Application of FTO, interference sequence of FTO and application of interference sequence

Abstract

The invention relates to the technical field of medicine preparation, and particularly discloses application of FTO in preparation of a product for diagnosing preeclampsia, an interference sequence of the FTO and application of the interference sequence, and the FTO sequence is as shown in SEQ ID NO.1. The FTO can be used as an effective component of a preparation for diagnosing preeclampsia. Meanwhile, interference sequences FTO-RNAi (118151-1), FTO-RNAi (118152-2) and FTO-RNAi (118153-1) which can be used for preparing the medicine for treating preeclampsia are screened out through FTO, and tests prove that the interference sequences can obviously weaken attack of hypoxia-induced preeclampsia.

Description

Technical Field

[0001] The present invention relates to the technical field of drug preparation, and in particular to the application of FTO in the preparation of products for diagnosing preeclampsia, an interfering sequence of FTO and the application of the interfering sequence. Background Art

[0002] Preeclampsia (PE) is a systemic syndrome that affects multiple systems during pregnancy. It is mainly manifested by increased blood pressure (systolic blood pressure ≥140 mmHg / diastolic blood pressure ≥90 mmHg) and proteinuria (≥300 mg / 24h; urine protein qualitative ≥(+)) after 20 weeks of pregnancy, headache, nausea, upper abdominal discomfort and other symptoms. It can affect multiple organs such as the heart, brain, liver, and kidneys, causing serious maternal and infant complications such as heart failure, placental abruption, and intrauterine fetal death. It is one of the main causes of maternal and perinatal death. Therefore, termination of pregnancy and delivery of the placenta are the most effective radical treatment methods so far. With the continuous progress of medicine and scientific research, PE has made certain progress in early screening, but its mortality and morbidity are still high. Therefore, how to prevent the occurrence of PE and implement timely intervention and treatment measures in the early stage is a difficult problem that medical researchers need to solve urgently.

[0003] At present, the etiology of PE has not been fully clarified, but the academic community generally believes that PE is caused by insufficient invasion and migration of placental trophoblasts, which leads to placental hypoperfusion, resulting in the release of local microenvironmental inflammatory factors, inducing systemic vascular inflammation and endothelial dysfunction, and ultimately leading to clinical symptoms such as hypertension and organic diseases in the mother. Among them, the placenta, as a unique organ during pregnancy, is the main link for the exchange of nutrients between the fetus and the mother. Its functional abnormality is the core and key to the formation of PE. Trophoblasts are a type of cell unique to the placenta. Their structural damage and functional abnormalities will cause irreversible changes to the normal physiological functions of the placenta. Therefore, it is of great scientific significance to deeply explore the mechanism of PE and explore the prevention and treatment methods of PE.

[0004] A large number of basic studies have shown that traditional epigenetics, such as DNA methylation, histone modification, and chromatin remodeling, can regulate the expression of related genes, regulate placental development and adaptive changes, and participate in the development of PE. Recently, RNA methylation modification, as an emerging research direction of epigenetic regulation, has attracted much attention from medical researchers. RNA modification, as a post-transcriptional regulatory method, is an important branch of epigenetic disorders in the development of diseases. 6 A (N6-methyladenosine) is one of the most common RNA modifications in eukaryotes and is conservative, dynamic, and reversible. 6A modification mainly occurs on the sixth N atom of RNA adenine (A), which is a post-transcriptional modification similar to DNA methylation. 6 A methylation is mainly completed by methyltransferase 3 (Methyltransferase-like protein 3, METTL3) and methyltransferase 14 (Methyltransferase-like protein 14, METTL14). 6 A demethylation is mainly performed by fat mass-and obesity-associated gene (FTO) and AlkB homologue 5 (ALKBH5). 6 A reader proteins include YTH domain family proteins 1-3 (YTHDF1-3) and insulin-like growth factor 2 mRNA binding protein 1 / 2 / 3 (Insulin-likegrowth factorⅡmRNA-bindingprotein 1 / 2 / 3, IGF2BP1 / 2 / 3), which recognize m 6 Methylation sites of A and enhance RNA stability. 6 A modification mainly occurs in the common sequence of RRACH (R = G or A, H = A, C or U), which can regulate the entire metabolic process of mRNA splicing, maturation, transport, translation and degradation, and plays an important role in post-transcriptional regulation of genes. Its abnormal modification can be involved in a variety of diseases such as tumorigenesis, cardiovascular disease, obesity, and fat metabolism. So far, there have been some reports on mRNA modification in PE placenta, but its role in the pathogenesis of PE has not yet been clarified. FTO is m 6 A demethylase, located on chromosome 16q12.2, encodes 2-hydroxyglutarate (2-OG) Fe (II)-dependent AlkB family dioxygenase, with a total length of 410.50 kb, including 9 exons and 8 introns. FTO is mainly associated with m 6 A methyltransferases jointly regulate m 6 FTO is involved in the pathogenesis of malignant tumors, affecting the proliferation, migration, invasion, characteristics of tumor stem cells, drug resistance and other malignant biological behaviors of tumor cells. Clinically, FTO can be targeted for treatment. Studies have found that FTO can regulate m 6 A modification inhibits the expression of APOE and inhibits glycolysis of thyroid cancer by regulating the IL-6 / JAK2 / STAT3 signaling pathway, thereby inhibiting tumor growth. 6ARNA modification reduces the contractile function of mammalian hearts and hypoxic cardiomyocytes, and provides a new mechanism for the treatment of myocardial infarction. The latest study found that the lipid-lowering drug atorvastatin can reduce the expression of FTO protein in endothelial cells, through m 6 A modification upregulates the expression levels of Kruppel-like factor 2 (KLF2) and eNOS mRNA in endothelial cells and inhibits the expression of adhesion molecules VCAM-1 and ICAM-1. However, there are no reports on the effect of FTO in the pathogenesis of PE. Summary of the invention

[0005] Based on the above technical problems, the present invention provides an application of FTO in the preparation of products for diagnosing preeclampsia. The FTO in the present invention can be used as an effective molecule for preparations for diagnosing preeclampsia, and the present invention screened out interference sequences FTO-RNAi (118151-1), FTO-RNAi (118152-2), and FTO-RNAi (118153-1) that can be used to prepare treatments for preeclampsia through FTO.

