Application of BDNF-TrkB signal channel in prevention and / or treatment of CDKL5 deficiency related epilepsy

Abstract

The invention relates to application of a BDNF-TrkB signal channel to prevention and / or treatment of CDKL5 deficiency related epilepsy, in particular to application of a BDNF-TrkB signal channel inhibitor to preparation of a composition or a preparation, and the composition or the preparation is used for prevention and / or treatment of CDKL5 deficiency related epilepsy. The BDNF-TrkB signal channel inhibitor can be used for preventing and / or treating epilepsy related to CDKL5 deficiency.

Description

Technical Field

[0001] The present invention relates to the field of biopharmaceuticals, and in particular, to the application of BDNF-TrkB signaling pathway in preventing and / or treating epilepsy associated with CDKL5 deficiency. Background Art

[0002] CDKL5 deficiency disorder (CDD) is a rare genetic disease characterized by seizures that begin in infancy and are accompanied by significant developmental delays in multiple systems. CDKL5 deficiency occurs in approximately 1 in 40,000 to 60,000 newborns and is one of the most common genetic causes of childhood epilepsy, of which approximately 90% occur in females. CDKL5 deficiency was previously classified as an atypical form of Rett syndrome, with which they share common features, including seizures, intellectual disability, and other developmental problems. However, patients with CDKL5 deficiency have a significantly different clinical course from Rett syndrome. In Rett syndrome, seizures generally begin in adolescence and decrease in severity with age; whereas patients with CDKL5 deficiency develop seizures in the first few months of life and are severely resistant to antiepileptic drugs and cannot be cured. Therefore, CDKL5 deficiency is now considered a separate disease from Rett syndrome.

[0003] CDKL5 deficiency is caused by mutations in the CDKL5 gene. Mutations in the CDKL5 gene reduce the expression level of functional CDKL5 protein or change its activity in nerve cells, but it is not clear how these changes lead to the specific phenotypes of CDKL5 deficiency. The CDKL5 gene is located on the X chromosome and is inherited in an X-linked dominant pattern. Since women have two X chromosomes, random inactivation of the X chromosome can lead to different severity of symptoms and signs in different CDD patients. Women with a higher proportion of mutated neurons have more severe signs and symptoms than women with a lower proportion of mutated neurons. Since men have only one X chromosome in each cell, mutations in the CDKL5 gene are active in all cells, and affected men do not have a normal copy of the gene.

[0004] Seizures are often the first manifestation of patients with CDKL5 deficiency, with a median time from birth to onset of 4-6 weeks, and more than 90% of patients experience seizures within 3 months of birth, which can occur as early as the first week after birth. Patients' seizures can develop into different types over time and may follow a certain pattern of seizures. The most common types are generalized tonic-clonic seizures, including loss of consciousness, muscle rigidity, and convulsions; tonic seizures, which are characterized by abnormal muscle contractions; and epileptic spasms, in which the EEG shows mild arrhythmias and short-term muscle twitches. Although there may be remission periods (a period of no seizures), most people with CDD may have seizures every day. About one-third of people will have multiple stages of seizures. Clonic, atonic, and absence seizures can also be observed in CDD patients, but they are not common types. At first, seizures occur during sleep, but over time, they often occur when awake. The first seizure usually has no significant features on the EEG, but this does not mean that CDD-related seizure activity does not exist.

[0005] Children with CDKL5 deficiency will have developmental impairments, most of whom have severe intellectual disabilities, with language skills being particularly affected. The development of gross motor skills such as sitting, standing, and walking is delayed, and only about one-third of CDD patients can walk independently. Fine motor skills (such as picking up small objects with fingers) are also affected, and about half of CDD patients have limited fine motor skills and will accompany them for life. Most patients have vision problems, some of which manifest as cortical visual impairment (complete loss of binocular vision, normal pupil light reflex, and normal fundus). Other common features of CDD patients include repetitive hand movements such as clapping, licking, and sucking; teeth grinding; interrupted sleep; feeding difficulties and gastrointestinal problems, including constipation and gastroesophageal reflux. Some patients have paroxysmal irregular breathing. Other limb abnormalities may also occur, such as head abnormalities (microcephaly), lateral curvature of the spine, and thin fingers.

[0006] The current medical management of patients with CDKL5 deficiency is mainly symptomatic and supportive treatment, aimed at maximizing the patient's personal abilities and improving any skills that may arise. Emphasis is placed on early intervention treatments such as physical therapy, occupational therapy, and speech and assistive communication therapy. Among them, epilepsy control is the most challenging content. The "International Consensus Recommendations for the Evaluation and Management of Patients with CDKL5 Deficiency" points out that existing drugs, including corticosteroids, vigabatrin, valproic acid, phenytoin, felbamate, carbamazepine, clonazepam, oxcarbazepine, and lacosamide, can reduce the frequency of epileptic seizures when used alone in the early stage, but the medication will lose its efficacy after a certain period of time (median response time is 6 months), and even in some cases, it will aggravate the seizure. The consensus document does not make specific anti-seizure drug treatment recommendations for CDKL5 deficiency, but suggests alternatives, including a ketogenic diet; implantation of a vagus nerve stimulator (VNS, which delivers small pulses of electrical current to the vagus nerve along the neck to the brain); corpus callosotomy (severing the main fibers connecting the two hemispheres of the brain); and pharmaceutical-grade cannabidiol. Children with CDKL5 deficiency are generally not candidates for focal lesion removal surgery because CDKL5 loss affects the brain broadly rather than in a specific location. People with CDD often require multiple anti-seizure drugs to control seizures. The choice is based on the type of seizure and mechanism of action of the drug, potential side effects, and the potential for interaction with other medications.

[0007] Epilepsy is a central nervous system disease in which patients suffer from recurrent, partial or whole-body seizures, sometimes accompanied by loss of consciousness. It is a catastrophic neurological disease. The severity of seizures in epilepsy patients can range from brief distraction or muscle rigidity to prolonged severe convulsions. Epileptic seizures are generally classified as focal or generalized, depending on how and where the seizure begins. Temporal lobe epilepsy (TLE) is the most common form of focal epilepsy. About 60% of patients with focal epilepsy have temporal lobe epilepsy, which often begins in the hippocampus or limbic system. Temporal lobe epilepsy is considered to be the most suitable for scientific research on epilepsy: as the most common type of epilepsy, temporal lobe epilepsy has a large amount of EEG data and case reports available for research, and because temporal lobectomy has a good therapeutic effect on temporal lobe refractory epilepsy, its pathological tissue is easier to obtain than other types of epilepsy. The most common pathological feature of temporal lobe epilepsy is hippocampal sclerosis, which can be observed in epilepsy patients and animal models. It is mainly manifested by the loss of hippocampal neurons, including the loss of pyramidal neurons in CA1 and CA3, and the diffuse distribution of dentate gyrus cells. The most significant of these is the loss of granule cells. The dentate gyrus is a key structure for transmitting excitation to the hippocampus. In epilepsy patients and animal models of epilepsy, the dentate gyrus undergoes a variety of changes, making the hypothesis that epilepsy originates from the hippocampus a hot topic.

[0008] CDKL5 deficiency is a severe epileptic encephalopathy caused by mutations in the CDKL5 gene. Since CDKL5 deficiency was studied as an independent disease, there have been many research advances on the properties and functions of CDKL5 protein, but these findings cannot clearly explain the symptoms caused by CDKL5 deficiency, and there is no animal model that can well reproduce the spontaneous epileptic phenotype of CDD patients. As the most core clinical symptom, the mechanism of CDD-related spontaneous epilepsy is still unclear.

[0009] Therefore, there is an urgent need in the art to develop a new drug for treating CDKL5 deficiency-related epilepsy. Summary of the invention

[0010] The purpose of the present invention is to provide a new drug for treating epilepsy associated with CDKL5 deficiency.

[0011] Another object of the present invention is to provide evidence that targeting the BDNF-TrkB signaling pathway can be used to prevent and / or treat CDKL5 deficiency-related epilepsy. Specifically, the present invention provides a use of a BDNF-TrkB signaling pathway inhibitor for preparing a composition or preparation for preventing and / or treating CDKL5 deficiency-related epilepsy.

[0012] A first aspect of the present invention provides a use of a BDNF-TrkB signaling pathway inhibitor for preparing a composition or preparation for preventing and / or treating CDKL5 deficiency-related epilepsy.

[0013] In another preferred embodiment, the CDKL5 deficiency-related epilepsy has one or more phenotypic characteristics selected from the following group:

[0014] (a) Spontaneous epilepsy phenotype;

[0015] (b) Enhanced excitatory synaptic transmission in the dentate gyrus of the hippocampus;

[0016] (c) abnormal upregulation of BDNF-TrkB signaling pathway in the hippocampus;

[0017] (d) Patients’ epileptic seizures can develop into different types over time;

[0018] (e) the patient's epilepsy phenotype is resistant to antiepileptic drugs;

[0019] (f) The patient's electroencephalogram (EEG) during the seizure shows bilateral synchronous flat potentials followed by repetitive sharp waves and spikes, typical EEG findings that develop over time and are not evident in young children.

[0020] In another preferred embodiment, the composition or preparation is also used for one or more purposes selected from the following group:

[0021] (i) Reduce epileptic activity associated with CDD.

[0022] In another preferred embodiment, the BDNF-TrkB signaling pathway inhibitor includes a TrkB antagonist.

[0023] In another preferred embodiment, the BDNF-TrkB signaling pathway inhibitor is selected from the following group: ANA-12, K252a, or a combination thereof.

[0024] In another preferred embodiment, the composition or preparation further comprises other drugs that can prevent and / or treat epilepsy associated with CDKL5 deficiency.

[0025] In another preferred embodiment, other drugs for preventing and / or treating CDKL5 deficiency-related epilepsy include TAK-935 / OV935 and Ganaxolone.

[0026] In another preferred embodiment, the composition comprises a pharmaceutical composition.

[0027] In another preferred embodiment, the pharmaceutical composition contains (a) a BDNF-TrkB signaling pathway inhibitor and (b) a pharmaceutically acceptable carrier.

[0028] In another preferred embodiment, the component (a) accounts for 0.1-99.9wt% of the total weight of the pharmaceutical composition, preferably 10-99.9wt%, and more preferably 70%-99.9wt%.

[0029] In another preferred embodiment, the component (a) accounts for 60.0%-99.5wt% of the total weight of the pharmaceutical composition, preferably 70.0-99.5wt%, more preferably 80.0%-99.5wt%.

[0030] In another preferred embodiment, the pharmaceutical composition is liquid, solid, or semisolid.

[0031] In another preferred embodiment, the dosage form of the pharmaceutical composition includes tablets, granules, capsules, oral solutions, or injections.

[0032] In another preferred embodiment, the composition is an oral preparation.

[0033] In another preferred embodiment, the composition (such as a pharmaceutical composition) is administered to a mammal by the following means: oral administration, intravenous injection, or local injection.

[0034] In another preferred embodiment, the mammal includes a mammal suffering from CDKL5 deficiency-related epilepsy.

[0035] In another preferred embodiment, the mammal includes a human or a non-human mammal.

[0036] In another preferred embodiment, the non-human mammals include rodents, such as mice and rats.

[0037] The second aspect of the present invention provides a pharmaceutical composition for preventing and / or treating CDKL5 deficiency-related epilepsy, comprising:

[0038] (a1) a first pharmaceutical composition, the first pharmaceutical composition comprising (a) a first active ingredient, the first active ingredient being a BDNF-TrkB signaling pathway inhibitor; and

[0039] (a2) an optional second pharmaceutical composition, wherein the second pharmaceutical composition contains (b) a second active ingredient, which is another drug that can prevent and / or treat epilepsy associated with CDKL5 deficiency;

[0040] (b) a pharmaceutically acceptable carrier.

[0041] In another preferred embodiment, the first pharmaceutical composition and the second pharmaceutical composition are different pharmaceutical compositions, or the same pharmaceutical composition.

[0042] In another preferred embodiment, the BDNF-TrkB signaling pathway inhibitor includes a TrkB antagonist.

[0043] In another preferred embodiment, the BDNF-TrkB signaling pathway inhibitor is selected from the following group: ANA-12, K252a, or a combination thereof.

[0044] In another preferred embodiment, other drugs for preventing and / or treating CDKL5 deficiency-related epilepsy include TAK-935 / OV935 and Ganaxolone.

[0045] In another preferred embodiment, the weight ratio of the first active ingredient to the second active ingredient is 1:100 to 100:1, preferably 1:10 to 10:1.

[0046] In another preferred embodiment, in the pharmaceutical composition, the content of component (a1) is 1%-99%, preferably, 10%-90%, more preferably, 30%-70%.

[0047] In another preferred embodiment, in the pharmaceutical composition, the component (a1) and the component (a2) account for 0.01-99.99 wt %, preferably 0.1-90 wt %, and more preferably 1-80 wt % of the total weight of the product combination.

[0048] In another preferred embodiment, the dosage form of the pharmaceutical composition includes an injection form and an oral dosage form.

[0049] In another preferred embodiment, the oral dosage form includes tablets, capsules, films, and granules.

[0050] In another preferred embodiment, the dosage form of the pharmaceutical composition includes a sustained-release dosage form and a non-sustained-release dosage form.

[0051] In another preferred embodiment, the weight ratio of component (a1) to component (a2) is 1:100 to 100:1, preferably 1:10 to 10:1.

[0052] The third aspect of the present invention provides a medicine kit, comprising:

[0053] (a1) a first container, and a BDNF-TrkB signaling pathway inhibitor or a drug containing a BDNF-TrkB signaling pathway inhibitor in the first container;

[0054] (a2) Optionally, a second container, and other drugs for preventing and / or treating epilepsy associated with CDKL5 deficiency located in the second container, or a drug containing other drugs for preventing and / or treating epilepsy associated with CDKL5 deficiency.

[0055] In another preferred embodiment, the first container and the second container are the same or different containers.

[0056] In another preferred embodiment, the drug in the first container is a single-ingredient preparation containing a BDNF-TrkB signaling pathway inhibitor.

[0057] In another preferred embodiment, the drug in the second container is a single-ingredient preparation containing other drugs for preventing and / or treating epilepsy associated with CDKL5 deficiency.

[0058] In another preferred embodiment, the dosage form of the drug is an oral dosage form or an injection dosage form.

[0059] In another preferred embodiment, the kit further contains instructions.

[0060] In another preferred embodiment, the description records one or more instructions selected from the following group:

[0061] (a) A method for using a BDNF-TrkB signaling pathway inhibitor to prevent and / or treat CDKL5 deficiency-related epilepsy;

[0062] (b) A method for preventing and / or treating CDKL5 deficiency-related epilepsy by combining a BDNF-TrkB signaling pathway inhibitor with other drugs for preventing and / or treating CDKL5 deficiency-related epilepsy.

