Fluorescence detection kit for detecting hydroxycobalamin receptor antibody for central nervous vitamin B12 deficiency and application of fluorescence detection kit

Abstract

The invention relates to a fluorescence detection kit for detecting a hydroxycobalamin receptor antibody for central nervous vitamin B12 deficiency and application of the fluorescence detection kit. The existence and concentration of an anti-CD320 antibody in serum or cerebrospinal fluid of a patient can be efficiently and accurately detected. According to the kit, a specific antibody is combined with CD320 protein generated by cells expressing CD320 genes and then combined with a fluorescently-labeled second antibody to generate a fluorescence signal, so that the diagnosis of the B12 deficiency of the central nervous system is realized. The base sequence in the application ensures effective expression of the CD320 gene, and is crucial for improving the detection sensitivity and specificity.

Description

Technical Field

[0001] The invention relates to the field of fluorescence detection, and in particular to a fluorescence detection kit for detecting hydroxycobalamin receptor antibodies of central nervous system vitamin B12 deficiency and an application thereof. Background Art

[0002] Vitamin B12 is an essential water-soluble micronutrient that is involved in metabolic processes. Vitamin B12 plays an important role in the normal function of the nervous system by participating in the synthesis of myelin and promoting the maturation of red blood cells in the bone marrow. It also has an impact on the circulatory system. Vitamin B12 deficiency may lead to neurological deficits, including poor coordination, spasticity and cognitive decline. However, tests that rely on B12 in the blood do not accurately reflect levels in the brain.

[0003] CD320, also known as the transcobalamin receptor, is enriched in endothelial cells of the blood-brain barrier and mediates the uptake and transcytosis of transcobalamin-bound vitamin B12 into cells of the central nervous system. Studies have shown that immunoglobulins in patients with B12 deficiency inhibit CD320 function, and anti-CD320 may impede the transport of vitamin B12 across the blood-brain barrier by reducing the availability of cell surface receptors. The detection of positive anti-CD320 antibodies in the blood predicts vitamin B12 deficiency in the brain. CD320 autoantibodies may affect brain neurons by first reducing brain vitamin B12 levels. Consider testing cerebrospinal fluid for vitamin B12 metabolites in patients who are seropositive for anti-CD320 and have unexplained neurological abnormalities.

[0004] Detecting the presence of CD320 antibodies can help diagnose central nervous system diseases associated with vitamin B12 deficiency and guide clinical treatment. However, there is currently a lack of efficient and rapid methods and kits for detecting CD320 antibodies. Therefore, the development of a highly sensitive and specific detection kit is of great clinical significance. Summary of the invention

[0005] In view of the lack of efficient and rapid CD320 antibody detection kits, the present invention aims to provide a targeted CD320 antibody kit. The present invention also provides a new method for detecting anti-hydroxycobalamin receptor autoantibodies in patient serum or cerebrospinal fluid, by preparing cells carrying CD320 gene vectors and combining highly sensitive cell immunofluorescence detection technology. This method has the characteristics of high detection efficiency and strong specificity, and has important clinical application value.

[0006] The present invention utilizes cellular immunofluorescence (CBA) technology, combines the specific binding properties of antigen and antibody, and does not modify or fix the antigen or antibody in the sample during the detection process, fully retaining their spatial structure, thereby improving the sensitivity and specificity of the detection.

[0007] Specifically, the present invention recombines the CD320 gene into the pIRES2-EGFP vector by a multi-stage recombination method. The vector retains the EGFP protein function while avoiding the influence on the function of the target gene. The vector is convenient for detecting whether the transfection is successful, ensuring the high-quality expression of the CD320 gene, thereby producing enough CD320 protein for detecting anti-CD320 antibodies in the sample.

[0008] In order to solve the above problems, the present invention provides a detection kit for detecting anti-CD320 antibodies. The kit includes cells expressing CD320 gene and a second antibody; wherein the second antibody is an anti-human antibody, which generates fluorescence or causes fluorescence quenching when in contact with the second antibody.

[0009] In the present invention, the CD320 antibody contained in the sample to be tested is the first antibody, which can undergo antigen-antibody specific binding with the CD320 protein produced by the cells expressing the CD320 gene in the kit of the present invention. The first antibody (antibody antigen) can also undergo antigen-antibody specific binding with the second antibody in the kit.

[0010] As one of the embodiments of the present invention, the second antibody includes but is not limited to anti-human antibodies of goats, rats, mice, donkeys, horses, rabbits, dogs, cows, etc.; preferably goat anti-human antibodies, and their sources include but are not limited to commercially available or laboratory prepared.

[0011] As one of the embodiments of the present invention, the second antibody type includes but is not limited to IgG, IgM, IgA, IgG (Fc), etc., preferably IgG.