[0006] The present invention provides an application of FTO in preparing a product for diagnosing or treating preeclampsia, wherein the FTO sequence is shown as SEQ ID NO.1.

[0007] Furthermore, the product is a kit.

[0008] Furthermore, the kit includes primers for detecting FTO, and the primer sequences for detecting the FTO are:

[0009] Forward primer: 5′-GTTCACAACCTCGGTTTAGTTC-3′;

[0010] Reverse primer: 5′-CATCATCATTGTCCACATCGTC-3′.

[0011] Furthermore, the kit includes TB Green Premix Ex Taq II (Tli RNaseH Plus) (2X), DNA template, and enzyme-free water.

[0012] The present invention also provides an interference sequence of the FTO, wherein the interference sequence is FTO-RNAi (118151-1), FTO-RNAi (118152-2) or FTO-RNAi (118153-1).

[0013] The present invention also provides the use of the interference sequence in preparing a drug for treating preeclampsia.

[0014] Furthermore, the only active ingredient of the drug is any one or a combination of FTO-RNAi (118151-1), FTO-RNAi (118152-2) and FTO-RNAi (118153-1).

[0015] Furthermore, the drug includes a pharmaceutically acceptable carrier or excipient.

[0016] Furthermore, the carrier or auxiliary material includes but is not limited to lactose, glucose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum arabic, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate or mineral oil.

[0017] The drug can be prepared into an oral preparation or an injection preparation as required. The oral preparation can be a capsule, granule, tablet, oral solution or other liquid preparation. The injection preparation is a preparation administered by intravenous injection or intramuscular injection, such as an injection solution or an injection powder.

[0018] Furthermore, the interfering sequence is used to prepare an agent for promoting trophoblast migration, invasion or proliferation. Furthermore, the interfering sequence is used to prepare an inhibitor of trophoblast apoptosis or inflammation.

[0019] Furthermore, the preeclampsia is induced by hypoxia.

[0020] The present invention also provides a method for screening a drug for preventing, improving or treating preeclampsia, comprising:

[0021] The candidate drug is administered to the preeclampsia model, and the expression level of the FTO is detected before and after the administration. If the expression level of the preeclampsia after the administration is lower than the expression level of the preeclampsia before the administration, it indicates that the candidate drug is the target drug.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] 1. The present invention combines clinical placental tissue samples and hypoxia-induced human placental trophoblastic cells (HTR-8 / SVneo, JEG-3, BEWO) in vitro research models to investigate the m 6 A related methylases were screened and FTO was identified as a methylase involved in regulating PE m 6 The key demethylase modified by A provides new potential targets and ideas for the early clinical prediction and precise treatment of PE.

[0024] 2. The FTO provided by the present invention can be used to prepare preparations for diagnosing preeclampsia. The expression level of FTO is significantly increased after hypoxia-induced preeclampsia, indicating that FTO can be used as a molecular marker for preeclampsia.

[0025] 3. The present invention has designed interference sequences FTO-RNAi (118151-1), FTO-RNAi (118152-2), and FTO-RNAi (118153-1) for FTO; experimental studies have shown that the three interference sequences all have a significant inhibitory effect on FTO, and the inhibitory effects of the expression of the three interference sequences are roughly the same.

[0026] 4. After interference with the FTO interference sequences FTO-RNAi (118151-1), FTO-RNAi (118152-2), and FTO-RNAi (118153-1) provided by the present invention, the proliferation, migration, and invasion abilities of trophoblastic cells were enhanced, and the apoptosis and inflammation of trophoblastic cells were weakened, indicating that FTO-RNAi (118151-1), FTO-RNAi (118152-2), and FTO-RNAi (118153-1) can significantly reduce the onset of hypoxia-induced preeclampsia, providing a theoretical basis for the treatment of preeclampsia and prevention of recurrence. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0028] Figure 1 The migration ability of cells was detected by scratch assay; A: The migration ability of HTR-8 / SVneo cells was detected by scratch assay, magnification 4×; A1: The migration rate of HTR-8 / SVneo cells; B: The migration ability of JEG-3 cells was detected by scratch assay, magnification 4×; B1, the migration rate of JEG-3 cells; C: The migration ability of BEWO cells was detected by scratch assay, magnification 4×; C1: The migration rate of BEWO cells.

[0029] Figure 2The transwell assay was used to detect the invasion ability of different cells; A: transwell assay was used to detect the invasion ability of HTR-8 / SVneo cells, with a magnification of 20×; A1: the invasion index of HTR-8 / SVneo cells; B: transwell assay was used to detect the invasion ability of JEG-3 cells, with a magnification of 20×; B1: the invasion index of JEG-3 cells; C: transwell assay was used to detect the invasion ability of BEWO cells, with a magnification of 20×; C1: the invasion index of BEWO cells.

