044.3 5249-5267 AAGGTTAGGAGGCCAACAG 170 NM„000044.3 5251-5269 GGTTAGCAGGCCAACAGCT 171 NM„000044.3 5269-5287 TCTGAGATCTATCTGTAGÁ 172 NMm000044.3 5273-5291 ACATCTATCTGTAGATGCC 173 ÑM_000044.3 5275-5293 ATCTATCTGTAGATGCGAG 174 NM„OOOQ44,3 5311-5329 TACCAACTC 175 NMJ)00044.3 5313-5331 CCÁACTCTCAGATCGCTGG 176 NMJJ00044.3 5323-5341 GATCGCTGGAGCCCTTAGA 177 i NM_000044.3 5335-5353 CCTTAGACAAACTGGAAAG ..... 178 NM„00Q044.3 .................................................... 5401-5419 CAGAGATGATACCCTCCCA Ϊ79 NM_000044.3 5407-5425 TGATACCCTCCCAGCAAGT 180 ÑM_000044.3 5459-5477 AAAGGGGCTAC G C AGATCA 181 NM„000044.3 5465-5483 GCTACCCAGATCAGGGTTG 182 NM_000044.3 5493-5511 CTCAATTÁCCAGGGTGGGA 183 NMJ300044.3 5553-5571 CTTGTCAGCCAGCATATCC 184 NM_. 000044.3 5647-5665 AGCCTAAAGGCAGATGGAC 185 NM_000Q44.3 5715-5733 TCTGACATTGCCCATAGTC 186 NM_000044.3 5771-5789 GAGGGAGGCCAAACCATTG 187 ΝΜ_000044.3 5773-5791 GGGAGGCCAAACCATTGAG 188 ΝΜ„000044.3 5775-5793 GAGGCCAAACCATTGAGAC 189 ΝΜ„000044,3 5795-5813 TTCTÁCÁGAACCATGGCTT 190 ΝΜ„000044.3 5803-5821 AACCATGGCTTCTTTCGGA 191 NMJ00Ó44.3 5811-5829 CTTCTTTGGGAAAGGTCTG 192 : ΝΪΟ00044.3 5815-5833 I Π CGGAAAGGTCTGGTTG 193 ΝΜ„000044.3 5841-5859 TCCAATACTTTGCCACCCA W4 ΝΜ^000044.3 5859-5877 ATGAACTCAGGGTGTGCCC ί 195 ΝΜ„000044.3 5867-5885 AGGGTGTGCCCTGGGACAC 196 ΝΜ_00δ044,3 5883-5901 CACTGGTTTTATATAGTCT 197 ΝΜ_000044.3 5895-5913 ATAGTCTTTTGGCACACCT 198 ΝΜ_000044.3 5897-5915 AGTCTTTTGGCACACCTGT 199 ΝΜ_000044.3 5915-5933 TGTTCTGTTGACTTCGTTC 200 NMJ)00044.3 5963-5981 ACCTACTTTCTCATCTTGG i ί 201 ΝΜ.000044.3 5991-6009 CCTTACTTAGCTCTTAATC | 202 ΝΜ„000044.3 5999-6017 AGCTCTTAATCTCATGTGT 203 NMJ)00044,3 6005-6023 TAATCTOÁTCTGTTGAACT 204 ΝΜ_000044.3 6007-6025 ATCTCATCTGTTGAACTCA 205 NMJJ00044.3 6045-6063 TCAAGCTGCCCATTTTAAT 206 ΝΜ_000044.3 6077-6095 ffGfTGAGAGGATAGTTTC 207 ΝΜ_000044.3 6099-6117 GTGACATGATATGATCCAC ί . 208 ΝΜ„000044.3 6145-6163 TGATATTAATAGCCAAACG 209 ΝΙΟ00044.3 6147-6165 ATATTAATAGCCAAACGAA 210 ΝΜ„000044.3 6149-6169AAGTAAGTAAGTAGGAAGCC 211 ΝΜ_ΟΟΟ044.3 6151-6169 TAATAGCCAAACGAACTTC 212 ΝΜ_000044.3 6153-6171 ATAGCCAAACGAACTTCAA 213 NMJW44.3 6155-6CAAA1AACTCAAACTTC214 ΝΜ®00044.3 6157-6175 GCAAACGAACTTCAAAACA 215 NM_O0ÓQ44.3 6159-6177 AAACGAACTTCAAAACAGC 21β NMJ00044.3 6193-6211 AGAGGAGAGGAGAGAGAT2193-6211 ΝΜ®00044,3 6195-6213 AGGGGAAGCTAAGATGAGT 218 ΝΜ_000044.3 6197-6215 GGGAACCTAAGATGAGTAA 219 ΝΜ_000044.3 6199-6217200044.3 6199-6 NMJO0044.3 6211-6229 AGTAATATGOCAATCCAAG 221 ΝΜ„ΟΟΟ044.3 6213-6231 TAATATGCCAATC CAAGAC 222 NM-00Q044.3 6215-62333 AAATATGCAATGCCATG23 ΝΜ®00044.3 6243-6261 ACTAAAGCTGACAGGTTCC 224 ΝΜ„000044.3 6265-6283 TTTGGGGTGGGATAGACAT :.225 Ν Μ®00044.3 6249-6299ATTAGCA 226 ΝΜ„000044.3 6301-6319 TATTACACAATCTGGCTCA [227 I........................................ ΝΜ„000044.3 ......................................................... .6317-6335 TCATGTACAGGATCACm. 228 ΝΜ„000044,3 [6377-6395 GTTACACTAGGTTACÁTTT 229 ΝΜ„000044>3 6395-6413 TTAATAGGTGCTTTACATC 230: NM,000044.3 6439-6457 GTGATACACAGATTGAATT 231 NM„000044,3 6469-6474ATATTATACT2323 NM 000044.3 6485-6503 ATACTAGAAGCTCTCCTTT 233 NM 000044.3 6487-6505 ACTAGAAGCTCTCCTTTAC 234 NM_000044.3 6533-6551 TGGGTTTCCCAAT3 6607-6625 AGCAGTGTAATTAAAAGCA 236 NM_000044.3 6623-6641 GCAACAACTGGATTACTCC i 2 37 NM:„000044.3 6625-6643 AACAACTGGATTAGTCCAA 2304„4. 6661-6679 CTAGGGAAAAATAGCCTAC 239 NM_000044.3 6663-6681 AGGGAAAAATAGCCTACAC 240 NMm000044.3 6673-6691 AGCCTACACAAGCTTTAG 241 NM_3060_3604693. CGTACACAAGCCTTTAGGC 242 NM_000044,3 6677-6695 TACAGAAGCCTTTAGGCCT 243 NM„000044.3 6679-6697 CACAAGCCTTTAGGCCTAC 244 NM_000044.3 6698GCCTAGCCTAGCCCT 245 NM_000044.3 6711-6729 GGGTTTGAGTGAACAAAGG 246 NM_000044,3 6787-6805 TTTGGCCATTGATGTTCTA 247 NMJJ00044.3 6789-6807 TGGTTCATGCATGCTA 248 NM„000044J 6833-6851 TTGCATGCGCTCTGCTCTA 249 NM„000044.3 6835-6853 GCATGCGCTCTGCTCTACA 250 NM„000044.3 6837-6855 ATGCGCTCTGCTCTACAAA 251 NM00ÓO44.3 6845-6863 fGCTCTACAAACÁGÁGTTG 252 NM„000044,3 6847-6865 CTCTÁCAAÁCÁGÁGW 253 NM„ 000044.3 6865-6883 TATGGTTGGTATACTGTAC 254 NM_000044.3 6901-6919 GCCACTCAGACCCACTTAG 255 NM„Ó00044>3 6903-6921 CACTCAGACCCACTTAGCT 256 NM_000044.3 6913-6931 CACTTAGCTGGTGAGCTAG 257 N¡000044,3 6915-6933 CTTAGCTGGTGAGCTAGAA 258 NM.J00044.3 6979-6997 MGTTGGCAGTGCTCGATG 259 NM_000044.3 6981-6999 GTTGGCAGTGCTCGATGTG 260 NMJ300D44.3 6989-7007 TGCTCGATGTGGACGAAGA 261 NM_000044.3 6991-7009 CTCGATGTGGACGAAGAGT 282 NM.000044.3 6999-7017 GGACGAAGAGTGAGGAAGA 263 NMJ300044.3 7095-7113 TCAAAGAAAAGAGTCGTGT 264 NMJJ0Q044.3 7115-7133 GCAGTTTCAGCTCTCGTTC 265 NMJ)00044.3 7119-7137 TTTCAGCTCTCGTTCATTG 266 NM_000044.3 7123-7141 agctctcgttcattgggca 267 NM„000044.3 7125-7143 CTCTCGTTCATTGGGCAGC |268 NOQW4.3 7127-7145 CTCGTTCATTGGGCAG^ 269 ΝΜ_000044.3 7129-7147 CGTTCATTGGGCAGCTCGC 270 ΝΜ„ΟΟ0Ο44.3 7159-7187GTTGTTGTTGATT 