[0012] As one of the embodiments of the present invention, the CD320-expressing cells are cells transformed with a pIRES2-EGFP vector carrying the CD320 gene expression.

[0013] As one of the embodiments of the present invention, the method for preparing cells expressing the CD320 gene comprises:

[0014] Construction of CD320 gene vector;

[0015] Prepare 293T cells for transfection;

[0016] Plasmid transfection into cells;

[0017] As one of the embodiments of the present invention, the CD320 gene vector construction step includes: obtaining a fragment PCR product by PCR amplification, and recombining it into a target vector by a multi-segment sufficient method to finally obtain a target plasmid.

[0018] As one of the embodiments of the present invention, the construction of the CD320 gene vector further comprises: a step of digesting the full-length sequence of the human CD320 gene with the vector and then connecting the vector with a restriction endonuclease, wherein the restriction endonuclease is Xhol-BamHI. In the step of constructing the CD320 gene vector plasmid, the CD320 gene is obtained by PCR, and the sequences of the primer pairs used in the PCR method are the sequences shown in G0294965-1_1 and G0294965-1_2.

[0019] As one of the embodiments of the present invention, the cells used for transfection include but are not limited to HEK293T, CHO, Hela, Human ES cells, MC3T3-E1, etc.; preferably HEK293T, and more preferably HEK293T that has been adherently grown after passage.

[0020] As one of the embodiments of the present invention, the plasmid transfection method includes but is not limited to electric shock method, liposome-mediated method, virus-mediated method, microinjection method, calcium phosphate method, gene gun method, etc.; preferably, liposome-mediated method.

[0021] As one of the embodiments of the present invention, the liposome used for transfection in the plasmid transfected cells is a cationic liposome; preferably lipofectamine3000.

[0022] As one of the embodiments of the present invention, the plasmid transfection into cells includes adding plasmid and liposome.

[0023] The kit provided by the present invention can be used to prepare a reagent for a method for detecting anti-hydroxycobalamin receptor autoantibodies in patient serum or cerebrospinal fluid, and the detection method comprises:

[0024] Step 1: Sample processing: collect patient samples and dilute them with diluent at a ratio of 1:10, 1:32, 1:100, or 1:320;

[0025] Step 2: inoculating the cells expressing the CD320 gene;

[0026] Step 3: Add blocking solution and incubate at 37°C for 30 minutes;

[0027] Step 4: Add the sample to be tested and incubate at 37°C for 1 hour;

[0028] After washing in step 5, add secondary antibody and incubate at 37°C for 30 minutes;

[0029] After washing in step 6, the fluorescence intensity generated by the detection cells and the test sample is analyzed to diagnose whether the patient suffers from central nervous system B12 deficiency.

[0030] As one of the embodiments of the present invention, the sample in step 1 includes but is not limited to serum and cerebrospinal fluid; serum is preferred.

[0031] As one of the embodiments of the present invention, the step 2 further includes: digesting HEK293T cells with 1 ml of trypsin for 1-2 minutes, and resuspending HEK293T cells with DMEM medium containing 10% fetal bovine serum. The cell suspension is placed in a 96-well plate, and the well plate is placed in an incubator at 37°C, 5% carbon dioxide, and saturated humidity for 8-24 hours. After the cells are completely attached to the wall, transfection begins. HEK293T cells transfected with CD320 gene plasmids are cultured in a 96-well plate for 24 hours. When the plasmid transfection rate reaches 60%-80% under a microscope, it is used for subsequent detection.

[0032] As one of the embodiments of the present invention, the blocking solution includes goat serum, bovine serum albumin, skim milk powder, commercially available blocking solution, etc., preferably goat serum.

[0033] As one of the embodiments of the present invention, the washing solution includes but is not limited to PBS, commercially available washing solution, etc., preferably PBS.

[0034] As one of the embodiments of the present invention, the secondary antibody reacted in step 5 is a fluorescently labeled goat anti-human antibody.

[0035] As one of the embodiments of the present invention, step 6 further includes using negative and positive samples as controls to diagnose whether the patient suffers from central nervous system B12 deficiency according to the intensity of the fluorescent signal under a microscope.

[0036] The present invention also provides a method for constructing a CMV-CD320-pIRES-EGFP gene vector plasmid for preparing the fluorescent detection kit for detecting anti-CD320 antibodies, comprising the following steps:

[0037] Step 1: Amplify the CD320 fragment by PCR, using the following primers:

[0038] The base sequence of the upstream primer is the base sequence of SEQ ID NO.1 in the base sequence table:

[0039] TCAGATCCGCTAGCGCTACCGGACTCAGATCTCGAGATGAGCGGCGGTTGGATGGCGCAGGTTGGAGCGTGG;

[0040] The base sequence of the downstream primer is the base sequence of SEQ ID NO.2 in the base sequence table:

[0041] TAACGTTAGGGGGGGGGGAGGGAGAGGGGCGGATCCTCACTTGT CATCGTCGTCCTTGTAAT;

[0042] Step 2: Screen positive clones by PCR method of bacterial solution, obtain plasmids by shaking the positive bacterial solution at 37°C, compare the correct plasmids by sequencing, and perform double restriction enzyme digestion with Xhol-BamHI.