[0030] Figure 3 CCK-8 was used to detect the proliferation ability of HTR-8 / SVneo, JEG-3 and BEWO cells.

[0031] Figure 4 The apoptosis rate of cells was detected by flow cytometry; A: the apoptosis rate of HTR-8 / SVneo cells was detected by flow cytometry; A1: the apoptosis rate statistics of HTR-8 / SVneo cells; B: the apoptosis rate of JEG-3 cells was detected by flow cytometry; B1, the apoptosis rate statistics of JEG-3 cells; C: the apoptosis rate of BEWO cells was detected by flow cytometry; C1: the apoptosis rate statistics of BEWO cells.

[0032] Figure 5 It is the expression of cellular inflammatory factors; A: qRT-PCR detection of the expression level of inflammatory factor mRNA in trophoblast cells (HTR-8 / SVneo, JEG-3, BEWO); B: ELISA method detection of the content of inflammatory factors in the supernatant of trophoblast cell (HTR-8 / SVneo, JEG-3, BEWO) culture fluid.

[0033] Figure 6 Is the effect of FTO on different cells m 6 A: The overall level of influence of FTO on HTR-8 / SVneo cells 6 A: Overall level; B: Effect of FTO on JEG-3 cells m 6 A: The overall level; C: FTO on BEWO cells m 6 The overall level of A. DETAILED DESCRIPTION

[0034] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0035] The present invention provides the use of FTO in preparing a product for diagnosing preeclampsia, and the FTO sequence is shown as SEQ ID NO.1.

[0036] The present invention combines clinical placental tissue samples and hypoxia-induced human placental trophoblastic cells (HTR-8 / SVneo, JEG-3, BEWO) in vitro research models to investigate the m 6 A related methylases were screened and FTO was identified as a methylase involved in regulating PE m 6 This indicates that FTO can be used as a potential target for early clinical prediction and precise treatment of PE.

[0037] The present invention designs interference sequences FTO-RNAi (118151-1), FTO-RNAi (118152-2), and FTO-RNAi (118153-1) for FTO; experimental studies have found that the three interference sequences all have a significant inhibitory effect on FTO. After interference with the interference sequence, the proliferation, migration and invasion abilities of trophoblasts are improved, and the apoptosis and inflammation of trophoblasts are weakened, indicating that the interference sequence can significantly reduce the onset of hypoxia-induced preeclampsia.

[0038] Example 1

[0039] A use of FTO and its interfering sequence in the preparation of products for diagnosing or treating preeclampsia.

[0040] 1. Experimental Materials and Methods

[0041] 1. Materials and reagents

[0042] Penicillin-streptomycin (Solarbio, China); PBS (Hyclone, China); gentamicin (Biotopped, Beijing); fetal bovine serum (FBS) (Zhongqiao Xinzhou, China); α-EME medium (Zhongqiao Xinzhou, China); ROS kit (Servicebio, China); TBST buffer (Double Helix, China); total RNA extraction kit (TIANGEN, China); cDNA (complementary DNA) kit, RT-qPCR (real-time fluorescence quantitative PCR) kit (Takara, Japan); Lipofectamine TM 2000 (ThermoFisher Scientific, USA); primers were synthesized by Shanghai Bioengineering Co., Ltd.; FTO sequence is shown in SEQ ID NO. 1. Interference fragment sequence is shown in Table 1.

[0043] FTO, SEQ ID NO.1:

[0044]

[0045] Table 1 Interference fragment sequences

[0046] name serial number sequence FTO-RNAi(118151-1) NM_001080432 CAGTGAAAAGGGTCTAATATAA, SEQ ID NO.2 FTO-RNAi(118152-2) NM_001080432 CTGGTTAGGATCCAAGGCAAA, SEQ ID NO.3 FTO-RNAi(118153-1) NM_001080432 ACAAGATGAAGTGGACATTAA, SEQ ID NO.4

[0047] 2. Instruments and equipment

[0048] Handheld vortex oscillator (Kylin-bell, China); precision electronic balance (Sartorius, Germany); micropipette (Eppendorf, Germany); dual-temperature water bath shaker (HLD, Jiangsu); UV clean bench (Antai, China); desktop centrifuge (Eppendorf, Germany); handheld portable centrifuge (SCILOGEX, USA); biological safety cabinet (Sujing Antai, China); ice machine (BILON, China); Biotek microplate reader (Dequan Xingye, Beijing); 6-well plate and 96-well plate (Corning, USA); horizontal shaker (Kylin-bell, China); gradient PCR instrument (Eppendorf, Germany); fluorescence quantitative PCR instrument (Thermo Fisher Scientific, USA); LUNA cell counter (Dongsheng, Beijing); gel imager (BIO-RAD, USA).

