Use of an expression inhibitor of the tspan4 gene and a pharmaceutical containing the expression inhibitor of the tspan4 gene

Abstract

The application belongs to the technical field of genetic engineering and cardiovascular disease treatment, and specifically discloses application of an expression inhibitor of a TSPAN4 gene in preparation of a drug for treating cardiovascular diseases and the drug containing the expression inhibitor of the TSPAN4 gene. The application first constructs a carotid artery injury mouse model, and research finds that the expression absence of TSPAN4 has a significant improvement effect on intimal neogenesis. Further, the expression of the TSPAN4 gene is inhibited through siRNA interference RNA technology targeting the TSPAN4 gene, and it is found that after being treated by human h-siTSPAN4, the phenotype of smooth muscle cells can be changed, and the purpose of treating cardiovascular diseases can be achieved. The method of the application can inhibit the expression of the TSPAN4 gene by delivering siRNA, so as to inhibit the proliferation and migration of abnormal smooth muscle cells and reduce the development of cardiovascular diseases.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and cardiovascular disease treatment technology, specifically relating to the application of a TSPAN4 gene expression inhibitor in the preparation of drugs for treating cardiovascular diseases and drugs containing the TSPAN4 gene expression inhibitor. Background Technology

[0002] Cardiovascular diseases, including coronary artery disease, hypertension, cardiomyopathy, arrhythmia, and heart failure, are globally recognized as serious threats to human health. For the past three decades, cardiovascular diseases have consistently been a leading cause of morbidity and mortality worldwide. The pathophysiological basis of vascular diseases involves multiple mechanisms, including vascular aging, calcification, atherosclerosis, extracellular matrix remodeling, and immune cell infiltration. Vascular smooth muscle cells (VSMCs) are the most abundant cell type in blood vessels, not only performing vascular physiological functions but also contributing to vascular disease in various ways. Recent studies have shown that VSMCs exhibit high plasticity and multiple differentiation potentials in disease states, ultimately acquiring unexpected phenotypes with altered morphology and function. Notably, VSMC phenotypic transformation can be multidirectional in a single local injury. According to literature reports, this process involves metabolic dysfunction, stress response, intercellular communication, and multi-level signaling pathways, collectively forming a complex regulatory network. Because of the significant correlation between VSMC phenotypes and the occurrence and progression of vascular diseases, many studies have indicated that VSMC phenotypic switching is fundamental to the progression of vascular diseases, and have found that inhibiting the switching of VSMCs from contraction to other phenotypes helps alleviate the severity of vascular diseases. Research on VSMC phenotypic switching has not only elucidated new mechanisms of vascular diseases but also provided a novel therapeutic target.

[0003] However, there is currently no literature reporting the role of TSPAN4 expression in the pathogenesis and development of cardiovascular diseases. As a member of the Tetraspanin family, the function and regulatory mechanisms of TSPAN4 are receiving increasing attention. Studies have shown that TSPAN4 is expressed in multiple cell types and participates in various biological processes. Previous studies have identified TSPAN4 as a marker protein for novel organelles called "migrators," closely related to cellular functions such as migration and other biological functions. In addition to its role in normal physiological processes, abnormal expression of TSPAN4 is closely associated with the occurrence and development of various diseases. For example, TSPAN4 has been reported to be associated with the development and progression of tumors such as gastric cancer, lung cancer, and glioma. A few studies have also shown that TSPAN4 is related to cardiovascular diseases; however, the relationship between TSPAN4 and smooth muscle phenotypic transformation and vascular intimal neoplasia has not been reported, and its potential role in cardiovascular diseases remains to be explored and investigated. Summary of the Invention

[0004] The purpose of this invention is to provide an application of a TSPAN4 gene expression inhibitor in the preparation of drugs for treating cardiovascular diseases. Firstly, by constructing a carotid artery ligation mouse model, this invention found that TSPAN4 gene knockout significantly improved carotid artery stenosis, suggesting that TSPAN4 plays an important role in cardiovascular diseases. Further, using a vascular smooth muscle phenotypic alteration cell model, it was found that administration of human h-siTSPAN4 significantly inhibited PDGF-induced vascular smooth muscle cell proliferation, migration, and phenotypic changes. This provides important reference and guidance for new drug development in clinical practice and offers crucial evidence for the clinical use of h-siTSPAN4 to treat cardiovascular diseases.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0006] This invention provides the application of an inhibitor of TSPAN4 gene expression in the preparation of drugs for treating cardiovascular diseases.