[0043] A method for obtaining HEK293T transfected cells with CD320 gene plasmid, used for preparing the fluorescent detection kit for detecting anti-CD320 antibodies, comprises the following steps:

[0044] 1) Cell culture: HEK293T cells were routinely cultured in our laboratory in DMEM medium containing 10% inactivated fetal bovine serum, and cells in the logarithmic growth phase were used for the experiment;

[0045] 2) Cell recovery and passaging: Add 20 ml of DMEM medium to a 50 ml centrifuge tube in advance, take out the frozen cells from the liquid nitrogen tank and immediately put them in a 37°C water bath to thaw, disinfect the outer wall of the cryopreservation tube with 70% alcohol, transfer the cell storage solution to a centrifuge tube, centrifuge at 100 rpm for 5 minutes, discard the supernatant, resuspend the cells in DMEM medium containing 10% fetal bovine serum, and culture in an incubator at 37°C, 5% carbon dioxide, and saturated humidity;

[0046] 3) Cell preparation: HEK293T cells were digested with 1 ml of trypsin for 1-2 minutes, and HEK293T cells were resuspended in DMEM medium containing 10% fetal bovine serum; the cell suspension was placed in a 96-well plate, and the well plate was incubated in an incubator at 37°C, 5% carbon dioxide, and saturated humidity for 8-24 hours. After the cells were completely attached, transfection began;

[0047] 4) Plasmid transfection: Take a sterile 1.5 ml EP tube, add serum-free DMEM medium, mix the plasmid prepared in claim 8 and lipofectamine3000 thoroughly, and let stand for 15-20 minutes; add the mixed solution to the cells prepared above, and incubate in a 37°C incubator containing 5% carbon dioxide.

[0048] The beneficial effects of the present invention are:

[0049] The present invention provides a fluorescent detection kit for detecting anti-CD320 antibodies and a preparation method thereof, which can efficiently and accurately detect the presence and concentration of anti-CD320 antibodies in patient serum or cerebrospinal fluid. The kit combines a specific antibody with the CD320 protein produced by cells expressing the CD320 gene, and then combines with a fluorescently labeled second antibody to generate a fluorescent signal, thereby achieving the diagnosis of central nervous system B12 deficiency. The base sequence in the present application ensures the effective expression of the CD320 gene, which is crucial for improving the sensitivity and specificity of the detection.

[0050] The kit has high sensitivity and specificity, simple operation process, and reduces the difficulty of operation through standardized experimental steps, thereby improving the detection efficiency. In addition, the selection of the second antibody is flexible and diverse, and anti-human antibodies from different animal sources can be selected according to actual needs, thereby enhancing the adaptability and flexibility of the kit. The present invention is not only suitable for diagnosing central nervous system B12 deficiency, but can also be extended to other fields that require the detection of anti-CD320 antibodies, providing strong support for clinical diagnosis and scientific research.

[0051] The present invention establishes a method for highly sensitively detecting CD320 antibodies in samples through cell immunofluorescence technology, which is used for clinical qualitative analysis and CD320 autoantibody titer determination. The highly sensitive and specific cell immunofluorescence staining (CBA) detection technology is used, and chemical modification and fixation of antigens and antibodies are not required, so the spatial structure of antigens and antibodies can be better preserved.

[0052] By comparing with existing detection methods such as enzyme-linked immunosorbent assay (ELISA), radioimmunoprecipitation assay (RIPA), and immunoblotting, it was determined that this CBA detection technology has the characteristics of high sensitivity and strong specificity, and successfully solves the common false positives or false negatives of traditional detection methods such as ELISA, and has very important clinical value. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0054] Attached Figure 1 A flow chart of a method for preparing cells expressing the CD320 gene;

[0055] Attached Figure 2 Flow chart of the method for obtaining HEK293T transfected cells with CD320 gene plasmid;

[0056] Attached Figure 3 5 is the CD320 plasmid map constructed in the embodiment of the present invention;

[0057] Attached Figure 4 It is the result diagram of enzyme cutting in the embodiment of the present invention;

[0058] Attached Figure 5 This is a graph showing the detection results of CD320 antibodies with Flag tags detected by the method of the present invention in cells expressing CD320 gene constructed in the implementation of the present invention. The detection results are negative and strongly positive from left to right.

