Molecular marker related to early heading character of wheat and application of molecular marker

Abstract

The invention discloses a molecular marker related to the early heading character of wheat and application of the molecular marker, and belongs to the field of molecular genetic breeding. The nucleotide sequence of the molecular marker is shown as SEQ ID NO.1, G / A mutation exists at the 25th site, and the genotypes of the site comprise GG, AA and GA genotypes. The molecular marker provided by the invention is extremely remarkably related to the early heading gene ehd1 of the early heading mutant AS2388eh of aegilops tauschii, shows close linkage marker characteristics, is high in accuracy when being used for molecular marker-assisted selection, can remarkably improve the selection and identification efficiency of screening early heading gene materials containing the ehd1 in different genetic backgrounds, and is high in success rate. The molecular marker provided by the invention can be used for positioning the character of early heading of aegilops tauschii, and also can be used for rapidly screening plants containing the ehd1 gene in the breeding process, so that the breeding working efficiency is improved, and a basis is provided for research on the early heading gene of wheat.

Description

Technical Field

[0001] The invention relates to the field of molecular genetic breeding, and in particular to a molecular marker related to early heading traits of wheat and an application thereof. Background Art

[0002] Heading date is an important trait that determines crop environmental adaptability and affects crop yield. The heading date habits of plants are determined by the interaction between genes that promote or inhibit heading and flowering and environmental factors. In the long evolutionary process, plants have formed their own adaptation mechanism to the environment. They sense the changes in light and temperature brought about by the circadian rhythm through their leaves, thereby regulating the changes in their own developmental state. Flowering of plants is one of the important processes in their own developmental state, which is affected by many environmental factors, such as light length, light quality, ambient temperature, available water and minerals. When the plant's own internal clock rhythm matches the environment in which it grows, the plant's growth can reach a better state. Therefore, it is very important to explore and rationally utilize the genes involved in heading and flowering for the development of crop production.

[0003] Aegilops tauschii Coss. is the donor species of the wheat D genome. Artificial wheat was formed by hybridizing tetraploid wheat (AABB) with Aegilops tauschii Coss. and doubling it. A number of new wheat varieties have been bred through breeding and improvement of artificial wheat, greatly enriching the genetic diversity of the wheat D genome. Therefore, gene mining and utilization of the D genome are particularly important for wheat breeding and improvement.

[0004] Molecular marker-assisted breeding does not rely on phenotypic selection, that is, it is not affected by factors such as the environment, gene interaction, and gene-environment interaction. Instead, it directly selects the genotype, thereby greatly improving breeding efficiency. Single nucleotide polymorphism (SNP) refers to the DNA sequence polymorphism caused by changes such as conversion, transversion, insertion, and deletion at a specific nucleotide position in the DNA genome. The technology uses known sequence information to compare and find SNP sites, and then uses the discovered variant sites to design specific primers to perform PCR amplification on genomic DNA or cDNA to obtain specific polymorphic products based on SNP sites, and finally uses electrophoresis technology to analyze the polymorphism of the products. The advantages of SNP markers are large number and wide distribution; uneven distribution in a single gene and the entire genome; and easy estimation of SNP allele frequency.

[0005] Competitive Allele Specific PCR (KASP) is a new low-cost, high-throughput genotyping technology developed by LGC (Laboratory of the Government Chemist) (http: / / www.lgcgenomics.com). It uses specific matching of primer terminal bases to accurately perform double allele typing on SNP and InDel sites. It has been widely used in molecular marker-assisted selection of crops such as rice, wheat and soybean. Summary of the invention

[0006] The purpose of the present invention is to provide a molecular marker related to the early heading trait of wheat and its application, so as to solve the problems existing in the above-mentioned prior art.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The invention provides a molecular marker related to the early heading trait of wheat. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, a G / A mutation exists at position 25, and the genotypes of the site include GG, AA and GA genotypes.

[0009] The present invention also provides a KASP primer set for detecting the molecular marker, comprising an upstream primer F1 with a nucleotide sequence as shown in SEQ ID NO.2, an upstream primer F2 with a nucleotide sequence as shown in SEQ ID NO.3, and a downstream primer R with a nucleotide sequence as shown in SEQ ID NO.4.

[0010] The present invention also provides a detection kit for the molecular marker, comprising the KASP primer set.

[0011] The present invention also provides an application of the KASP primer set or the detection kit in identifying the early or late heading stage trait of wheat.

[0012] The present invention also provides a method for identifying the early and late traits of wheat heading period, comprising the following steps:

[0013] Using the genomic DNA of the wheat sample to be tested as a template, using the KASP primer set or the detection kit to perform fluorescent quantitative PCR amplification on the template, reading the fluorescent signal after the PCR amplification is completed, analyzing and converting the fluorescent signal, identifying the genotype, and judging the early or late heading period of the wheat according to the genotype;

[0014] If the identified genotype is the AA genotype, the heading period of the wheat sample to be tested is judged to be early; if the identified genotype is the GG genotype, the heading period of the wheat sample to be tested is judged to be late.