[0049] 3. Human placental trophoblast cell culture

[0050] Human placental trophoblast cells (HTR-8 / SVneo, JEG-3, BEWO) were cultured in MEM basal medium (containing nucleosides and deoxynucleosides) containing 10% fetal bovine serum and 1% double antibody (penicillin-streptomycin) at 37°C and 5% CO2 in an incubator. Establishment of an in vitro model of hypoxia-induced human placental trophoblast cells: The cells were placed in a cell culture incubator at 37°C, 1% O2 and 5% CO2, and subsequent experiments were performed after 48 hours. Virus infection: The virus was transferred according to the conditions determined in the preliminary experiment, and the calculation was performed according to the following formula:

[0051]

[0052] After adding 0.2uL of lentivirus (calculated according to MOI=50) according to the above formula, 40uL of HiTransGA infection enhancement solution was added and culture was continued; the fluorescence efficiency was observed according to the time when the cells were most efficiently infected with the virus in the preliminary experiment (it can also be monitored in real time), and the culture medium needs to be replaced during this period (the culture medium with the virus added is discarded and new culture medium is added) to maintain a high cell activity; after the lentivirus-infected cells enter the logarithmic growth phase, 2μg / mL of puromycin is added to the culture medium to screen cells successfully infected with the lentivirus, and cells that fail to be infected are removed. When the fluorescence efficiency reaches 80% and the density reaches 80%, the cells in the six-well plate are transferred to a 25T culture flask for culture. At this time, a stable cell line infected with FTO interfering lentivirus has been constructed, and the cells can be passaged to expand the culture volume for seed retention (long-term storage after freezing) and subsequent experiments.

[0053] 4. RT-qPCR (real-time quantitative fluorescence PCR) detection of FTO expression

[0054] According to the instructions of the TIANGEN total RNA extraction kit, the total RNA (ribonucleic acid) of osteoblasts was extracted, and reverse transcription was performed according to the instructions of the reverse transcription kit. RT-qPCR (real-time quantitative fluorescence PCR) was performed using the Takara Real-Time PCR MasterMix (fluorescent dye-labeled real-time PCR mixture) kit to detect and analyze the FTO expression using a Thermo Fisher PCR instrument, and GAPDH was used as a control. The experimental results were calculated according to the following formula: Relative expression of the target gene = 2 －△△Ct , where ΔΔCt=[CtGI(test sample)-CtGAPDH(test sample)]-[CtGI(calibration sample)-CtGAPDH(calibration sample)]. GI refers to the target gene being measured, Ct refers to the intensity of the fluorescence signal detected in the reaction system, and calibration samples refer to all samples selected to represent 1 times the expression amount of the target gene being measured.

[0055] (1) The specific steps of RNA extraction are as follows:

[0056] a. Centrifuge the cells and discard the supernatant. 6 Add 1 ml of Lysis Buffer RZ to the cells. Do not wash the cells before adding Lysis Buffer RZ to avoid degradation of mRNA;

[0057] b. The homogenized sample was placed at room temperature for 5 minutes to allow the nucleic acid-protein complex to be completely separated;

[0058] c. Add 200 μL of chloroform, cover the tube, shake vigorously for 15 seconds, and leave at room temperature for 3 minutes;

[0059] d. Centrifuge at 4°C, 12,000 rpm (~13,400 x g) for 10 minutes. The sample will separate into three layers: a yellow organic phase, an intermediate layer, and a colorless aqueous phase. RNA is mainly in the aqueous phase, and the volume of the aqueous phase is about 50% of the lysis buffer RZ reagent used. Transfer the aqueous phase to a new tube and proceed to the next step;

[0060] e. Slowly add 0.5 times the volume of anhydrous ethanol and mix well (precipitate may appear at this time). Transfer the obtained solution and precipitate into the adsorption column CR3, centrifuge at 4°C, 12,000rpm (~13,400xg) for 30 seconds. If the entire solution and mixture cannot be added to the adsorption column CR3 at one time, transfer them into the adsorption column CR3 twice, centrifuge at 4°C, 12,000rpm (~13,400xg) for 30 seconds, and discard the waste liquid in the collection tube;

[0061] f. Add 500 μl of deproteinized solution RD to the adsorption column CR3, centrifuge at 4°C, 12,000 rpm (~13,400 x g) for 30 seconds, discard the waste liquid, and place CR3 into a collection tube;

[0062] g. Add 500 μl of rinse solution RW to the adsorption column CR3, let stand at room temperature for 2 minutes, centrifuge at 4°C, 12,000 rpm (~13,400 x g) for 30 seconds, and discard the waste liquid;

[0063] h. Repeat step g;

[0064] i. Place the adsorption column in a 2 ml collection tube and centrifuge at 4°C, 12,000 rpm (~13,400 x g) for 2 minutes to remove the residual liquid;

[0065] j. Transfer the adsorption column CR3 into a new 1.5 ml centrifuge tube, add 50 μl RNase-Free ddH20, leave at room temperature for 2 minutes, and centrifuge at 4°C, 12,000 rpm (~13,400 x g) for 2 minutes;

[0066] The concentration of the extracted RNA was measured using a micro-spectrophotometer, and the RNA was reverse transcribed into cDNA.

[0067] (2) The specific steps of reverse transcription are:

[0068] The reaction solution was prepared according to the 20 μL system (5X PrimeScript Buffer (for Real Time) 4 μl; PrimeScript RT Enzyme Mix I 1 μl, Oligo dT Primer (50 μM) 1 μl, Random 6mers (100 μM) 1 μl, Total RNA (1 μg), supplemented with 13 μL of enzyme-free water), vortexed to mix, reverse transcription conditions: 37°C for 15 minutes, 85°C for 5 seconds, and stored at 4°C. The reverse transcribed cDNA was subjected to real-time fluorescence quantitative PCR detection.

[0069] (3) The specific steps of real-time fluorescence quantitative PCR detection are as follows:

[0070] The reaction solution was prepared according to the 20 μL system (TB Green Premix Ex Taq II (Tli RNaseH Plus) (2X) 10 μL, PCR Forward Primer (10 μM) 0.8 μL, PCR Reverse Primer (10 μM) 0.8 μL, DNA template 2 μL, enzyme-free water 6.4 μL), and mixed by vortexing.