[0059] Among them: Figure 4 The target gene obtained by PCR amplification was constructed into the pIRES2-EGFP vector, the plasmid was extracted, and the plasmid was digested with XhoI-BamHI. The obtained band was about 879 / 5261, which was consistent with the expected size of 879 / 5261. The digestion results showed that a recombinant plasmid containing the CD320 gene was obtained. DETAILED DESCRIPTION

[0060] Combination Figures 1 to 5 , the present invention includes a fluorescence detection kit for detecting anti-CD320 antibodies, the kit includes cells expressing CD320 gene, and a second antibody; wherein the second antibody is an anti-human antibody, and when in contact with the second antibody, fluorescence is generated or fluorescence quenching occurs;

[0061] The CD320 antibody contained in the sample to be tested is the first antibody, which can undergo antigen-antibody specific binding with the CD320 protein produced by the cells expressing the CD320 gene in the detection kit, and the first antibody can undergo antigen-antibody specific binding with the second antibody in the kit.

[0062] The second antibody is goat, rat, mouse, donkey, horse, rabbit, dog or cow anti-human antibody; preferably goat anti-human antibody;

[0063] The second antibody type is IgG, IgM, IgA or IgG(Fc); preferably IgG;

[0064] The cells expressing the CD320 gene are cells transformed with a pIRES2-EGFP vector carrying the CD320 gene expression.

[0065] The method for preparing cells expressing the CD320 gene comprises the following steps:

[0066] Construction of CD320 gene vector;

[0067] Prepare 293T cells for transfection;

[0068] Plasmid transfection into cells.

[0069] The CD320 gene vector construction steps include: obtaining a fragment PCR product by PCR amplification, and recombining it into a target vector by a multi-segment sufficient method to finally obtain a target plasmid.

[0070] The construction of the CD320 gene vector further comprises the steps of: digesting the full-length sequence box of the human CD320 gene with the vector with a restriction endonuclease and then connecting the two, wherein the restriction endonuclease is Xhol-BamHI.

[0071] In the step of constructing a plasmid of the CD320 gene vector, the CD320 gene is obtained by using the PCR method, and the sequence of the primer pair used in the PCR method is:

[0072] The base sequence of the upstream primer is:

[0073] TCAGATCCGCTAGCGCTACCGGACTCAGATCTCGAGATGAGCGGCGGTTGGATGGCGCAGGTTGGAGCGTGG;

[0074] The base sequence of the downstream primer is:

[0075] TAACGTTAGGGGGGGGGGAGGGAGAGGGGCGGATCCTCACTTGT CATCGTCGTCCTTGTAAT.

[0076] The cells used for transfection are HEK293T, CHO, Hela, Human ES cells or MC3T3-E1; preferably HEK293T, more preferably HEK293T that has been adherently grown after passage;

[0077] The plasmid transfection method is electric shock method, liposome-mediated method, virus-mediated method, microinjection method, calcium phosphate method or gene gun method; preferably liposome-mediated method;

[0078] The liposome used for transfection in the plasmid transfected cells is a cationic liposome; preferably lipofectamine3000;

[0079] The plasmid transfection into cells includes adding plasmid and liposome.

[0080] A method for constructing a CMV-CD320-pIRES-EGFP gene vector plasmid, used for preparing the fluorescent detection kit for detecting anti-CD320 antibodies, comprises the following steps:

[0081] Step 1: Amplify the CD320 fragment by PCR, using the following primers:

[0082] The base sequence of the upstream primer is:

[0083] TCAGATCCGCTAGCGCTACCGGACTCAGATCTCGAGATGAGCGGCGGTTGGATGGCGCAGGTTGGAGCGTGG;

[0084] The base sequence of the downstream primer is:

[0085] TAACGTTAGGGGGGGGGGAGGGAGAGGGGCGGATCCTCACTTGT CATCGTCGTCCTTGTAAT;

[0086] Step 2: Screen positive clones by PCR method of bacterial solution, obtain plasmids by shaking the positive bacterial solution at 37°C, compare the correct plasmids by sequencing, and perform double restriction enzyme digestion with Xhol-BamHI.