[0007] In a preferred embodiment of the present invention, the expression inhibitor of the TSPAN4 gene is the interfering sequence h-siTSPAN4 of TSPAN4;

[0008] The nucleotide sequence of the interfering sequence h-siTSPAN4 is shown in SEQ ID NO.1.

[0009] As a preferred embodiment of the present invention, the TSPAN4 gene expression inhibitor is used to prepare a drug for treating cardiovascular diseases caused by vascular stenosis due to intimal neoplasia.

[0010] As a preferred embodiment of the present invention, the TSPAN4 gene expression inhibitor is used to prepare a drug that improves cardiovascular diseases caused by vascular smooth muscle cell proliferation, migration, or phenotypic changes.

[0011] The TSPAN4 gene expression inhibitor achieves its therapeutic effect on related cardiovascular diseases by inhibiting the proliferation and migration of vascular smooth muscle cells and phenotypic changes.

[0012] In a preferred embodiment of the present invention, when the interfering sequence h-siTSPAN4 is applied to cells, the concentration of the interfering sequence h-siTSPAN4 in the transfection system is 10 nM to 50 nM.

[0013] In a preferred embodiment of the present invention, the interfering sequence h-siTSPAN4 is used to prepare an expression promoter of SMA, SM22a or CNN1 in human smooth muscle cells.

[0014] In a preferred embodiment of the present invention, the interfering sequence h-siTSPAN4 is used to prepare an inhibitor of human smooth muscle cell proliferation and migration.

[0015] The present invention also provides a medicament for treating cardiovascular diseases, wherein the medicament uses an expression inhibitor of the TSPAN4 gene as the sole effective active ingredient.

[0016] In a preferred embodiment of the present invention, the drug comprises pharmaceutically acceptable excipients or carriers.

[0017] In a preferred embodiment of the present invention, the drug is an oral preparation or an injectable preparation.

[0018] More preferably, the oral preparation is a granule, tablet, capsule, powder, syrup, oral liquid or tincture.

[0019] More preferably, the injectable formulation is an intravenous injection formulation, an intramuscular injection formulation, or an injectable powder.

[0020] When the drug is prepared into an oral or injectable formulation, the excipients or carriers selected are specifically chosen according to the desired drug dosage form. For example, the selected excipients may be suspending agents, suspending aids, thickeners, colorants, antioxidants, preservatives, pH adjusters, osmotic pressure adjusters, thickeners, wetting agents, coating materials, capsule shells, etc.

[0021] Compared with the prior art, the beneficial effects of the present invention are:

[0022] This study found that TSPAN4 expression levels were elevated in both human atherosclerotic samples and mouse arteries after vascular intimal hyperplasia. Knockout of TSPAN4 inhibited vascular intimal hyperplasia in mice and increased the expression of vasomotor markers. This suggests that TSPAN4 may affect smooth muscle cell function, thereby influencing diseases related to vascular intimal hyperplasia, such as atherosclerosis, coronary heart disease, pulmonary hypertension, post-arterial restenosis, or diabetic syndrome. In vitro experiments confirmed that inhibitors of TSPAN4 gene expression can suppress the proliferation, migration, and phenotypic transformation of vascular smooth muscle cells, thereby achieving the ultimate goal of treating cardiovascular diseases.

[0023] This invention provides the application of a TSPAN4 gene expression inhibitor in the preparation of drugs for treating cardiovascular diseases. The TSPAN4 gene expression inhibitor is an interfering sequence of TSPAN4. Firstly, this invention establishes a mouse model of carotid artery stenosis and finds that TSPAN4 knockout significantly improves carotid artery stenosis, suggesting that TSPAN4 plays an important role in carotid artery stenosis. Further, human TSPAN4 is synthesized into siRNA:h-siTSPAN4, and using a vascular smooth muscle cell model, it is found that administration of h-siTSPAN4 significantly inhibits PDGF-induced proliferation, migration, and phenotypic changes in vascular smooth muscle cells. This demonstrates that h-siTSPAN4 has a therapeutic effect on cardiovascular diseases, which helps in the treatment of cardiovascular diseases and the development and application of nucleic acid drugs, and provides important evidence for the clinical use of siTSPAN4 to treat diabetic cardiomyopathy. The method of this invention can inhibit the expression of the TSPAN4 gene by delivering siRNA, thereby inhibiting the proliferation and migration of abnormal smooth muscle cells and reducing the development of cardiovascular diseases.