[0071] The FTO amplification primer sequences are:

[0072] FORWARD: 5'-GTTCACAACCTCGGTTTAGTTC-3', SEQ ID NO.5;

[0073] REVERSE: 5'-CATCATCATTGTCCACATCGTC-3', SEQ ID NO. 6.

[0074] Amplification conditions: pre-denaturation: 95°C for 30 seconds; denaturation: 95°C for 5 seconds; annealing and extension: 60°C for 34 seconds.

[0075] 5. Isolation of RNA from the nucleus and cytoplasm

[0076] (1) Preparation of cell components:

[0077] a. Aspirate the culture medium and wash with PBS solution, then aspirate the PBS solution;

[0078] b. Add 200 μL of ice-cold Lysis Buffer J directly to the culture plate;

[0079] c. Gently tap the culture plate and swirl the buffer around the plate surface 5 times to lyse the cells for 5 minutes while placing the cell culture plate on an ice cube tray;

[0080] d. Transfer the lysate to an RNase-free centrifuge tube and spin at maximum speed in a centrifuge for 10 minutes;

[0081] e. Using a pipette, transfer the supernatant containing cytoplasmic RNA to another RNase-free tube.

[0082] (If nuclear RNA extraction is required, retain the pellet containing nuclear RNA and proceed immediately to step (1))

[0083] (2) A. Binding cytoplasmic RNA to the column

[0084] a. Add 200 μL of Buffer SK to 1 e of supernatant (cytoplasmic RNA fraction) and vortex for 10 seconds;

[0085] b. Add 200 μL of anhydrous ethanol to the mixture and mix by vortexing for 10 seconds;

[0086] c. Place the mixture on a spin column equipped with a collection tube and centrifuge at ≥3,500 x g for 1 minute;

[0087] d. Discard the waste solution and reassemble the spin column and its collection tube.

[0088] B. Binding nuclear RNA to the column

[0089] a. Add 400 μL Buffer SK to the nuclear RNA fraction pellet and vortex for 10 seconds;

[0090] b. Add 200 μL of anhydrous ethanol to the mixture and vortex for 10 seconds;

[0091] Note: For more than 10 6 It is recommended to pass the lysate through a 25-gauge needle attached to a syringe 5 to 10 times to shear the genomic DNA before loading onto the column.

[0092] c. Place the mixture onto a second spin column equipped with a collection tube and centrifuge at ≥3,500 x g for 1 minute.

[0093] d. Discard the waste solution and reassemble the spin column and its collection tube.

[0094] (3) Column washing

[0095] a. Add 400 μL Wash Solution A to the column and centrifuge for 1 minute, discarding the centrifuged liquid;

[0096] Note: Make sure all wash solution A has passed through the collection tube by inspecting the column. If not all wash volume has been used, spin for an additional minute;

[0097] b. Repeat the previous step to clean the column for the second time;

[0098] c. Add another 400 μL Wash Solution A and wash the column for the third time, centrifuge for 1 minute;

[0099] d. Discard the flow-through and reassemble the spin column and its collection tube;

[0100] e. Spin the column for 2 minutes to thoroughly dry the resin and discard the collection tube.

[0101] (4) RNA elution

[0102] a. Place the column into a new 1.7 mL elution tube provided with the kit;

[0103] b. Add 50 μL Elution Buffer E to the column;

[0104] c. Centrifuge at 200 x g for 2 minutes, then at 14,000 x g for 1 minute;

[0105] Note: To achieve maximum RNA recovery, it is recommended to perform a second elution in a separate microcentrifuge tube (repeat steps b and c).

[0106] (5) Storage of RNA

[0107] The extracted and purified RNA samples can be stored at -20℃ for several days. It is recommended to store the samples at -70℃ for long term storage.

[0108] 6. Transfection of human placental trophoblast cells (HTR-8 / SVneo, JEG-3, BEWO) with FTO interference fragments

[0109] Since the three interference sequences of FTO in Table 1, FTO-RNAi (118151-1), FTO-RNAi (118152-2), and FTO-RNAi (118153-1), have roughly the same inhibitory effect on FTO, the present invention will only use the interference sequence FTO-RNAi (118151-1) as an example to illustrate the effect.

[0110] The interference fragment sequences FTO-RNAi (118151-1), FTO-RNAi (118152-2), and FTO-RNAi (118153-1) in Table 1 were used to inhibit the expression of the specific gene FTO in a targeted manner.

[0111] Different trophoblast cells were inoculated into 6-well plates and cultured for 24 hours until the cell density reached 70%. TM2000 kit operating instructions for transfection, add 5μL FTO-RNAi (118151-1) to 250μL serum-free culture medium, mix gently, and add 5μL Lipofectamine TM 2000 liposomes were mixed with 250 μL serum-free medium and placed at room temperature for 5 minutes. After 5 minutes, the two were mixed and placed at room temperature for 20 minutes. Each well of the 6-well plate was fixed to 2 mL with serum-free medium and placed in a constant temperature incubator for continued culture. After 6 hours of transfection, the control group was replaced with 7% MEM medium.

[0112] After successful transfection of the interference fragment, each cell line was grouped into: control group, marked as sh-NC; FTO interference group, marked as sh-FTO; hypoxia group, marked as sh-NC+Hypoxia; hypoxia+FTO interference group, marked as sh-FTO+Hypoxia.