[0087] A method for obtaining HEK293T transfected cells with CD320 gene plasmid, used for preparing the fluorescent detection kit for detecting anti-CD320 antibodies, comprises the following steps:

[0088] 1) Cell culture: HEK293T cells were routinely cultured in our laboratory in DMEM medium containing 10% inactivated fetal bovine serum, and cells in the logarithmic growth phase were used for the experiment;

[0089] 2) Cell recovery and passaging: Add 20 ml of DMEM medium to a 50 ml centrifuge tube in advance, take out the frozen cells from the liquid nitrogen tank and immediately put them in a 37°C water bath to thaw, disinfect the outer wall of the cryopreservation tube with 70% alcohol, transfer the cell storage solution to a centrifuge tube, centrifuge at 100 rpm for 5 minutes, discard the supernatant, resuspend the cells in DMEM medium containing 10% fetal bovine serum, and culture in an incubator at 37°C, 5% carbon dioxide, and saturated humidity;

[0090] 3) Cell preparation: HEK293T cells were digested with 1 ml of trypsin for 1-2 minutes, and HEK293T cells were resuspended in DMEM medium containing 10% fetal bovine serum; the cell suspension was placed in a 96-well plate, and the well plate was incubated in an incubator at 37°C, 5% carbon dioxide, and saturated humidity for 8-24 hours. After the cells were completely attached, transfection began;

[0091] 4) Plasmid transfection: Take a sterile 1.5 ml EP tube, add serum-free DMEM medium, mix the prepared plasmid and lipofectamine3000 thoroughly, and let it stand for 15-20 minutes; add the mixed solution to the cells prepared above, and incubate in a 37°C incubator containing 5% carbon dioxide.

[0092] A use of the kit in preparing a detection reagent for detecting whether a person suffers from central nervous system B12 deficiency; comprising the following steps:

[0093] Step 1, sample processing: collect samples from patient serum or cerebrospinal fluid, and dilute them with diluent at a ratio of 1:10, 1:32, 1:100, 1:320;

[0094] Step 2, inoculating the cells expressing the CD320 gene;

[0095] Step 3, add blocking solution and incubate at 37°C for 30 minutes;

[0096] Step 4, add the sample to be tested and incubate at 37°C for 1 hour;

[0097] Step 5: After washing, add secondary antibody and incubate at 37°C for 30 minutes;

[0098] Step 6: After washing, analyzing the fluorescence intensity generated by the detection cells and the test sample to diagnose whether the patient suffers from central nervous system B12 deficiency;

[0099] Wherein: the sample in step 1 is serum or cerebrospinal fluid, preferably serum;

[0100] The step 2 further comprises: digesting the HEK293T cells with 1 ml of trypsin for 1-2 minutes, and resuspending the HEK293T cells with a DMEM medium containing 10% fetal bovine serum; placing the cell suspension in a 96-well plate, and incubating the well plate in an incubator at 37° C., 5% carbon dioxide, and saturated humidity for 8-24 hours, and starting transfection after the cells are completely attached to the wall; culturing the HEK293T cells transfected with the CD320 gene plasmid in the 96-well plate for 24 hours, and observing under a microscope that the plasmid transfection rate reaches 60%-80%, and then using it for subsequent detection;

[0101] The blocking solution is goat serum, bovine serum albumin or skimmed milk powder, preferably goat serum;

[0102] The washing solution includes but is not limited to PBS;

[0103] The secondary antibody reacted in step 5 is a fluorescently labeled goat anti-human antibody;

[0104] The step 6 further includes using negative and positive samples as controls to diagnose whether the patient suffers from central nervous system B12 deficiency according to the intensity of the fluorescent signal under a microscope.

[0105] Example 1: See Figure 3 The preparation of the kit for detecting anti-human CD320 antibodies adopts the following steps:

[0106] Construction of CMV-CD320-pIRES-EGFP gene vector plasmid

[0107] 1) Amplify the CD320 fragment by PCR, using the following primers:

[0108] Upstream primer: G0294965-1_1:

[0109] TCAGATCCGCTAGCGCTACCGGACTCAGATCTCGAGATGAGCGGCGGTTGGATGGCGCAGGTTGGAGCGTGG

[0110] Downstream primer: G0294965-1_2:

[0111] TAACGTTAGGGGGGGGGGAGGGAGAGGGGCGGATCCTCACTTGT CATCGTCGTCCTTGTAAT

[0112] 2) The positive clones were screened by PCR method of bacterial solution, and the plasmids were obtained by shaking the positive bacterial solution at 37°C. The correct plasmids were compared by sequencing and double-digested with Xhol-BamHI.

[0113] The first and last primers used:

[0114]

[0115] Sequencing primers used:

[0116]

[0117] Obtaining HEK293T transfected cells

[0118] 1) Cell culture: HEK293T cells were routinely cultured in our laboratory in DMEM medium containing 10% inactivated fetal bovine serum (FBS, SH30084.03, Hyclone), and cells in the logarithmic growth phase were used for the experiment.

