Application of Lnc-PSMB8-AS1 gene in preparation of drugs and diagnostic kits for treating gastric cancer

Abstract

The invention discloses application of an Lnc-PSMB8-AS1 gene in preparation of a medicine for treating gastric cancer and a diagnostic kit, and belongs to the field of biomedical treatment. Statistic analysis is carried out on the expression quantity of the Lnc-PMSB8-AS1 gene in gastric cancer patient tissues and normal gastric tissues in a TCGA database, and it is found that the expression quantity of the Lnc-PMSB8-AS1 gene in the gastric cancer tissues is obviously higher than that in the normal tissues. The method comprises the following steps of: transfecting Lnc-PMSB8-AS1-siRNA, then verifying at the lncRNA level by using a real-time fluorescent quantitative PCR (Polymerase Chain Reaction) technology, and displaying that after transfecting Lnc-PMSB8-AS1-siRNA, the mRNA level expression of MGC-803 cell related migration and proliferation genes MMP7, MMP14, cyclinB1 and cyclinE1 is obviously reduced. Meanwhile, in combination with phenotypic experimental results, the Lnc-PMSB8-AS1 is prompted to have good application in preparation of diagnostic kits and targeted therapeutic drugs for gastric cancer.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to the use of the Lnc-PSMB8-AS1 (lncRNAPSMB8-AS1) gene as a target for gastric cancer diagnosis and treatment. Background Art

[0002] Gastric cancer (GC) ranks fifth in incidence and fourth in mortality among various malignant tumors worldwide.

[0003] The pathogenesis of gastric cancer is very complex and the process is very long. Chronic superficial gastritis often develops into atrophic gastritis, followed by intestinal metaplasia leading to dysplasia, and finally leading to the occurrence of gastric cancer. The pathogenesis of gastric cancer is induced by internal and external factors. The internal carcinogenic factors are mainly manifested as the expression of proto-oncogenes in genetic family history. External carcinogenic factors can directly induce or long-term damage the gastric mucosal barrier, making it easier for carcinogens to induce stem cell oncogene expression or gene mutation to produce carcinogens, turning newly born immature primitive cells into various abnormal cells with poor differentiation and uncontrolled growth. Because the early symptoms of gastric cancer are not obvious, it is not easy to detect and eventually develops into the late stage. Therefore, further research on the molecular mechanism of GC and finding a diagnostic method that is simple to operate and has a higher diagnosis rate are urgently needed in clinical practice.

[0004] Long non-coding RNA (lncRNA) is a non-coding RNA with a length greater than 200 nucleotides. lncRNA was initially considered to be the "noise" of genomic transcription, a byproduct of RNA polymerase II transcription, and was considered to have no biological function. With the in-depth study of lncRNA, it was found that lncRNA is involved in many important regulatory processes such as X chromosome silencing, genomic imprinting, chromatin modification, transcriptional activation, transcriptional interference, and nuclear transport. lncRNA can be transcribed from the upstream promoter region of protein-coding genes, interfering with the expression of downstream genes; inhibiting RNA polymerase II or mediating chromatin remodeling and histone modification, affecting the expression of downstream genes; forming complementary double strands with the transcripts of protein-coding genes, interfering with the shearing of mRNA, and forming different shearing forms; forming complementary double strands with the transcripts of protein-coding genes, and producing endogenous siRNA under the action of Dicer enzyme; binding to specific proteins, lncRNA transcripts can regulate the activity of corresponding proteins; as a structural component, forming a nucleic acid-protein complex with proteins; binding to specific proteins, changing the cellular localization of the protein; acting as a precursor molecule of small molecule RNA (such as miRNA, piRNA), etc. At the same time, studies have found that the expression or abnormal function of long non-coding RNA is closely related to the occurrence of human diseases, including cancer, degenerative neurological diseases and many other major diseases that seriously endanger human health.

[0005] Studies have reported that patients with higher levels of Lnc-PSMB8-AS1 in pancreatic cancer and colon cancer have poorer healing, and Lnc-PSMB8-AS1 promotes cancer cell proliferation and migration, thereby promoting cancer progression. However, so far, the role of Lnc-PSMB8-AS1 in gastric cancer and its mechanism of occurrence have not been reported.