271 ΝΜ„0ΟΟΟ44<3 7203-7221 TTTTCTATGCCATAGGCÁA 272 ΝΜ„000044.3 7205-7223 TTQTATGCCATAGGCAATA 273 ΝΜ_000044726.726 TACTCTGAGAAAGGGATAT (274 ΝΜ „000044.3 7283-7301 TTGMGGACTGTCATATAT 275 ΝΜ„000044.3 7335-7353 TTTATGTATGTTCACTGGC 276 Ν00Μ „000044.3 7283-735 TATGTATGTTCACTGGCAC 277 NMJ300044.3 7351-7369 GGCACTAAAAAATATAGAG 278 ΝΜ„0ΟΟΟ44.3 7357-7375 AAAAAATAGAGAGCTTC 279 ΝΜ40_400041.3741 GGTTGAAAAATAATGTGCT 280 ΝΜ„000044.3 7431-7449 tgatgctAgagtccctctc 281 NMJJ00044.3 7433-7451 ATGCTAGAGTCCCTCTCTG 282 ΝΜ„4003.749.7449 GTCCCTCTCTGTCCATACT 283 Ν1000044.3 7487-7505 TAGGAAGTTTTATTTGACT 284 ΝΜ„000044.3 7553-7571 AGGTAACATTGAGCTTCÁA 285 ΝΜ„4003.7538 GTTTGTTTCATTAGGCACA 286 ΝΜ_000044.3 7587-7605 TTGTTTCATTAGGGACAGC ί 2 87 NM_000044j 7593-7611 CATTAGGCACAGCACAGAT 288 NM„000044.3 7647-7665 CAGGGCATAAAGGCCCAGG 289 NM_000Q44.3 7696-7713 ACCAAAGCTGCATTTCAGG 290 NM„0Q0Q44.3 7709-7727 TCAGGAGACTCTCTCCAGA 291 NMJ00Q44.3 7721-7739 CTCCAGACAGCCCAGTAAG 292 NM_000044.3 7727-7745 ACAGCCCAGTAACTACCCG 293 000044.3 7729-7747 AGCCCAGTMCTACCCGAG 294 NM.000Ó44.3 7731-7749 CCCAGTAACTACCCGAGCA 295 NM 000044.3 7733-7751 cagtaactacccgagcatg 296 ÑM„000044J 7735-7753 GTAACTACCCGAGCATGGC 297 NMJ300044J 7777-7795 AGAGGCTGACTGTCTACGA 298 NMJ)0ÓÓ4€3 7779-7797 AGGCTGACTGTCTACGAAT 299 NMJ3000443 7781-7799 GCTGAGTGTCTAGGAÁTTA 300 NM_000044.3 7783-7801 TGACTGTCTACGÁATTATC 301 NMJ00044.3 7785-7803 ACTGTCTACGÁATTATCTT 302 NMfe00044;3 7791-7809 TACGAATTATCTTGTGCCA 303 NMJ300044.3 7793-7811 CGAATTATCfTGTGCCAGT 304 NM__000044.3 7845-7863 GGTTTTCATGTTTGACCCA 305 i NM_0Q0044.3 7847-7865 TTTTCATGTTTGACCCACT ¡306 NJO00044.3 7969-7987 TTCTACCQCTGATGQCTTT |307 HM.J00044.3 7987-8005 TGTÁGGCAGATCTGTTCTC 308 ΝΜ^000044.3 7989-8007 TAGGCAGATCTGTTCTCAC 309 ΝΜ_000044.3 8081-8099 GATTACATTGTAGCTGGTA 310 ΝΜ„000044.3 8083-8 311 ΝΜ„000044.3 8087-8105 ATTGTACGTGCTAAGATAC 312 NM„00Ó044j 8109-8127 mttcátaagGgcaggggg ................. 313 NMJJ00044.3 8123-8141 GGGGGGGAGCAAGCATTAG 314 ÑOÓÓÓ44.3 8125-8143 GGGGGAGCAAGCATTAGTG 315 NMte00044.3 8127-8GAGCAGGGTAGT14 316 NM„000044.3 8145-8163 CTCTTTGATAAGCTGTGCA 317 NM„000044.3 8149-8167 TTGAWG^ 318 nO00044 3 8167-8185 ACAGAGTAAAGCTGACT394NGCJ0404:3 8185-8203 GTGGTGACTGAGTTAIAAG 320 NMm000044,3 8187-8205 GGTGACTGACTTATAAGAG 321 NM„000044.3 8191-8209 ÁGTGAGfTATAÁG 322 ί0000079.387 ATGGGTCCTTCACTAAGTG 323 ÑOW44.3 8301-8319 TTATAAGGAGAACTGGCTT 324 NM.000044.3 8323-8341 innTCTCTÁGTAGtTGCTG 325 NM„00Q044í3- 8327.38 CTCTAGTAGTTGCTGAGCA 326 NM_0Q0044.3 8343-8361 GCAAATTGTTGAAGGTGCA 327 ΝΜ.Ό00044.3 8349-8367 TGTTGMGCTCCATCATTG 328 NMJ00044.3 8351-8369 TTGAAGCTGCATGATTGCA 329 NMJ3OO044.3 8353-8371 GAAGCTCCATCATTGCATG 330 NM_ÓQ0044.3 8355'8373 AGCTCCATGATTGCATGGT 331 NMJ0QQ44.3 8357-8375 CTCCATCATTGCATGGTTG 332 ΝΜ„000044.3 8359-8377 CCATCATTGCATGGTTGGA 333 NMJ00044.3 8361-8379 atcattgcatggttggaaa 334 ΝΜ_000044.3 8393-8411 AGCCACTGTGTTTGCTAGT 335 ΝΜ„000044.3 8405-8423 tgctagtgcccatgWgc 336 NM...000044J 8407-8425 ctagtgcccatgttagctt 337 ΝΜ 000044.3 8447-8465 GCTGATAAGGGAGGATTTA 338 ΝΜ,.000044.3 8449-8467 TGATAAGGGAGCATTTAAA 339 NM.J00044.3 8455-8473 GGGAGGATTTAAAGTAGTA 340 ΝΜ_000044.3 8529-8547 ggcacaaaaagttatctgc 341 NMJ00044.3 8539-8557 gttatgtgcagugmggc 342 NM„ 000044.3 8659-8677 gtgtgtgttctgatagctt ¡343 NM.000044.3 8735-8753 TGAGAGAGGATGCAGTTTT 344 NMJJO0O44.3 8783-8801 ACACCTGGATTGATOAGTT ,345 NM„OPO044.3 8785-8803 ACGTGGATTGATGAGTTAA 346 NM„000044.3 8787-8805 ctggattgatcagttaact 347 NMJ)ÓÓO44J 8789-8807 ggattgatcagttaactaa 348 NMJW0044.3 8793-8811 TGATCAGTTAACTAAAAGT 349 ÑOQÓÓ44.3 8795-8813 ÁTCÁGTTAACTAAAAGTTT 350 NMJ300044.3 8797-8815 CTAAC 351 NTAGin 000044,3 8817-8835 GCCCTATTGGGTTTGAGCC 352 NMJ)00044,3 8819-8837 GCTATTGGGTTTGACGGAG 353 NMJ00044.3 8825-8843 GGGTTTGACCCA3 8857-8875 AGGGATAAAAAGAGTÁGAG 355 NM„0000443 8871-8889 TAGAGGACATGATÁCATTG 356 NM_O00044.3 8873-8891 GAGGAGATGATÁGATTGTA 357 NM„000044.3 8881-8899GATACTTGTACATTG3855 NM_000044,3 8893-8911 TTTACTAGTTCAAGACAGA 359 NM_000044.3 8897-8915 GTAGTTCÁGAGAGATGAA 360 NM„000044.3 8989-9007 CCTACCCAAGTGACCM3 9001-9019 ATTGACCAGTGGCCCCCTA 362 NM„000044.3 9003-9021 TGAGCAGTGGGCCCCTAAT 363 NM.000044,3 9009-9027 GTGGCCCGCTAATGGGACC_364M_0304.3 9015-9033 CGCTAATGGGACCTGAGCT 365 NM„0Q0044.3 9017-9035 CTAATGGGACCTGAGCTGT 366 NM_000044,3 9083-9101 GGGCAGTTTQGTGCATTGM 3004„43604. 