[0063] The fourth aspect of the present invention provides a use of a combination, wherein the combination comprises a BDNF-TrkB signaling pathway inhibitor and optionally other drugs for preventing and / or treating CDKL5 deficiency-related epilepsy, for preparing a pharmaceutical composition or a kit for preventing and / or treating CDKL5 deficiency-related epilepsy.

[0064] In another preferred embodiment, the pharmaceutical composition or kit comprises (a) a BDNF-TrkB signaling pathway inhibitor and optionally other drugs for preventing and / or treating CDKL5 deficiency-related epilepsy; and (b) a pharmaceutically acceptable carrier.

[0065] In another preferred embodiment, in the pharmaceutical composition or medicine kit, the BDNF-TrkB signaling pathway inhibitor and the drug for preventing and / or treating CDKL5 deficiency-related epilepsy respectively account for 0.01-99.99wt%, preferably 0.1-90wt%, and more preferably 1-80wt% of the total weight of the pharmaceutical composition or medicine kit.

[0066] A fifth aspect of the present invention provides a method for preventing and / or treating epilepsy associated with CDKL5 deficiency, comprising:

[0067] A BDNF-TrkB signaling pathway inhibitor and optionally other drugs for preventing and / or treating CDKL5 deficiency-related epilepsy, or the pharmaceutical composition of the second aspect of the present invention or the drug kit of the third aspect of the present invention is administered to a subject in need thereof.

[0068] In another preferred embodiment, the subject includes a human or non-human mammal suffering from CDKL5 deficiency-related epilepsy.

[0069] In another preferred embodiment, the non-human mammals include rodents and primates, preferably mice, rats, rabbits, and monkeys.

[0070] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0071] The following drawings are used to illustrate specific embodiments of the present invention and are not used to limit the scope of the present invention defined by the claims.

[0072] Figure 1 The structural domains of CDKL5 protein and pathogenic mutations are shown. The functional domains of CDKL5 protein are marked with different colors, and the numbers refer to the type and position of amino acids. Red marks are pathogenic or likely pathogenic mutations; black marks are benign or likely benign mutations. NES = nuclear export sequence; NLS = nuclear localization signal; ST = serine-threonine kinase active site; TEY = conserved Thr-Glu-Tyr motif.

[0073] Figure 2 A neural circuit diagram of the rodent hippocampus is shown. (A, B) A neural circuit diagram of the rodent hippocampus and a schematic diagram of the corresponding neural network. The solid arrows depict the neural circuit of the entorhinal cortex (EC)-dentate gyrus-CA3-CA1-EC. Neurons in layer II of the entorhinal cortex project axons to the dentate gyrus through the perforant pathway (PP), which includes two parts: the lateral perforant pathway (LPP) and the medial perforant pathway (MPP). The dentate gyrus projects to the pyramidal cells of CA3 via mossy fibers. CA3 pyramidal neurons transmit information to CA1 pyramidal neurons via Schaffer collaterals. CA1 pyramidal neurons output to neurons in the deep layers of the entorhinal cortex. CA3 also receives direct projections from the entorhinal cortex via the perforant pathway. CA1 receives direct input from the entorhinal cortex via the temporoamnion (TA). Dentate granule cells also project to mossy cells in the hilus region and interneurons in the hilar region, and project back to granule cells, respectively.

[0074] Figure 3This shows the biological role of BDNF. When the axon potential reaches the presynaptic junction, Na + The influx depolarizes the membrane, which triggers the Ca 2+ The influx of Ca and the release of the excitatory neurotransmitter glutamate into the synaptic cleft. Glutamate binds to AMPA and NMDA receptors on the postsynaptic membrane. Activation of the receptors causes membrane depolarization, Ca 2+ Ca influx via NMDA and VDCC. 2+ Binds to CaMKs that activate CREB and NF-kB, which in turn induce transcription of the Bdnf gene. BDNF is released at the synaptic cleft and activates the TrkB receptor, leading to the activation of downstream signaling cascades including PLCγ, PI3K, and MAPKs and subsequent expression of genes critical for neuronal survival and plasticity. BDNF signaling also has acute effects on membrane excitability and synaptic transmission by altering the kinetics of NMDA receptors and increasing the number of presynaptic synaptic vesicles.

[0075] Figure 4 Cdkl5 is shown fl / Y ; Emx1-Cre mice develop spontaneous epileptic phenotype.

[0076] (A)Cdkl5 fl / Y ; Expression levels of CDKL5 protein in the cerebral cortex, hippocampus and striatum of Emx1-Cre mice and their control groups. There are four pairs of mice in total, and Tubulin is used as the internal reference protein.

[0077] (B)Cdkl5 fl / Y ; Representative images of electroencephalogram (EEG) and electromyogram (EMG) recordings during spontaneous epileptic seizures in Emx1-Cre mice. The target mice were 6 months old. The upper and middle images show Cdkl5 fl / Y ; Changes in the electroencephalogram (EEG) recordings of Emx1-Cre mice during epileptic seizures. The top arrow represents the onset of epileptic seizures. The amplitude of the seizures increases significantly during the seizures and is suppressed after the seizures. The bottom figure represents Cdkl5 fl / Y ; Changes in electromyographic (EMG) recordings during epileptic seizures in Emx1-Cre mice.

[0078] (C)Cdkl5 fl / Y ; Statistical graph of spontaneous epileptic seizure rates in Emx1-Cre mice and their control group, Cdkl5 fl / Y A total of 10 mice, Cdkl5 fl / Y ; A total of 15 Emx1-Cre mice.

[0079] (D)Cdkl5 fl / Y; Survival rate statistics of Emx1-Cre mice and their control group, Cdkl5 fl / Y A total of 10 mice, Cdkl5 fl / Y ; A total of 15 Emx1-Cre mice.

[0080] Figure 5 Cdkl5 is shown fl / Y ;CaMK2α-iCre mice develop spontaneous epileptic phenotype.

[0081] (A)Cdkl5 fl / Y ; The expression levels of CDKL5 protein in the cerebral cortex, hippocampus and striatum of CaMK2α-iCre mice and their control groups. There are four pairs of mice in total, and Tubulin is used as the internal reference protein.

[0082] (B)Cdkl5 fl / Y ; Representative images of electroencephalogram (EEG) and electromyogram (EMG) recordings during spontaneous epileptic seizures in CaMK2α-iCre mice. The target mice were 6 months old. The upper image shows that Cdkl5 fl / Y ; Changes in electroencephalogram (EEG) recordings during epileptic seizures in CaMK2α-iCre mice. The top arrow represents the onset of epileptic seizures. The amplitude of the seizures increases significantly during the seizures and is suppressed after the seizures. The bottom figure represents Cdkl5 fl / Y ; Changes in electromyogram (EMG) recordings during epileptic seizures in CaMK2α-iCre mice.

[0083] (C)Cdkl5 fl / Y ; Statistical graph of spontaneous epileptic seizure rates in CaMK2α-iCre mice and their control group, Cdkl5 fl / Y There were 12 mice in total, Cdkl5 fl / Y ; There were 15 CaMK2α-iCre mice in total.

[0084] (D)Cdkl5 fl / Y ; Survival statistics of CaMK2α-iCre mice and their control group, Cdkl5 fl / Y There were 12 mice in total, Cdkl5 fl / Y ; There were 15 CaMK2α-iCre mice in total.

[0085] Figure 6 Cdkl5 is shown fl / Y ; Excitatory transmission in the dentate gyrus of the hippocampus of Emx1-Cre mice is enhanced.

[0086] (A)Cdkl5 fl / Y ; Representative images of sEPSCs in the dentate gyrus of the hippocampus of Emx1-Cre mice.

[0087] (B) Whole-cell recordings showed that Cdkl5 fl / Y ; The frequency of sEPSCs in the dentate gyrus of the hippocampus of Emx1-Cre mice was increased compared with that of the control group.

[0088] (C) Whole-cell recordings showed that Cdkl5 fl / Y ; The amplitude of sEPSC in the dentate gyrus of the hippocampus of Emx1-Cre mice was not significantly different from that of the control group. (B) and (C) The control group was Cdkl5 fl / Y Mice, 5 in total, 8 neurons recorded; experimental group Cdkl5 fl / Y ; Emx1-Cre mice, 4 mice in total, 16 neurons recorded. *p<0.05, unpaired two-tailed t-test.

[0089] (D)Cdkl5 fl / Y ; Representative images of mEPSCs in the dentate gyrus of the hippocampus of Emx1-Cre mice.

[0090] (E) Whole-cell recordings showed that Cdkl5 fl / Y ; The frequency of mEPSCs in the dentate gyrus of the hippocampus of Emx1-Cre mice was increased compared with that of the control group.

[0091] (F) Whole-cell recordings showed that Cdkl5 fl / Y ; The amplitude of mEPSC in the dentate gyrus of the hippocampus of Emx1-Cre mice was not significantly different from that of the control group. (E) and (F) The control group was Cdkl5 fl / Y Mice, 4 in total, 14 neurons recorded; experimental group Cdkl5 fl / Y ; Emx1-Cre mice, 3 mice in total, 10 neurons recorded. **p<0.01, unpaired two-tailed t-test.

[0092] Figure 7 Cdkl5 is shown fl / Y ; Excitatory transmission in the dentate gyrus of the hippocampus of CaMK2α-iCre mice is enhanced.

[0093] (A)Cdkl5 fl / Y ; Representative images of sEPSCs in the dentate gyrus of the hippocampus of CaMK2α-iCre mice.

[0094] (B) Whole-cell recordings showed that Cdkl5 fl / Y ; The frequency of sEPSCs in the dentate gyrus of the hippocampus of CaMK2α-iCre mice was increased compared with that of the control group.

[0095] (C) Whole-cell recordings showed that Cdkl5 fl / Y; The amplitude of sEPSC in the dentate gyrus of the hippocampus of CaMK2α-iCre mice was not significantly different from that of the control group. (B) and (C) The control group was Cdkl5 fl / Y Mice, 3 in total, 11 neurons recorded; experimental group Cdkl5 fl / Y ;CaMK2α-iCre mice, 4 mice in total, 11 neurons recorded. ***p<0.001, unpaired two-tailed t-test.

[0096] (D)Cdkl5 fl / Y ; Representative images of mEPSCs in the dentate gyrus of the hippocampus of CaMK2α-iCre mice.

[0097] (E) Whole-cell recordings showed that Cdkl5 fl / Y The frequency of mEPSCs in the hippocampal dentate gyrus of CaMK2α-iCre mice was increased compared with that in the control group. Whole-cell recording showed that Cdkl5 fl / Y ; The amplitude of mEPSC in the dentate gyrus of the hippocampus of CaMK2α-iCre mice was not significantly different from that of the control group. (E) and (F) The control group was Cdkl5 fl / Y Mice, 4 in total, 13 neurons recorded; experimental group Cdkl5 fl / Y ;CaMK2α-iCre mice, 4 mice in total, 15 neurons recorded. ****p<0.0001, unpaired two-tailed t-test.

[0098] Figure 8 Cdkl5 is shown fl / Y ; The amplitude of mIPSCs in the dentate gyrus of the hippocampus of Emx1-Cre mice is enhanced.

[0099] (A)Cdkl5 fl / Y ; Representative images of sIPSCs in the dentate gyrus of the hippocampus of Emx1-Cre mice.

[0100] (B) Whole-cell recordings showed that Cdkl5 fl / Y ; The frequency of sIPSCs in the dentate gyrus of the hippocampus of Emx1-Cre mice had no significant difference compared with the control group.

[0101] (C) Whole-cell recordings showed that Cdkl5 fl / Y ; The amplitude of sIPSC in the dentate gyrus of the hippocampus of Emx1-Cre mice was not significantly different from that of the control group. (B) and (C) The control group was Cdkl5 fl / Y Mice, 5 in total, 10 neurons recorded; experimental group Cdkl5 fl / Y ; Emx1-Cre mice, 3 in total, 9 neurons recorded. Unpaired two-tailed t-test.

[0102] (D)Cdkl5 fl / Y; Representative images of mIPSCs in the dentate gyrus of the hippocampus of Emx1-Cre mice.

[0103] (E) Whole-cell recordings showed that Cdkl5 fl / Y ;The frequency of mIPSCs in the dentate gyrus of the hippocampus of Emx1-Cre mice was not significantly different from that of the control group.

[0104] (F) Whole-cell recordings showed that Cdkl5 fl / Y ; The amplitude of mEPSC in the dentate gyrus of the hippocampus of Emx1-Cre mice was enhanced compared with that of the control group. (E) and (F) The control group was Cdkl5 fl / Y Mice, 6 in total, 13 neurons recorded; experimental group Cdkl5 fl / Y ; Emx1-Cre mice, 4 mice in total, 13 neurons recorded. **p<0.01, unpaired two-tailed t-test.

[0105] Fig. 9 Cdkl5 is shown fl / Y ;CaMK2α-CreER mice develop spontaneous epilepsy.

[0106] (A)Cdkl5 fl / Y ; The expression levels of CDKL5 protein in the cerebral cortex, hippocampus, striatum and cerebellum of CaMK2α-CreER mice and their control group. There were 3 mice in each group, and GAPDH was used as the internal reference protein.

[0107] (B)Cdkl5 fl / Y ; Representative images of electroencephalogram (EEG) and electromyogram (EMG) recordings during spontaneous epileptic seizures in CaMK2α-CreER mice and control mice.

[0108] (B)Cdkl5 fl / Y ; Statistical chart of spontaneous epileptic seizure rates in CaMK2α-CreER mice and their control group.

[0109] (D)Cdkl5 fl / Y ; Survival statistics of CaMK2α-CreER mice and their control group, Cdkl5 fl / Y + tamoxifen group, 10 mice in total; Cdkl5 fl / Y ;CaMK2α-CreER+corn oil group, 5 mice in total; Cdkl5 fl / Y ; There were 6 mice in the CaMK2αCreER+tamoxifen group.

[0110] Fig.10 Cdkl5 is shown fl / Y; Excitatory transmission in the dentate gyrus of the hippocampus in CaMK2α-CreER mice is enhanced.

[0111] (A)Cdkl5 fl / Y ; Representative images of sEPSCs in the dentate gyrus of the hippocampus of CaMK2α-CreER mice.

[0112] (B) Whole-cell recordings showed that Cdkl5 fl / Y ; The frequency of sEPSCs in the dentate gyrus of the hippocampus of CaMK2α-CreER mice was increased compared with that of the control group.

[0113] (C) Whole-cell recordings showed that Cdkl5 fl / Y ; The amplitude of sEPSC in the hippocampal dentate gyrus of CaMK2α-CreER mice was not significantly different from that of the control group. (B) and (C) The control group was Cdkl5 fl / Y +Tamoxifen group, 3 mice in total, 11 neurons recorded; Cdkl5 fl / Y ; 3 mice in the CaMK2α-CreER+corn oil group, 14 neurons were recorded; the experimental group was Cdkl5 fl / Y ;CaMK2α-CreER+tamoxifen mice, 3 in total, 11 neurons were recorded.

