Molecular marker for identifying number of small spike grains of Pennisetum americana and application of molecular marker

Abstract

The invention relates to a molecular marker for identifying the spikelet grain number of Pennisetum americana, application of the molecular marker and a yield-related variation site of the molecular marker, in particular to an SV site PGLA1542300 of the spikelet grain number of the Pennisetum americana under the normal irrigation condition, and the nucleotide sequence is shown as SEQ ID No: 1. The invention provides a detection primer of the PGLA1542300 site in the Pennisetum americanum, the genotype based on the PGLA1542300 site in a Pennisetum americanum genome is detected, when the PGLA1542300 site is deleted, the to-be-detected Pennisetum americanum is used as a candidate germplasm with the characteristic of high grain yield, and when the PGLA1542300 site is used as a candidate germplasm with the characteristic of low grain yield, the to-be-detected Pennisetum americanum is used as a candidate germplasm with the characteristic of low grain yield. By utilizing the method provided by the invention, the accuracy of predicting the yield per mu of the seeds by the Pennisetum americanum can be improved within a certain limit, so that Pennisetum americanum materials or strains with sites with high grain yield can be quickly screened out for breeding.

Description

Technical Field

[0001] The invention relates to molecular biology and crop genetic breeding, and in particular to SV variation sites related to spikelet grain yield of Pennisetum americanum and applications thereof. Background Art

[0002] Pennisetum glaucum is an excellent forage and also a grain crop. The three factors that make up the yield are the number of grains per spike, the number of spikes per mu and the grain weight. The spike traits determine the number of spikelets, which is related to the yield to a certain extent. On the other hand, the spike morphology is also meaningful for the identification of Pennisetum glaucum species. The factors affecting the number of grains per spike of Pennisetum glaucum include spike length, the number of spikelets per spike and spike density, all of which are quantitative traits. Within a certain range, increasing the number of spikelets per spike can effectively increase the yield of Pennisetum glaucum. In recent years, drought stress has become increasingly severe, and plants under drought stress conditions will lead to reduced yields and a series of other traits. Therefore, under such conditions, it is very important to ensure that plants have higher yields under drought conditions.

[0003] Pennisetum americanum is an important warm-season annual grass forage and one of the six major cereal crops in the world. It has the characteristics of high protein, high seed, high grass yield and strong stress resistance. It can grow and bear fruit normally in hot and arid areas and areas with poor land. Therefore, it is considered to be a high-quality forage resource and potential energy plant that can be planted in arid areas such as northwest my country. In recent years, the per capita available land has decreased. How to harvest more high-quality forage on limited land to meet the survival needs of a large number of livestock has become the key to alleviating this contradiction. At present, the main method is to quickly select new high-yield and high-quality forage varieties by tapping the yield potential of forage. As one of the important determinants of grass forage yield, the number of spikelets has attracted widespread attention from scientists. In-depth analysis of the molecular mechanism that affects the regulation of spikelet number in plants will help to select new high-yield forage varieties and provide support for grassland animal husbandry.

[0004] In recent years, with the development of a large number of molecular markers and the rapid development of bioinformatics, the application of association analysis methods to discover plant quantitative trait genes has become one of the hot spots in international plant genomics research. Association analysis is based on linkage disequilibrium (LD), which is a non-random combination of alleles at different gene loci. It is a method for directly analyzing phenotypic and genotypic variations and further locating certain genes. However, this method has certain disadvantages because it mainly analyzes a single reference genome and single nucleotide polymorphisms (SNPs). Plant species have high polymorphism, and the reference genome of a single individual can no longer cover all the genetic information of the species. If only a single reference genome is used for studies such as genetic domestication variation, a lot of meaningful genetic code information may be lost because many unique sequences are not on the reference genome. At the same time, with the continuous development of genome sequencing technology, the application of pan-genome has become increasingly widespread. Pan-genome is the general term for all genes of a species, which has great advantages in studying different subspecies or variants with huge differences in the same species. In addition to providing SNPs (single nucleotide polymorphisms, SNPs), pan-genomes also provide a large amount of SV (genomic structural variation, Structural variation, referred to as SV) information. SV has a greater impact on the genome than SNP and can be better used to explain the characteristics of agronomic trait population diversity. Summary of the invention

[0005] The present invention provides an SV variation site marker for identifying spikelet grain number of Pennisetum americanum, characterized in that the marker is located at the variation site PGLA1542300 of the chromosome 5 structure, and the sequence thereof is shown in SEQ ID No:1.