[0015] Furthermore, the program of the fluorescent quantitative PCR amplification is: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing / extension at 65°C for 60 s, for a total of 10 cycles; denaturation at 94°C for 20 s, annealing / extension at 55°C for 60 s, for a total of 30 cycles.

[0016] Furthermore, the system of the fluorescent quantitative PCR amplification is: 5 μL Master Mix, 1.4 μL mixed primers, 5 ng template DNA, and double distilled water added to a total of 10 μL; the volume ratio of the upstream primer F1, the upstream primer F2 and the downstream primer R in the mixed primer is 4:4:1.

[0017] The present invention also provides an application of the KASP primer set or the detection kit in screening wheat with early heading traits.

[0018] The present invention also provides an application of the KASP primer set or the detection kit in molecular marker-assisted breeding of wheat with early heading traits.

[0019] The present invention discloses the following technical effects:

[0020] Molecular markers provided by the present invention and early heading mutant AS2388 of Aegilops tauschii eh It is extremely significantly correlated with the early heading gene ehd1 of rice, showing the characteristics of a tightly linked marker, and has high accuracy in molecular marker-assisted selection. It can significantly improve the efficiency of selecting and identifying materials containing the ehd1 early heading gene in different genetic backgrounds, and has a high success rate.

[0021] The molecular marker provided by the invention can be used to locate the trait of early heading of wheat, and can also be used to quickly screen plants containing the ehd1 gene during breeding, thereby improving breeding efficiency and providing a basis for the study of early heading genes in wheat. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0023] Figure 1 For AS2388 eh ×AS2407F 2 Fluorescence reading results of SNP site detection in the generation strains; among them, FAM (blue square, 'AS2388 eh') fluorescence is the early heading strain, HEX (orange circle, 'AS2407') fluorescence is the late heading strain; green triangle fluorescence is the heterozygous strain; black diamond fluorescence is the blank control;

[0024] Figure 2 The fluorescence readings of SNP site detection in the hexaploid background, where FAM (blue square) fluorescence is the early heading mutant AS2388 eh Langdon and AS2388 eh The artificial wheat formed by hybridization, HEX (orange circle) fluorescence is AS2388 wild type, AS2388 WT The artificial wheat formed by hybridization with Langdon and 20

[0025] Common wheat. DETAILED DESCRIPTION

[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0028] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0029] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0030] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0031] The Aegilops tauschii germplasms AS2388 and AS2407, tetraploid durum wheat Langdon, China Spring, Shumai 830, Shumai 580, Shumai 969, Shumai 114, Zhongke Nuowanmai 2168, Chuanzimai 925, Neizimai 232, Chuanyu 72 and Chuannong 32 in the present invention are provided by the Wheat Research Institute of Sichuan Agricultural University.

[0032] Example 1 Acquisition of SNP loci associated with early heading traits and design of KASP primers

[0033] The inventors used EMS to mutate the Aegilops tauschii germplasm AS2388 to obtain an early heading mutant AS2388 eh The inventors based on mutant AS2388 eh A SNP site closely linked to the early heading gene ehd1 was developed from the gene sequence of Aegilops tauschii AL8 / 78 reference genome Aegilops tauschii (Aet-v4.0), and the gene sequence containing the SNP site is shown in SEQ ID NO.1:

[0034] ATTGTATAATGCAGGGTGGTGAAGRCGACTGCTTTTATGTTGTTGGGAATGGTGAGT TTGG (Note: the 25th base of the sequence shown in SEQ ID NO.1 is a SNP site, which has a G / A mutation, and R represents A or G).

[0035] According to the sequence information of SEQ ID NO.1, three primers were designed using online software, upstream primer F1 (SEQ ID NO.2), upstream primer F2 (SEQ ID NO.3) and downstream primer R (SEQ ID NO.4), wherein F1 and F2 respectively contain FAM and HEX fluorescent linker sequences (underlined), and the sequences are as follows:

[0036] Upstream primer F1 with FAM linker sequence (SEQ ID NO.2):

[0037] 5'- GAAGGTGACCAAGTTCATGCT ATAATGCAGGGTGGTGAAGA-3′;

[0038] Upstream primer F2 with HEX linker sequence (SEQ ID NO.3):

[0039] 5'- GAAGGTCGGAGTCAACGGATTATAATGCAGGGTGGTGAAGG-3′;

[0040] Downstream primer R (SEQ ID NO. 4): 5'-CCAAACTCACCATTCCCAACA-3'.

[0041] Example 2 Application of SNP sites in selecting the gene ehd1 controlling early heading

[0042] (1) Using mutant material AS2388 eh As the female parent, the common Aegilops tauschii material AS2407 was used as the male parent to construct F 2 Generation group, and in F 2:3 100 lines were selected from the progeny lines and the F 2:3 The heading period traits of the families were investigated.

[0043] (2) SNP site detection was performed on the 100 strains obtained. The specific method was as follows: DNA of the 100 strains was extracted by CTAB method at the seedling stage; the DNA was used as a substrate template and fluorescence quantitative PCR amplification was performed with the KASP primer pair designed in Example 1.