[0114] ****p<0.0001, unpaired two-tailed t-test.

[0115] (D)Cdkl5 fl / Y ; Representative images of mEPSCs in the dentate gyrus of the hippocampus of CaMK2α-CreER mice.

[0116] (E) Whole-cell recordings showed that Cdkl5 fl / Y ; The frequency of mEPSCs in the dentate gyrus of the hippocampus of CaMK2α-CreER mice was increased compared with the control group.

[0117] (F) Whole-cell recordings showed that Cdkl5 fl / Y ; The amplitude of mEPSC in the dentate gyrus of the hippocampus of CaMK2α-CreER mice was not significantly different from that of the control group. (E) and (F) The control group was Cdkl5 fl / Y +Tamoxifen group, 3 mice in total, 10 neurons recorded; Cdkl5 fl / Y ; 3 mice in the CaMK2α-CreER+corn oil group, 15 neurons were recorded; the experimental group was Cdkl5 fl / Y ;CaMK2α-CreER+tamoxifen mice, 3 in total, 11 neurons were recorded.

[0118] ****p<0.0001, unpaired two-tailed t-test.

[0119] Fig.11 Cdkl5 is shown fl / Y ; The density and maturity of dendritic spines in granule cells of CaMK2α-CreER mice are normal.

[0120] (A)Cdkl5 fl / Y ; Representative fragments of dendrites of hippocampal dentate gyrus granule cells in the CaMK2α-CreER+tamoxifen group and the control group. Scale bar: 5 μm.

[0121] (B)Cdkl5 fl / Y ; Quantitative analysis of dendritic spine density of hippocampal dentate gyrus granule cells in the CaMK2α-CreER+tamoxifen group of mice and their control group. One-way ANOVA with Tukey's multiple comparison test.

[0122] (C)Cdkl5 fl / Y ; Classification of dendritic spines of hippocampal dentate gyrus granule cells in the CaMK2α-CreER+tamoxifen group and the control group. Two-way ANOVA with Bonferroni post hoc test. Each group contained 41-52 neurons.

[0123] Fig.12 Cdkl5 is shown fl / Y ; The BDNF expression level in the hippocampus of CaMK2α-CreER mice was increased, and the BDNF-TrkB signaling pathway was abnormally activated.

[0124] (A) Immunoblotting assay to detect Cdkl5 fl / Y ; Protein levels of BDNF and CDKL5 in the hippocampus of CaMK2α-CreER mice, with GAPDH as the internal reference.

[0125] (B) Cdk15 fl / Y ; The protein level of BDNF in the hippocampus of CaMK2α-CreER mice and their control group was quantitatively analyzed. fl / Y + tamoxifen group, 25 mice in total; Cdkl5 fl / Y ; CaMK2α-CreER+corn oil group, a total of 9 mice; experimental group Cdkl5 fl / Y ; CaMK2α-CreER+tamoxifen mice, a total of 23. ****p<0.0001, unpaired two-tailed t-test.

[0126] (C)Cdkl5 fl / Y qPCR analysis of BDNF mRNA levels in the hippocampus of CaMK2α-CreER mice and their control group. fl / Y + tamoxifen group, 11 mice in total; Cdkl5 fl / Y;CaMK2α-CreER+corn oil group, 5 mice in total; experimental group Cdkl5 fl / Y ; CaMK2α-CreER+tamoxifen mice, a total of 10. *p<0.05, unpaired two-tailed t test.

[0127] (D) Immunoblotting assay to detect Cdkl5 fl / Y ; Protein levels of p-TrkB (Tyr 516), p-TrkB (Tyr 707), p-TrkB (Tyr 816), p-ERK1 / 2, p-Akt (Ser473), p-GSK3β, and p-mTOR (Ser2448) in the hippocampus of CaMK2α-CreER mice.

[0128] (E) Quantification of phosphorylation levels of the proteins shown in (D). The control group was Cdk15 fl / Y + tamoxifen group, 14 mice in total; Cdkl5 fl / Y ; CaMK2α-CreER+corn oil group, 8 mice in total; experimental group Cdkl5 fl / Y ;CaMK2α-CreER+tamoxifen mice, a total of 12 mice.

[0129] *p<0.05, unpaired two-tailed t-test.

[0130] Fig.13 The Trk inhibitor K252a was shown to improve Cdkl5 fl / Y ; Defect in enhanced excitatory synaptic transmission in CaMK2α-CreER mice.

[0131] (A)Cdkl5 fl / Y ; Representative sEPSCs before and after the use of K252a in CaMK2α-CreER mice.

[0132] (B and C) Whole-cell recordings showed that Cdkl5 fl / Y ; After incubation with K252a, the elevated sEPSC frequency of the CaMK2α-CreER+tamoxifen group mice returned to the normal level of the control group, while the amplitude did not change. fl / Y +Tamoxifen group, 4 mice in total, 11 neurons recorded; Cdkl5 fl / Y ; 3 mice in the CaMK2αCreER+corn oil group, 10 neurons were recorded; the experimental group was Cdkl5 fl / Y ;CaMK2α-CreER+tamoxifen mice, a total of 4 mice, 13 neurons were recorded.

[0133] (D)Cdkl5 fl / Y; Representative images of mEPSCs in CaMK2α-CreER mice before and after treatment with K252a.

[0134] (E and F) Whole-cell recordings showed that Cdkl5 fl / Y ; After incubation with K252a, the elevated mEPSC frequency of the CaMK2α-CreER+tamoxifen group mice returned to the normal level of the control group, while the amplitude did not change. fl / Y +Tamoxifen group, 3 mice in total, 11 neurons recorded; Cdkl5 fl / Y ; 3 mice in the CaMK2α-CreER+corn oil group, 10 neurons recorded; experimental group Cdkl5 fl / Y ; 3 CaMK2α-CreER+tamoxifen mice, 11 neurons recorded. **p<0.01, ***p<0.001, ****p<0.0001, paired two-tailed t-test before and after drug administration, unpaired two-tailed t-test between different groups.

[0135] Fig.14 The TrkB antagonist ANA-12 was shown to improve Cdkl5 fl / Y ; Defect in enhanced excitatory synaptic transmission in CaMK2α-CreER mice.

[0136] (A)Cdkl5 fl / Y ; Representative graphs of sEPSCs in CaMK2α-CreER mice before and after treatment with ANA-12.

[0137] (B and C) Whole-cell recordings showed that Cdkl5 fl / Y ; After incubation with ANA-12, the elevated sEPSC frequency of the CaMK2α-CreER+tamoxifen group mice returned to the normal level of the control group, while the amplitude did not change. fl / Y +Tamoxifen group, 3 mice in total, 15 neurons recorded; Cdkl5 fl / Y ; 3 mice in the CaMK2α-CreER+corn oil group, 11 neurons were recorded; the experimental group was Cdkl5 fl / Y ;CaMK2α-CreER+Tamoxifen mice, 3 mice in total, 19 neurons recorded. ***p<0.001, ****p<0.0001.

[0138] (D)Cdkl5 fl / Y ; Representative images of mEPSCs in CaMK2α-CreER mice before and after treatment with ANA-12.

[0139] (E and F) Whole-cell recordings showed that Cdkl5 fl / Y; After incubation with ANA-12, the elevated mEPSC frequency of mice in the CaMK2α-CreER+tamoxifen group returned to the normal level of the control group, while the amplitude did not change. fl / Y +Tamoxifen group, 3 mice in total, 10 neurons recorded; Cdkl5 fl / Y ; 3 mice in the CaMK2α-CreER+corn oil group, 12 neurons were recorded; the experimental group was Cdkl5 fl / Y ; 3 CaMK2α-CreER+tamoxifen mice, 13 neurons recorded. **p<0.01, ****p<0.0001, paired two-tailed t-test before and after drug administration, unpaired two-tailed t-test between different groups.

[0140] Fig.15 It was shown that knockdown of TrkB receptor can improve spontaneous epileptic activity caused by Cdkl5 knockout in adulthood.

[0141] (A) Immunoblotting assay to detect Cdkl5 fl / Y ;TrkB flox / + ; Protein levels of CDKL5 and TrkB in the cerebral cortex and hippocampus of CaMK2α-CreER mice, with GAPDH as the internal reference.

[0142] (B) Cdk15 fl / Y ;TrkB flox / + The protein levels of CDKL5 and TrkB in the cerebral cortex and hippocampus of CaMK2α-CreER mice and their control group were quantified. fl / Y + tamoxifen group mice, 4 mice in total;

[0143] Cdkl5 fl / Y ;CaMK2α-CreER+tamoxifen group, 4 mice in total; experimental group Cdkl5 fl / Y ;TrkB flox / + ; CaMK2α-CreER+tamoxifen mice, 4 mice in total. **p<0.001, unpaired two-tailed t-test.

[0144] (C)Cdkl5 fl / Y ;TrkB flox / + ; Schematic diagram of the video observation experiment of CaMK2α-CreER mice.

[0145] (D)Cdkl5 fl / Y ;CaMK2α-CreER mice and Cdkl5 fl / Y ;TrkB flox / + ; Statistical chart of spontaneous epileptic seizure rate in CaMK2α-CreER mice. The control group was Cdkl5 fl / Y;CaMK2α-CreER mice, a total of 11; experimental group Cdkl5 fl / Y ;TrkB flox / + ;CaMK2α-CreER mice, 7 in total.

[0146] Fig.16 It was shown that inhibition of TrkB receptor can improve Cdkl5 fl / Y ; Spontaneous epileptic activity in CaMK2α-CreER mice.

[0147] (A)Cdkl5 fl / Y ; Schematic diagram of the intraperitoneal injection experiment of CaMK2α-CreER mice.

[0148] (B, C) Cdkl5 fl / Y CaMK2α-CreER mice were intraperitoneally injected with the TrkB antagonist ANA12

[0149] (B) or VPA (C) before and after 12 hours of spontaneous epileptic activity changes. Number of animals: 6. **p<0.01, *p<0.05, paired two-tailed t-test.

[0150] (D) A single injection of ANA-12 did not induce Cdkl5 fl / Y Mice and Cdkl5 fl / Y ; CaMK2α-CreER mouse hippocampal cell apoptosis. The positive control group was Cdkl5 fl / Y Mouse + DNase; experimental group: Cdkl5 fl / Y Mice and Cdkl5 fl / Y ; CaMK2α-CreER mice + ANA12, 3 mice in each group. Scale bar: 200 μm. DETAILED DESCRIPTION

[0151] After extensive and in-depth research, the inventor unexpectedly discovered that BDNF-TrkB signaling pathway inhibitors (such as TrkB antagonists) can effectively prevent and / or treat CDKL5 deficiency-related epilepsy. On this basis, the inventor completed the present invention.

[0152] As used herein, the term "ANA-12" has the structural formula:

[0153]

[0154] As used herein, the term "K252a" has the structural formula:

[0155]

[0156] As used herein, the Chinese name of the term "TAK-935 / OV935" is Sotistatin, and the structural formula is:

[0157]

[0158] As used herein, the Chinese name of the term "Ganaxolone" is Ganaxolone, and the structural formula is:

[0159]

[0160] CDKL5 Deficiency

[0161] CDKL5 deficiency disorder (CDD) is a rare genetic disease characterized by seizures that begin in infancy and are accompanied by significant developmental delays in multiple systems. CDKL5 deficiency occurs in approximately 1 in 40,000 to 60,000 newborns and is one of the most common genetic causes of childhood epilepsy, of which approximately 90% occur in females. CDKL5 deficiency was previously classified as an atypical form of Rett syndrome, with which they share common features, including seizures, intellectual disability, and other developmental problems. However, patients with CDKL5 deficiency have a significantly different clinical course from Rett syndrome. In Rett syndrome, seizures generally begin in adolescence and decrease in severity with age; whereas patients with CDKL5 deficiency develop seizures in the first few months of life and are severely resistant to antiepileptic drugs and cannot be cured. Therefore, CDKL5 deficiency is now considered a separate disease from Rett syndrome.

[0162] CDKL5 deficiency is caused by mutations in the CDKL5 gene. Mutations in the CDKL5 gene reduce the expression level of functional CDKL5 protein or change its activity in nerve cells, but it is not clear how these changes lead to the specific phenotypes of CDKL5 deficiency. The CDKL5 gene is located on the X chromosome and is inherited in an X-linked dominant pattern. Since women have two X chromosomes, random inactivation of the X chromosome can lead to different severity of symptoms and signs in different CDD patients. Women with a higher proportion of mutated neurons have more severe signs and symptoms than women with a lower proportion of mutated neurons. Since men have only one X chromosome in each cell, mutations in the CDKL5 gene are active in all cells, and affected men do not have a normal copy of the gene.

[0163] Seizures are often the first manifestation of patients with CDKL5 deficiency, with a median time from birth to onset of 4-6 weeks, and more than 90% of patients experience seizures within 3 months of birth, which can occur as early as the first week after birth. Patients' seizures can develop into different types over time and may follow a certain pattern of seizures. The most common types are generalized tonic-clonic seizures, including loss of consciousness, muscle rigidity, and convulsions; tonic seizures, which are characterized by abnormal muscle contractions; and epileptic spasms, in which the EEG shows mild arrhythmias and short-term muscle twitches. Although there may be remission periods (a period of no seizures), most people with CDD may have seizures every day. About one-third of people will have multiple stages of seizures. Clonic, atonic, and absence seizures can also be observed in CDD patients, but they are not common types. At first, seizures occur during sleep, but over time, they often occur when awake. The first seizure usually has no significant features on the EEG, but this does not mean that CDD-related seizure activity does not exist.

[0164] Children with CDKL5 deficiency will have developmental impairments, most of whom have severe intellectual disabilities, with language skills being particularly affected. The development of gross motor skills such as sitting, standing, and walking is delayed, and only about one-third of CDD patients can walk independently. Fine motor skills (such as picking up small objects with fingers) are also affected, and about half of CDD patients have limited fine motor skills and will accompany them for life. Most patients have vision problems, some of which manifest as cortical visual impairment (complete loss of binocular vision, normal pupil light reflex, and normal fundus). Other common features of CDD patients include repetitive hand movements such as clapping, licking, and sucking; teeth grinding; interrupted sleep; feeding difficulties and gastrointestinal problems, including constipation and gastroesophageal reflux. Some patients have paroxysmal irregular breathing. Other limb abnormalities may also occur, such as head abnormalities (microcephaly), lateral curvature of the spine, and thin fingers.