[0024] The TSPAN4 interference sequence provided by this invention, as a novel drug molecule, has advantages such as high affinity, high specificity, easy synthesis and modification, and flexible design, which helps to widely apply nucleic acid drugs in the pharmaceutical field. Attached Figure Description

[0025] Figure 1 To reduce intimal hyperplasia in mice after TSPAN4 knockout. (A) H&E staining of carotid artery tissue from WT and TSPAN4- / - mice; (B) Statistical graph of intima and media area;

[0026] Figure 2 The following is an illustration of the proliferation of human vascular smooth muscle cells (HASMCs) in Example 2 of this invention after treatment with the nucleic acid drug h-siTSPAN4 (concentration of 20 nM); (A) EdU staining of human vascular smooth muscle cells after treatment with si-TSPAN4 in the control group siNC and the experimental group; (B) EdU staining statistics.

[0027] Figure 3 The following is an illustration of the migration of human vascular smooth muscle cells (HASMCs) after treatment with the nucleic acid drug h-siTSPAN4 (concentration of 20 nM) in Example 2 of this invention: (A) Scratch test results of human vascular smooth muscle cells after treatment with si-TSPAN4 in the control group siNC and the experimental group; (B) Statistical graph of relative cell migration distance.

[0028] Figure 4The following is an illustration of the expression of vascular smooth muscle contractile-related proteins in human vascular smooth muscle cells (HASMCs) after treatment with the nucleic acid drug h-siTSPAN4 (concentration of 20 nM) in Example 2 of the present invention: (A) Expression of α-SMA, SM22α, and CNN1 in human vascular smooth muscle cells after treatment with si-TSPAN4 in the control group siNC and the experimental group; (B) Statistical graph of relative protein expression intensity. Detailed Implementation

[0029] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments thereof. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0030] This invention provides the application of an inhibitor of TSPAN4 gene expression in the preparation of drugs for treating cardiovascular diseases.

[0031] This study found that TSPAN4 expression levels were elevated in both human atherosclerotic samples and mouse arteries after vascular intimal hyperplasia. Knockout of TSPAN4 inhibited vascular intimal hyperplasia in mice and increased the expression of vasomotor markers. This suggests that TSPAN4 may affect smooth muscle cell function, thereby influencing diseases related to vascular intimal hyperplasia.

[0032] Further investigation using a mouse model of carotid artery stenosis revealed that TSPAN4 knockout significantly improved carotid artery stenosis, suggesting that TSPAN4 plays an important role in carotid artery stenosis.

[0033] This invention further synthesizes siNRA: h-siTSPAN4 from human TSPAN4, the nucleotide sequence of which is shown in SEQ ID NO.1; and using a vascular smooth muscle cell model, it was found that after administration of h-siTSPAN4, PDGF-induced proliferation, migration and phenotypic changes of vascular smooth muscle cells were significantly inhibited, proving that h-siTSPAN4 has a therapeutic effect on cardiovascular diseases.

[0034] Example 1

[0035] Effects of TSPAN4 knockout on carotid artery stenosis in mice induced by carotid artery ligation

[0036] To verify the role of TSPAN4 in cardiovascular disease, a mouse model of arterial stenosis was established by carotid artery ligation, and TSPAN4 was knocked out. The tissue changes of the carotid artery before and after TSPAN4 knockout were observed, as follows:

[0037] 1. Modeling and Grouping

[0038] TSPAN4 was knocked out in mice using CRISPR / Cas9 gene editing technology to obtain TSPAN4-KO mice, in order to explore the protective effect of TSPAN4 on arterial stenosis. The specific method is as follows:

[0039] Twenty wild-type and 20 TSPAN4-KO C57BL / 6 mice, SPF grade, weighing (20±2)g, were selected and fed a normal diet for 1 month. Ten mice from each wild-type and TSPAN4-KO group were randomly selected as blank control group (WT) and TSPAN4 knockout group (TSPAN4-KO).

[0040] The groups were: blank control group WT, arterial stenosis model group WT+Ligation, TSPAN4 knockout group TSPAN4-KO, and TSPAN4 knockout arterial stenosis model group TSPAN4-KO+Ligation.

[0041] Implementation method:

[0042] (1) Surgical instruments, including spring scissors, forceps, and scissors, are sterilized under high temperature and high pressure in advance and dried in an oven at 55°C.

[0043] (2) After general anesthetizing mice with 1% sodium pentobarbital at a dose of 50 mg / kg, remove hair from the neck with depilatory cream and disinfect with povidone-iodine.