9095-9113 GCATTGGAACCTGGAGCAA 368 NM_δ00θ44.3 9101-9119 GAACCTGGAGCAAGCGCTC 369 NM_000044.3 9107-9125 GGAGGMGCGCTGTATCTT 370 NM_000044.3 9109-9127 AGCMGCGCTCTATCTTTC 371 NMJ00044.3 9111-9129 CAAGCGCTCTATCTTTCAC 372 NM„000044.3 9113-9131 AGCGCTCTATCTTTCACAC 373 NM_000044.3 9125-9143 TTCACACAAATTCCCTCAC 374 NM„000044.3 9127-9145 CACACAAATTCCCTCACCT 375 ΝΜ_000044.3 9151-9169 TGAGGTGGTCTTGTTAGTG 376 NM„000044.3 9153-9171 AGGTGCTCTTGTTACTGGG 377 NM^.000044.3 9155-9173 GTGCTGTTGTTACTGGGTG 378 NM„000044;3 9157-9175 GCTGTTGTTACTGGGGTGTC 379 J NM„000044.3 9161-9179 TTGTTACTGGGGTGTCTG 380 ÑMJ30Ó044.3 9175-9193 CTGTGTGCTGTAATTCTGG 381 NMm00Q0443 9177-9195 GTGTGCTGTAATTGTGGTT 382 ÑMJ300044J 9239-9257 TTCTCTGTTAAAACTTGTC 383 ÑM_00Q044.3 9249-9267 AAACTTGTCAGAGTAGTAG 384 ÑM 000044.3 9251-9269 ACTTGTCAGAGTACTAGAA 385 NIO00044.3 9253-9271 TTGTCAGAGTACTAGAAGT 386 NM„00α044,3 9261-9279 GTACTAGAAGTTGTATCTC 387 NM_000044,3 9271-9289 TTGTATCTCTGTÁGGTGCA 388 NMJ00044.3 9325-9343 TGATTAÁGAGATTGACÁCT 389 NMJJ00044.3 9327-9345 ATTAAGAGATTGACACTTC 390 NMJ)00044.3 9329-9347 TAAGAGATTGACACTTCTG 391 NMJ500044.3 9339-9357 ACACTTCTGTTGCCTAGGA 392 NMJ300044.3 9341-9359 ACTTCTGT^ 393 NM 000044,3 9343-9361 TTCTGTTGCCTAGGACCTC 394 NM.J00044,3 9345-9363 CTGTTGCCTAGGACCTCCC 395 NMJJ00044.3 9379-9397 AGGTGAAGGCAGAAAAATC 396 NM.J00044.3 i..................................................... 9401-9419 attagttaótcctcttcag 397 NM_00Q044.3 9403-9421 tagttactgctcttcagag 398 NMJ>00044,3 9551-9569 ATTTGGCCAGAAAGTAGGT 399 NM„000044.3 9563-9581 agtaggtaatatgcattga 400 NM_000044.3 9565-9583 taggtaatatgcattgatt 401 NM„000044,3 9567-9585 ggtaatatgcattgattgg 402 NM 000044.3 .......... 9571-9589 ATATGCATTGATTGGCTTC 403 NMm000044.3 9573-9591 ATGCATTGÁTTGGCTTCTG 404 NM_000044,3 9599-9617 TTCAGTATAGCAAGGTGCT 405 NM_000044.3 9601-9619 CAGTATÁGCAAGGTGCTAG 406 ÑM„ÓÓÓ044.3 9603-9621 gtatagcaaggtgctAggt 407 NMJ)00044.3 9609-9627 CAAGGTGGTAGGTTTTTTC 408 9671-9689 GTTAGAATGGGTGGCCCTT 409 NM„0Q0044.3 9705-9723 TCCGACATAAGCTACTTAA 410 NMJ)O0O44.3 9707-9725 CCACATAAGCTACTTAACA 411 HM_000044J 9719-9737 CTTAACAAGATTGTCATGG 412 NM.000044.3 9737-9755 GAGCTGCAGATTCGATTGC 413 NM„000044.3 9751-9769 ATTGCCCACGÁAAGÁCTÁé 414 NM_OQ0044.3 9855-9873 GTÁTGGGÁACCTGTACTCT 415 NM_OO0O44.3 9893-9911 TTTGCATTATCTGACAACC 416 NM„000O44.3 9895-9913 TGCATTATCTCACAACCTT 417 NM 000044,3 9897-9915 cattatctcagaaccttag 418 NM„000044.3 9905-9923 CACAACCTTAGCCCTTGGT 419 NM„00Q044,3 9907-9925 CAACCTTAGCCCTTGGTGC 420 NMJJ00044.3 9911-9929 CTTAGCCCTTGGTGCTAAC 421 NM„000044.3 9913-9931 TAGCCCTTGGTGCTAACTG 422 NM„000044.3 9919-9937 TTGGTGCTAAC TGTCCTAC 423 NM„OO0O44.3 9925-9943 ctmctgtggtácá^ 424 NM. 000044,3 9927-9945 aactgtcgtacagtgaagt 425 NM„000044.3 9939-9957 GTGAAGTGCCTGGGGGGTT 426 NM_000044.3 9941-9959 GAAGTGCC^ 427 NM„000044.3 9947-9965 cctggggggttgtcctatc 428 ΝΜ_000044,3 9949-9967 TGGGGGGTTGTCCTATCCG 429 ΝΜ 000044.3 - 9951-9969 GGGGGTTGTCCTATCCCAT 430 ΝΜΟΟΟ0Ο3,949-995 GGGTTGTCCTATCCCATAA 431 ΝΜ„000044,3 9955-9973 GTTGTCCTATGCCATAAGC 432 ΝΜ„000044.3 9957-9975 TGTCCTATCCCATAAGCCA 433 NMJJ0304-9975 TCCTATCGGATAAGCCACT ..... 434 NMfeOOO44.3 10003-10021 gmtgacccacgcaaaaaaa 435 NMJ)00044,3 10039-10057 aaagtcccctcacaaccca 436 Ν„0Mio340-340m AGTCCCGTCACAACCCAGT 437 NM„000044.3 19043-10061 TGCCGTCACMCCCAGTGA 438 10051-10069 CAACCCAGTGACACCTTTC 439 ^000044,3 10053-10071 acccagtgacaccttgtg 440 NM_000044.3 10075-10093 TCCTCTAGACTGGAACATT 441 NM„000044.3 10077-10095 CTCTAGACTGACTGA44 ΜΜ„000044.3 10099-10117 GGGAGTGCCTCAGACATGA 443 NM„000Ó44.3 10161-10119 GAGTGCCTCAGACATGACA : ...... i 444 NM_000044.3 1000044 445 NMfe00044.3 10163-10181 agactatgtaáacagagat 446 NM„000044.3 10287-10305 TTTAGATGGGGCTCATTTC 447 HMJJ00044.3 10299-CG100044.3 10299-CG017GTTACGTTCA 448 NM„ 000044.3 10301-10319 ATTTCTCACGGTGGCAGTT 449 NM„000044.3 10341-10359 CCAGCTCCAAGCGCTAGTG 450 NMJ00044.3 10343-10361 AGCTCGAAGCGCTAGTGTT 451 NM_000044.3 10347-10365 CCAAGGGCTAGTGTTCTGT 452 NM„ 000044.3 10349-10367 AAGCGCTAGTGTTCTGTTC 453 NM_0OO443 10383-10401 GGAAtCni 1G H GCTCTA 454 ΝΜ„000044.3 10413-10431 AAATGGCAGAAACTTGTTT 455 NMJJ00044.3 10481-40499 AATGTCATCCATTGTGTM 456 ÑMmQÓÓ04¿3 10499-10517 AAATATTGGCTTACTGGTC |457 ΝΜ„000044.3 1050140519 ATATTGGCTTACTGGTCTG 458 ÑM„Ó00044.3 10535-10553 CGACATCCCCTGTTATGGC 459 ΝΜ„000044.3 10537-10555 ACATCCCCTGTTATGGCTG 460 NM_000044.3 10541-10559 CCCCTGTTATGGCTGCAGG 461 ÑMJOOO44.3 10543-10561 CCTGTTATGGCTGCAGGAT 462 ñKoow^ 10545-10563 TGfmTGGCTGCAGGATCG 463 ÑMj0Ó044.3 10553-10571 CTGCAGGATCGAGTTATTG 464 NM...000044.3 10555-10573 GCAGGATCGAGTTATTGTT 465 NM„000044G 10557-10575 AGGATCGAGTTATTGTTAA 466 NMJ300044.3 10559-10577 GATCGAGTTATTGTTAACA 467 NM„000044.3 10601-10619 ATGTGCTCTTATCATTGTT 468 NMJ00044.3 10603-10621 GTCCTCTTATCATTGTTGT 545 - cttacgctgagtacttc ga Table 3 androgen receptor-specific siRNA sequence described in the related literature (US 2007-0141009A) SEQ ID NO: Related patent Position Sense strand sequence 469 US 2007-0141009 Al 1122-1140 GUGGAGUUAGGGCUGGGAA 470 US 2007-0141009 Al 1141-1159 GGGUCGCCACCGU147 2007-0141009 Al 1190-1208 UCUGUÜCCAGAGCGUGCGC 472 US 2007-0141009 Al 1212-1230 GUGAUCCAGAACCCGGGCC 473 US 2007-0141009 A1 1190-1208 CAGCC-1475CAGCCACCA 474 US 2007-0141009 Α1 1544-1562 GGGGCUGCCGCAGCAGCUG 