[0165] The current medical management of patients with CDKL5 deficiency is mainly symptomatic and supportive treatment, aimed at maximizing the patient's personal abilities and improving any skills that may arise. Emphasis is placed on early intervention treatments such as physical therapy, occupational therapy, and speech and assistive communication therapy. Among them, epilepsy control is the most challenging content. The "International Consensus Recommendations for the Evaluation and Management of Patients with CDKL5 Deficiency" points out that existing drugs, including corticosteroids, vigabatrin, valproic acid, phenytoin, felbamate, carbamazepine, clonazepam, oxcarbazepine, and lacosamide, can reduce the frequency of epileptic seizures when used alone in the early stage, but the medication will lose its efficacy after a certain period of time (median response time is 6 months), and even in some cases, it will aggravate the seizure. The consensus document does not make specific anti-seizure drug treatment recommendations for CDKL5 deficiency, but suggests alternatives, including a ketogenic diet; implantation of a vagus nerve stimulator (VNS, which delivers small pulses of electrical current to the vagus nerve along the neck to the brain); corpus callosotomy (severing the main fibers connecting the two hemispheres of the brain); and pharmaceutical-grade cannabidiol. Children with CDKL5 deficiency are generally not candidates for focal lesion removal surgery because CDKL5 loss affects the brain broadly rather than in a specific location. People with CDD often require multiple anti-seizure drugs to control seizures. The choice is based on the type of seizure and mechanism of action of the drug, potential side effects, and the potential for interaction with other medications.

[0166] CDKL5 protein

[0167] Cyclin-dependent Kinase Like 5 (CDKL5) is encoded by the CDKL5 gene, which was originally named STK9, i.e., serine / threonine kinase 9. The CDKL5 gene is located in region 22 of the short arm of chromosome X (Xp22). The human CDKL5 gene has 24 exons. The N-terminus of the CDKL5 protein is a serine / threonine kinase domain, and its pathogenic mutations are mostly found in the catalytic region ( Figure 1), exons 2-21 are the coding region. CDKL5 protein belongs to the cell cycle dependent kinase family, and is highly homologous to the kinase domains of cyclin-dependent kinases (CDKs), mitogen-activated protein kinases (MAPKs), and glycogen synthasekinases (GSKs).

[0168] CDKL5 protein is expressed in large quantities in the central nervous system of humans and rodents, among which the highest expression levels are in the cerebral cortex, hippocampus, thalamus, striatum and olfactory bulb. CDKL5 is expressed at a low level in the embryonic period, and the expression level increases significantly after birth, reaching a peak in the first few weeks, and maintaining stable expression in adulthood. Neurons are the main cell type expressing CDKL5, and glial cells only express a small amount. CDKL5 is expressed in various subcellular structures, among which the cytoplasm is the main expression area, but nuclear aggregation gradually appears as the brain develops. Some potential substrates of CDKL5 have been identified, and some of the substrates related to physiological functions have been verified in cells. Currently known substrates include MAP1S, EB2, CEP131, a regulator of microtubule and centrosome function, and ELOA involved in DNA damage response, etc. CDKL5 is mainly enriched in the nucleus in the area of ​​RNA splicing and processing. CDKL5 also accumulates in different subcellular regions at different developmental stages: in the early stages of cultured neurons, CDKL5 was found to accumulate in growth cones; in mature neurons, CDKL5 accumulates in dendritic spines, especially in the postsynaptic density; some studies have also found that CDKL5 exists in centrosomes. These expression patterns indicate that CDKL5 is involved in the regulation of neuronal development and plays a role in the maturation of adult neurons.

[0169] CDKL5 plays different functions at different stages of neuronal development. In early neuronal development, CDKL5 regulates cell proliferation and neuronal migration. According to previous studies, CDKL5 has a negative regulatory function in regulating cell proliferation. Upregulating CDKL5 expression inhibits the proliferation of human neuroblastoma cells; while knocking out mouse Cdkl5 increases the proliferation rate of dentate gyrus granule cells. In addition, CDKL5 was found to be present in the centrosomes of dividing cells and post-mitotic neurons, indicating that it may regulate cell proliferation and division by affecting the centrosome. CDKL5 has a regulatory effect on neuronal migration, and it was found to interact with IQGAP1, an important regulator related to cell migration and polarity. In rodent model animals, reducing the expression of CDKL5 in neural progenitor cells leads to delayed migration of layer 2-3 pyramidal neurons. In the process of neuronal maturation, CDKL5 is closely related to the growth and development of dendrites and axons, and is one of the key proteins for synapse formation. CDKL5 interacts with Shootin1, a key protein for axon growth, in growth cones. Silencing Cdkl5 by RNAi or overexpressing CDKL5 leads to an increase in the number of neurons with multiple axons, but downregulating Cdkl5 does not hinder axon formation, indicating that CDKL5 has a regulatory function in axon growth, but does not play a decisive role in axon formation. CDKL5 also regulates dendrite development. When Cdkl5 is silenced in cultured neurons, the dendritic branching of neurons is severely impaired. Cdkl5 knockout mice can be observed to have a significant reduction in the total length of dendrites in the cerebral cortex and hippocampal CA1 pyramidal neurons, as well as dentate gyrus granule cells. Overexpression of CDKL5 in cultured neurons results in a kinase activity-dependent increase in total dendrite length. In addition, CDKL5 is also involved in synapse formation. CDKL5 has been observed to interact with palmitoylated PSD95 and the adhesion molecule NGL1. PSD is a major scaffolding protein that regulates the localization of synaptic proteins and synaptic strength; NGL1 is a key adhesion molecule for synapse formation. In dendritic spines, CDKL5 is highly enriched in the postsynaptic density, a dense protein complex composed of key proteins for synaptic transmission, signal transduction, and cell adhesion. The synaptic localization of CDKL5 strongly suggests that this protein is involved in the development and function of synapses. In whole-body Cdkl5 knockout mice, the density of dendritic spines and the number of mature dendritic spines were significantly reduced in dentate gyrus granule cells, hippocampal CA1 pyramidal neurons, and cortical layer V pyramidal neurons. In mice with conditional knockout of Cdkl5 in forebrain excitatory neurons, a trend towards increased dendritic spine density and complexity was observed. The reason for this difference is unclear, and the loss of Cdkl5 in inhibitory interneurons may trigger compensatory mechanisms.

[0170] The function of CDKL5 is not limited to neuronal development, and its expression persists in the adult brain. In adult mice lacking CDKL5, the stability and long-term potentiation of mature dendritic spines are impaired, and these animals have defects in hippocampal-dependent memory. Notably, these defects can be reversed by restoring CDKL5 protein levels in adult mice, including abnormal morphology of dendritic spines, hindlimb grasping, and learning and memory abilities. The defects of CDKL5 knockout mice can also be improved by activating the downstream signaling pathways of CDKL5. For example, the application of IGF-1 can restore the stability of dendritic spines, indicating that CDKL5 also plays an important role in the neural maturation period after adulthood. In addition, the function and activity of CDKL5 itself are also regulated by neural activity, such as DYRK1A phosphorylation of serine residue 308 promotes the cytoplasmic localization of CDKL5 in Neuro-2a cells; in cultured neurons, BDNF induces transient phosphorylation of CDKL5; neuronal activity prompts PP1 to dephosphorylate CDKL5. The mutual regulation between neural activity and CDKL5 indicates that CDKL5 plays a key and unique role in regulating the homeostasis of neurons and neural circuits.

[0171] Mouse model of CDKL5 deficiency

[0172] Cdkl5 exon knockout mice are the most commonly used Cdkl5 knockout mouse model. In this strain of Cdkl5 knockout mice, researchers observed impairment of limb coordination, motor skills, learning and memory abilities, autism-like symptoms, abnormal eye movements, abnormal breathing and sleep patterns, and atypical behavioral responses to whisker-mediated tactile stimulation. Most of these phenotypes can be mutually confirmed with the symptoms of patients with CDKL5 deficiency.

[0173] The establishment of a CDKL5 deficiency mouse model confirmed the importance of this gene for normal brain development and nervous system function, and also provided an in vivo environment to discover and validate various protein-protein interactions and signaling pathways involving CDKL5, and to test newly discovered treatments. Despite extensive experimental exploration of various CDD mouse models, the endogenous function of CDKL5 and its role in the development, maintenance, and pathogenesis of the nervous system remain to be elucidated, and the core spontaneous epilepsy phenotype of CDKL5 deficiency has not been well reproduced, and there is still a lack of a new animal model to simulate CDD-related epilepsy.

[0174] Hippocampal dentate gyrus and epilepsy

[0175] Epilepsy is a central nervous system disease in which patients suffer from recurrent, partial or whole-body seizures, sometimes accompanied by loss of consciousness. It is a catastrophic neurological disease. The severity of seizures in epilepsy patients can range from brief distraction or muscle rigidity to prolonged severe convulsions. Epileptic seizures are generally classified as focal or generalized, depending on how and where the seizure starts. Temporal lobe epilepsy (TLE) is the most common form of focal epilepsy. About 60% of patients with focal epilepsy have temporal lobe epilepsy, which often starts in the hippocampus or limbic system. Temporal lobe epilepsy is considered to be the most suitable for scientific research on epilepsy: as the most common type of epilepsy, temporal lobe epilepsy has a large amount of EEG data and case reports available for research, and because temporal lobectomy has a good therapeutic effect on temporal lobe refractory epilepsy, its pathological tissue is easier to obtain than other types of epilepsy. The most common pathological feature of temporal lobe epilepsy is hippocampal sclerosis, which can be observed in both epilepsy patients and animal models. It is mainly manifested by the loss of hippocampal neurons, including the loss of CA1 and CA3 pyramidal neurons and the diffuse distribution of dentate gyrus cells. The most significant loss is the loss of granule cells. The dentate gyrus is a key structure for the transmission of excitement to the hippocampus. In epilepsy patients and animal models of epilepsy, the dentate gyrus undergoes a variety of changes, making the hypothesis that epilepsy originates from the hippocampus a research hotspot.

[0176] The hippocampus is located in the medial region of the temporal lobe and plays an important role in emotion regulation, consolidation of information from short-term to long-term memory, and spatial processing. Understanding the anatomy of the hippocampus is crucial to its cognitive function.

[0177] The hippocampus is composed of subregions such as Cornu ammonis (CA, including CA1-CA4), dentate gyrus and subthalamic area. The axons of layer II neurons in the entorhinal cortex project to the dentate gyrus through the perforant pathway (PP), including the lateral perforant pathway (LPP) and the medial perforant pathway (MPP). The dentate gyrus projects to the pyramidal cells of CA3 through mossy fibers, which are then transmitted to CA1 pyramidal neurons through Schaffer collaterals, and finally output to the deep neurons of EC through CA1 pyramidal neurons. In addition, CA3 also receives direct projections from the entorhinal cortex through the perforant pathway; CA1 receives direct input from the entorhinal cortex through the temporo-ammonic pathway (TA). The dentate granule cells project to interneurons and mossy cells, and receive their inhibitory and excitatory feedback, respectively ( Figure 2 , AB).

[0178] The dentate gyrus consists of three layers from outside to inside: the molecular layer, the granule cell layer, and the polymorphic layer (also called the Hilus layer). Granule cells, as the main neurons of the dentate gyrus, are densely arranged in the granule cell layer, and their axons project to CA3 to form excitatory synapses with pyramidal neurons. The molecular layer is a cell-free layer occupied by the dendrites of granule cells in the granule cell layer and the perforated path fibers from the entorhinal cortex. There are many cell types in the polymorphic layer, and mossy cells are one of the most important neurons. At the edge of the granular layer and the polymorphic layer, there are several types of neurons, such as pyramidal basket cells, which are inhibitory interneurons. There is much controversy about whether neurogenesis in the dentate gyrus continues into adulthood, but it is generally believed that the total number of granule cells in adult animals is relatively stable. The mossy fibers projected by granule cells terminate above the CA3 pyramidal cell layer, which is called the clear layer. Mossy fibers also project to the polymorphic layer to form synaptic connections with interneurons. Under physiological conditions, the activity of granule cells in the dentate gyrus is very low, which is related to both the intrinsic characteristics of their own cells and the circuit network environment in which they are located. First, compared with most excitatory hippocampal neurons, granule cells exhibit a hyperpolarized resting membrane potential, which makes them more difficult to induce action potentials. In addition, granule cell dendrites show significant voltage-dependent linear integration and strong attenuation of synaptic inputs to the entorhinal cortex. In addition to the relatively low excitability of the membrane intrinsic properties, dentate gyrus granule cells are also in a circuit network that is biased towards inhibition. Among them, feedforward inhibition is provided by a variety of inhibitory neurons such as fast-spiking interneurons, hilar interneurons, and basket cells. Granule cell axonal projections are also connected to a variety of GABAergic interneurons, which form dendritic targeted feedback regulation on granule cells. The intrinsic properties of granule cells and the inhibitory circuit network environment make them exist as a shock absorber between the entorhinal cortex and CA3. Therefore, when abnormalities occur in the dentate gyrus, it is considered to be the "detonator / detonator" of the epileptogenic process, and together with CA3, it becomes the key to the formation of epileptic seizures, which is also known as the gating hypothesis of the dentate gyrus. The gating hypothesis states that the dentate gyrus protects the hippocampal circuit from abnormal excitation, and that damage to this region can lead to epilepsy. A large number of epilepsy studies supporting this theory have elaborated on the gating hypothesis of the dentate gyrus, including mossy fiber sprouting (abnormal synapses formed on mossy fibers and other granule cells); abnormal formation and persistence of basal dendrites of granule cells; ectopic dispersion and migration of granule cells; changes in intrinsic properties of granule cell membranes and expression of synaptic receptors; downregulation of inhibitory GBABergic synaptic transmission and abnormal regulation of various molecular signaling pathways.Moreover, the use of optogenetics to depolarize or hyperpolarize dentate gyrus granule cells in animal models can effectively inhibit / induce spontaneous epilepsy, proving that the dentate gyrus is a key node in the temporal lobe epilepsy network. Optogenetic activation of dentate gyrus inhibitory interneurons can prevent the spread of epilepsy in the hippocampus and cortex, further highlighting the important role of the dentate gyrus in regulating cortical input.

[0179] Patients with CDKL5 deficiency will show different types of epileptic seizures at different stages of the disease course, but CDD patients can be observed to have high-intensity temporal lobe activity in MRI, and multiple case reports have shown temporal lobe atrophy in CDD patients; common pathological features of temporal lobe epilepsy such as mossy fiber sprouting can also be seen in CDD animal models, and these evidences indicate that CDD-related epilepsy is closely related to temporal lobe epilepsy. In CDD mouse models, various changes in the dentate gyrus of the hippocampus can also be observed. In Cdkl5 knockout mice, the molecular layer of the dentate gyrus has reduced immunoreactivity to presynaptic markers synaptophysin and VGLUT1, indicating impaired synaptic maintenance; GluN2B subunits accumulate ectopically at the synaptic junctions of the dentate gyrus granule cells-CA3 layer, causing synaptic hyperexcitation and increased susceptibility to epilepsy; the death of postmitotic granule neuron precursors increases, the total number of granule cells decreases, and the newly generated granule cells show severe dendritic atrophy, which impairs hippocampal-dependent behaviors; the density of dendritic spines and the number of mature dendritic spines of dentate gyrus granule cells and CA1 pyramidal neurons are significantly reduced. These experimental data suggest that the dentate gyrus of the hippocampus plays a key role in the pathological development of CDKL5 deficiency.