[0044] (3) The mouse was placed in a supine position. After fixing the limbs and head, the skin was cut along the midline of the neck. Under a stereomicroscope, the neck muscles were bluntly separated with forceps to avoid damaging the nerves next to the blood vessels. The left common carotid artery was located and exposed.

[0045] (4) Ligate the left common carotid artery with 7-0 sterile surgical sutures;

[0046] (5) After ligation, the muscle is returned to its original position, the surgical opening is sutured, disinfected with iodine, and placed on a warming pad.

[0047] (6) After the mice have recovered, place them in a clean cage and feed them under normal conditions while observing their condition.

[0048] 2. Evaluation Methods

[0049] Three weeks later, the degree of vascular stenosis was evaluated by embedding the mouse carotid artery and HE staining to determine whether the model was successful and the effect of TSPAN4 knockout on arterial stenosis.

[0050] 2.1 Tissue sampling of mouse carotid artery and aorta

[0051] (1) The instruments required for sampling, including spring shears, tweezers and scissors, should be sterilized in advance by high temperature and high pressure and dried in an oven at 55℃.

[0052] (2) After euthanizing the mice, fix the mice in a supine position, cut open the skin and subcutaneous tissue, expose the heart, remove the pericardium, cut a small opening in the right atrial appendage, and inject about 20 mL of pre-cooled physiological saline through the left ventricle.

[0053] (3) Bluntly dissect the neck muscle layer, remove the common carotid artery from the bifurcation of the carotid artery, and retain the ligation suture; use fine spring scissors and pointed forceps to separate the blood vessels and surrounding excess tissue along the aortic arch to the thoracic aorta, abdominal aorta and iliac artery, and remove the aorta; place it in a well plate filled with physiological saline on ice, rinse it and place it in a 1.5mL EP tube;

[0054] (4) The removed carotid artery was fixed overnight in 4% paraformaldehyde at 4°C. Then it was transferred to 30% sucrose solution to dehydrate until it naturally sank to the bottom. The tissue was then embedded using OCT. The tissue used for protein and RNA extraction was placed in 1.5 mL EP tubes, flash-frozen in liquid nitrogen, and then stored at -80°C for later use.

[0055] (5) Preparation of frozen sections: After OCT embedding, the sections were sliced ​​using a cryostat and marked and stored in a -20℃ freezer.

[0056] 2.2 Hematoxylin-eosin (H&E) staining of tissue sections and pathological evaluation

[0057] (1) After removing the frozen sections, let them warm to room temperature for about 30 minutes, and then soak them in double-distilled water for 5 minutes.

[0058] (2) Stain in hematoxylin solution for 3 to 5 minutes, soak twice in double-distilled water, and observe the color under a microscope.

[0059] (3) Dehydrate with 95% ethanol for 5 min;

[0060] (4) Stain in eosin solution for 1 min;

[0061] (5) Dehydrate with anhydrous ethanol for 5 min, repeat twice;

[0062] (6) Xylene becomes transparent in 5 minutes;

[0063] (7) Mount the slide with neutral resin, scan it with a digital slide scanner and save it.

[0064] 3. Results and Analysis

[0065] The results showed that WT (wild type) and TSPAN4 - / -The carotid arteries of TSPAN4 knockout mice and Sham (sham-operated group, i.e., negative control group) mice were relatively smooth and intact, with more regular arrangement of smooth muscle cells in the tunica media; WT mice showed severe intimal hyperplasia and stenosis in the ligated side of the carotid artery, while TSPAN4 knockout mice showed more regular arrangement of smooth muscle cells in the tunica media. - / - The intimal hyperplasia induced by carotid artery ligation in the group of mice was significantly reduced. Figure 1 ).

[0066] The above results demonstrate the important role of TSPAN4 in carotid artery stenosis, suggesting that inhibition of TSPAN4 may have a therapeutic effect on related cardiovascular diseases.

[0067] Example 2

[0068] Preparation of TSPAN4 interference sequences and their effects on related cardiovascular diseases

[0069] 1. According to Example 1, the corresponding interference sequence was designed: h-siTSPAN4, whose sequence is CGGACAAGAUUGACAGGUAUG (SEQ ID NO.1), and was manufactured by Shanghai Sangon Biotech.