475 US 2007-0141009 Al 1661-1679 AGACAUCCUGAGCGAGGCG 476 US 2007-0141092 A-11716 CUCCUUGAGCAACAGCAGC 477 US 2007-0141009 Al 1728-1746 GGCAGCAGCAGCGGGAGAG 478 US 2007-0141009 Al 1781-1799 GGACAAUUACUUAGGGGGC 479- Al 20107-1409 US 1787-1805 UUÁCUUAGGGGGCACUÜCG 480 US 2007-0141009 Al 1838-1856 GGCAGUGUCGGUGUCCAUG 481 US 2007-0141009 A1 1899-1917 CAGCUGAUCGAUG42GGCAGUGG 2007-0141009 Al 1983-2001 UGCAAAGGUUCUCUGCUAG or 483 US 2007-0141009 Al 1988-2006 AGGUUCUCÜGCUAGACGAG 484 US 2007-0141009 Α1 2018-2036 GAGCACUGAAGAUACUGCU 485 US 2007-0141009 Λ1 2028-2046 GAUACUGCUGAGUAUUCCC 486 US 2007-0141009 Al 2054-2072 GGGAGGUUACACCAAAGGG 487 US 2007-0141009 ΑΪ 2079-2097 GGCGAGAGCCUAGGCUGCU 488 US 2007-0141009 Al 2162-2180 GUCCGGAGGACUGGACGAG 489 ÜS 2007-014109 ΑΪ 2213-2231 cyuUCCACUGGCUCUGGCG 490 US 2007-0141009 Al 2279-2297 GCÜGGAGAAGGCGCUGGAG 491 US 2007-0141009 Al 2288-2306 CGCGGAGGAGCA2949 US 2007-0141009 Á1 2442-2460 GAAGGCCAGUUGUAUGGAC 493 US 2007-0141009 A1 2445-2463 GGCCAGUUGUAUGGACCGU 494 US 2007-0141009 Al22678- AAGCGAAAUGGGCCCCUGG 495 US 2007-0141009 Al 2680-2698 GCGAAAUGGGCCCCUGGAU 496 US 2007-0141009 Al 2685-2703 AUGGGCCCCUGGAUGGA 497- Al 2007-01409 2814-2832 GCUUCUGGGUGUCACUAUG 498 US 2007-0141009 A1 2858-2876 GGUCUUCUUCAAAAGAGCC 499 US 2007-0141009 Al 2870-2888 AAGAGCCGAGAGAACU0050 2007-0141009 Á1 2872-2890 GAGCCGCUGAAGGGAAACA 501 US 2007-0141009 A1 2883-2901 GGGAAACAGAAGUACCUG U 502 US 2007-0141009 A1-2868 ACAGAAGUÁCCÜGÜGCGCC 503 US 2007-0141009 Α1 2894-2912 GUACGUGUGCGCCAGGAGA 504 US 2007-0141009 Al 2933-2951 AUUCCGAAGGAAAAUUGU 505 US 2007-01499110412994 GGAAAAAUÜGUCCAUCÜG i 506 US 2007'0141009 A1 2945'2963 AAAUUGUCCAUCUUGUCGU 507 US 2007-0141009 A1 2947'2965 AUUGUCCAUCUGUGGUUGUG 508 US 2007-0141009 Al 2982-3000 GCAGGGAUGACUCUGGGAG 509 US 2007-0141009 Al 3008-3026 GCUGUAGAAACUUGGUAAU 510 US Al 20307-Q1 GÁAACUUGGUAAUCUGAAA 511 US 2007-0141009 Al 3017-3035 acuugguaaucugaaacua 512 US 2007'0141009 Al 3045-3083 GGAGAGGGUUCCA70 USAGCACCA 20141009 3114-3132 GGCUAUGAAUGUCAGCCCA 514 US 2007-0141009 Al 3123-3141 uguca^ 515 US 2007-0141009 Al 3191-3209 GAACCAGCCCGAG 72016-USCUU U 4250 U . 3194-3212 CCAGCCCGAGUCCUUUGGA 5Ϊ7 US 2007-0141009 Al 3233-3251 UGAACUGGGAGAGAGACAG 518 US 2007-0141009 Al 3237-32GAUGAG GA51 CUGCA 2007-0141009 Al 3278-3296 GGCCUUGCCUGGCUUGCGG 520 US 2007-0141009 A1 3299-3317 quacacguggácgaccag 521 US 2007-01410409 UGAGUACCGCAUGCACAAG 522 US 2007-0141009 A1 3478-3496 UGAGGGACCUCUCAAGA 523 US 2007-0141009 Al 3495-3513 GAGUUUGGAUGGCUCCAAA 524 US 2007-0141009 Á1 3528-3546 ÜUCCUGUGCAUGAAAGCAC 525 US 2007-0141009 A1 3542-3560 agC^üc^^ 526 US 2007-0141009 Al 3584-3302 aaaucaaaaau ucuuugau 527 US 2007-0141009 Al 3583-3604 AUCAAAAAU UCUUUGAUGA 528 US 2007-0141009 A1 3591-3609 AAAUUCUU UGAUGAACUUC 529 US 2007-0141009 A1 3593-3611 AUUCAUGACAAUCA 530 US 2007-0141009 A1 3606-3624 CARRIAGE ACUACAUCA 531 US A3 UGAACUAGAUCAAGGAAGU 532 US 2007-0141009 A1 3617-3635 CUACAUCAAGGAACUGGAU 533 US 2007-0141009 A1 3653-3671 AAGAAAAA91240 Al 3655-3673 GAAAAAAUCCCACAUCCUG 535 US 2007-0141009 Al 3658'3676 AAAAUCCCACAUCCUGCUC 536 US 2007-0141009 Al 3660-3608-16109 USUCCAA05GCUCCU7 A1 3662-3680 UCCCACAUCCUGCUCAAGA 538 US 2007-0141009 Al 3701-3719 GCUCCUGGACUCCGUGCAG 539 US 2007-0141009 Al 3763-3781 UCAGUAGAUCACAAGA 2007-0141009 A1 3767-3785 GUCACAUGGUGAGCGUG 541 US 2007-0141009 A1 3825-3843 GUGCCAAGAUOCUUCUG 542 US 2007-03 GAUCQUCUGGAAAAG 543 US 2007-0141009 Al 3848-3866 iAGUCAAGCCCAUCÜAUUÜC 544 US 2007-0141009 Al 3854-3872 [GCCGAUCUAUUUCCACACC Example 2, Synthesis of a Bicatenary Oigonucleotide Construct The double-stranded oligonucleotide (SAMiRNA) construct manufactured in the present invention has the structure represented by the following structural formula. A - X - S - Y - B5pAS The synthesis process includes repeating the cycle which includes unlocking, coupling, capping and oxidation on a solid support (CPG) to which the nucleoside was attached, thus obtaining a single strand of RNA with the desired sequence. An RNA synthesizer (384 synthesizer, PIONEER, 1 or Korea) was used for a series of double-stranded oligo RNA synthesis processes. The sense strand of the double-stranded oligonucleotide construct was fabricated by joining phosphodiester bonds that constituted a DNA backbone using β-cyanoethylphosphoamide on polyethylene glycol (PEG)-CPG as a support to synthesize a double-stranded oligonucleotide construct that had a sense strand having polyethylene glycol attached to the 3' end and a hydrophilic material, after which the Cz* containing a disulfide bond was attached to the 5' end. In order for an antisense strand to attach to the sense strand, an antisense strand was fabricated that had a sequence complementary to the sense strand by joining phosphodiester bonds