Application of Sestrin2 inhibitor in prevention or treatment of altitude sickness

Abstract

The invention discloses application of a Sestrin2 inhibitor to preparation of a product for preventing and / or treating altitude sickness, and particularly relates to application of the Sestrin2 inhibitor to prevention and / or treatment of altitude heart diseases. Experiments show that the knockout Sestrin2 shows a good protection effect on right ventricular hypertrophy of mice in a simulated plateau low-pressure environment, has a potential value of being developed into drugs for preventing and treating altitude sickness (especially altitude heart diseases), and has important significance on researches such as prevention and / or treatment of the altitude sickness.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to an application of a Sestrin2 inhibitor in preventing and / or treating altitude sickness. Background Art

[0002] The air on the plateau is thin and the atmospheric pressure is low. The disease caused by the inability to adapt to the low-pressure environment of the plateau is called mountain sickness. People who migrate from the plains or stay in the plateau for a short period of time may suffer from mountain sickness. In recent years, with the improvement of plateau medical rescue methods, there has been great progress in the prevention and treatment of mountain sickness, but the real protective drugs have not been unanimously recognized. Therefore, the discovery of new preventive and therapeutic drugs has become an important task in plateau medical research.

[0003] Sestrin2 is a novel stress-induced protein that has been shown to have two important functions: the C-terminal domain inhibits rapamycin complex 1 (mTORC1) through the GATOR complex and plays a role in anti-oxidation and genotoxic stress, and the alkyl hydroperoxide reductase activity generated by the N-terminal domain prevents the accumulation of reactive oxygen species (ROS) to inhibit oxidative stress. Other studies have shown that Sestrin2 has functions such as promoting sqstm1-mediated autophagic degradation of KEAP1 and positively regulating the transcription of genes involved in oxidative stress response through NFE2L2.

[0004] It has been proven that Sestrin2 is associated with cancer, type 2 diabetes, and nervous system-related diseases. For example, the non-patent literature: Study on the role and mechanism of Sestrin2 protein in hypoxia-reoxygenation injury of rat cardiomyocytes (Liu Yingcun, Chongqing Medical University, 2020) discloses that in cardiomyocytes, after hypoxia / reoxygenation treatment, the expression of intracellular Sestrin2 protein increases. After silencing the expression of Sestrin2 protein with siRNA, it was found that cell apoptosis increased significantly, indicating that the presence of Sestrin2 protein causes less cell damage than when it is silenced, proving that Sestrin2 protein does play an endogenous protective role in hypoxia / reoxygenation-induced cardiomyocyte damage. Another example is the non-patent literature: Research progress of Sestrin2 in cardiovascular diseases (Jiang Zhilong, Jiang Yue, Zhang Youzhi. Journal of Chongqing Medical University, 2021, 46(02):138-141) which also proves the protective role of Sestrin2 in heart and vascular diseases. After phenylephrine stimulates cardiomyocyte hypertrophy, it downregulates the expression of Sestrin2. Overexpression of Sestrin2 protects cardiomyocytes from phenylephrine-induced hypertrophy changes by regulating the extracellular protease signaling pathway.

[0005] However, the present invention unexpectedly discovered that reducing the expression of Sestrin2 exhibits excellent effects on the treatment of altitude sickness, especially having a significant protective effect on right ventricular hypertrophy, right ventricular anterior wall thickening and increased right ventricular ejection fraction caused by the low-pressure environment of the plateau. This is of great significance for the study of the mechanism of action of Sestrin2, the treatment of altitude sickness and the development of drugs against altitude sickness. Summary of the invention

[0006] To fill the gap in the prior art, the present invention knocks out Sestrin2, reduces the right heart index, reduces the right ventricular anterior wall or reduces the right ventricular ejection fraction, thereby achieving a protective effect on right heart hypertrophy, thereby being used to prevent and / or treat altitude sickness. The specific scheme is as follows:

[0007] The first aspect of the present invention provides a use of a Sestrin2 inhibitor in the preparation of a product for preventing and / or treating altitude sickness.

[0008] The Sestrin2 inhibitors include reagents, nucleic acids, polypeptides, antibodies, proteins, small molecule compounds, traditional Chinese medicines or extracts thereof for knocking out or knocking down Sestrin2.