[0119] 2) Cell recovery and passaging: Add 20 ml of DMEM medium to a 50 ml centrifuge tube in advance, take out the frozen cells from the liquid nitrogen tank and immediately put them in a 37°C water bath to thaw, disinfect the outer wall of the cryopreservation tube with 70% alcohol, transfer the cell storage solution to a centrifuge tube, centrifuge at 100 rpm for 5 minutes, discard the supernatant, resuspend the cells in DMEM medium containing 10% fetal bovine serum, and culture in an incubator at 37°C, 5% carbon dioxide, and saturated humidity.

[0120] 3) Cell preparation: Digest HEK293T cells with 1 ml of trypsin for 1-2 minutes, and resuspend HEK293T cells in DMEM medium containing 10% fetal bovine serum. Place the cell suspension in a 96-well plate, and incubate the plate in an incubator at 37°C, 5% carbon dioxide, and saturated humidity for 8-24 hours. After the cells are completely attached, transfection begins.

[0121] 4) Plasmid transfection: Take a sterile 1.5 ml EP tube, add serum-free DMEM medium, mix the target plasmid and lipofectamine 3000 thoroughly, and let it stand for 15-20 minutes. Add the mixture to the cells prepared above and incubate in a 37°C incubator containing 5% carbon dioxide.

[0122] Example 2: Anti-CD320 antibody kit for sample detection

[0123] The method for using the kit prepared in Example 1 for anti-CD320 antibody detection is as follows:

[0124] 1) Inoculating cells: HEK293T cells transfected with CD320 gene plasmid were cultured in a 96-well plate for 24 hours. When the plasmid transfection rate reached 60%-80% under a microscope, they were used for subsequent detection.

[0125] 2) Cell immunofluorescence: After washing the inoculated plasmid plate with PBS, add goat serum to block, and incubate at 37°C for 0.5 h; after discarding the goat serum, add the primary antibody against the Flag tag and incubate at 37°C for 1 h; after discarding the primary antibody and washing with PBS; add the fluorescent secondary antibody and incubate at 37°C for 0.5 h; after discarding the secondary antibody, wash with PBS and take pictures with a fluorescence microscope.

[0126] 3) The results showed that the method of the present invention can distinguish patients with strong CD320 positive cells from patients with negative cells without positive cells based on the fluorescence intensity.

[0127] Example 3: Specific steps for fluorescence detection of anti-CD320 antibodies

[0128] Experimental materials and equipment:

[0129] Cells expressing the CD320 gene: HEK293T cells were transfected with the pIRES2-EGFP vector carrying the CD320 gene expression.

[0130] Secondary antibody: fluorescently labeled goat anti-human IgG antibody using FITC (fluorescein isothiocyanate) as a fluorescent label.

[0131] Samples to be tested: patient serum or cerebrospinal fluid samples. Blocking solution: goat serum. Washing solution: PBS. Fluorescence microscope: Leica DM6 B fluorescence microscope, equipped with filters suitable for FITC excitation and emission wavelengths. 96-well plate: used for cell culture and detection. Fluorescence intensity analysis software: ImageJ.

[0132] Experimental steps:

[0133] Sample processing: Collect serum or cerebrospinal fluid samples from patients and dilute them with diluent at a ratio of 1:10, 1:32, 1:100, or 1:320.

[0134] Inoculation of cells expressing the CD320 gene: HEK293T cells transfected with CD320 gene plasmid were inoculated in a 96-well plate and cultured until the transfection rate reached 60%-80%.

[0135] Blocking: Add blocking solution (such as goat serum) and incubate at 37°C for 30 minutes to reduce nonspecific binding.

[0136] Add the sample to be tested: After washing the cells, add the diluted sample to be tested and incubate at 37°C for 1 hour to allow the anti-CD320 antibody in the sample to bind to the CD320 protein on the cell surface.

[0137] Wash: Wash cells with PBS to remove unbound sample.

[0138] Add fluorescently labeled secondary antibody: Add fluorescently labeled goat anti-human IgG antibody and incubate at 37° C. for 30 minutes to allow the secondary antibody to bind to the primary antibody (anti-CD320 antibody).

[0139] Wash again: Wash the cells again with PBS to remove unbound secondary antibody.

[0140] Fluorescence intensity analysis: Fluorescence signals were observed and recorded using a Leica DM6 B fluorescence microscope. The intensity of the fluorescence signal was quantified using ImageJ software and compared with a known standard curve to determine the presence and concentration of anti-CD320 antibodies.

[0141] Specific fluorescence measurement steps: Fluorescence microscope settings: excitation wavelength: 488nm; emission wavelength: 515-545nm; exposure time: 200ms; gain: 1.0; magnification: 20x objective lens;

[0142] Image acquisition: Select an appropriate field of view and collect cell images using a fluorescence microscope. Ensure that the image is clear and the fluorescence signal is obvious.

[0143] Quantify the fluorescence signal: Open the acquired image using ImageJ software. Use the ROI tool to select the cell area. Select "Measure" in the analysis menu to obtain the fluorescence intensity value.