[0070] 2. Interference sequence processing of human vascular smooth muscle cells (HASMC)

[0071] h-siTSPAN4 was delivered to human vascular smooth muscle cells via transfection. The specific method is as follows:

[0072] This experiment used Lipofectamine RNAiMAX transfection reagent and Gibco. TM Opti-MEM TM The culture medium was used to divide the cells into two groups: a control group transfected with the control sequence (siNC, concentration of the control sequence in the transfection system was 20 nM), and an experimental group transfected with the h-siTSPAN4 sequence (labeled as si-TSPAN4, concentration of the h-siTSPAN4 sequence in the transfection system was 20 nM). The control siNC sequence was: UCUCCGAACGUGUCACGUdTdT, SEQ ID NO.2.

[0073] It should be noted that the effects of h-siTSPAN4 sequences at concentrations of 10 nM to 50 nM on human vascular smooth muscle cells are basically the same in the transfection system. Here, this invention only uses a concentration of 20 nM as an example to illustrate this effect.

[0074] The specific operating steps are as follows (taking a 6-well plate as an example):

[0075] (1) When the cell density reaches 80%, passage is performed, and the cells are counted after resuspending, according to 3×10⁻⁶ cells / year. 5The cell count per cell / well was transferred to a 1.5 mL EP tube and centrifuged at 800 rpm for 5 min.

[0076] (2) Incubate siRNA or siNC with RNAiMAX transfection reagent and Opti-MEM medium at room temperature for 5 min;

[0077] (3) After centrifuging, remove the supernatant from the cells, add the mixture from step (2) to resuspend the cells, and let them stand at room temperature for 5 minutes.

[0078] (4) Seed the cells into a 6-well plate, gently shake to mix, and then place in a cell culture incubator.

[0079] Transfection efficiency can be tested and further experiments can be conducted 24 to 48 hours later.

[0080] 3. Cell proliferation was detected using EdU.

[0081] (1) Cells were prepared at a ratio of 3 × 10⁶ cells per well. 4 One cell was seeded into a prepared sterile cell spreader 24-well plate and cultured in a cell culture incubator until it adhered to the plate.

[0082] (2) After adhesion, the culture medium was replaced with FBS-free culture medium and cultured for another 48 hours;

[0083] (3) Dilute EdU (10mM) with cell culture medium at a ratio of 1:500 to obtain (2×) EdU working solution (20μM). Add an equal volume of the EdU working solution preheated in a 37℃ water bath to a 24-well plate to make the final concentration of EdU in the well plate (2×), and incubate for 2h.

[0084] (4) Discard the culture medium and add 1 mL of 4% paraformaldehyde. Fix at room temperature for 15 min.

[0085] (5) Remove the fixative, permeate each well with 1 mL of 0.3% Triton X-100 permeabilizing solution at room temperature for 15 min, remove the permeabilizing solution, wash each well with 1 mL of washing solution for 5 min, and repeat twice;

[0086] (6) Discard the washing solution, add 0.25 mL of the prepared ClickAdditive Solution to each well to evenly cover the cells, and incubate at room temperature in the dark for 30 min;

[0087] (7) Discard the Click reaction solution, wash with washing solution for 5 min, repeat 3 times;

[0088] (8) Mount the slide with DAPI-containing anti-fluorescence quenching mounting medium, store at 4°C and photograph under a fluorescence microscope.

[0089] 4. Detect cell migration using a scratch assay.

[0090] (1) Cells in each group were prepared at a ratio of 1×10⁶ cells per well. 5 One cell was seeded in a 12-well plate and cultured in a cell culture incubator until confluence was greater than 90%.

[0091] (2) Use a 200μL pipette tip to draw a cross on the bottom of the well plate, discard the culture medium, wash the cell debris with PBS and replace it with FBS-free culture medium, and take pictures under a microscope to record the results.

[0092] (3) Culture in a cell culture incubator for 12h-24h and take pictures under a microscope to record the results;

[0093] (4) Use Image J to plan the area of ​​scar wound healing.

[0094] 5. Detection of smooth muscle phenotypic transformation protein expression by Western blot.

[0095] Protein extraction, concentration determination and protein denaturation

[0096] (1) After cell treatment, wash twice with PBS, add 100 μl of protein lysis buffer per well, gently shake to spread the lysis buffer to the bottom, lyse on ice for 15 min, collect cells with a cell scraper, and transfer the lysis buffer to a 1.5 ml EP tube. Centrifuge at 12000 rpm and 4℃ for 30 min. After centrifugation, transfer the supernatant to a new EP tube to obtain total cell protein.

[0097] (2) Protein concentration was determined by the BCA method.