that constituted an RNA backbone using β-Cyanone-in-1-phosphate. After this, an antisense strand was fabricated that had a phosphate group attached to the 5' end using a chemical phosphorylation reagent (CPR) to attach a phosphate group to the 5' end. Once the synthesis is complete, the single strand of oligonucleotides The synthesized S and the oligonucleotide-polymer construct were separated from the CPG using 28% (v / v) ammonia in a 60°C water bath, followed by deprotection to remove the protecting residue. The deprotected single-strand oligonucleotides and the oligonucleotide-polymer construct were treated with N-methylpyrrolidone triethylamine and triethylamine triethanolamine in a The volume ratio of 10:3:4 was used in a 70X oven, thus eliminating the 2:. The single-stranded oligonucleotides, the oligonucleotide-polymer construct, and the ligand-bound oligonucleotide-polymer construct were separated from the reaction mixture by high-performance liquid chromatography (HPLC), and their molecular weights were measured using a MALDI-TQF mass spectrometer (SHIMADZU, Japan). It was confirmed whether the resulting products matched the base sequence and oligonucleotide-polymer construct to be synthesized. Then, to fabricate each double-stranded oligonucleotide construct, the sense and antisense strands were mixed in equal amounts and placed in an IX annealing buffer (30 mM of HEPES, 100 mM potassium acetate and 2 mM magnesium acetate) at a pH of 7.0 or higher, was allowed to react for 3 minutes in a water bath at a constant temperature of 90°C, and then allowed to react again at 37°C, thus fabricating the desired SAMiRNA, monoSAMiRNA (n-2), monoSAMiRNA (n-3), and monoSAMiRNA (n-4). The annealing of the resulting double-stranded oligonucleotide sequences was confirmed by electrophoresis. Example 3. Screening of SAMIRNA nanoparticles that induce RNAi targeting the androgen receptor 3.1 Fabrication and particle size analysis of SAMiRNA nanoparticles Based on the results of measuring the size and polydispersity index of SAMiRNAs using a Zetasizer Nano ZS (Malvern, UK) for particle size analysis of 544 types of SAMiRNAs targeting the androgen receptor sequence synthesized in Example 2, the nanoparticle size and polydispersity index for randomly selected SAMiRNAs are shown in Table 4 below, and a representative graph of these is shown in Figure 1G. 3. Table 4 Nanoparticle size and polydispersity index of androgen receptor-specific SAMiRNA SEQ ID NO: Code Name Size PDl 545 SAMkCOÑ 28*1 OR 0.28*0.04 10 SAMi-AR #10 27.8*0.7 0.18*0.07 3.2 Intracellular treatment method for SAMIRNA nanoparticles The LNCaP cell line, which is a human-derived prostate cancer cell line, was used to discover SAMiRNA, which inhibits the expression of an androgen receptor, and the LNCaP cell line was cultured at 37¾ and 5% The cell line was dispensed at 4 x 10⁴ cells / well in a 12-well plate (Costar, US). The following day, SAMiRNA was diluted with 1X DPBS and used to treat the cells at 50 nM. SAMiRNA was treated a total of 4 times under the once-every-12-hour treatment condition and cultured at 37°C and 5% CO₂. SAMiRNA screening was performed by analyzing the efficacy of inhibiting androgen receptor mRNA expression. The RNA extracted from cells treated with SAMiRNA as in the Example 3.2 was synthesized in cDNA using AccuPower® RocketScriptTM Oyete RT Premix with oligo(dT)20, after which the relative expression level of the androgen receptor gene was analyzed in comparison with the SAMiRNA control sample using the Taqman multiplex qPCR method. As a result, as shown in FIG. 4, 9 sequences mentioned in the related patent (US 2007-0141QQ9A) and 14 sequences in Table 2 were selected from among 544 types of SAMiRNAs targeting the androgen receptor, showing the ability to inhibit androgen receptor mRNA expression by 60% or more (FIG. 5). The results of the re-evaluation of the ability of these 14 sequences to inhibit androgen receptor mRNA expression are shown in FIG. 6. Finally, two types of SAMiRNAs that most effectively inhibit androgen receptor gene expression were selected. The corresponding SAMiRNAs are shown in Table 5. Table 5 SAMiRNA sequence that effectively inhibits androgen receptor expression SEQ ID NO; Code Name Position Sense Strand Sequence 68 SAMBAR #68 3495-3513 GAGTTTGGATGGCTGQAAA 109 SAMi-AR #109 3991-4009 ATGTACAGTCTGTCATGAA : : : . 