[0113] 7. Scratch wound healing test

[0114] ① Seed plate: Take a clean and sterile 6-well plate, and use a marker pen to draw two parallel horizontal lines on the back of the plate, crossing the wells. Each well is divided into three equal parts. Add 5×10 5 The cells were cultured in a 37°C, 5% CO2 cell culture incubator;

[0115] ② Scratch: Take the 6-well plate out of the incubator. When the density of cells in the 6-well plate is about 90%, use a 20uL pipette tip to scratch perpendicular to the parallel lines on the bottom of the 6-well plate. Make 3 scratches per well (maintain the same force), then wash twice with PBS, shake the 6-well plate crosswise to clean the cells at the scratch, then add 2ml of serum-free culture medium to each well, and place the 6-well plate in a 37°C, 5% CO2 cell culture incubator for incubation;

[0116] ③Photography and statistics: Under a microscope, observe the cell wound healing at 0 and 24 hours and take photos. Note that the location of each photo is located according to the parallel lines on the back of the 6-well plate to ensure the same field of view each time. Calculate the migration distance of each group. After repeating 3 batches of samples, use Imag J to perform statistical analysis on the images and draw statistical graphs.

[0117] 8. Transwell cell invasion

[0118] One day before the experiment, take out the matrix gel from -20℃ and place it at 4℃ overnight to melt it. The next day, place the matrix gel on an ice box and bring it into the clean bench.

[0119] ① Preparation of Transwell chamber: Dilute the matrix gel at a ratio of 1:8 on ice and mix well. After pre-cooling the pipette tip, add 100 μL of the diluted matrix gel into each Transwell chamber, shake well, and place in a 37°C, 5% CO2 cell culture incubator for 2 to 3 hours or overnight to allow the gel to solidify. Add serum-free medium to hydrate for 30 minutes before seeding;

[0120] ② Cell resuspension: The normal control and experimental group cells after transfection for 48 hours were digested with trypsin, centrifuged at 1000 rpm for 5 minutes, resuspended in complete medium, and counted with a counting plate to adjust the cell concentration to 5×10 5 Pieces / mL;

[0121] ③Cell inoculation: Add 200 μL of cell suspension to the upper chamber, set up 3 replicate wells for each group, and add 700 μL of culture medium containing 20% ​​FBS to the corresponding lower chamber of the 24-well plate (avoid bubbles), and place in a 37°C, 5% CO2 cell culture incubator for 24 hours;

[0122] ④ Wash the cells: After 24 hours, discard the culture medium in the Transwell chamber, clamp the chamber with tweezers and wash it twice in PBS solution;

[0123] ⑤ Fix the cells: The upper and lower chambers of the Transwell were immersed in 4% paraformaldehyde for 20 minutes, and then the chambers were clamped with tweezers and washed twice in PBS solution;

[0124] ⑥Cell staining: Add appropriate amount of 0.1% crystal violet staining solution to both the upper and lower chambers of the Transwell for 20 minutes. Clamp the chamber with tweezers and wash it twice in PBS solution. Use a dry cotton swab to gently wipe off the uninvaded cells and matrix gel in the upper chamber and let it dry at room temperature.

[0125] ⑦ Cell counting: Place the chamber under an inverted microscope, observe the cells passing through the chamber and take pictures. Randomly select 3 fields of view from each chamber and use Imag J for statistical analysis of the images.

[0126] 9. CCK-8 cell proliferation

[0127] ① Inoculation of cells: The normal control and experimental group cells after transfection for 48 hours were digested with trypsin, centrifuged at 800 rpm for 5 minutes, resuspended in complete medium, and counted on a counting plate to adjust the cell concentration to 5×10 4 Each group of cells was inoculated into 96-well plates at 100 μL per well, with 7 replicate wells per group, and cultured in a 37°C, 5% CO2 cell culture incubator;

[0128] ② Cultured cells: conventional cultured cells;

[0129] ③ Color development: Take out the corresponding 96-well plates from the incubator at 0h, 12h, 24h, 48h, and 96h, respectively, mix CCK-8 and complete culture medium in a ratio of 1:9 in a clean bench, discard the waste culture medium, add 100uL of the prepared CCK-8 mixture, be careful not to have bubbles, and incubate in the incubator for 2h;

[0130] ④Measure and count the OD value: Place the 96-well plate on the microplate reader and measure the OD value at 450nm.

[0131] 10. Flow cytometry apoptosis detection technology

[0132] ① Various specifications of pipettes, various specifications of RNase-free tips, EDTA-free trypsin, PBS (cold), BD apoptosis kit;

[0133] ② Collect cells and centrifuge: remove cells from the cell compartment, discard the supernatant, add 1 mL of cold PBS to wash the cells, discard the waste liquid, repeat 3 times. Add 1 mL of EDTA-free trypsin to digest the cells, and centrifuge at 4°C, 1000 rpm for 5 minutes;

[0134] ③ Wash cells and stain: Take out the centrifuged cells, discard the supernatant, add 1mL PBS and gently blow the cells twice, discard the supernatant; put the washed cells on ice and stain, dilute 10×binding buffer with UP water to 1×binding buffer, add 100uL 1×binding buffer to each loading tube, gently stir to mix, add 5uL PE and 5uL 7-ADD to each tube, gently stir to mix, protect from light and let stand for 15min. Then, add 400uL 1×bindingbuffer to each loading tube, blow gently to mix, and filter into a new loading tube with a filter membrane;

[0135] ④On-machine detection: The apoptosis rate was detected on the machine within 1 hour, and the obtained data were analyzed using Novo Express.