[0144] Data analysis: Compare the fluorescence intensity of the sample to be tested with that of the negative control group and the positive control group. Analyze the relationship between the fluorescence intensity and the concentration of the anti-CD320 antibody.

[0145] Interpretation of results: If the fluorescence intensity of the sample to be tested is higher than that of the negative control group, it indicates that anti-CD320 antibodies are present in the sample. Determine the concentration of anti-CD320 antibodies based on the comparison of the fluorescence intensity with the known standard curve.

[0146] Thus far, the description of the above-described embodiments is provided for the purpose of illustration and description. It is not intended to be exhaustive or to limit the present disclosure. The individual elements or features of a specific embodiment are generally not subject to the limitations of the specific embodiment, but when applicable, they can be interchanged and used for selected embodiments even if not specifically shown or described. In many respects, the same element or feature also can be changed. This variation is not considered to be a departure from the present disclosure, and all such modifications are intended to be included in the scope of the present disclosure.

[0147] Example embodiments are provided so that the present disclosure will be thorough and the scope will be fully conveyed to those skilled in the art. In order to thoroughly understand the embodiments of the present disclosure, numerous details are set forth, such as examples of specific parts, devices, and methods. Obviously, for those skilled in the art, it is not necessary to use specific details, the example embodiments can be implemented in many different forms, and neither should be construed as limiting the scope of the present disclosure. In certain example embodiments, well-known processes, well-known device structures, and well-known technologies are not described in detail.

[0148] Here, specialized vocabulary is used only for the purpose of describing specific example embodiments, and is not intended to be limiting. Unless the context clearly indicates otherwise, the singular forms "a" and "the" used herein may be intended to include plural forms as well. The terms "including" and "having" are inclusive, and therefore specify the presence of the claimed features, wholes, steps, operations, elements and / or components, but do not exclude the presence or additional presence of one or more other features, wholes, steps, operations, elements, components and / or combinations thereof. Unless the order of execution is clearly indicated, the method steps, processing and operations described herein are not interpreted as necessarily needing to be performed in the specific order discussed and shown. It should also be understood that additional or optional steps may be adopted.

Claims

1. A fluorescence detection kit for detecting anti-CD320 antibodies, characterized in that: The kit includes cells expressing CD320 gene and a second antibody; wherein the second antibody is an anti-human antibody; The CD320 antibody contained in the sample to be tested is the first antibody, which can undergo antigen-antibody specific binding with the CD320 protein produced by the cells expressing the CD320 gene in the detection kit, and the first antibody can also undergo antigen-antibody specific binding with the second antibody in the kit; when the first antibody contacts the cells expressing the CD320 gene and the second antibody, fluorescence will be generated or fluorescence quenching will occur.

2. The fluorescence detection kit according to claim 1, wherein the second antibody is goat, rat, mouse, donkey, horse, rabbit, dog or cow anti-human antibody; preferably goat anti-human antibody; The second antibody type is IgG, IgM, IgA or IgG(Fc); preferably IgG; The cells expressing the CD320 gene are cells transformed with a pIRES2-EGFP vector carrying the CD320 gene expression.

3. The fluorescence detection kit according to claim 1, wherein the method for preparing cells expressing the CD320 gene comprises the following steps: Construction of CD320 gene vector; Prepare 293T cells for transfection; Plasmid transfection into cells.

4. The fluorescence detection kit according to claim 3, wherein the CD320 gene vector construction step comprises: The fragment PCR product is amplified by the PCR method, and recombined into the target vector through a multi-segment sufficient method to finally obtain the target plasmid.

5. The fluorescence detection kit according to claim 4, wherein the CD320 gene vector construction further comprises: The step of connecting the full-length sequence box of the human CD320 gene to the vector after being digested with a restriction endonuclease, wherein the restriction endonuclease is Xhol-BamHI.

6. The fluorescence detection kit according to claim 5, in the step of constructing a plasmid of the CD320 gene vector, the CD320 gene is obtained by PCR, and the sequence of the primer pair used in the PCR method is: The base sequence of the upstream primer is: TCAGATCCGCTAGCGCTACCGGACTCAGATCTCGAGATGAGCGGCGGTTGGATGGCGCAGGTTGGAGCGTGG; The base sequence of the downstream primer is: TAACGTTAGGGGGGGGGGAGGGAGAGGGGCGGATCCTCACTTGTCATCGTCGTCCTTGTAAT.