[0098] (3) Protein denaturation: Mix the protein sample with the protein loading buffer at a ratio of 4:1, heat in a 95°C metal bath for 10 min, and store the sample at -80°C.

[0099] (4) Western Blot detection

[0100] The expression levels of several proteins associated with pyroptosis were detected by Western blotting analysis. Briefly, cardiac tissue and cells were homogenized in RIPA lysis buffer (Beyontime, Jiangsu, China) supplemented with 0.1 mM benzyl sulfonyl fluoride (PMSF) (Sigma, Missouri, USA) for Western blotting analysis. Cells were harvested and lysed in lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1.5 mM MgCl2, 10% glycerol, 1% Triton X-100, 5 mM MEGTA, 20 μM leupeptin, 1 mM MAEBSF, 1 mM NaVO3, 10 mM NaF, and a 1x protein inhibitor mixture). Proteins were separated using sodium dodecyl sulfate-12% polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a polyvinylidene fluoride (PVDF) membrane at 300 mA for 1.5 h. The membrane was then incubated at room temperature for two hours in TBS / T buffer (20 mM Tris-HCl, pH 7.6, 150 mM NaCl, 0.1% Tween-20) containing 5% skim milk. Specific primary antibodies included rabbit anti-NLRP3 (D4D8T) (Cell Signaling Technology, USA), GSDMD, ASC, and mouse anti-caspase-1 (1:1000, Santa Cruz Biotechnology, USA). All antibodies, including GSDMD, were diluted in TBST buffer (50 mM Tris-HCl, 150 mM NaCl, 0.1% Tween-20, pH 7.4) and incubated with the PVDF membrane overnight at 4°C. Subsequently, the corresponding horseradish peroxidase (HRP)-conjugated secondary antibody (1:5000, A21010, abbkine, CA, USA) was incubated with the PVDF membrane at room temperature for 90 minutes. Signal detection was performed using an enhanced chemiluminescence (ECL) reagent (Amersham Biosciences, Piscataway, NJ, USA). The luminescence signal was detected using a Bio-Rad ChemiDoc MP system (Bio-Rad, Richmond, CA, USA).

[0101] 6. Results

[0102] The statistical method for EdU results was to count the ratio of EdU-stained cells to DAPI-stained cells. The results showed that h-siTSPAN4 treatment significantly inhibited the proliferation of vascular smooth muscle cells. Figure 2 ).

[0103] Scratch assays can reflect cell migration. The faster the migration and the shorter the distance between cells, the greater the migration distance. The results show that knocking out h-siTSPAN4 significantly inhibited the migration of vascular smooth muscle cells. Figure 3 ).

[0104] α-SMA, SM22α, and CNN1 are all phenotypic markers of contractile vascular smooth muscle cells. Treatment with h-siTSPAN4 enhanced the expression of α-SMA, SM22α, and CNN1, indicating that h-siTSPAN4 stabilizes the contractile phenotype of vascular smooth muscle cells and is important for maintaining their contractile state. Figure 4 ).

[0105] The above results demonstrate that the nucleic acid drug h-siTSPAN4 prepared in this invention can significantly inhibit the proliferation, migration, and phenotypic transformation of vascular smooth muscle, playing an important role in cardiovascular diseases. Therefore, this nucleic acid drug has a therapeutic effect on cardiovascular diseases, and its practical application can help in further personalized treatment.

[0106] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention should be included within the scope of protection of the present invention.

Claims

1. A kind TSPAN4 The application of gene expression inhibitors in the preparation of drugs for treating cardiovascular stenosis caused by intimal neoplasia, characterized in that, The TSPAN4 Gene expression inhibitors are TSPAN4 The interfering sequence h-siTSPAN4; the nucleotide sequence of the interfering sequence h-siTSPAN4 is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The TSPAN4 Gene expression inhibitors are used to prepare drugs that improve cardiovascular stenosis caused by the proliferation, migration, or phenotypic changes of vascular smooth muscle cells.

3. The application according to claim 1, characterized in that, The drug includes pharmaceutically acceptable excipients or carriers.

4. The application according to claim 3, characterized in that, The drug is an oral or injectable formulation.

5. The application according to claim 4, characterized in that, The oral preparations are granules, tablets, capsules, powders, syrups, oral liquids, or tinctures.

6. The application according to claim 4, characterized in that, The injectable preparation is an intravenous injection preparation, an intramuscular injection preparation, or an injectable powder.

Images