[0180] BDNF-TrkB signaling pathway and epilepsy

[0181] Brain derived neurotrophic factor (BDNF) belongs to the neurotrophic factor family and is related to the typical nerve growth factor (NGF), which also includes NT-3 and NT-4 / NT5. BDNF acts on certain neurons in the central and peripheral nervous systems. In the brain, it is active in the hippocampus, cortex, and basal forebrain regions, and is also expressed in the retina, kidney, prostate, motor neurons, and skeletal muscle. BDNF mainly binds to the TrkB receptor with high affinity, and the low-affinity nerve growth factor receptor LNGFR (also known as p75) can also respond to BDNF. BDNF plays different roles in neurons at different time and space stages, and the existence of complex multi-level regulation proves the importance and diversity of BDNF functions. During development, BDNF plays a vital role in the survival and differentiation of neuronal populations, promoting the growth and differentiation of newborn neurons by changing cell survival and proliferation; BDNF plays a key role in regulating plastic changes in the adult brain, including regulating protein transport, receptor phosphorylation and glutamate receptor expression levels; BDNF can promote changes in the morphology of dendritic spines, increase the number, size and complexity of dendritic spines, thereby stabilizing long-term potentiation (LTP), and plays a key role in memory formation and maintenance.

[0182] BDNF enhances excitatory synaptic transmission ( Figure 3 ).

[0183] Studies have shown that the BDNF-TrkB signaling pathway is abnormally upregulated during epilepsy, and this upregulation is closely related to the excitatory / inhibitory homeostasis of the neural circuit. The hippocampus, especially the dentate gyrus of the hippocampus, is a key structure in the epileptogenic effect of BDNF. Increased BDNF expression levels may not only lead to structural reorganization of the hippocampal circuit (mossy fiber sprouting), but also affect synaptic transmission in multiple regions of the hippocampus (including enhanced glutamate-mediated excitatory synaptic transmission or GABA-mediated inhibitory synaptic transmission). These changes can lead to a hyperexcitable state in the hippocampal circuit, further promoting abnormal activation of BDNF, thereby forming status epilepticus.

[0184] CDKL5 deficiency-related epilepsy

[0185] As used herein, "CDKL5 deficiency-associated epilepsy disorder" refers to an epilepsy phenotype caused by CDKL5 deficiency.

[0186] In the present invention, the CDKL5 deficiency-related epilepsy disease has one or more phenotypic characteristics selected from the following group:

[0187] (a) Spontaneous epilepsy phenotype in mouse models;

[0188] (b) Enhanced excitatory synaptic transmission in the dentate gyrus of the hippocampus in the mouse model;

[0189] (c) Abnormal upregulation of BDNF-TrkB signaling pathway in the hippocampus of the mouse model;

[0190] (d) Patients’ epileptic seizures can develop into different types over time.

[0191] (e) The patient's epilepsy phenotype is resistant to antiepileptic drugs.

[0192] (f) The patient's electroencephalogram (EEG) during the seizure shows bilateral synchronous flat potentials followed by recurrent sharp waves and spikes, typical EEG findings that develop over time and are not evident in young children.

[0193] The present invention focuses on exploring the pathogenesis of epilepsy associated with CDKL5 deficiency. We found that knocking out Cdkl5 in forebrain excitatory neurons can cause mice to have spontaneous epileptic phenotypes, and the excitatory synaptic transmission in the dentate gyrus of the hippocampus is enhanced, whether in the developmental period or in adulthood. fl / Y In addition to the observed enhancement of excitatory synaptic transmission in the dentate gyrus of the hippocampus, the density and maturity of dendritic spines of granule cells in the dentate gyrus of CaMK2α-CreER mice were normal, and the electrophysiological properties mediated by AMPA receptors were not affected, but the BDNF-TrkB signaling pathway in the hippocampus was abnormally upregulated. By inhibiting the BDNF-TrkB signaling pathway, the abnormal synaptic transmission in the dentate gyrus can be rescued and Cdkl5 can be reduced. fl / Y ; The epileptic activity of CaMK2α-CreER mice suggests that abnormal upregulation of the BDNF-TrkB signaling pathway promotes epilepsy in genetic epilepsy mouse models, and targeting this pathway may be an effective strategy for treating CDD-related epilepsy.

[0194] BDNF-TrkB signaling pathway inhibitors

[0195] In the present invention, the BDNF-TrkB signaling pathway inhibitor refers to a small molecule that can inhibit the TrkB activity induced by BDNF in a competitive or non-competitive manner, including TrkB antagonists.

[0196] In a preferred embodiment, the BDNF-TrkB signaling pathway inhibitor is selected from the group consisting of ANA-12, K252a, or a combination thereof.

[0197] The present invention finds for the first time that BDNF-TrkB signaling pathway inhibitors can effectively prevent and / or treat CDKL5 deficiency-related epilepsy.

[0198] Compound pharmaceutical composition and medicine kit

[0199] The present invention provides a compound pharmaceutical composition containing an active ingredient (a) a BDNF-TrkB signaling pathway inhibitor; optionally (b) a drug for preventing and / or treating epilepsy associated with CDKL5 deficiency; and (c) a pharmaceutically acceptable carrier. Such carriers include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, powders, and combinations thereof. The pharmaceutical preparation should match the mode of administration. The pharmaceutical composition of the present invention can be prepared in the form of an injection, for example, by conventional methods using physiological saline or an aqueous solution containing glucose and other adjuvants. Pharmaceutical compositions such as tablets and capsules can be prepared by conventional methods. Pharmaceutical compositions such as injections, solutions, tablets and capsules are preferably manufactured under sterile conditions. The pharmaceutical combination of the present invention can also be prepared in powder form for aerosol inhalation. A preferred dosage form is an injection preparation. In addition, the pharmaceutical composition of the present invention can also be used with other therapeutic agents.

[0200] The present invention also provides a drug kit for preventing and / or treating CDKL5 deficiency-related epilepsy, the drug kit comprising:

[0201] (a1) a first container, and a BDNF-TrkB signaling pathway inhibitor or a drug containing a BDNF-TrkB signaling pathway inhibitor in the first container;

[0202] (b1) an optional second container, and other drugs for preventing and / or treating epilepsy associated with CDKL5 deficiency located in the second container, or containing other drugs for preventing and / or treating epilepsy associated with CDKL5 deficiency.

[0203] The pharmaceutical composition and kit of the present invention are suitable for preventing and / or treating epilepsy associated with CDKL5 deficiency.

[0204] The preparation of the present invention can be taken three times a day to once every ten days, or once every ten days in a sustained-release manner. The preferred mode is to take it once a day, because it is convenient for patients to adhere to it, thereby significantly improving the compliance of patients to take the medicine.

[0205] When taking the drug, the total daily dose in most cases should be lower than (or equal to or slightly higher than) the daily dose of each single drug in a few cases. Of course, the effective dose of the active ingredient used may vary depending on the mode of administration and the severity of the disease to be treated.

[0206] Treatment

[0207] The present invention also provides a method for preventing and / or treating CDKL5 deficiency-related epilepsy using the above-mentioned active ingredients or corresponding drugs of the present invention, which comprises administering to a mammal an effective amount of the active ingredient (a) a BDNF-TrkB signaling pathway inhibitor; optionally (b) other drugs for preventing and / or treating CDKL5 deficiency-related epilepsy (such as TAK-935 / OV935 and Ganaxolone), or administering a pharmaceutical composition containing the active ingredient (a) and the optional active ingredient (b).

[0208] When the active ingredient of the present invention is used for the above purposes, it can be mixed with one or more pharmaceutically acceptable carriers or excipients, such as solvents, diluents, etc., and can be administered orally in the form of tablets, pills, capsules, dispersible powders, granules or suspensions (containing, for example, about 0.05-5% suspending agents), syrups (containing, for example, about 10-50% sugar), and elixirs (containing about 20-50% ethanol), or parenterally in the form of sterile injectable solutions or suspensions (containing about 0.05-5% suspending agents in isotonic media). For example, these pharmaceutical preparations can contain about 0.01-99%, more preferably about 0.1%-90% (weight) of the active ingredient mixed with a carrier.

[0209] The active ingredients or pharmaceutical compositions of the present invention can be administered by conventional routes, including (but not limited to): intramuscular, intraperitoneal, intravenous, subcutaneous, intradermal, oral, intratumoral or topical administration. Preferred routes of administration include oral administration, intramuscular administration or intravenous administration.

[0210] From the standpoint of ease of administration, the preferred pharmaceutical composition is a liquid composition, especially an injection.

[0211] The main advantages of the present invention include:

[0212] (1) The present invention is the first to discover that BDNF-TrkB signaling pathway inhibitors (such as TrkB antagonists) can effectively prevent and / or treat CDKL5 deficiency-related epilepsy.

[0213] (2) The present invention focuses on exploring the mechanism of epilepsy associated with CDKL5 deficiency. We found that knocking out Cdkl5 in forebrain excitatory neurons can cause mice to have spontaneous epileptic phenotypes, and the excitatory synaptic transmission in the dentate gyrus of the hippocampus is enhanced, whether during development or adulthood. fl / YIn addition to the observed enhancement of excitatory synaptic transmission in the dentate gyrus of the hippocampus, the density and maturity of dendritic spines of granule cells in the dentate gyrus of CaMK2α-CreER mice were normal, and the electrophysiological properties mediated by AMPA receptors were not affected, but the BDNF-TrkB signaling pathway in the hippocampus was abnormally upregulated. By inhibiting the BDNF-TrkB signaling pathway, the abnormal synaptic transmission in the dentate gyrus can be rescued and Cdkl5 can be reduced. fl / Y ; The epileptic activity of CaMK2α-CreER mice suggests that abnormal upregulation of the BDNF-TrkB signaling pathway promotes epilepsy in genetic epilepsy mouse models, and targeting this pathway may be an effective strategy for treating CDD-related epilepsy.

[0214] (3) The present invention first discovered that previous CDD animal models could not well replicate the core epilepsy phenotype of CDD. The present invention constructed a mouse model with a spontaneous epilepsy phenotype by knocking out Cdkl5 in the excitatory neurons of the forebrain.

[0215] (4) The present invention discovered for the first time that CDKL5 maintains the stability of the hippocampal neural network in adulthood, illustrating that CDKL5 deficiency is not only a neurodevelopmental disorder but also a neurofunctional disorder.

[0216] (5) The present invention observed for the first time that the BDNF-TrkB signaling pathway was abnormally upregulated in adult Cdkl5 knockout mice, and that inhibition of the BDNF-TrkB signaling pathway could reduce spontaneous epileptic seizure activity, thus proposing a molecular mechanism for the occurrence of CDD-related epilepsy.

[0217] (6) The research of the present invention illustrates the important role of CDKL5 in the balance of excitatory / inhibitory synaptic transmission, and provides a new model and new target for the occurrence of CDD-related epilepsy, laying a more solid foundation for the clinical treatment of CDD-related epilepsy.

[0218] The present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually carried out under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in the examples are all commercially available products.

[0219] General Methods

[0220] 1. Experimental Materials

[0221] 1.1 Experimental animals

[0222] All experimental animals were derived from C57BL / 6J background, Cdkl5 flox / flox Provided by Professor Zhaolan Zhou of the University of Pennsylvania; Emx1-Cre mice (JAX 005628) purchased from The Jackson Laboratory; CaMK2α-iCre mice and CaMK2α-CreER mice were from Professor Schutz of the German Cancer Research Center; TrkB flox / flox Mice were donated by Professor Du Jiulin of the Center for Excellence in Brain Science and Intelligence Technology, Chinese Academy of Sciences. All animals were kept in an SPF (Specific Pathogen Free) barrier system environment with free access to water and food, a growth temperature of 21-24°C, and a 12-hour light / dark environment. The animal experiments and operations involved in this article meet the relevant requirements of the Animal Ethics Committee of the Center for Excellence in Brain Science and Intelligence Technology, Chinese Academy of Sciences.

[0223] 1.2 Experimental Antibodies

[0224]

[0225] 1.3. Experimental reagents

[0226]

[0227]

[0228]

[0229] The reagent formulas for biochemical experiments are as follows:

[0230]

[0231]

[0232] The reagents related to mouse experiments are as follows:

[0233] (1) Tamoxifen formulation (final concentration: 100 mg / kg): 0.5 g of tamoxifen (MedChemExpress, 1052910) was dissolved in a mixture of 2.5 ml of anhydrous ethanol (Sinopharm, 10009228) and 47.5 ml of corn oil (ABCONE, C67366), mixed in a 40°C water bath until completely dissolved, and stored in aliquots at -20°C. 0.1 ml was injected for every 10 g of mouse body weight.

[0234] (2) ANA-12 formulation (final concentration: 6 mg / kg): Dissolve 1.2 mg ANA12 (MedChemExpress, HY-12497) in 100 μl dimethyl sulfoxide (DMSO) solution (Sigma-Aldrich, D2447), add 900 μl corn oil (ABCONE, C67366), shake until no precipitation, store at -20°C, and use within one week. Inject 0.1 ml for every 20 g of mouse body weight.

[0235] (3) VPA formulation (final concentration: 50 mg / kg): 10 mg valproic acid (Valproic Acid, TargetMol, T7064) was dissolved in 100 μl dimethyl sulfoxide (DMSO) solution (Sigma-Aldrich, D2447), and then 900 μl corn oil (ABCONE, C67366) was added. The mixture was shaken until no precipitation was observed, and stored at -20°C. It was used within one week. 0.1 ml was injected for every 20 g of mouse body weight.

[0236] (4) pY816 formulation (final concentration: 20 mg / kg): 100 mg of pY816 or control peptide (customized by GenScript) was added to 12.5 ml of phosphate-buffered saline (cellgro, 21-040-CVCa), shaken until no precipitation, stored at -20°C, and used within one week. 0.1 ml was injected for every 20 g of mouse body weight.

[0237] The reagent formulas for electrophysiological experiments are as follows:

[0238]

[0239]

[0240] The inhibitors and drugs required for electrophysiological experiments are as follows:

[0241]

[0242] 1.4. Experimental instruments and software

[0243]

[0244]

[0245] 2. Experimental Methods

[0246] 2.1 Mouse gene identification

[0247] Using the alkaline lysis method, add 200 μl of mouse tail lysis buffer and 2 μl of Proteinase K (20 mg / mL) to about 2 mm of mouse tissue (toe or tail), mix thoroughly, and place in a 56°C oven for digestion for 6 hours or overnight. Then place in a metal bath at 95°C to inactivate proteinase K and store at 4°C.

[0248] A 2X Taq PCR Master Mix kit (Tiangen, KT211) was used: 7 μl 2X Taq PCR Master Mix; 0.5 μl of each F-terminal and R-terminal primers; 5 μl ddH2O; 1 μl of template; and a total volume of 14 μl.