[0009] Preferably, the reagent for knocking out or knocking down Sestrin2 includes one or more of the reagents required for the CRISPR / Cas system, the reagents required for tissue-specific knockout, or the interfering RNA targeting Sestrin2.

[0010] Further preferably, the Cas protein used in the CRISPR / Cas system is selected from Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5d, Cas5t, Cas5h, Cas5a, Cas6, Cas7, Cas8, Cas9, Cas10, Csy1, Csy2, Csy3, Csy4, Cse1, Cse2, Cse3, Cse4, Cse5e, Csc1, Csc2, Csa5, Csn1, Csn2, Csm1, Csm2, Csm3, Csm4, Csm 5. Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx1S, Csf1, Csf2, CsO, Csf4, Csd1, Csd2, Cst1, Cst2, Csh1, Csh2, Csal, Csa2, Csa3, Csa4, Csa5, C2c1, C2c2, C2c3, Cpf1, CARF, DinG, homologs thereof or modified forms thereof.

[0011] Further preferably, the tissue-specific knockout includes but is not limited to the Cre / loxp recombinase system. The Cre / loxp recombinase system is a site-specific recombinase technology that can perform deletion, insertion, translocation and inversion at a specific site of DNA. This system can be used to modify DNA in cells for specific cell types or using specific external stimuli.

[0012] Further preferably, the interfering RNA includes one or more of siRNA, dsRNA, shRNA, aiRNA or miRNA (microRNA).

[0013] In the present invention, the Sestrin2 refers to stress-induced protein 2 or its encoding gene.

[0014] Preferably, the Sestrin2 inhibitor achieves the treatment and / or prevention of altitude sickness by inhibiting the expression, function or activity of Sestrin2.

[0015] The inhibiting of Sestrin2 expression includes inhibiting the mRNA expression level and / or protein expression level of Sestrin2.

[0016] The Sestrin2 inhibitor knocks out any one or more than two of exons 1-10 of the Sestrin2 gene. Preferably, the Sestrin2 inhibitor knocks out all or part of exons 1-10 of the Sestrin2 gene. Preferably, the Sestrin2 inhibitor knocks out exon 3 of the Sestrin2 gene and the subsequent coding sequence.

[0017] In some embodiments, the Sestrin2 inhibitor knocks out exon 3-6, exon 3-7, exon 3-8, exon 3-9, or exon 3-10 of Sestrin2.

[0018] Preferably, the knockout comprises knocking out using a gRNA targeting Sestrin2.

[0019] Further preferably, the number of gRNAs is one or more.

[0020] Preferably, there are two gRNAs, one of which targets exon 3 of Sestrin2 or an intron adjacent to the upstream of exon 3, and the other targets exons 6-10 of Sestrin2 or introns therebetween.

[0021] In some embodiments, there are two gRNAs, one of which targets exon 3 of Sestrin2 or an intron adjacent to the upstream of exon 3, and the other targets exon 6 of Sestrin2 or an intron adjacent to the downstream of exon 6.

[0022] In some embodiments, there are two gRNAs, one of which targets exon 3 of Sestrin2 or an intron adjacent to the upstream of exon 3, and the other targets exon 8 of Sestrin2 or an intron adjacent to the downstream of exon 8.

[0023] In some embodiments, the sequence of the gRNA comprises SEQ ID NO: 1 and / or 2.

[0024] In some embodiments, the Sestrin2 inhibitor comprises gRNA and Cas protein.

[0025] Preferably, the Sestrin2 inhibitor prevents and / or treats altitude sickness by reducing one or more of the following: right cardiac index, right ventricular anterior wall, or right ventricular ejection fraction.

[0026] Preferably, the Sestrin2 inhibitor achieves the treatment and / or prevention of altitude sickness by alleviating right ventricular hypertrophy.

[0027] Preferably, the prevention and / or treatment of altitude sickness comprises inhibiting the expression of Sestrin2 (eg, the expression level of mRNA or the expression level of protein).

[0028] Preferably, the prevention and / or treatment of altitude sickness comprises knocking out or knocking down Sestrin2 using the CRISPR / Cas method.