[0044] The amplification system of fluorescent quantitative PCR amplification is: 5 μL Master Mix, 1.4 μL mixed primers, 5 ng template DNA, double distilled water added to a total of 10 μL, and at least 3 independent blanks with double distilled water instead of DNA template should be added. The upstream primer F1, upstream primer F2 and downstream primer R are added at a concentration of 10 ng / μL, 120 μL, 120 μL and 300 μL respectively, and ddH is added. 2 O 460 μL was mixed and used as a mixed primer.

[0045] The procedure of fluorescence quantitative PCR amplification is: 94℃ pre-denaturation for 15min; 94℃ denaturation for 20s, 65℃ annealing / extension for 60s, a total of 10 cycles; 94℃ denaturation for 20s, 55℃ annealing / extension for 60s, a total of 30 cycles; after completion, fluorescence reading is performed. Fluorescence reading results (see Figure 1 ), will detect the AS2388 eh The genotype of the plant with consistent FAM (blue) fluorescence is recorded as "A", the genotype at the SNP site is AA, which is a homozygous line for early heading, the genotype that shows HEX (orange) fluorescence like AS2407 is recorded as "B", the genotype at the SNP site is GG, which is a homozygous line for late heading, the green triangle fluorescence is a heterozygous line, the genotype is recorded as "H", and the genotype at the SNP site is GA. The genotypes of each line and the field phenotypic values ​​are shown in Table 1. Comparing the heading period trait data, it was found that the line genotype was consistent with the heading period phenotypic data.

[0046] Table 1AS2407 / AS2388 eh F 2 Generation strains and F 2:3 Statistics of family genotype and field phenotype results

[0047]

[0048]

[0049]

[0050] Example 3 Applicability detection of SNP loci in hexaploid wheat background

[0051] Tetraploid durum wheat Langdon was used as the female parent and was cross-fertilized with wild-type Aegilops tauschii AS2388 (AS2388 WT ) Early heading mutant AS2388 eh Hybridization was performed and artificial hexaploid wheat was obtained after doubling, and multiple wheat varieties (a total of 20 samples) as shown in Table 2 were used as controls for detection and verification.

[0052] The specific method is: extract DNA of all the above wheat varieties by CTAB method at the seedling stage; use it as a substrate template and perform fluorescence quantitative PCR amplification with the KASP primer pair designed in Example 1. The amplification system and amplification procedure are the same as in Example 2. After the fluorescence quantitative PCR amplification is completed, the fluorescence reading is performed, and the fluorescence reading results are shown in Figure 2 and Table 2.

[0053] Table 2 Materials (hexaploid background) for verifying the availability of SNP sites and genotyping results

[0054]

[0055]

[0056] From Table 2 and Figure 2 It can be seen that the SNP site is still available in the hexaploid background, providing a basis for the next step of molecular marker-assisted breeding.

[0057] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A molecular marker associated with early heading trait in wheat, It is characterized in that The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and there is a G / A mutation at position 25, and the genotypes of this site include GG, AA and GA genotypes.

2. A KASP primer set for detecting the molecular marker according to claim 1, It is characterized in that It comprises an upstream primer F1 with a nucleotide sequence as shown in SEQ ID NO.2, an upstream primer F2 with a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer R with a nucleotide sequence as shown in SEQ ID NO.

4.

3. A detection kit for the molecular marker according to claim 1, It is characterized in that Comprising the KASP primer set according to claim 2.

4. Use of the KASP primer set according to claim 2 or the detection kit according to claim 3 in identifying the early or late heading stage traits of wheat.

5. A method for identifying the early and late characteristics of wheat heading period, It is characterized in that The steps include: Using the genomic DNA of the wheat sample to be tested as a template, using the KASP primer set described in claim 2 or the detection kit described in claim 3 to perform fluorescent quantitative PCR amplification on the template, reading the fluorescent signal after the PCR amplification is completed, analyzing and converting the fluorescent signal, identifying the genotype, and judging the early or late heading period of the wheat according to the genotype; If the identified genotype is the AA genotype, the heading period of the wheat sample to be tested is judged to be early; if the identified genotype is the GG genotype, the heading period of the wheat sample to be tested is judged to be late.

6. The method according to claim 5, It is characterized in that The program of the fluorescent quantitative PCR amplification is: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing / extension at 65°C for 60 s, for a total of 10 cycles; denaturation at 94°C for 20 s, annealing / extension at 55°C for 60 s, for a total of 30 cycles.

7. The method according to claim 5, It is characterized in that The system of the fluorescent quantitative PCR amplification is: 5 μL Master Mix, 1.4 μL mixed primers, 5 ng template DNA, and double distilled water added to a total of 10 μL; the volume ratio of the upstream primer F1, the upstream primer F2 and the downstream primer R in the mixed primer is 4:4:

1.

8. Use of the KASP primer set according to claim 2 or the detection kit according to claim 3 in screening wheat for early heading trait.

9. Use of the KASP primer set according to claim 2 or the detection kit according to claim 3 in molecular marker-assisted breeding of wheat with early heading traits.

Images