[0136] 11. Enzyme-linked immunosorbent assay (ELISA)

[0137] ① Sample processing: collect the supernatant of each group of cell culture, centrifuge at 2000rpm for 20min, and collect the supernatant;

[0138] ②Prepare standard products: first, take 0.5 mL of standard products and dilute them according to the instructions of IL-1β, IL-6, IL-8 and TNF-a;

[0139] ③ Sample addition: On the enzyme-labeled plate, add 50uL of the standard to each well, 40uL of the diluent to each well of the sample to be tested, and 10uL of the sample to be tested, and gently shake to mix;

[0140] ④ Incubation: Seal the plate with a sealing film and incubate in a 37°C incubator for 30 minutes;

[0141] ⑤ Washing: Take out the enzyme-labeled membrane and remove the sealing film, discard the liquid, spin dry, fill each well with washing solution, let it stand for 30 seconds and then discard it, repeat this 5 times, and pat dry;

[0142] ⑥ Add enzyme: add 50uL of enzyme labeling reagent to each well, except for the blank well;

[0143] ⑦ Incubation: same operation as ③;

[0144] ⑧Washing: the same operation as ⑤;

[0145] ⑨ Color development: first add 50uL of color development medium A to each well, then add 50uL of color development medium B, gently shake and mix, and color development at 37℃ in the dark for 10min;

[0146] ⑩ Termination and determination: Add 50uL of stop solution to each well to terminate the reaction, adjust to zero with the blank well, measure the OD value of each well at 450nm and the standard curve, and calculate the concentration of each sample to be tested.

[0147] 12. EpiQuikm6A RNA methylation quantitative detection 6 A modification level

[0148] ① Reagent preparation: Wash Buffer, CA (capture antibody), DA solution (detection antibody), ES solution (enhancement solution), PC (positive control): dilute to 0.5 ng / μL, 0.2 ng / μL, 0. / 1 ng / μL, 0.05 ng / μL, 0.02 ng / μL and 0.01 ng / μL in sequence for use as standards, prepare on ice before use;

[0149] ② Add 80 μl BS (binding solution) solution, add 2 μl diluted PC solution of different concentrations, NC (negative control) solution and 200 ng RNA sample, mix well by pipetting, and incubate at 37°C for 90 min;

[0150] ③Discard the liquid, wash twice with 150 μL 1× Wash Buffer, add 50 μL diluted CA solution, and incubate at room temperature for 60 min;

[0151] ④Discard the liquid, wash three times with 150 μL 1× Wash Buffer, add 50 μL diluted DA solution, and incubate at room temperature for 30 min;

[0152] ⑤Discard the liquid, wash 4 times with 150 μL 1× Wash Buffer, add 50 μL diluted ES solution, and incubate at room temperature for 30 min;

[0153] ⑥Discard the liquid, wash five times with 150 μL 1× Wash Buffer, add 100 μL DS solution, and incubate at room temperature in the dark for 10 min;

[0154] ⑦ Add 100 μL SS solution to terminate the color reaction and detect the absorbance at a wavelength of 450 nm;

[0155] ⑧Calculation: OD value is the vertical coordinate, m 6 A Oligos mass is used as the horizontal axis to draw a standard curve. The m 6 The amount of A is then calculated using the following formula to calculate m in the RNA sample. 6 The percentage of A. m 6 A%=m 6 A content (ng) / total RNA content (200ng) × 100%

[0156] 13. Statistical processing

[0157] The results were analyzed and processed using Prism 9.0 statistical software and expressed as mean ± standard deviation (Mean ± SD). The Student's t test was used to compare the means of two samples, the One-way ANOVA test was used to compare the means of multiple samples, and the Student-Newan-Keuls test was used to compare the means between groups. P ≤ 0.05 was considered statistically significant.

[0158] 2. Experimental Results

[0159] 1. Effect of FTO on trophoblast migration ability

[0160] In order to further clarify the effect of FTO on the migration ability of trophoblast cells (HTR-8 / SVneo, JEG-3, BEWO) induced by hypoxia. The scratch wound healing assay was used to detect the effect of FTO on the migration ability of trophoblast cells (HTR-8 / SVneo, JEG-3, BEWO) induced by hypoxia. The results showed that in the trophoblast cells (HTR-8 / SVneo, JEG-3, BEWO) with the same width of scratches, compared with the sh-NC group, the scratch distance of the sh-FTO group was significantly shortened, and the cell migration ability was increased; compared with the sh-NC+Hypoxia group, the scratch distance of the sh-FTO+Hypoxia group was significantly shortened, and the cell migration ability was increased, indicating that FTO can inhibit the migration ability of trophoblast cells, see Figure 1 .

[0161] 2. Effect of FTO on trophoblast invasion

[0162] In order to further clarify the effect of FTO on the invasion ability of hypoxia-induced trophoblast cells (HTR-8 / SVneo, JEG-3, BEWO). The scratch wound healing assay was used to detect the effect of FTO on the invasion ability of hypoxia-induced trophoblast cells (HTR-8 / SVneo, JEG-3, BEWO). The results showed that in the trophoblast cells (HTR-8 / SVneo, JEG-3, BEWO) with the same width of scratches, compared with the sh-NC group, the scratch distance of the sh-FTO group was significantly shortened, and the cell invasion ability was increased; compared with the sh-NC+Hypoxia group, the scratch distance of the sh-FTO+Hypoxia group was significantly shortened, and the cell invasion ability was increased, indicating that FTO can inhibit the invasion ability of trophoblast cells, see Figure 2 .