[0029] Preferably, the prevention and / or treatment of altitude sickness comprises administering a Sestrin2 inhibitor to a subject in need thereof.

[0030] The altitude sickness includes diseases caused by low pressure in the plateau environment, preferably including acute altitude sickness or chronic altitude sickness.

[0031] Preferably, the acute mountain sickness includes high altitude coma, high altitude pulmonary edema, high altitude cerebral edema, pulmonary hypertension or a mixed disease in which abnormal brain and lung symptoms coexist.

[0032] Preferably, the chronic altitude sickness includes altitude heart disease, high altitude polycythemia, high altitude hypertension or high altitude hypotension.

[0033] In some embodiments, the altitude sickness is altitude sickness, such as heart failure.

[0034] The altitude of the plateau low-pressure environment is above 2500m, above 3000m, above 4000m, above 5000m or above 5500m.

[0035] Preferably, the altitude of the plateau low-pressure environment is 2500-8000m, and more preferably, the altitude of the plateau low-pressure environment is 4000-6500m.

[0036] Preferably, the product includes medicine, food or health care product.

[0037] The second aspect of the present invention provides the use of a Sestrin2 inhibitor in the preparation of a product for preventing and / or treating right ventricular hypertrophy caused by a high-altitude low-pressure environment.

[0038] Preferably, the Sestrin2 inhibitor prevents and / or treats right ventricular hypertrophy caused by high altitude hypotension by reducing the expression of Sestrin2.

[0039] Preferably, the Sestrin2 inhibitor alleviates right ventricular hypertrophy caused by high altitude hypotension by reducing the expression of Sestrin2.

[0040] The third aspect of the present invention provides the use of a Sestrin2 inhibitor in the preparation of a product for preventing and / or treating altitude sickness by reducing right cardiac index, reducing right ventricular anterior wall or reducing right ventricular ejection fraction.

[0041] Preferably, the Sestrin2 inhibitor reduces the expression of Sestrin2 to reduce the right cardiac index, reduce the right ventricular anterior wall or reduce the right ventricular ejection fraction, thereby preventing and / or treating altitude sickness.

[0042] A fourth aspect of the present invention provides the use of a Sestrin2 inhibitor in preparing a product for preventing and / or treating altitude sickness by alleviating right ventricular hypertrophy.

[0043] Preferably, the Sestrin2 inhibitor prevents and / or treats altitude sickness by reducing the expression of Sestrin2 to alleviate right ventricular hypertrophy.

[0044] A fifth aspect of the present invention provides use of a Sestrin2 inhibitor in the preparation of a product for preventing and / or treating altitude sickness by inhibiting the expression of Sestrin2.

[0045] The sixth aspect of the present invention provides the use of knocking out or knocking down Sestrin2 or reducing the expression of Sestrin2 in the preparation of a product for preventing and / or treating right ventricular hypertrophy caused by high-altitude hypotension environment.

[0046] The method for knocking out or knocking down Sestrin2 includes one or more of CRISPR / Cas, tissue-specific knockout or interfering RNA targeting Sestrin2.

[0047] Preferably, the knockout of Sestrin2 comprises knocking out any one or two or more of exons 1-10 of the Sestrin2 gene. Preferably, the knockout of Sestrin2 comprises knocking out all or part of exons 1-10 of the Sestrin2 gene. Preferably, the knockout of Sestrin2 comprises knocking out exon 3 of the Sestrin2 gene and the subsequent coding sequence.

[0048] In some embodiments, the knocking out of Sestrin2 comprises knocking out exon 3-6, exon 3-7, exon 3-8, exon 3-9 or exon 3-10 of Sestrin2.

[0049] Preferably, the knockout comprises knocking out using a gRNA targeting Sestrin2. Further preferably, the knockout comprises a Cas protein.

[0050] Further preferably, the number of gRNAs is one or more.

[0051] Preferably, there are two gRNAs, one of which targets exon 3 of Sestrin2 or an intron adjacent to the upstream of exon 3, and the other targets exons 6-10 of Sestrin2 or introns therebetween.