[0006] Therefore, the present invention will detect the expression of long non-coding Lnc-PSMB8-AS1 in gastric cancer tissue, aiming to prepare a diagnostic kit, and on this basis study the effect of down-regulation of Lnc-PSMB8-AS1 expression on the proliferation and migration of gastric cancer cells, which provides a favorable theoretical basis for improving the diagnosis rate of gastric cancer and improving the survival of gastric cancer. Summary of the invention

[0007] One of the purposes of the present invention is to provide a use of the Lnc-PSMB8-AS1 gene in the preparation of a drug for treating gastric cancer. Another purpose of the present invention is to provide a use of the Lnc-PSMB8-AS1 gene in the preparation of a kit for molecular diagnosis of gastric cancer.

[0008] In order to achieve the above-mentioned invention object, the technical solution adopted by the present invention is as follows:

[0009] (1) Application of Lnc-PSMB8-AS1 gene (NCBI Gene ID: 100507463) in the preparation of a diagnostic kit for gastric cancer.

[0010] (2) Use of the Lnc-PSMB8-AS1 gene in the preparation of a drug for inhibiting gastric cancer. The drug is designed with the Lnc-PSMB8-AS1 gene as a target.

[0011] (3) The inhibitor of Lnc-PSMB8-AS1 gene is Lnc-PSMB8-AS1-siRNA, and its sequence is: 5'-CAGUGCAUGUAAACAGACUTT-3'.

[0012] (4) Application of Lnc-PSMB8-AS1 gene inhibitors in the preparation of drugs for inhibiting gastric cancer.

[0013] Beneficial effects: The present invention proves through a large amount of experimental data that Lnc-PSMB8-AS1 plays an important role in promoting the occurrence of gastric cancer: the specific siRNA sequence is used to efficiently inhibit the expression of the Lnc-PSMB8-AS1 gene in human gastric cancer cell lines. Through MTT, cell scratch experiments and real-time fluorescence quantitative PCR methods, it is confirmed that reducing the expression of the Lnc-PSMB8-AS1 gene can inhibit the proliferation and migration ability of gastric cancer cells. It can be seen that the Lnc-PSMB8-AS1 gene is widely used in the preparation of drugs for treating gastric cancer and in gastric cancer molecular diagnostic kits. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is a differential expression analysis of Lnc-PSMB8-AS1 in gastric cancer tissues and normal tissues of gastric adenocarcinoma patients in the TCGA database.

[0015] Figure 2 Real-time fluorescence quantitative PCR analysis: Changes in the mRNA level of Lnc-PSMB8-AS1 gene in cells after transfection of Lnc-PSMB8-AS1-siRNA in gastric cancer cell line MGC803. 18S rRNA was used as the internal reference gene of Lnc-PSMB8-AS1.

[0016] Figure 3 This is an MTT cell proliferation experiment. The proliferation of gastric cancer cell MGC803 cells after transfection with Lnc-PSMB8-AS1-siRNA within 96 hours.

[0017] Figure 4A The picture shows the cell scratch experiment of gastric cancer cell MGC803 transfected with Lnc-PSMB8-AS1-siRNA within 96 hours. Figure 4B The figure shows the healing rate of gastric cancer cell MGC803 transfected with Lnc-PSMB8-AS1-siRNA within 96 hours, 24 hours and 96 hours.

[0018] Figure 5 Real-time fluorescence quantitative PCR analysis; changes in intracellular mRNA levels of MMP7, MMP14, cyclinB1, and cyclinE1 genes after transfection of Lnc-PSMB8-AS1-siRNA in the gastric cancer cell line MGC803. DETAILED DESCRIPTION

[0019] The interference with Lnc-PSMB8-AS1 gene expression described in the present invention includes knocking out the coding gene of Lnc-PSMB8-AS1, interfering with the transcription of Lnc-PSMB8-AS1 gene and other biological processes. Although the specific mechanism of interference is not yet fully understood, it does not hinder the realization of "interference".

[0020] In some specific embodiments, the drug may be added with one or more pharmaceutically acceptable adjuvants, including but not limited to granules, buffers, surfactants and other well-known pharmaceutical adjuvants.

[0021] In some specific embodiments, the drug can be prepared into dosage forms including but not limited to microinjections and dosage forms suitable for transfection, and these dosage forms can be prepared according to conventional methods in the pharmaceutical field.

[0022] The present invention is further described below by embodiments, including the use of materials and specific sources. However, it should be understood that these are exemplary only, and not limiting of the present invention. Materials similar or identical to the types and models, or properties or functions of the following tissues, cells, reagents, instruments can be used for implementation of the present invention.