7. The fluorescent detection kit according to claim 6, wherein the cells used for transfection are HEK293T, CHO, Hela, Human ES cells or MC3T3-E1; preferably HEK293T, more preferably HEK293T that has been subcultured and grown adherently; The plasmid transfection method is electric shock method, liposome-mediated method, virus-mediated method, microinjection method, calcium phosphate method or gene gun method; preferably liposome-mediated method; The liposome used for transfection in the plasmid transfected cells is a cationic liposome; preferably lipofectamine3000; The plasmid transfection into cells includes adding plasmid and liposome.

8. A method for constructing a CMV-CD320-pIRES-EGFP gene vector plasmid for preparing the fluorescent detection kit for detecting anti-CD320 antibodies according to claim 1, characterized in that The steps include: Step 1: Amplify the CD320 fragment by PCR, using the following primers: The base sequence of the upstream primer is: TCAGATCCGCTAGCGCTACCGGACTCAGATCTCGAGATGAGCGGCGGTTGGATGGCGCAGGTTGGAGCGTGG; The base sequence of the downstream primer is: TAACGTTAGGGGGGGGGGAGGGAGAGGGGCGGATCCTCACTTGTCATCGTCGTCCTTGTAAT; Step 2: Screen positive clones by PCR method of bacterial solution, obtain plasmids by shaking the positive bacterial solution at 37°C, compare the correct plasmids by sequencing, and perform double restriction enzyme digestion with Xhol-BamHI.

9. A method for obtaining HEK293T transfected cells with CD320 gene plasmid, used for preparing the fluorescent detection kit for detecting anti-CD320 antibodies according to claim 1, characterized in that The steps include: 1) Cell culture: HEK293T cells were routinely cultured in our laboratory in DMEM medium containing 10% inactivated fetal bovine serum, and cells in the logarithmic growth phase were used for the experiment; 2) Cell recovery and passaging: Add 20 ml of DMEM medium to a 50 ml centrifuge tube in advance, take out the frozen cells from the liquid nitrogen tank and immediately put them in a 37°C water bath to thaw, disinfect the outer wall of the cryopreservation tube with 70% alcohol, transfer the cell storage solution to a centrifuge tube, centrifuge at 100 rpm for 5 minutes, discard the supernatant, resuspend the cells in DMEM medium containing 10% fetal bovine serum, and culture in an incubator at 37°C, 5% carbon dioxide, and saturated humidity; 3) Cell preparation: HEK293T cells were digested with 1 ml of trypsin for 1-2 minutes, and HEK293T cells were resuspended in DMEM medium containing 10% fetal bovine serum; the cell suspension was placed in a 96-well plate, and the well plate was incubated in an incubator at 37°C, 5% carbon dioxide, and saturated humidity for 8-24 hours. After the cells were completely attached, transfection began; 4) Plasmid transfection: Take a sterile 1.5 ml EP tube, add serum-free DMEM medium, mix the plasmid prepared in claim 8 and lipofectamine3000 thoroughly, and let stand for 15-20 minutes; add the mixed solution to the cells prepared above, and incubate in a 37°C incubator containing 5% carbon dioxide.

10. Use of the kit according to claim 1 in the preparation of a detection reagent for detecting whether a person suffers from central nervous system B12 deficiency; characterized in that The steps include: Step 1, sample processing: collect samples from patient serum or cerebrospinal fluid, and dilute them with diluent at a ratio of 1:10, 1:32, 1:100, 1:320; Step 2, inoculating the cells expressing the CD320 gene; Step 3, add blocking solution and incubate at 37°C for 30 minutes; Step 4, add the sample to be tested and incubate at 37°C for 1 hour; Step 5: After washing, add secondary antibody and incubate at 37°C for 30 minutes; Step 6: After washing, analyzing the fluorescence intensity generated by the detection cells and the test sample to diagnose whether the patient suffers from central nervous system B12 deficiency; Wherein: the sample in step 1 is serum or cerebrospinal fluid, preferably serum; The step 2 further comprises: digesting the HEK293T cells with 1 ml of trypsin for 1-2 minutes, and resuspending the HEK293T cells with a DMEM medium containing 10% fetal bovine serum; placing the cell suspension in a 96-well plate, and incubating the well plate in an incubator at 37° C., 5% carbon dioxide, and saturated humidity for 8-24 hours, and starting transfection after the cells are completely attached to the wall; culturing the HEK293T cells transfected with the CD320 gene plasmid in the 96-well plate for 24 hours, and observing under a microscope that the plasmid transfection rate reaches 60%-80%, and then using it for subsequent detection; The blocking solution is goat serum, bovine serum albumin or skimmed milk powder, preferably goat serum; The washing solution includes but is not limited to PBS; The secondary antibody reacted in step 5 is a fluorescently labeled goat anti-human antibody; The step 6 further includes using negative and positive samples as controls to diagnose whether the patient suffers from central nervous system B12 deficiency according to the intensity of the fluorescent signal under a microscope.

Images