[0163] 3. Effect of FTO on trophoblast proliferation

[0164] CCK-8 assay was used to detect the effect of FTO on the proliferation ability of trophoblast cells (HTR-8 / SVneo, JEG-3, BEWO) induced by hypoxia. The results showed that compared with the sh-NC group, the proliferation ability of HTR-8 / SVneo, JEG-3, and BEWO cells in the sh-FTO group was increased at 48h and 72h, and there was no significant change in the proliferation ability at 12h and 24h; compared with the sh-NC+Hypoxia group, the proliferation ability of HTR-8 / SVneo, JEG-3, and BEWO cells in the sh-FTO+Hypoxia group was increased at 48h and 72h, and there was no significant change in the proliferation ability at 12h and 24h, indicating that FTO can inhibit the proliferation ability of trophoblast cells. Figure 3 .

[0165] 4. Effect of FTO on apoptosis of trophoblastic cell lines

[0166] Flow cytometry was used to detect the effect of interfering with FTO on apoptosis of trophoblast cells (HTR-8 / SVneo, JEG-3, and BEWO) during hypoxia. The results showed that compared with the sh-NC group, the apoptosis rates of HTR-8 / SVneo, JEG-3, and BEWO cells in the sh-FTO group were significantly reduced; compared with the sh-NC+Hypoxia group, the apoptosis rates of HTR-8 / SVneo, JEG-3, and BEWO cells in the sh-FTO+Hypoxia group were also significantly reduced, indicating that FTO can promote the apoptosis of trophoblast cells. Figure 4 .

[0167] 5. Effect of FTO on the expression of inflammatory factors in hypoxic trophoblasts

[0168] qRT-PCR was used to detect the effect of interfering with FTO on the mRNA expression of inflammatory factors in trophoblast cells (HTR-8 / SVneo, JEG-3, BEWO) induced by hypoxia. The results showed that compared with the sh-NC group, the mRNA expressions of inflammatory factors IL-1β, IL-6, IL-8, and TNF-α in HTR-8 / SVneo, JEG-3, and BEWO cells in the sh-FTO group were decreased; compared with the sh-NC+Hypoxia group, the mRNA expressions of inflammatory factors IL-1β, IL-6, IL-8, and TNF-α in the sh-FTO+Hypoxia group were decreased, indicating that FTO can promote the mRNA expression of inflammatory factors in trophoblast cells. Figure 5 A.

[0169] ELISA was used to detect the effects of FTO on the levels of inflammatory factors in the culture fluid of trophoblast cell lines induced by hypoxia. The results showed that in trophoblast cells (HTR-8 / SVneo, JEG-3, BEWO), compared with those in the sh-NC group, the levels of inflammatory factors IL-1β, IL-6, IL-8, and TNF-α in the cell culture supernatant of the sh-FTO group were decreased; compared with those in the sh-NC+Hypoxia group, the levels of inflammatory factors IL-1β, IL-6, IL-8, and TNF-α in the cell culture supernatant of the sh-FTO+Hypoxia group were decreased, indicating that FTO can promote the expression of inflammatory factors IL-1β, IL-6, IL-8, and TNF-α in the culture fluid of trophoblast cells. Figure 5 B.

[0170] 6. Effect of FTO on trophoblast cells 6 Effect of A modification

[0171] The effects of FTO interference on trophoblast m 6 The results showed that compared with the sh-NC group, the m 6 Compared with the sh-NC+Hypoxia group, the m 6 The methylation level of A was also significantly increased (P < 0.01). Figure 6 . This suggests that FTO can regulate trophoblast m 6 The methylation level of A.

[0172] In summary, the present invention found that FTO expression was upregulated in trophoblasts under hypoxia treatment, and FTO may be the target of hypoxia-induced preeclampsia. Knocking down FTO can reduce the onset of hypoxia-induced preeclampsia. The diagnostic value of FTO was clarified for the first time, which provides a theoretical basis for the treatment of preeclampsia and prevention of recurrence, and is of great significance.

[0173] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0174] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. An application of FTO in the preparation of a product for diagnosing preeclampsia, characterized in that: The FTO sequence is shown as SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The product is a kit, which includes primers for detecting the FTO. The primer sequences for detecting the FTO are: Forward primer: 5′-GTTCACAACCTCGGTTTAGTTC-3′; Reverse primer: 5′-CATCATCATTGTCCACATCGTC-3′.

3. The use according to claim 2, characterized in that: The kit includes 2X TB Green Premix ExTaq II, DNA template, and enzyme-free water.

4. An interference sequence of the FTO according to claim 1, characterized in that: The interference sequence is FTO-RNAi (118151-1), FTO-RNAi (118152-2) or FTO-RNAi (118153-1).

5. Use of the interfering sequence according to claim 4 in the preparation of a drug for treating preeclampsia.

6. The use according to claim 5, characterized in that: The only active ingredient of the drug is any one or a combination of FTO-RNAi (118151-1), FTO-RNAi (118152-2) and FTO-RNAi (118153-1).

7. The use according to claim 6, characterized in that: The medicine includes a pharmaceutically acceptable carrier or excipient.

8. The use according to claim 7, characterized in that: The medicine is an oral preparation or an injection preparation.

9. The use according to claim 1 or 5, characterized in that: The preeclampsia is induced by hypoxia.

10. A method for screening drugs for preventing, ameliorating or treating preeclampsia, characterized in that: include: The candidate drug is administered to the preeclampsia model, and the expression level of FTO described in claim 1 is detected before and after administration. The expression level of preeclampsia after administration is lower than the expression level of preeclampsia before administration, which indicates that the candidate drug is a target drug.

Images