[0023] The methods in the following examples are common methods unless otherwise specified.

[0024] Main Materials:

[0025]

[0026]

[0027] Note: Unless otherwise specified, the reagents used in the present invention can be any suitable commercially available reagents; cell lines can be obtained commercially.

[0028] 1. Differential analysis of Lnc-PSMB8-AS1 expression in gastric cancer and normal tissues of patients with gastric adenocarcinoma in the TCGA database

[0029] The Xena functional genomics browser was used to perform genomic statistical analysis on the mRNA expression of Lnc-PSMB8-AS1 in gastric cancer tissues and normal tissues of gastric cancer patient samples in the online TCGA database, and the significant differences were calculated, including 29 normal tissue samples and 305 gastric cancer tissue samples.

[0030] Results: Compared with the expression in normal gastric tissue, the expression level of Lnc-PSMB8-AS1 in gastric cancer tissue was significantly upregulated (P<0.0001). This indicates that Lnc-PSMB8-AS1 is highly expressed in gastric cancer tissue and is a potential factor promoting gastric cancer.

[0031] 2. Changes in mRNA levels in MGC803 cells after interference with Lnc-PSMB8-AS1

[0032] 1. Cell Culture

[0033] Human gastric cancer cell line MGC803 cells were cultured in DMEM medium containing 10% (V / V) fetal bovine serum (FBS), 1% (V / V) penicillin and streptomycin. The cells were cultured in an incubator at 37°C and 5% CO2 saturated humidity.

[0034] 2. Cell Transfection

[0035] First, MGC803 cells were cultured at 1.6 × 10 5 The cells were seeded in 6-well plates at a density of 100 μg / cm2. After 24 hours, the cells were transfected when the cells were about 60% plated. The Lnc-PSMB8-AS1-siRNA interference group and the NC-siRNA universal negative control group were set up for transfection. The transfection concentration was 50 nM. The transfection reagent used was Lipofectamine 8000, and the transfection method was carried out according to the instructions. Before transfection of siRNA, the cell culture medium was replaced with an incomplete culture medium, and after 6-8 hours, it was replaced with a complete culture medium for continued culture.

[0036] 3. RNA Extraction

[0037] Continue to culture for 48 hours after transfection and collect cells. Discard the supernatant of cells, add 1ml Trizol to the same group of 6-well plates, and shake on a shaker for 5 minutes. After fully dissolved, remove the liquid and put it in a 1.5ml EP tube. Add 100μL BCP. Mix thoroughly with a vortex machine for 15s and let it stand for 8 minutes to separate. Centrifuge at 12000×g at 4℃ for 15min, extract the supernatant containing RNA to a new 1.5ml centrifuge tube, add an equal volume of isopropanol and mix dozens of times, let it stand for 10min to precipitate RNA, centrifuge at 12000×g at 4℃ for 15min, remove the liquid, and leave the white precipitate as the extracted RNA. Finally, add 75% DEPC ethanol solution to clean RNA. Centrifuge at 4℃, centrifuge at 7500×g for 5min, and discard the supernatant to remove the isopropanol residue. Dry at room temperature for 1h, add nuclease-free water, and heat at 55℃ in a metal bath for 10min to fully dissolve the RNA. The OD260 and OD280 absorbance values ​​of RNA were tested. It is generally believed that an A260 / A280 value between 1.8 and 2.1 can be used to preliminarily determine that the total RNA quality is good.

[0038] 4. Detection of Lnc-PSMB8-AS1 Levels by Fluorescence Quantitative PCR

[0039] The Vazyme reverse transcription kit was selected. According to the concentration of RNA, 3000 ng was loaded, 20 μM Oligo (dT) and random primers were used in an amount of 1 μL each. Nuclease-free water was added to a total volume of 10 μL in the corresponding PCR eight-row tube. After mixing, it was placed in a PCR instrument at 65°C for 10 min. According to the instructions of the kit, 5×HiScript II Select qRTSuperMix and nuclease-free water were added to react at 50°C for 15 min, and then at 85°C for 5 sec. After the reaction was completed, it was stored at -80°C. Using cDNA as a template, Lnc-PSMB8-AS1 upstream and downstream primers and 2×SYBR Select Master Mix were added for real-time fluorescence quantitative PCR, and the control group samples were selected for gradient dilution as the standard curve. The reaction conditions were 50°C for 20 s; 95°C for 10 min, 95°C for 10 s, and 60°C for 1 min, and repeated for 40 cycles. The detected Lnc-PSMB8-AS1 CT value was standardized and corrected with the CT value of the internal reference gene 18s. The obtained CT value was calculated using the 2-ΔΔCT method to compare the differences in the Lnc-PSMB8-AS1 gene content between different samples. The Lnc-PSMB8-AS1 forward primer used was as described in SEQ ID NO: 1; the Lnc-PSMB8-AS1 reverse primer was as described in SEQ ID NO: 2. The internal reference 18s forward primer was as described in SEQ ID NO: 3; the internal reference 18s reverse primer was as described in SEQ ID NO: 4.