3.4 Evaluation of the efficacy of the selected SAMiRNAs in inhibiting the expression of the androgen receptor protein A Western blot (WB) assay was performed to confirm whether the 14 selected SAMiRNAs, including sequences Nos. 68 and 109 selected in Example 3.3, effectively inhibit androgen receptor protein expression. The LNCaP cell line was dispensed at 1.2 x 10⁵ cells / well in a 6-well plate (Costar, USA) and cultured at 3FC and 5% CO₂. The following day, transfection was performed at a concentration of 50 nM using lipofectamine (Invitrogen, USA). After 48 hours of culture, the medium was removed, and the protein was isolated using a cell lysis buffer (Cell Signaling Technology, USA) containing a protease inhibitor cocktail (Sigma-Aidrich, USA). After quantifying the amount of protein using a BCA assay kit (Thermo, USA), 20 g of protein were boiled at 95°C for 10 minutes along with a Laémmlí Sx sample buffer. The denatured protein was electrophorized on an SDS-polyacrylamide gel and then transferred to a PVDF membrane. The membrane was immersed in a blocking solution (5% nonfat dry milk in TBS and 0.05% Tween 20) and treated for 1 hour at room temperature, followed by overnight incubation in a refrigerator at 4°C along with an AR primary antibody (T2000, Santa Cruz, USA) and a GAPDH antibody (1 5000, Cell Signaling Technology, USA), three times with TBST and then reacted for 1 hour at room temperature with a radish peroxidase conjugated secondary antibody (Cell Signaling Technology), after which the protein band was detected using, as a chemiluminescent reagent, the chemiluminescent substrate SuperSignal® Pico (Thermo, USA). The ability of 14 types of SAMiRNAs to inhibit androgen receptor protein expression was confirmed as shown in FIG. 7, and the inhibitory capacity of the Nos, 68 and 109 sequences was also much higher 20 on protein expression. 3.5 Evaluation of the efficacy of inhibiting androgen receptor protein expression in the hair follicle dermal papilla cell (HFDPC) as a human-derived hair root cell To confirm whether the SEQ ID NOS: 68 and 109 finally selected in Example 3.4 actually inhibit the expression of the androgen receptor protein in human hair root cells, the degree of inhibition of protein expression was measured using human-derived hair root cells, specifically hair follicle dermal papilla cells (HFDPCs) (FIG. 8). It was found that both sequences were capable of inhibiting the expression of the androgen receptor protein. Example 4. Confirmation of the intradermal delivery effect of SAMiRNA nanoparticles To confirm whether the SAMiRNA-AR» and SAMiRNA«AR#1O9 manufactured with the SEQ ID NOS: 68 and 109 finally selected are actually delivered to the 15 human hair roots, the effect of gene transfer on human hair was measured. Hair was collected by pulling on the hair tip on the day of the experiment, cut to a length of approximately 1 cm from the root, and cultured in an incubator for 1 hour using 200 µL of MI99 medium (10% FBS + 1% penicillin) in a 96-well plate. Subsequently, to observe gene transfer, cultures were incubated for 24 hours using 200 µL of MI99 medium containing 2 pM and 10 pM SAMIRNA labeled with a fluorescent material (FAM dye). After 24 hours of treatment, the material underwent three washes with DPBS, and finally, the hair roots were fixed for 20 minutes in PBS containing 3.7% formaldehyde and 2% F8S. The fixed hair roots were placed in base mold 5 containing the OCT compound and placed on a pre-frozen stainless steel plate to completely freeze the OGT compound. The frozen tissues were stored at -70°C and allowed to stand for about 30 minutes to facilitate tissue sectioning before cutting with a tissue sectioning machine. The sectioned tissue was placed on a slide with a thickness of 10 µm and dried for 1 hour. After drying, a mounting process was performed. Here, a mounting medium containing DAPL was used. Based on the result of fluorescence observation using a laser scanning confocal microscope (LSM5 UVE CONFIGURATION VARIOTWO VRGB), it was confirmed that SAMIRNA was delivered to the hair root cells of the hair tissue (FIG; 15 9). Although specific embodiments of the present invention have been disclosed in detail as described above, it will be obvious to those skilled in the art that the description is merely of preferred exemplary embodiments and should not be construed as limiting the scope of the present invention. Therefore, the substantial scope of the present invention shall be defined by the appended claims and their equivalents. Industrial applicability 8 According to the present invention, a bio-oligonucleotide construct including an androgen receptor-specific oligonucleotide and a composition for preventing hair loss or promoting hair growth containing the same as an active ingredient can suppress the expression of an androgen receptor with high efficiency without side effects, and can thus exhibit excellent effects in preventing hair loss, particularly androganeic alopecia, alopecia areata, and telogen effluvium, and promoting hair growth.