[0249] Identification procedure: 95°C, 3 min; 95°C, 30 s, 58°C, 30 s, 72°C, 30 s, steps 2-4 were cycled 35 times; 72°C, 7 min; 10°C, ∞.

[0250] Primer information is as follows:

[0251] Cdkl5-F:CCACCCTCTCAGTAAGGCAG

[0252] Cdkl5-R:GTCCTTTGCCACTCAATTCCATCC

[0253] Emx1-F:GCAAGAACCTGATGGACATGTTCAG

[0254] Emx1-R:GCAATTTCGGCTATACGTAACAGGG

[0255] iCre-F:TGCCCAAGAAGAAGAGGAA

[0256] iCre-R:TTGCAGGTACAGGAGGTAGTC

[0257] creER-F:GACAGGCAGGCCTTCTCTGAA

[0258] creER-R:CTTCTCCACACCAGCTGTGGA

[0259] TrkB-F:ATGTCGCCCTGGCTGAAGTG

[0260] TrkB-R:ACTGACATCCGTAAGCCAGT

[0261] 2.2. Video observation

[0262] Cdkl5 fl / Y;Emx1-Cre and Cdkl5 fl / Y ; CaMK2α-iCre mice start from adulthood, Cdkl5 fl / Y The CaMK2α-CreER mice were monitored by video after tamoxifen injection. The mice were observed and recorded under single-blind conditions. The observed seizure number, time and seizure grade were recorded. The mice were monitored for 1 hour every day (5 days a week). fl / Y ;TrkB;Cam2α-CreER mice and their control group were continuously video recorded for 24 hours. The epileptic seizures of mice were graded according to the Racine criteria: Grade 1, tremors of whiskers and face; Grade 2, obvious nodding movements; Grade 3, unilateral forelimb spasms, tail erection; Grade 4, forelimb spasms, obvious myotonia; Grade 5, loss of limb control, tonic clonus, convulsions. Because grade 1 and grade 2 epileptic seizures are very mild and can be easily overlooked during the video recording, only grade 3 or higher epileptic seizures were considered spontaneous epileptic seizures in our study (Racine, 1972)

[0263] When Cdkl5 fl / Y ; The epileptic seizures of CaMK2α-CreER mice entered a stable period, and the seizure frequency was stable (more than one seizure every three hours in the 24-hour video recording, and the intensity and interval of the seizures were similar), and pharmacological experiments could be performed. Video recording was performed 12 hours before and after the injection of control corn oil (ABCONE, C67366), TrkB antagonist ANA12 (MedChemExpress, HY-12497) or classic anti-epileptic drug VPA (TargetMol, T7064). The anti-epileptic effect was evaluated by counting the number of systemic seizure events before and after the injection. Each mouse was given more than one dosing experiment and the average was taken. Each pharmacological experiment was separated by more than 2 days.

[0264] 2.3 EEG and EMG recording

[0265] The mouse head was fixed to a stereotaxic instrument, the skull was exposed, two small holes were polished at the electrode implantation point, the EEG electrode was screwed into the small hole, and fixed to the skull with dental cement. The EMG electrode was inserted into the trapezius muscle with forceps. After 3 days of surgery, the adaptation was recorded for 2 consecutive days. EEG and EMG were recorded for freely moving mice, and the frequency of acquisition was 1kHz using Spike2 software (CED Ltd., Micro1401mkⅡ).

[0266] 2.4 Protein extraction and immunoblotting

[0267] After the mouse was anesthetized with isoflurane (Sigma, 1349003), the head was removed and the skull was separated to expose the brain tissue. The brain was removed with tweezers and washed in pre-cooled saline. After the tissue was cut in half with a blade, the brain, hippocampus, striatum, cerebellum and other tissues were separated with a seahorse spoon, placed in a 2ml centrifuge tube, and magnetic beads and the corresponding volume of RIPA strong protein lysis solution were added. Grind for one minute in a fast grinder (Shanghai Jingxin Experimental Equipment Technology Department, JX-FSTPRP) at a frequency of 60Hz, and then placed in ice for 1 hour for full lysis. After that, the EP tube was transferred to a pre-cooled 4°C centrifuge and centrifuged at 14,000g for 25 minutes, and the supernatant was aspirated into a new centrifuge tube.

[0268] Protein content was determined using a BCA protein quantification kit (Tiangen, PA115). Prepare BCA working solution, mix reagents A and B at a volume ratio of 50:1; dilute the BSA standard with a solution of the same buffer system as the sample, and dilute the sample 5-10 times; use a 96-well plate, each well contains 25μl of diluted sample or BSA standard and 200μl of BCA working solution, mix thoroughly, cover and place in a 37°C oven for 30 minutes; after 30 minutes, use an ELISA reader (Molecular Devices) to detect the absorbance at 562nm; calculate the protein concentration of the sample based on the standard curve.

[0269] Use protein loading buffer to adjust the sample concentration and heat at 80℃ for 7 minutes. Prepare the electrophoresis device with SDS-PAGE gel plate in advance (VE-180 vertical electrophoresis tank, Shanghai Tianneng Technology Co., Ltd., China) and add 1X electrophoresis solution. Then add the cooked protein sample to the lane of the gel plate in sequence with a pipette. The parameters of electrophoresis are: constant voltage 80V for 30 minutes in the first stage; constant voltage 110V for 100 minutes in the second stage. Use PageRuler for electrophoresis reference standard TMPlusPrestained Protein Ladder (Thermo Scientific, 26619). After the electrophoresis, the protein was transferred to the PVDF membrane using a constant current mode of 350 mA for 3 hours. According to the properties of the protein, skim milk powder (Yili) or BSA (aladdin, B265991) was added to TBST buffer to prepare a 5% blocking solution, which was blocked at room temperature for 1 hour. After blocking, the corresponding protein primary antibody was diluted in the blocking solution and incubated overnight at 4°C. The membrane was washed three times on the bed at room temperature using TBST buffer for 5-7 minutes each time. After the membrane was washed, the corresponding protein secondary antibody was dissolved in the blocking solution and incubated at room temperature for 1-2 hours. After the incubation, the membrane was washed three times and exposed using Pro-Light HRP chemiluminescent detection reagent (Tiangen, PA112) in a chemiluminescent imager (AnalytikJena AG).

[0270] 2.5 Tissue RNA extraction and reverse transcription

[0271] Use surgical instruments treated with DEPC (Acmec, D21980) to dissect the corresponding brain tissue and place it in a 2ml centrifuge tube. Add 1ml of Trizol (Invitrogen, 15596026) to the centrifuge tube and grind it at 60Hz for one minute in a fast grinder. Add 200μl of chloroform (Sigma, 1601383), shake vigorously 15 times, let stand at room temperature for 10 minutes, centrifuge at 12,000g for 15 minutes, and get a three-layer sample. Take the upper transparent phase to a new centrifuge tube, add 500μl of isopropanol (Sigma, W292907), shake up and down and let stand for 10 minutes, centrifuge at 12,000g for 10 minutes, discard the supernatant, and get a white precipitate. Wash with 1ml of 75% anhydrous ethanol, centrifuge at 7,500g for 5 minutes, remove the supernatant and invert the centrifuge tube to dry for 1 hour. Then, add 20-50μl DEPC water, heat at 56℃ to dissolve, and use Nanodrop 2000 ultra-micro spectrophotometer (ThermoScientific) for nucleic acid quantification. After quantification, use iScript cDNA Synthesis kit (Bio-Rad, 1708891) for reverse transcription, take 1μg of mRNA and quantify it to 15μl, add 4μl of 5x iScript Reaction MixBuffer and 1μl of iScript reverse transcriptase, mix well, and reverse transcription program is 25℃, 5 minutes; 42℃, 30 minutes; 85℃, 5 minutes; then maintain at 10℃. After reverse transcription, store the sample at -80℃.

[0272] 2.6 Real-time fluorescence quantitative PCR

[0273] use RT-PCR reaction was performed using RNA Master SYBR Green I kit (Roche, 03064760001). The reaction system was 10 μL SYBR Green Mix, 1 μl primer, 2 μl cDNA template, 6 μl ddH2O, and the total volume was 20 μl. The reaction procedure was 95°C, 5 min; 95°C, 10 s, 60°C, 20 s, 72°C, 20 s, and the second to fourth steps were cycled 40 times; 95°C, 5 s; 65°C, 1 min.

[0274] Primer information is as follows:

[0275] BDNF-F:AGGTCTGACGACGACATCACT

[0276] BDNF-R:CTTCGTTGGGCCGAACCTT

[0277] GAPDH-F:ATCCCAGAGCTGAACGGGAAGC

[0278] GAPDH-R:TTGGGGGTAGGAACACGGAAGG

[0279] After the reaction is completed, the amplification curve and melting curve of RT-PCR are confirmed, analyzed and calculated.

[0280] 2.7 Golgi staining

[0281] Golgi staining was performed using the FD Rapid GolgiStainTMKit (FD NeuroTechnologies, PK401). After anesthetizing the mouse, open the chest cavity and expose the heart. Use a syringe to inject the PBS solution from the left ventricle and out of the right atrium until the lungs and liver turn white. Cut off the head with scissors to expose the skull, and use the tip of the scissors to gently slide along the exposed inner surface of the bone from the cerebellum to the olfactory bulb, peel off the brain, and quickly remove the complete brain tissue. Add the AB mixture that was pre-mixed 24 hours ago, incubate at room temperature in the dark for one day, replace the AB mixture again, and continue to incubate at room temperature in the dark for 14 days. After 14 days, replace it with C solution, replace C solution once after 1 day of incubation, and continue incubation for 3 days. Slice after 3 days. The brain was embedded in 3% agar (ASONE, CC-5166-03) in a coronal section, placed in a refrigerator for cooling, and fixed to a vibrating microtome (Leica, VT1200s) with 502 adhesive for slicing. The slicing parameters were as follows: speed, 0.5-0.7 mm / s; amplitude, 1 mm; brain slice thickness, 150 μm; continuous collection. The brain slices were attached to gelatin-coated slides and dried in the dark for more than 3 days before staining. The slides were first placed in double distilled water twice for 4 minutes each time; then the slides were placed in a staining mixture for 10 minutes. The staining mixture contained Solution D, Solution E and double distilled water in a ratio of 1:1:1; the slides were placed in double distilled water for two 4-minute washes before entering the dehydration process. Place the slides in 50% ethanol, 75% ethanol, 95% ethanol, and anhydrous ethanol solutions for dehydration step by step, 4 minutes each time, and repeat the anhydrous ethanol solution four times, then place the slides in xylene solution (Acmec, X31920) for fixation for 4 minutes, and repeat the fixation step three times. Use neutral resin to seal the slides and store in the dark.

[0282] 2.8 TUNEL staining

[0283] After the mice were anesthetized, the chest cavity was opened to expose the heart. The perfusion solution was infused from the left ventricle and out of the right atrium using a perfusion needle. PBS was first perfused until the lungs and liver turned white, then 4% paraformaldehyde (Acmec, P35120) was changed to continue the perfusion. After the perfusion was completed, the mice were in a state of rigidity. The head was cut off with scissors, the skin was cut to expose the skull, and the tip of the scissors was gently slid along the exposed inner surface of the bone from the cerebellum to the olfactory bulb to peel off the brain. The brain was taken out and soaked in 10ml 4% paraformaldehyde fixative for 24h, and placed in a gradient dehydration of 10%, 20%, and 30% sucrose solution. The slicer was cooled to a suitable temperature, the bottom of the brain was flattened, the excess liquid was absorbed with filter paper, and it was placed in an embedding tank, and an appropriate amount of OCT embedding agent (Servicebio, G6059) was added to submerge the tissue, and it was placed on a quick freezing table and frozen for 30 minutes. After removal, apply embedding agent to the slice base, fix the brain tissue, and place it in a quick freezer for 30 minutes. Place the frozen brain tissue on the slicer holder and flatten the tissue. Adjust the anti-roll plate to the appropriate position and start slicing. Set the thickness of the brain slice to 40μm and collect the brain slice in PBS solution. Wash it twice with PBS, 10 minutes each time, attach the brain slice to a gelatin-coated slide, and dry it.

[0284] Wash twice with PBS, 10 minutes each time, add PBS containing 0.1% Triton X-100, and incubate in an ice bath for 2 minutes. Incubate at room temperature for 20 minutes with 0.3% hydrogen peroxide solution (Sigma, SML0790) prepared in methanol to inactivate endogenous peroxidase in the slices, and wash 3 times with PBS, 10 minutes each time. Use the colorimetric TUNEL Apoptosis Assay Kit (Colorimetric TUNEL Apoptosis Assay Kit, Biyuntian, C1098) for staining, prepare the biotin labeling working solution according to the ratio of TdT enzyme: Biotin-dUTP: biotin labeling solution = 2:48:50, and mix thoroughly. Add 50μl of biotin labeling working solution to the brain slice, incubate at 37℃ for one hour, and wash once with PBS. Keep it moist during incubation to minimize the evaporation of the working solution. Add 0.3ml of labeling reaction termination solution, incubate at room temperature for 10 minutes, and wash once with PBS. Add 50μl Streptavidin-HRP working solution to the sample, incubate at room temperature for 30 minutes, and wash three times with PBS. Add 0.5ml DAB colorimetric solution, incubate at room temperature for 30 minutes, and wash three times with PBS. Use hematoxylin staining solution to stain the nuclei and wash three times with PBS. Dehydrate the brain slices with 95% ethanol, change to 100% ethanol for dehydration twice, and finally use xylene twice. All operations take 5 minutes each time, and then seal the slices for observation. Positive samples are prepared using the TUNEL detection positive control preparation kit (Biyuntian, C1082). Add 1μl DNase I to 100μl 1XReaction Buffer, mix well, add to the sample, incubate at room temperature for 10 minutes, and wash three times with PBS. Observe the degree of cell apoptosis using an Olympus VS120 microscope.

[0285] 2.9 Image Acquisition and Processing

[0286] Golgi staining image data were collected by Nikon A1 laser scanning microscope or Nikon A1R laser scanning microscope with 60x oil objective, pixel resolution of 1024x 1024, and acquisition at 1μm intervals. Image processing was performed using ImageJ software, and all data analysis was performed in a "single-blind" manner. Dendritic spine density was calculated by dividing the total number of dendritic spines by the length of the dendritic shaft. The proportion of each dendritic spine subtype was calculated as the percentage of the total dendritic spines on the dendritic segment.