[0040] Results: Figure 2 As shown in the figure, the results of real-time fluorescence quantitative PCR showed that the mRNA level of Lnc-PSMB8-AS1 was knocked down by more than 70% in the Lnc-PSMB8-AS1-siRNA transfection group compared with the control group (P<0.05), proving that Lnc-PSMB8-AS1-siRNA has been successfully transferred into the cells and caused a decrease in the content of Lnc-PSMB8-AS1. This result shows that the expression level of Lnc-PSMB8-AS1 in gastric cancer cells can be reduced by exogenous interference.

[0041] 3. Interference with the Lnc-PSMB8-AS1 gene can inhibit the proliferation of gastric cancer cells

[0042] MTT was used to detect cell proliferation. 5 MGC803 cells were seeded in 6-well culture plates and transfected with Lnc-PSMB8-AS1-siRNA and NC-siRNA universal negative control according to the method in Specific Implementation 2. Complete medium was replaced 8 h after transfection, and cells were collected 48 h after transfection. The two transfected cells were re-seeded in 96-well plates at a density of 0.8×105 / well, and 3 replicate wells were set for each transfection group. After the cells adhered to the wall, 10 μL of MTT solution (5 mg / ml) was added to each well, and the 96-well plate was placed in an incubator for 4 hours, and then dimethyl sulfoxide solution was added for extraction for 10 minutes, and the absorbance at 450 nm was measured with an enzyme marker. The detection was performed at 0h, 24h, 48h, 72h, and 96h after inoculation into the 96-well plate. The cell proliferation curve was drawn according to the measured OD value.

[0043] Results: Figure 3 As shown, at 96h, the growth rate of the Lnc-PSMB8-AS1-siRNA transfection group was significantly lower than that of the control group (P<0.001), indicating that interfering with Lnc-PSMB8-AS1 can effectively inhibit the proliferation ability of gastric cancer cell MGC803.

[0044] 4. Interference with the Lnc-PSMB8-AS1 gene can inhibit the migration of gastric cancer cells

[0045] MGC803 cells with good growth status were seeded into 24-well plates, with 1.6×10 5 Before transfection, the cells were grown to a density of about 70%. After the cells adhered to the wall, transfection was performed according to the method in the specific implementation 2. Lnc-PSMB8-AS1-siRNA and NC-siRNA universal negative control were transfected respectively. After 8 hours of transfection, fresh complete medium was replaced. After 48 hours of transfection, a 200 μL sterile pipette tip was used to scratch the monolayer cells in a "cross" shape. PBS was washed three times to remove the fallen cells, and complete medium was added to continue culturing the cells. Under a 4x microscope, a smooth scratch position was selected and marked, and a photo was taken as the 0h control. Then the culture dish was placed in an incubator for continued culture, and cell images at the same position were collected at 24h and 72h. The area and width of the scratch were measured using ImagePro Plus 6.0 software. Cell healing rate = (width 1-width 2) / width 1, where width 1 represents the width of the scratch of the cell at 0h, and width 2 represents the width of the scratch of the cell at 48h or 96h.

[0046] Results: As shown in Figure 4, 24 hours after transfection, the migration speed of gastric cancer cells in the Lnc-PSMB8-AS1-siRNA transfection group was lower than that in the control group (P < 0.05). At 96 hours after transfection, the cells in the siNC transfection group were close to healing, while the healing rate of cells in the Lnc-PSMB8-AS1-siRNA transfection group was about 50% (P < 0.05). This result shows that after the Lnc-PSMB8-AS1 gene is interfered, the migration ability of gastric cancer cells MGC803 can be effectively inhibited.