Claims

1. A double-stranded oligonucleotide construct having a structural formula (1) as follows: AXRYB Structural Formula (1) 5 in Structural Formula (1), characterized in that A is a hydrophobic material, B is a hydrophobic material, each of X and Y independently represents a single covalent bond or an envalent bond mediated by a linker, and R represents an androgen receptor-specific oligonucleotide comprising a sense strand comprising any sequence 10 selected from the group consisting of SEQ ID NOS: 6, 58, 68, 99, 107, 109, 260, 270, 284, 298, 348, 358, 359 and 434 and an antisense strand comprising a sequence complementary thereto, 2 The construction of double-stranded oligonucleotides according to claim 15, characterized in that the double-stranded oligonucleotide construction has a structural formula (2) below; AXSY-8 AS Structural Formula (2) in Structural Formula (2), S represents the sense strand of the oligonucleotide according to claim 1, AS represents the antisense strand thereof, and A, B, X and Y are as defined in claim 1, 3. The double-stranded oligonucleotide construction according to claim 2, characterized in that the double-stranded oligonucleotide construction has a structure of Structural Formula (3) or Structural Formula (4) as follows: A - X - 5' S 3' - Y - 8 5 Structural Formula (3) AX-S' s AS Structural Formula (4) In Structural Formula (3) and in Structural Formula (4), A, B, XY, S and AS are as defined in claim 2, and 5' and 3' represent a 5' end and a 3' end of the sense strand of the oligonucleotide.