[0287] 2.10 Preparation of brain slices for electrophysiology

[0288] Mice were anesthetized with isoflurane (Sigma, 1349003). After opening the chest, a small incision was made in the right atrium, and perfusion was performed using a syringe from the left ventricle near the apex. The perfusion fluid used was pre-cooled oxygenated (95% O2 + 5% CO2) slice fluid until the lungs and liver turned white. The brain tissue was quickly peeled off and placed in pre-oxygenated pre-cooled slice fluid for cooling. The brain tissue was cut into 300 μm coronal slices using a vibrating slicer (Leica, VT1200S) with continuous oxygenated pre-cooled slice fluid, mainly retaining the hippocampus. The cut brain slices were transferred to 32°C continuously oxygenated slice fluid for incubation for 12 minutes. At this time, the brain slices can be divided into two halves along the sagittal plane. Then they were transferred to 25°C repair HEPES artificial cerebrospinal fluid for incubation for at least one hour, and electrophysiological recordings can be performed after one hour. The brain slices can be maintained for 7-8 hours and must always be in oxygen-saturated repair HEPES artificial cerebrospinal fluid. During the recording process, the brain slices were perfused with oxygen-saturated artificial cerebrospinal fluid at a rate greater than or equal to 2 ml / min.

[0289] 2.11 Whole-cell recording

[0290] Whole-cell recording experiments were performed in 300 μm coronal slices. Glass electrodes with fiber filaments (Sutter, BF150-86) were pulled using an electrode puller (Sutter, P-97) with a resistance of 4-8 MΩ. Cesium or potassium internal solution was added to the tip of the glass electrode as needed to ensure that there were no bubbles at the tip of the electrode. Cells were observed using an FN1 microscope (Nikon) and a 40x water immersion objective. After forming a high-resistance seal between the glass electrode and the neuron, wait for 1-2 minutes to reduce the leakage current to less than 20 pA, then aspirate and rupture the cell, and record the membrane rupture parameters in the Membrane test mode. Series resistance compensation was performed using the Rs compensation module of the MultiClamp 700B amplifier (Axon CNS, Molecular Devices). The signal was acquired using a Digidata 1440A digital-to-analog converter (Molecular Devices) with a sampling frequency of 10 kHz and a 2 kHz filter.

[0291] During the recording of sEPSC, artificial cerebrospinal fluid containing Picrotoxin (Tocris, 1128) was used for perfusion; during the recording of mEPSC, artificial cerebrospinal fluid containing Picrotoxin (Tocris, 1128) and Tetrodotoxin (Tocris, 1078) was used for perfusion; during the recording of sIPSC, artificial cerebrospinal fluid containing D-AP5 (Tocris, 0106) and CNQX (Tocris, 1045) was used for perfusion; during the recording of mIPSC, artificial brain containing D-AP5 (Tocris, 0106), CNQX (Tocris, 1045) and Tetrodotoxin (Tocris, 1078) was used for perfusion. The rats were perfused with artificial cerebrospinal fluid; during the recording of resting membrane potential and basal current, artificial cerebrospinal fluid containing Picrotoxin (Tocris, 1128) was used for perfusion; during the endocannabinoid receptor sensitivity test, artificial cerebrospinal fluid containing Picrotoxin (Tocris, 1128) was used for perfusion; when conducting the AMPA receptor-mediated EPSC current-voltage correlation experiment, artificial cerebrospinal fluid containing Picrotoxin (Tocris, 1128) was used for perfusion; when conducting the BDNF-TrkB signaling pathway inhibition experiment, artificial cerebrospinal fluid with K252a (CST, 12754S) or ANA-12 (MedChemExpress, HY-12497) added to the original fluid was used for perfusion

[0292] 2.12 Data Analysis and Statistics

[0293] All statistical values ​​in the figures and texts are expressed as mean ± SEM. N is the number of mice unless otherwise specified. Statistical tests were performed using GraphPad Prism 7. Electrophysiological data analysis was performed in Clampfit10.4 or Mini Analysis Program. Unpaired Student's t-test or paired Student's t-test was used to test the significance of differences between two groups; one-way ANOVA and Tukey's post-test were used to analyze the significance of differences between multiple groups; two-way ANOVA and Bonferroni post-test were used to analyze the morphological categories of dendritic spines in multiple groups. Statistical data with statistical significance are indicated as follows: *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0294] Example 1 Spontaneous epilepsy phenotype can be observed in mice with CDKL5 knockout in forebrain excitatory neurons

[0295] In order to simulate the symptoms of patients with CDKL5 deficiency and conduct basic research on CDKL5 deficiency, researchers have constructed a variety of CDD mouse models since the discovery of the CDKL5 gene, mainly including Cdkl5 knockout mice, point mutation mice that simulate patients, and conditional knockout mice. These mouse models have proven that CDKL5 is essential in neurological functions such as movement, learning and memory, and social interaction, but the core clinical symptom of CDD patients, spontaneous epilepsy, has not been reproduced. The conditional knockout mouse model (Conditional knockout, referred to as cKO), can knock out the target gene at a specific time or tissue-specifically to meet the specific needs of researchers and conduct more targeted research. The most common one is the Cre / Loxp system. We hybridized Emx1-ires-Cre and CaMK2α-iCre tool mice with Cdkl5-flox mice. Among them, Cdkl5-flox mice have flox sequences inserted in the same direction on both sides of exon 6 of Cdkl5; Emx1-cre tool mice express Cre recombinase in excitatory neurons in the cortex and hippocampus, and glial cells in the globus pallidus from embryonic stage E10.5; CaMK2α-iCre tool mice express Cre recombinase in glutamatergic excitatory neurons in the forebrain after birth. Through immunoblotting experiments, we found that Cdkl5 fl / Y ;Emx1-Cre and Cdkl5 fl / YThe expression level of CDKL5 in the cerebral cortex and hippocampus of CaMK2α-iCre mice was significantly decreased, but only in Cdkl5 fl / Y ; A decrease in CDKL5 expression level was observed in the striatum of CaMK2α-iCre mice ( Figure 4 A, Figure 5 A).

[0296] To investigate whether these two conditional knockout mouse strains have spontaneous epilepsy, we fl / Y ;Emx1-Cre and Cdkl5 fl / Y ;CaMK2α-iCre mice were recorded. We observed epileptic activity according to the Racine epilepsy scale. Because grade 1 and 2 seizures are mild and can be easily overlooked during recording, only grade 3 or higher seizures were considered spontaneous seizures in our study. We found that starting from 2 months of age, Cdkl5 fl / Y ; Some mice of the Emx1-Cre strain will have spontaneous grand mal seizures; at 3 months of age, about 50% of the mice can be observed to have epileptic seizures; and Cdkl5 fl / Y ; Some CaMK2α-iCre mice began to experience spontaneous grand mal seizures at 7 weeks of age, and about 50% of mice were observed to have seizures at 3 months of age. Similar to the clinical phenotype of CDD patients, this spontaneous epilepsy started with mild to moderate clonus and forelimb tremor in the early stage, and gradually developed into a high-grade generalized seizure ( Figure 4 C, Figure 5 C).

[0297] At the same time, we also observed that some mice were overly sensitive to vibration, touch, and sound, which is very similar to the clinical signs of irritability in CDD patients. We also observed the physiological indicators of spontaneous epilepsy by recording the electroencephalogram (EEG) and electromyography (EMG) of mice. We can observe that Cdkl5 fl / Y ;Emx1-Cre mice and Cdkl5 fl / Y ; CaMK2α-iCre mice have abnormal power generation during epileptic seizures that is different from that of the control group and normal physiological conditions ( Figure 4 B, Figure 5B). At the same time, similar to the situation of CDD patients, spontaneous epileptic seizures can seriously affect the life span of mice. Both strains of mice can be observed to have severe spontaneous epileptic seizures leading to sudden death in epilepsy. This phenomenon may occur in the early life of CDD model mice (2-3 months old). Some mice also suffer from frequent spontaneous epilepsy, which leads to physical dysfunction, inability to move and eat, and eventually death. At 6-7 months of age, Cdkl5 fl / Y ;Emx1-Cre and Cdkl5 fl / Y ; About 70% of CaMK2α-iCre mice died ( Figure 4 D, Figure 5 D).

[0298] The above results show that knocking out Cdkl5 in the excitatory neurons of the mouse forebrain will cause spontaneous epileptic seizures in this strain of mice. At the same time, some other symptoms similar to those of clinical CDD patients, such as irritability, sudden death in epilepsy, and affected life span can be observed. These phenomena indicate that forebrain excitatory neurons play a key role in the occurrence of CDD-related epilepsy, and the conditional knockout mouse model in which Cdkl5 is knocked out in forebrain excitatory neurons can well simulate the epileptic phenotype of CDD patients.

[0299] Example 2: Imbalance of excitation and inhibition in the hippocampal dentate gyrus of forebrain excitatory neurons in Cdk15 knockout mice

[0300] The dentate gyrus receives its main input from the entorhinal cortex through the perforant path with glutamate synapses, and its molecular layer granule cell proximal dendrites form synapses with perforant path axons. Subsequently, granule cells project to the CA3 region via mossy fibers, which terminate on pyramidal neurons of CA3. Under physiological conditions, there are few direct interconnections between granule cells. In addition, granule cells themselves have a high resting membrane potential and strong GABA receptor-mediated inhibition, which makes them considered to be shock absorbers between the entorhinal cortex and CA3. When the dentate gyrus is abnormal, it will cause an imbalance in the excitatory / inhibitory state of the hippocampal circuit and induce epilepsy. Therefore, it is also called the "detonator" of epilepsy and is of great significance in epilepsy. In order to detect whether there are abnormalities in synaptic transmission in the dentate gyrus of the hippocampus in Cdkl5 conditional knockout mice, we placed 3-month-old Cdkl5 mice in the dentate gyrus. fl / Y; The brains of Emx1-Cre mice were vibrated and whole-cell recordings were performed on the slices. We recorded the spontaneous excitatory postsynaptic current (sEPSC) and miniature excitatory postsynaptic current (mEPSC) of the mice and found that the frequency of the spontaneous excitatory postsynaptic current and miniature excitatory postsynaptic current was significantly increased compared with the control group, while the amplitude was not different ( Figure 6 , AF), indicating that knocking out CDKL5 protein in forebrain excitatory neurons leads to enhanced excitatory synaptic transmission in hippocampal dentate gyrus granule cells. Hyperexcitability of hippocampal circuits is considered to be closely related to epilepsy in various epilepsy models.

[0301] We also tested Cdkl5 fl / Y ; CaMK2α-iCre mice were used for whole-cell recording. We also found that the frequency of spontaneous excitatory postsynaptic current (sEPSC) and miniature excitatory postsynaptic current (mEPSC) of this strain of mice increased, but the amplitude did not differ, indicating an enhancement of excitatory synaptic transmission in the dentate gyrus ( Figure 7 , AF).

[0302] In addition, abnormalities in inhibitory neurons in the hippocampal circuit can also affect the excitatory / inhibitory balance of the circuit, so we also analyzed inhibitory synaptic transmission in the dentate gyrus. We observed that the amplitude of the miniature inhibitory postsynaptic current (mIPSC) of this strain of mice was significantly increased compared with the control group, but its frequency, as well as the frequency and amplitude of the spontaneous inhibitory postsynaptic current (sIPSC) did not change ( Figure 8 , AF), which indicates that the knockout of Cdkl5 in forebrain excitatory neurons also affects its inhibitory synaptic transmission, and may be a compensatory phenomenon for the enhanced excitatory synaptic transmission. The hippocampal circuit presents an excitatory / inhibitory imbalance phenotype, which appears in a variety of epilepsy models and also exists in other Cdkl5 knockout models. This shows that forebrain excitatory neurons are the key cell type for CDD-related epilepsy, and their Cdkl5 knockout will enhance the excitatory synaptic transmission in the dentate gyrus, breaking the balance of excitatory / inhibitory synaptic transmission in the hippocampal circuit, which may be the circuit basis for the spontaneous epileptic seizures in these two Cdkl5 conditional knockout mouse strains.

[0303] Example 3 Tamoxifen-induced Cdk15 fl / Y ; Spontaneous epilepsy phenotype can be observed in CaMK2α-CreER mice

[0304] CDKL5 not only plays an important role in the development of the nervous system, but also maintains a high expression level in adulthood. Studies have shown that restoring knocked-out Cdkl5 in adulthood can greatly improve the impaired cognitive function of mouse models, indicating that CDKL5 also plays an important role in neural maturation. But is CDKL5 protein in neural maturation also critical for its spontaneous epilepsy phenotype? To this end, we used the tamoxifen-induced expression of the creER / loxp system to knock out Cdkl5. flox / flox Female mice were combined with Camk2a-CreER male mice to obtain Cdkl5 fl / Y ;CaMK2α-CreER mice were injected with tamoxifen for 5 consecutive days at 2 months of age (the control group received corn oil), and the knockout was verified 7 days after the injection. Using this system, we were able to knock out Cdkl5 in the excitatory neurons of the forebrain in adulthood. As shown in the figure, 7 days after the tamoxifen injection, the expression level of CDKL5 protein in the cerebral cortex and hippocampus was significantly decreased compared with the control group, and the CDKL5 protein level in the striatum and cerebellum was consistent with the control group. Two control groups, including Cdkl5 injected with tamoxifen flox / Y Mouse group and Cdkl5 injected with corn oil fl / Y ; There was no difference in CDKL5 protein levels in the cerebral cortex, hippocampus, striatum, and cerebellum in the CaMK2α-CreER mouse group ( Fig. 9 A).

[0305] To investigate whether knocking out CDKL5 protein in forebrain excitatory neurons in adulthood would cause spontaneous epilepsy in mice, we performed video recordings of this strain of mice. We found that 50% of the Cdkl5 fl / Y ; CaMK2α-CreER mice developed spontaneous epilepsy phenotypes, and after 8 weeks, 100% of the mice developed spontaneous epilepsy phenotypes ( Fig. 9 C). In the previous nonspecific heterozygous model and conditional knockout model, spontaneous epilepsy was observed only after knockout for more than 2 months. We observed Cdkl5 fl / Y ;Emx1-Cre and Cdkl5 fl / Y ; Similar synchronized discharge signals of EEG and EMG during spontaneous epileptic seizures in CaMK2α-iCre mice ( Fig. 9 B). At the same time, Cdkl5 fl / Y; CaMK2α-CreER mice also showed a high mortality rate, with 80% of the mice dying within 3 months after the injection ( Fig. 9 D), while similar lethality in conditional knockout mice requires more than 6 months. fl / Y ;Emx1-Cre and Cdkl5 fl / Y ; Similar to CaMK2α-iCre mice, Cdkl5 fl / Y The causes of death of CaMK2αCreER mice included sudden death due to epilepsy and physical dysfunction. flox / Y Mouse group and Cdkl5 injected with corn oil fl / Y ; No abnormal behavior, synchronized discharges or abnormal deaths were observed in the CaMK2α-CreER mouse group. The above results show that CDD-related spontaneous epilepsy is closely related to the functional defects of CDKL5 during the neural maturation period. Before this, CDD has been considered to be a simple neurodevelopmental disease, and our results prove the criticality of CDKL5 protein to circuit excitability during neural maturation. The lack of CDKL5 protein during neural maturation can also induce circuit hyperexcitation and lead to epilepsy. Therefore, the study of CDD-related epilepsy should not only consider its neural development stage, but also its functional disorders during neural maturation.