[0006] The present invention also provides for detecting the genotype of the SV locus of spikelet grain number of Pennisetum americanum, which may include the following steps: detecting the genotype based on the PGLA1542300 locus in the Pennisetum americanum genome; when the PGLA1542300 locus is missing, the Pennisetum americanum to be tested is a candidate germplasm with a high grain yield characteristic; when the PGLA1542300 locus is present, the Pennisetum americanum to be tested is a candidate germplasm with a low grain yield characteristic.

[0007] The invention provides a primer set for identifying target genotypes of Pennisetum americanum.

[0008] PGL1542300_4: CCGCCGTGACTAGAACTCT GCCCAGATGTACCAATGCTTT

[0009] The present invention also provides a method for identifying the number of grains in the spikelet of Pennisetum americanum, comprising the steps of amplifying the product of PCR with corresponding primers:

[0010] (1) Extraction of Pennisetum genomic DNA.

[0011] (2) Design specific primers for the PGLA1542300 site for subsequent PCR amplification.

[0012] (3) Using the extracted genomic DNA as a template, perform PCR amplification using the designed specific primers to ensure that the amplified fragment contains the PGLA1542300 site. Optimize PCR conditions, such as annealing temperature and number of cycles, to ensure amplification efficiency and specificity. Use the PCR amplification product for genotyping.

[0013] The present invention also provides a genotype product for detecting the PGLA1542300 site in the Pennisetum americanum genome. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 :Distribution of grain number in spikelets of different genotypes.

[0015] Figure 2 : PCR detection of PGL1542300_4 (lane 1: DL5000 DNA marker; lanes 1-13: IP3098; IP21517; IP15320; IP9824; IP3471; IP3110; IP19626; IP13840; IP15320; IP6101;

[0016] IP9351; IP2058; IP8172). In the figure, SEQ NO.1 is genotype I, and SEQ NO.2 is genotype II. DETAILED DESCRIPTION

[0017] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the examples are based on conventional experimental conditions.

[0018] Example 1: PGLA1542300 is an SV associated with spikelet grain number in Pennisetum americanum

[0019] 1. Basic information of PGLA1542300 variant site

[0020] Through pan-genome sequencing analysis of Pennisetum fasciatum germplasm, a gene locus related to the number of spikelets of Pennisetum fasciatum was obtained, named PGLA1542300. This mutation site is located on chromosome 5 of the PI537069 genome, near gene PMA5G04566.1, and is a large fragment insertion mutation. The nucleotide sequence is shown in SEQ ID No: 1, and its basic information is shown in Table 1.

[0021] Table 1. Basic information of PGLA1542300 variant sites

[0022] SV Marker chromosome Serial Number Chromosome location PGLA1542300 5 SEQ ID No:1 108,807,419

[0023] Example 2: Detection of spikelet grain number and genotype of Salvia americana germplasm resources

[0024] The spikelet grain number detection was performed on the Pennisetum gracilis germplasm resources shown in Table 2. Combining the sequencing results of various plasm genomes with the reference genome comparison, the results show (Table 2) that the Pennisetum gracilis varieties lacking the PGLA1542300 locus have the characteristics of high grain yield, which is genotype I, and the varieties with the PGLA1542300 locus have the characteristics of low grain yield, which is genotype II. All varieties of Pennisetum gracilis of the present invention can be obtained from the germplasm collection of Sichuan Agricultural University.