[0052] In some embodiments, there are two gRNAs, one of which targets exon 3 of Sestrin2 or an intron adjacent to the upstream of exon 3, and the other targets exon 6 of Sestrin2 or an intron adjacent to the downstream of exon 6.

[0053] In some embodiments, there are two gRNAs, one of which targets exon 3 of Sestrin2 or an intron adjacent to the upstream of exon 3, and the other targets exon 8 of Sestrin2 or an intron adjacent to the downstream of exon 8.

[0054] In some embodiments, the sequence of the gRNA comprises SEQ ID NO: 1 and / or 2.

[0055] The seventh aspect of the present invention provides the use of knocking out or knocking down Sestrin2 in preparing a product for preventing and / or treating altitude sickness by reducing right cardiac index, reducing right ventricular anterior wall or reducing right ventricular ejection fraction.

[0056] The eighth aspect of the present invention provides the use of knocking out or knocking down Sestrin2 in preparing a product for preventing and / or treating altitude sickness by alleviating right ventricular hypertrophy.

[0057] According to a ninth aspect of the present invention, a Sestrin2 inhibitor is provided, wherein the Sestrin2 inhibitor comprises a gRNA targeting Sestrin2.

[0058] The number of gRNAs is one or more.

[0059] Preferably, there are two gRNAs, one of which targets exon 3 of Sestrin2 or an intron adjacent to the upstream of exon 3, and the other targets exons 6-10 of Sestrin2 or introns therebetween.

[0060] In some embodiments, there are two gRNAs, one of which targets exon 3 of Sestrin2 or an intron adjacent to the upstream of exon 3, and the other targets exon 6 of Sestrin2 or an intron adjacent to the downstream of exon 6.

[0061] In some embodiments, there are two gRNAs, one of which targets exon 3 of Sestrin2 or an intron adjacent to the upstream of exon 3, and the other targets exon 8 of Sestrin2 or an intron adjacent to the downstream of exon 8.

[0062] In some embodiments, the sequence of the gRNA comprises SEQ ID NO: 1 and / or 2.

[0063] In some embodiments, the Sestrin2 inhibitor comprises gRNA and Cas protein.

[0064] The tenth aspect of the present invention provides a drug, wherein the drug comprises a Sestrin2 inhibitor.

[0065] The drug further comprises a pharmaceutically acceptable excipient; preferably, the pharmaceutically acceptable excipient is selected from one or a combination of two or more of a diluent, an absorbent, a wetting agent, a binder, a disintegrant, a lubricant, a solvent, a pH adjuster, an antioxidant, a metal ion chelator, an antibacterial agent or an isotonicity adjuster.

[0066] Preferably, the drug can be administered by any suitable route, such as enteral administration (e.g., oral) or parenteral administration (e.g., intravenous, intramuscular, subcutaneous, intradermal, intraorgan, intranasal, intraocular, instillation, intracerebral, intrathecal, transdermal, intrarectal, etc.).

[0067] Preferably, the drug can be in any suitable dosage form, such as a dosage form for gastrointestinal administration or a dosage form for parenteral administration, preferably including but not limited to tablets, pills, powders, granules, capsules, lozenges, syrups, liquids, emulsions, microemulsions, suspensions, injections, sprays, aerosols, powder sprays, lotions, ointments, plasters, pastes, patches, eye drops, nasal drops, sublingual tablets, suppositories, effervescent tablets, pills, gels, etc.

[0068] Preferably, various dosage forms of the drug of the present invention can be prepared according to conventional production methods in the pharmaceutical field.

[0069] Preferably, the drug may contain a Sestrin2 inhibitor in an amount of 0.01-99.5% by weight or volume (specifically, 0.01%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.5%).

[0070] According to the needs of the specific implementation, the drug can be used alone, or used simultaneously with other drugs capable of treating altitude sickness or other diseases.

[0071] Preferably, the drug can be a human drug or a veterinary drug.

[0072] In an eleventh aspect of the present invention, a method for treating and / or preventing altitude sickness is provided, wherein the method comprises administering an effective amount of a Sestrin2 inhibitor or the above-mentioned drug to a subject in need thereof.