[0306] Example 4 Tamoxifen-induced Cdk15 fl / Y ; Enhanced excitatory synaptic transmission in CaMK2α-CreER mice

[0307] The tamoxifen-induced adult Cdkl5 knockout mouse model has the advantages of short onset latency (two weeks of action) and high spontaneous epileptic seizure rate (100% seizure rate), so it can well simulate the patient's seizure pattern and help study the mechanism of CDD-related epilepsy. As shown above, forebrain knockout of Cdkl5 will enhance the excitatory transmission of the hippocampal circuit, but it is still unknown whether knockout during neural maturation will still have a similar hyperexcitatory response. To further verify this possibility, we used Cdkl5 fl / Y ; CaMK2α-CreER mice were used as the subjects, and whole-cell recordings were performed on them one week after tamoxifen injection. At this time, CDKL5 in the forebrain tissue had been knocked out, but spontaneous epilepsy had not yet been observed.

[0308] We found that the frequency of spontaneous excitatory postsynaptic currents (sEPSCs) and miniature excitatory postsynaptic currents (mEPSCs) in mice was significantly higher than that in wild-type mice injected with tamoxifen and knockout control mice injected with corn oil, but the amplitudes of the three were not different ( Fig.10, AF), indicating that knocking out Cdkl5 in forebrain excitatory neurons during neural maturation enhances excitatory synaptic transmission in hippocampal dentate gyrus granule cells. This result is consistent with the spontaneous epilepsy mouse model in which Cdkl5 is knocked out during development. The above experimental results support that hyperexcitability of the hippocampal dentate gyrus circuit may be the common basis for CDD-related epilepsy.

[0309] Example 5 Tamoxifen-induced Cdk15 fl / Y The morphology of granule cells in the dentate gyrus of CaMK2α-CreER mice is normal

[0310] The density and morphology of dendritic spines are closely related to the excitability of the circuit. Their morphology is affected by many factors and is in a constant adjustment process. The morphological abnormalities of neuronal dendritic spines are an important part of epilepsy research. In different animal models, the morphological abnormalities of dendritic spines in multiple brain regions of the forebrain can be observed, including the cerebral cortex, the CA1 region of the hippocampus, and the dentate gyrus. Dendritic spines are the transmission sites of excitatory synapses, which can receive information and form synaptic connections, and are considered to be the basis of synaptic plasticity. In drug-induced epileptic seizure models, an increase in the total density of dendritic spines in the hippocampus and changes in the density of different types of dendritic spines can be observed. Dendritic spines include three morphologies: thin, mushroom, and stubby. The thin type is considered to be an immature state, while the stubby and mushroom types are mature. Dendritic spine density analysis is widely used in neuroscience research and is an important means to evaluate the functional plasticity of synapses in the central nervous system. Through Golgi staining, using the silver-loving properties of nerve cells, we can well record the morphology of neurons and the various types of dendritic spines. Although the number of dendritic spines is not directly equivalent to the number of synaptic activities, the analysis of dendritic spine density and type can be used to evaluate the strength of synaptic connections and changes in synaptic plasticity.

[0311] To explore the possible relationship between CDD-related epilepsy and the density and morphology of dendritic spines in the dentate gyrus of the hippocampus, we performed Golgi staining and dendritic spine density analysis in adult Cdkl5 knockout mice. fl / Y Dendritic spine density and Cdkl5 in the CaMK2α-CreER tamoxifen-injected group fl / Y ; CaMK2α-CreER corn oil injection group, Cdkl5 fl / Y There was no difference in the tamoxifen group ( Fig.11 A, B). At the same time, Cdkl5 fl / Y ; There was no difference in the type ratio between the CaMK2α-CreER tamoxifen injection group and the control group ( Fig.11A, C), indicating that knockout of Cdkl5 in forebrain excitatory neurons in adulthood does not cause significant changes in the density and maturation of dendritic spines in the dentate gyrus of the hippocampus, confirming that there is no direct link between CDD-related epilepsy and changes in dendritic spine morphology.

[0312] Example 6 Abnormal activation of the hippocampal BDNF-TrkB signaling pathway is the key to enhancing excitatory synaptic transmission in the dentate gyrus of the hippocampus

[0313] Brain-derived neurotrophic factor (BDNF) and its receptor TrkB are widely expressed in the central nervous system, and their signal transduction is crucial for the survival, morphogenesis, and plasticity of neurons. BDNF not only mediates the release of presynaptic transmitters, but also mediates the insertion of postsynaptic receptors, the distribution of dendrites and synapses, etc. The BDNF-TrkB signaling pathway is believed to be associated with a variety of diseases such as epilepsy and depression. When different pathological factors promote the upregulation of BDNF, BDNF affects synaptic transmission and changes the morphological characteristics of neurons, leading to excessive excitation of the hippocampal circuit, and this abnormal excitation in turn promotes the increase in BDNF expression levels, forming a pathological positive feedback. .

[0314] These reasons prompted us to investigate whether the BDNF-TrkB signaling pathway is involved in the circuit hyperexcitability induced by tamoxifen in Cdkl5 knockout mice. fl / Y ; BDNF expression levels in the hippocampus of mice in the CaMK2α-CreER tamoxifen injection group and the control group. Through immunoblotting and real-time fluorescence quantitative PCR (qRT-PCR) analysis, we found that Cdkl5 fl / Y ; The BDNF protein level and BDNF mRNA level in the hippocampus of the CaMK2α-CreER tamoxifen injection group were significantly higher than those of the Cdkl5 fl / Y ; CaMK2αCreER corn oil injection group and Cdkl5 fl / Y Tamoxifen injection group ( Fig.12 AC), suggesting that knocking out Cdkl5 in adulthood would lead to increased BDNF expression levels. We also performed immunoblotting experiments on the phosphorylation levels of the BDNF-TrkB downstream pathway. We found that the p-TrkB 707 site (Tyr707) was significantly increased compared with the control group mice, and the p-TrkB816 site (Tyr 816) and p-ERK1 / 2 also showed an increasing trend. At the same time, no differences were observed in the p-TrkB 516 site (Tyr516), p-Akt (Ser 473), p-GSK3β, p-CREB, p-mTOR (Ser 2448) and p-4EBP compared with the control group ( Fig.12DE). These data demonstrate that tamoxifen-induced Cdkl5 knockout leads to abnormal activation of the hippocampal BDNF / TrkB signaling pathway, but is this abnormal activation related to the hyperexcitability of the hippocampal circuit?

[0315] To test this hypothesis, we used the Trk receptor inhibitor K252a to verify whether blocking the BDNF-TrkB signaling pathway could rescue the enhanced excitatory synaptic transmission in the circuit caused by tamoxifen-induced Cdkl5 knockout. By whole-cell recording experiments, we found that incubation with the Trk receptor inhibitor K252a could inhibit the expression of Cdkl5. fl / Y The frequencies of spontaneous excitatory postsynaptic currents (sEPSCs) and miniature excitatory postsynaptic currents (mEPSCs) in granule cells of the dentate gyrus of the hippocampus in the CaMK2α-CreER tamoxifen injection group decreased to normal levels, while their amplitudes were similar to those of Cdkl5 fl / Y Tamoxifen injection group and Cdkl5 fl / Y ; There was no difference between the two control groups in the CaMK2αCreER corn oil injection group ( Fig.13 , AF). The above experimental results show that the Trk receptor inhibitor K252a can effectively rescue the increase in sEPSC / mEPSC frequency caused by Cdkl5 knockout without affecting the excitatory synaptic transmission of the control group, and improve the enhanced excitatory synaptic transmission of the dentate gyrus granule cells.

[0316] Given that K252a is a broad-spectrum Trk inhibitor and may interfere with the function of other neurotrophic factors, affecting the subsequent experimental design, we tested ANA-12, a specific antagonist of TrkB. We observed that ANA-12 had a similar effect to K252a and could induce Cdkl5 fl / Y The spontaneous excitatory postsynaptic current (sEPSC) and miniature excitatory postsynaptic current (mEPSC) frequencies of hippocampal dentate gyrus granule cells decreased in the CaMK2α-CreER tamoxifen injection group. The increase in sEPSC / mEPSC frequencies caused by Cdkl5 knockout could be restored to normal frequencies at a concentration of 10 μM, while the same concentration did not affect the excitatory synaptic transmission of the control group ( Fig.14 , AF). In the above experiments, the amplitudes of all groups were not affected by K252a or ANA-12. Given that our samples were collected earlier than the observed epileptic seizures, we believe that Cdkl5 fl / Y ; The increase in BDNF expression levels and overactivation of its signaling pathway in the CaMK2α-CreER tamoxifen injection group are key factors leading to enhanced excitatory synaptic transmission in the dentate gyrus of the hippocampus, and may be the key mechanism for the occurrence of CDD-related epilepsy.

[0317] Example 7 Inhibition of the BDNF-TrkB signaling pathway reduces epileptic activity in Cdkl5fl / Y;CaMK2α-CreER mice

[0318] Our previous studies found that Cdkl5 knockout in adulthood led to abnormal activation of the BDNF-TrkB signaling pathway, and this abnormal activation mediated the enhancement of excitatory synaptic activity in the dentate gyrus of the hippocampus. This series of experimental results provided sufficient endorsement for the hypothesis that targeting the BDNF-TrkB signaling pathway can reduce CDD-related epileptic activity.

[0319] To test this hypothesis, we flox / flox ;TrkB flox / + Female mice were mated with CaMK2α-CreER male mice to obtain Cdkl5 fl / Y ;TrkB flox / + ; CaMK2α-CreER mice, and injected tamoxifen for 5 consecutive days at 2 months of age. Western blot experiments showed that the expression level of CDKL5 protein in the cerebral cortex and hippocampus of this strain of mice was significantly decreased compared with the control group, which was different from Cdkl5 fl / Y ; CaMK2α-CreER mice; while the expression level of TrkB receptor in the cerebral cortex and hippocampus decreased by about 50% compared with the control group ( Fig.15 A, B). Through continuous monitoring by video recording, we found that all Cdkl5 fl / Y ; In the CaMK2α-CreER tamoxifen-injected mice, spontaneous epilepsy was observed 8 weeks after injection. However, in sharp contrast, Cdkl5 fl / Y ;TrkB flox / + ; Only one mouse in the CaMK2α-CreER tamoxifen injection group showed spontaneous epilepsy ( Fig.15 C, D), indicating that reducing the expression of TrkB receptors can effectively intervene in CDD-related epileptic activity.

[0320] Unlike basic research, in clinical practice, many CDD patients are not aware of their condition until epilepsy occurs. Therefore, it is more important to explore whether intervening in the BDNF-TrkB signaling pathway after a spontaneous epileptic seizure can reduce CDD-related epileptic activity. Previous studies have shown that continuous injection of ANA-12 can cause apoptosis of hippocampal cells, so we chose to use a single injection of ANA12 and determine the apoptosis of hippocampal cells by TUNEL staining. Experiments have shown that a single injection of ANA-12 does not cause apoptosis of hippocampal cells ( Fig.16 D) We monitored Cdkl5 fl / Y; The epileptic activity of mice in the CaMK2α-CreER tamoxifen injection group was stabilized when the frequency of epileptic activity was stabilized.

[0321] TrkB receptor antagonist ANA12 intervenes in the abnormal activation of the BDNF-TrkB signaling pathway by inhibiting TrkB receptor. We found that within 12 hours after injection, Cdkl5 fl / Y The frequency of epileptic activity in the mice injected with CaMK2α-CreER tamoxifen was significantly reduced compared with 12 hours before injection, and its anti-epileptic effect was comparable to that of the classic anti-epileptic drug valproic acid ( Fig.16 AC), indicating that inhibition of TrkB receptors after spontaneous epilepsy can also effectively reduce CDD-related epileptic activity, suggesting that the BDNF-TrkB signaling pathway can be an excellent target for the treatment of CDD-related epilepsy.

[0322] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A use of a BDNF-TrkB signaling pathway inhibitor, characterized in that: Used for preparing a composition or preparation for preventing and / or treating CDKL5 deficiency-related epilepsy.

2. The use according to claim 1, characterized in that The CDKL5 deficiency-related epilepsy has one or more phenotypic characteristics selected from the following group: (a) Spontaneous epilepsy phenotype; (b) Enhanced excitatory synaptic transmission in the dentate gyrus of the hippocampus; (c) abnormal upregulation of BDNF-TrkB signaling pathway in the hippocampus; (d) Patients’ epileptic seizures can develop into different types over time; (e) the patient's epilepsy phenotype is resistant to antiepileptic drugs; (f) The patient's electroencephalogram (EEG) during the seizure shows bilateral synchronous flat potentials followed by recurrent sharp waves and spikes, typical EEG findings that develop over time and are not evident in young children.

3. The use according to claim 1, characterized in that The composition or preparation is also used for one or more purposes selected from the following group: (i) Reduce epileptic activity associated with CDD.

4. The use according to claim 1, characterized in that The BDNF-TrkB signaling pathway inhibitor includes a TrkB antagonist.

5. The use according to claim 1, characterized in that The BDNF-TrkB signaling pathway inhibitor is selected from the group consisting of ANA-12, K252a, or a combination thereof.

6. A pharmaceutical composition for preventing and / or treating epilepsy associated with CDKL5 deficiency, characterized in that: include: (a1) a first pharmaceutical composition, the first pharmaceutical composition comprising (a) a first active ingredient, the first active ingredient being a BDNF-TrkB signaling pathway inhibitor; and (a2) an optional second pharmaceutical composition, wherein the second pharmaceutical composition contains (b) a second active ingredient, which is another drug that can prevent and / or treat epilepsy associated with CDKL5 deficiency; (b) a pharmaceutically acceptable carrier.

7. The pharmaceutical composition according to claim 6, characterized in that The BDNF-TrkB signaling pathway inhibitor includes a TrkB antagonist.

8. The pharmaceutical composition according to claim 6, characterized in that The BDNF-TrkB signaling pathway inhibitor is selected from the group consisting of ANA-12, K252a, or a combination thereof.

9. A medicine box, characterized in that: include: (a1) a first container, and a BDNF-TrkB signaling pathway inhibitor or a drug containing a BDNF-TrkB signaling pathway inhibitor in the first container; (a2) Optionally, a second container, and other drugs for preventing and / or treating epilepsy associated with CDKL5 deficiency located in the second container, or a drug containing other drugs for preventing and / or treating epilepsy associated with CDKL5 deficiency.

10. A use of a combination, characterized in that, The combination comprises a BDNF-TrkB signaling pathway inhibitor and optionally other drugs for preventing and / or treating CDKL5 deficiency-related epilepsy, and is used to prepare a pharmaceutical composition or a drug kit for preventing and / or treating CDKL5 deficiency-related epilepsy.

Images