[0047] 5. Interference with the Lnc-PSMB8-AS1 gene can inhibit the expression of genes related to proliferation and migration in gastric cancer cells

[0048] According to the method in the second specific implementation, total RNA of cells was extracted, reverse transcribed and then real-time fluorescence quantitative PCR was used to detect the changes in the mRNA levels of genes related to proliferation and migration in MGC803 cells after transfection with siRNA. The changes in the mRNA levels of MMP7, MMP14, cyclinB1 and cyclinE1 genes in MGC803 cells after transfection were detected. The forward primer of MMP7 used was as described in SEQ ID NO: 5; the reverse primer of MMP7 was as described in SEQ ID NO: 6; the forward primer of MMP14 was as described in SEQ ID NO: 7; the reverse primer of MMP14 was as described in SEQ ID NO: 8; the forward primer of cyclinB1 was as described in SEQ ID NO: 9; the reverse primer of cyclinB1 was as described in SEQ ID NO: 10; the forward primer of cyclinE1 was as described in SEQ ID NO: 11; the reverse primer of cyclinE1 was as described in SEQ ID NO: 12.

[0049] Results: Figure 5 As shown in the figure, compared with the control group, after interfering with Lnc-PSMB8-AS1 for 48 hours, the levels of migration and proliferation-related mRNA in MGC803 cells were detected, and the mRNA levels of MMP7, MMP14, cyclinB1 and cyclinE1 in the Lnc-PSMB8-AS1-siRNA group were significantly lower than those in the control group (P<0.05). This shows that interfering with the endogenous Lnc-PSMB8-AS1 gene can effectively inhibit the expression of genes that promote proliferation and migration in gastric cancer cells MGC803.

[0050] Statistical analysis: All data were averaged from three independent replicates, and the standard deviation (SD) was analyzed using the method in GraphPad Prism 8.0. P < 0.05 was considered statistically significant.

[0051] The scope of protection claimed for the present invention is not limited to the description of the specific embodiments.

[0052] Sequence Listing

[0053] Human-Lnc-PSMB8-AS1 forward primer: CAGUGCAUGUAAACAGACUTT

[0054] Human-Lnc-PSMB8-AS1 reverse primer: AGUCUGUUUACAUGCACUGTT

[0055] Human-18s forward primer: GTGGGCCGAAGATATGCTCA

[0056] Human-18s reverse primer: TTCACGGAGCTTGTTGTCCA

[0057] Human-MMP7 forward primer: GGGAGGCATGAGTGAGCTAC

[0058] Human-MMP7 reverse primer: CCAGCGTTCATCCTCATCGA

[0059] Human-MMP14 forward primer: CGAGGTGCCCTATGCCTAC

[0060] Human-MMP14 reverse primer: CTCGGCAGAGTCAAAGTGG

[0061] Human-cyclinB1 forward primer: TCGCATCAAACTCTCTGGCTA

[0062] Human-cycliB1 reverse primer: TGAGCGACTAAACTCACCACT

[0063] Human-cyclinE1 forward primer: AAGGAGCGGGACACCATGA

[0064] Human-cyclinE1 reverse primer: ACGGTCACGTTTGCCTTCC.

Claims

1. Application of LncR-PSMB8-AS1 gene in the preparation of a diagnostic kit for gastric cancer.

2. Application of Lnc-PSMB8-AS1 gene in the preparation of drugs for treating gastric cancer.

3. The use according to claim 2, characterized in that: The drug is designed with the Lnc-PSMB8-AS1 gene as a target.

4. An inhibitor of the Lnc-PSMB8-AS1 gene, characterized in that: The inhibitor is Lnc-PSMB8-AS1-siRNA, and its sequence is: 5'-CAGUGCAUGUAAACAGACUTT-3'.

5. Application of Lnc-PSMB8-AS1 gene inhibitors in the preparation of drugs for treating gastric cancer.

6. The use according to claim 5, characterized in that: The gene interfering with Lnc-PSMB8-AS1 expression includes knocking out or silencing the Lnc-PSMB8-AS1 encoding gene, and the vector is a viral vector or a non-viral gene silencing vector.

7. The use according to claim 6, characterized in that: The viral vector is an adenoviral vector, an adeno-associated viral vector, a retroviral vector or a herpes virus vector.

8. The use according to claim 6, characterized in that: The non-viral gene silencing vector is a CRISPR / Cas9 system gene knockout vector, an RNAi system gene silencing vector, or a vector modified on this basis.

Images