[0073] The method comprises knocking out or knocking down Sestrin2 using a CRISPR / Cas method.

[0074] The method includes inhibiting the expression of Sestrin2 (eg, the expression level of mRNA or the expression level of protein).

[0075] The effective amount depends on many factors, including the patient's age, weight, sex, natural health, nutritional status, time of administration, metabolic rate, severity of the disease, and the subjective judgment of the treating physician.

[0076] A twelfth aspect of the present invention provides a method for treating and / or preventing right ventricular hypertrophy, the method comprising administering an effective amount of a Sestrin2 inhibitor or the above-mentioned drug to a subject in need thereof.

[0077] The method comprises knocking out or knocking down Sestrin2 using a CRISPR / Cas method.

[0078] The method includes inhibiting the expression of Sestrin2 (eg, the expression level of mRNA or the expression level of protein).

[0079] In a thirteenth aspect of the present invention, a method for screening drugs for preventing and / or treating altitude sickness is provided, the method comprising treating a sample with a test drug and then detecting the mRNA and / or protein expression level of Sestrin2 or detecting the function or activity of the Sestrin2 protein.

[0080] Preferably, the sample comprises cells, tissues or organs.

[0081] Preferably, the tissue comprises cardiac tissue.

[0082] Preferably, the organ is the heart.

[0083] Preferably, the drug to be tested that can downregulate Sestrin2 in the sample has the effect of preventing and / or treating altitude sickness.

[0084] In a fourteenth aspect, the present invention provides a method for constructing a Sestrin2 gene-modified non-human animal, the construction method comprising knocking out the Sestrin2 gene of the non-human animal.

[0085] Preferably, any one or more of exons 1-10 of the Sestrin2 gene of a non-human animal is knocked out. Further preferably, all or part of exons 1-10 of the Sestrin2 gene is knocked out. More preferably, exon 3 of the Sestrin2 gene and the subsequent coding sequence are knocked out.

[0086] In some embodiments, exons 3-6, exons 3-7, exons 3-8, exons 3-9, or exons 3-10 of the Sestrin2 gene are knocked out.

[0087] Preferably, the knockout uses the Sestrin2 inhibitor or the drug.

[0088] The "method" described in the present invention can be for therapeutic purposes or non-therapeutic purposes.

[0089] The term “comprising” described in the present invention is an open description, which includes the specified components or steps described, and other specified components or steps that will not be substantially affected.

[0090] The "and / or" of the present invention includes all combinations of items connected by the term, and each combination should be deemed to have been listed separately herein. For example, "A and / or B" includes "A", "A and B" and "B".

[0091] The term "pharmaceutically acceptable" as used herein refers to a substance that neither significantly irritates an organism nor inhibits the biological activity and properties of the active substance of the administered product.

[0092] "Treatment" as used herein means to slow down, interrupt, prevent, control, stop, alleviate, or reverse the progression or severity of a sign, symptom, disorder, condition, or disease after the disease has begun to develop, but does not necessarily involve the complete elimination of all disease-related signs, symptoms, conditions, or disorders.

[0093] The term "prevention" as used in the present invention refers to all actions that suppress symptoms or delay the tension of specific symptoms by administering the product of the present invention.

[0094] The "effective amount" of the present invention refers to the amount or dosage of the product of the present invention that provides the desired treatment or prevention after administration to a patient or an organ in a single or multiple doses.

[0095] The "subject" described in the present invention can be a human or a non-human mammal, and the non-human mammal can be a wild animal, a zoo animal, an economic animal, a pet, an experimental animal, etc. Preferably, the non-human mammal includes but is not limited to pigs, cattle, sheep, horses, donkeys, foxes, raccoon dogs, minks, camels, dogs, cats, rabbits, mice (such as rats, mice, guinea pigs, hamsters, gerbils, chinchillas, squirrels) or monkeys, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0096] Figure 1 Schematic diagram of the strategy for constructing mice with exons 3-8 knockout of the Sestrin2 gene.

[0097] Figure 2 Schematic diagram of the strategy for constructing mice with exons 3-6 knockout of the Sestrin2 gene.

[0098] Figure 3 This is a sequence comparison chart of Sestrin2 gene before and after knockout, where Query is the sequence before knockout and Sbjct is the sequence after knockout.