4. The construction of double-stranded oligonucleotides according to claim 1, characterized in that the hydrophilic material has a molecular weight of 200 to 10,000.

5. The construction of double-stranded oligonucleotides according to claim 4, characterized in that the hydrophilic material is any selected from the group consisting of polyethylene glycol (PEG), polyvinylpyrrolidone, and polyoxazoline.

6. The construction of double-stranded oligonucleotides according to claim 1, characterized in that the hydrophilic material has a structure of Structural Formula (5) or Structural Formula (6) as follows. 5 (XA%)r Structural Formula ( 6) In Structural Formula (5) and Structural Formula (6), A' is a monomer of hydrophilic material, J is a linker for connecting m monomers of hydrophilic material to each other or for connecting m monomers of hydrophilic material and one oligonucleotide to each other, m is an integer from 1 to 15, and n is an integer from 1 to 10, the monomer of hydrophilic material A' is any compound selected from Compound (1) and Compound (3) below, and the linker (J) is selected from the group consisting of POs-, SCb-, and CCh-. Compound (J) Compound (1) Compound (2) 7. The construction of double-stranded oligonucleotides according to claim 5 1, characterized in that the hydrophobic material has a molecular weight of 250 to 1,000.

8. The construction of double-stranded oligonucleotides according to claim 7, characterized in that hydrophobic material is selected from the group consisting of a steroid derivative, a glyceride derivative, glycerol ether, polypropylene glycol, an unsaturated or saturated hydrocarbon, Cu-Oso, 5-diaeiphosphatidylcholine fatty acid, phospholipid, and lipopolamine.

9. The construction of double-stranded oligonucleotides according to claim 8, characterized in that the steroid derivative is selected from the group consisting of cholesterol, cholestanol, cholic acid, cholesterol formate, cholestanyl formate 10, and cholesterol amine.

10. The construction of double-stranded oligonucleotides according to claim 8, characterized in that the glyceride derivative is selected from the group consisting of mono-, di- and tri-glycerides.

11. The construction of double-stranded oligonucleotides according to claim 1, characterized in that the covalent bond represented by X and Y is either a non-scissile bond or a scissile bond.

12. The construction of double-stranded oligonucleotides according to claim 11, characterized in that the non-scissile bond is an amide bond or a phosphate bond.

13. The construction of double-stranded oligonucleotides according to claim 11, characterized in that the scintiform bond is a disulfide bond, an acid-scintiform bond, an ester bond, an anhydride bond, a biodegradable bond, or an enzyme-scintifiable bond.

14. The construction of double-stranded oligonucleotides according to claim 1, characterized in that a ligand having the property of specifically binding to a receptor that promotes target cell internalization via receptor-mediated endocytosis (RME) is further bound to the hydrophilic material, 15. The construction of double-stranded oligonucleotides according to claim 14, characterized in that the ligand is selected from the group consisting of a target receptor-specific antibody, aptamer, peptide, folate, N-acetylgalactosamine (NAG), glucose, and mannose. 20 16. The construction of double-stranded oligonucleotides according to claim 1, characterized in that an amsna group or a polyhistidine group is further introduced into an end portion of the hydrophilic material opposite an end portion bonded to the oligonucleotide. 5 17. The construction of bicatenan oligonucleotides according to claim 16, characterized in that the amine group or the polyhistidine group is connected to the hydrophilic material or to a hydrophilic block through at least one linker.

18. The construction of bicatenan oligonucleotides according to claim 16, characterized in that the amine group is any one selected from primary to tertiary amine groups.

18. The construction of double-chain oligonucleotides according to claim 16, characterized in that the polyhistidine group comprises from 3 to 10 histidines.

26. A nanoparticle comprising the construction of double-chain oligonucleotides according to any one of claims 1 to 15. 19-21. The nanoparticle according to claim 20, characterized in that it comprises a mixture of double-stranded oligonucleotide constructs comprising oligonucleotides having different sequences. 5 22. A pharmaceutical composition for preventing hair loss or promoting hair growth, comprising the double-stranded oligonucleotide construct according to any one of claims 1 to 19 as an active ingredient. 10 23. A pharmaceutical composition for preventing hair loss or promoting hair growth, comprising the nanoparticle according to claim 20 as an active ingredient.

24. The pharmaceutical composition according to claim 22, characterized in that the pharmaceutical composition is used for a formulation selected from ointment, paste, gel, lotion, serum, aerosol, non-aerosol spray, foam, cream, lotion, solution, and suspension formulations. 25.The pharmaceutical composition according to claim 23, characterized.

20. A pharmaceutical composition is used for a formulation selected from among the formulations of ointment, paste, gel, jelly, serum, aerosol, non-aerosol spray, foam, cream, lotion, solution, and suspension.

26. A cosmetic composition for preventing hair loss or promoting hair growth, comprising the construction of bicatephery oligonucleotides according to any one of claims 1 to 19 as an active ingredient.

27. A cosmetic composition for preventing hair loss or promoting hair growth, comprising the nanoparticle according to claim 29 as an active ingredient. 28.The cosmetic composition according to claim 26, characterized in that the composition is used for a formulation selected from 15 hair tonic, hair conditioner, hair essence, hair lotion, hair nutrition lotion, hair shampoo, hair rinse, hair treatment, hair cream, hair nutrition cream, hair moisturizing cream, hair massage cream, hair wax, hair spray, hair pack, hair nutrition pack, hair soap, 20 hair cleansing foam, hair oil, hair dryer, hair dye, hair waving agent, hair bleach, hair gel, hair polish, hair dressing, hair lacquer, hair moisturizer, hair mousse, and hair spray formulations. 29.The cosmetic composition according to claim 27, characterized in that the composition is used for a formulation selected from hair tonic, hair conditioner, hair essence, hair lotion, hair nutrition lotion, hair shampoo, hair rinse, hair treatment, hair cream, hair nutrition cream, hair moisturizing cream, hair massage cream, hair wax, hair spray, hair pack, hair nutrition pack, hair soap, hair cleansing foam, hair oil, hair dryer, hair dye, hair waving agent, hair bleach, hair gel, hair polish, hair dressing, hair lacquer, hair moisturizer, hair mousse, and hair spray formulations.