[0025] Table 2. Pennisetum fasciatum germplasm tested based on genotype at PGLA1542300

[0026]

[0027]

[0028]

[0029]

[0030]

[0031]

[0032] The results in Table 2 are as follows Figure 1The results showed that 117 varieties of 194 Pennisetum genotypes lacking the PGLA1542300 locus were of type I, and the average grain yield index of these 117 germplasms was 1428.86; 77 germplasms were of type II based on the PGLA1542300 locus, and the average grain yield index was 1260.43. The significance test P<0.05. The average grain yield of Pennisetum genotype I was higher, and the discovery of the PGLA1542300 locus provided a new idea for identifying or assisting in the identification of the grain yield changes of Pennisetum genotype and for screening or assisting in the screening of Pennisetum genotypes with different grain yield characteristics.

[0033] Example 3: Detection of Pennisetum fasciatum germplasm based on the genotype of the PGLA1542300 locus

[0034] The genotype of Pennisetum gracilis germplasm based on the PGLA1542300 locus was tested. Pennisetum gracilis varieties were randomly selected for testing (based on the genotype of PGLA1542300 locus as type I or genotype as type II), and the fourth group of markers were randomly selected for PCR testing. Primers were combined considering the CG content and Tm value of the primers, and the primer sequences were as follows:

[0035] Table 3. Primer sequences for detecting variant sites of PGLA1542300

[0036] Mark combination serial number -5' end labeling -3' end labeling PGL1542300_1 AGGAAGAGGAGCAGCACAT GGGATTTCTTGCCTGCTGTATT PGL1542300_2 GCCGAGAGGAGGACAATGT GGGATTTCTTGCCTGCTGTATT PGL1542300_3 GCCGAGAGGAGGACAATGT TGCAGCTTTGAAATGACTTACG PGL1542300_4 CCGCCGTGACTAGAACTCT GCCCAGATGTACCAATGCTTT PGL1542300_5 CCGCCGTGACTAGAACTCT AGGGATTTCTTGCCTGCTGTA PGL1542300_7 AAGGAAGAGGAGCAGCACAT AGGGATTTCTTGCCTGCTGTA PGL1542300_8 CCGCCGTGACTAGAACTCT AGGGATTTCTTGCCTGCTGTA PGL1542300_9 AAGGAAGAGGAGCAGCACAT GGGATTTCTTGCCTGCTGTATT PGL1542300_10 CCGCCGTGACTAGAACTCT GGGATTTCTTGCCTGCTGTATT

[0037] The results are as follows Figure 2 As shown in the figure, the PCR detection based on the marker combination PGL1542300_4 successfully identified the target genotype in the Pennisetum spp. samples, showing good specificity and stability. This marker combination can be used as an effective tool for identifying the grain yield-related traits of Pennisetum spp. and has application potential in high-yield breeding.

Claims

1. A molecular marker for identifying the number of grains in spikelets of Pennisetum americanum. Features: The molecular marker sequence is shown in SEQ ID No:

1.

2. A method for detecting the number of grains in spikelets of Pennisetum fasciatum, comprising the following steps: detecting the genotype based on the PGLA1542300 site in the Pennisetum fasciatum genome, whose sequence is shown in SEQ ID No: 1; when the PGLA1542300 site is missing, the Pennisetum fasciatum to be tested is a candidate germplasm with a high grain yield characteristic, and when the PGLA1542300 site is present, the Pennisetum fasciatum to be tested is a candidate germplasm with a low grain yield characteristic.

3. A set of primers for identifying a target gene of Pennisetum americanum based on the markers described in claim 1, Features: The primer is PGL1542300_4: CCGCCGTGACTAGAACTCT GCCCAGATGTACCAATGCTTT.

4. A method for identifying the number of spikelets of Pennisetum americanum based on the primers described in claim 3, It is characterized in that Follow these steps: (1) Extracting Pennisetum genomic DNA; (2) Design specific primers for the PGLA1542300 site for subsequent PCR amplification; (3) Using the extracted genomic DNA as a template, PCR amplification was performed using the designed specific primers to ensure that the amplified fragment contained the PGLA1542300 site. The PCR conditions were optimized to ensure amplification efficiency and specificity, and the PCR amplification products were used for genotyping.

5. A genotype product for detecting the PGLA1542300 locus in the genome of Pennisetum americanum.

Images