[0099] Figure 4 This is the electrophoresis diagram of the genotype detection of wild-type and heterozygous mice, where M represents marker, HE represents heterozygous, and WT represents wild-type.

[0100] Figure 5 The changes of right heart index of mice in each group, where RV refers to right ventricle, IS refers to ventricular septum, and LV refers to left ventricle; *p<0.05, model group vs control group; #p<0.05, treatment group vs model group; one-way ANOVA.

[0101] Figure 6 The changes of the right ventricular anterior wall of mice in each group, where RVAW represents the right ventricular anterior wall, *p<0.05, model group vs control group; #p<0.05, treatment group vs model group; one-way ANOVA.

[0102] Figure 7 The changes of right ventricular ejection fraction of mice in each group, where EF (Ejection Fractions) represents ejection fraction, *p<0.05, model group vs control group; #p<0.05, treatment group vs model group; one-way ANOVA. DETAILED DESCRIPTION

[0103] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0104] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0105] Unless otherwise specified, the reagents, materials, and instruments used in the following examples can be obtained from commercial sources.

[0106] Materials and methods involved in the examples:

[0107] 1. Animals

[0108] 6-8 weeks old C57BL / 6J mice (20-22 g, male, clean grade) were purchased from Beijing Weitonglihua Experimental Animal Co., Ltd., license number: SCXK (Beijing) 2016-0006. Feeding: Full nutritional feed was given regularly, room temperature was 22-25°C, and humidity was 50%-70%.

[0109] 2. Instruments

[0110] Small animal hypobaric oxygen chamber (Binglun Hyperbaric Oxygen Chamber Co., Ltd.);

[0111] Small animal ventilator (kent scientific);

[0112] Multifunctional physiological instrument (Millar);

[0113] Small animal ultrasound (Visual Sonics Inc);

[0114] Gene amplification instrument (Biometra);

[0115] Q-PCR instrument (Bio-Rad)

[0116] 3. Animal index detection method

[0117] 3% sodium pentobarbital, 0.2ml / 100g, was injected intraperitoneally to anesthetize the mice, and then ultrasound examination was performed. The mice were then fixed in a supine position on the operating table, tracheotomy was performed, the ventilator was connected, the chest was opened, the heart was exposed, and a catheter was inserted into the right ventricle for right heart catheter examination. The mice were killed, the heart was taken out, the atrial tissue and attached fat were removed, the left and right ventricles were separated, the water was absorbed with filter paper, and they were weighed separately.

[0118] 4. Statistical methods

[0119] All data were expressed as Mean±SD. One-way analysis of variance was used for comparison among groups. p<0.05 was considered statistically significant. GraphPad Prism 5 software package was used for statistical analysis.

[0120] Example 1: Preparation of Sestrin2 gene knockout mouse model

[0121] Preparation of Sestrin2 knockout mouse model

[0122] According to the sequence of the target gene Sestrin2 provided by GeneBank (its nucleic acid sequence is shown in NM_144907), CRISPR / Cas9 technology was used to prepare Sestrin2 gene knockout mice. Specifically:

[0123] Design and clone gRNA expression vectors; in vitro transfection of Cas9 mRNA and gRNA; fertilized eggs injected and transplanted to obtain F1 generation knockout mice, which were cultured and propagated to F2 generation. Gene sequencing and Western blot analysis were used to detect Sestrin2 expression and verify the gene knockout rate. The construction process of the mouse model with exon 3-8 knockout is as follows Figure 1 As shown in Figure 2, the process of constructing a mouse model with exon 3-6 knockout is as follows: Figure 2 shown.

[0124] It has been identified that the mouse Sestrin2 gene contains 10 exons, of which the ATG start codon is located in exon 1 and the TGA stop codon is located in exon 10. The present invention prepared a mouse model with exons 3-6 knocked out and a mouse model with exons 3-8 knocked out, respectively. Subsequent results showed that both knockout methods had a protective effect on right ventricular hypertrophy and the like in mice simulating a high-altitude low-pressure environment.

[0125] Taking the mouse with exon 3-6 knocked out as an example, the sequence of the gRNA used in constructing the mouse model with Sestrin2 gene knockout is:

[0126] gRNA1: SEQ ID NO: 1: GCCAGGCAAAGAAGAGCGCATGG;

[0127] gRNA2: SEQ ID NO: 2: AAAGAGAGAGGGGTGGCCCCTGG.

[0128] The method is: obtain Cas9 mRNA and gRNA by in vitro transcription; microinject Cas9 mRNA and gRNA into fertilized eggs of C57BL / 6J mice, transplant them into pseudo-pregnant mother mice, and the mice born around 20 days old are F0 generation mice. PCR amplification and sequencing are used to identify the genotype. The PCR identification method is as follows:

[0129] Primer information is shown in Table 1.

[0130] Table 1

[0131]

[0132] The reaction system is shown in Table 2.

[0133] Table 2

[0134] Reaction components Volume (μl) <![CDATA[ddH 2 The]]> 13.2 GXL PCR Buffer 2 2.5mM dNTP 2 Primer I (10 pmol / μl) 0.5 Primer II (10 pmol / μl) 0.5 GXL DNA Polymerase 0.8 Tail genomic DNA 1 total 20

[0135] The reaction conditions are shown in Table 3.

[0136] Table 3

[0137]

[0138]

[0139] The positive F0 mice were further mated with C57BL / 6J mice to obtain 31 positive F1 mice. The identification method and results are as follows:

[0140] 1) Identify the genotype of F1 mice based on the size of the PCR product.

[0141] Primer information is shown in Table 4.

[0142] Table 4

[0143]

[0144] Reaction system 1 is shown in Table 5.

[0145] Table 5

[0146]

[0147] Reaction system 2 is shown in Table 6.

[0148] Table 6

[0149]

[0150] The reaction conditions are shown in Table 7.

[0151] Table 7

[0152] step Temperature(℃) time Note 1 95 5min - 2 95 15s - 3 58 15s - 4 72 1min Steps 2-4 were reacted for 35 cycles 5 72 5min - 6 12 stop

[0153] PCR results are as follows Figure 4 As shown, a 639 bp fragment was obtained from P3 and P4 of wild-type mice, a 566 bp fragment was obtained from P1 and P2 of heterozygous genotype mice, and a 639 bp fragment was obtained from P3 and P4.

[0154] 2) Sequencing results

[0155] The obtained F1 generation mice lacked 2069 base pairs. The gene sequence before and after gene knockout was compared. Figure 3 shown.

[0156] The F1 generation mice were self-fertilized to obtain homozygous knockout mice, and the expression of Sestrin2 was detected by gene sequencing and Western blot. The results were stable and reliable and were applied to Example 2.

[0157] Example 2: Effects of Sestrin2 knockout on plateau low pressure environment

[0158] 2.1 Animal Experiment Design

[0159] Twelve C57BL / 6J mice were randomly divided into a control group and a model group, and six mice were randomly selected from the homozygous Sestrin2 knockout mice obtained in Example 1 as a treatment group, wherein:

[0160] The model group was placed in an experimental cabin, and the cabin pressure was adjusted to 380 mmHg to simulate the low-pressure environment of a plateau at an altitude of 5,500 meters. The cabin was opened for one hour every day to add feed and water to the animals, while the environment in which the mice were located was maintained at a 12:12 hour day and night alternation.

[0161] The mice in the control group were kept in the same room under normal pressure.

[0162] The mice in the treatment group were placed in an experimental cabin, and the pressure in the cabin was adjusted to 380 mmHg to simulate the low-pressure environment of a plateau at an altitude of 5,500 meters. The cabin was opened for 1 hour every day to add feed and water to the animals, while the environment in which the mice were located was maintained at a 12:12 hour day and night alternation.

[0163] 2.2 Effects of each treatment group on right ventricular hypertrophy in mice

[0164] After 35 days, the right heart index of mice in the model group was significantly higher than that in the control group, and the difference was statistically significant (p < 0.05). Compared with the model group, the right heart index of mice in the treatment group was significantly lower, and the difference was statistically significant (p < 0.05) ( Figure 5 ). Among them, the right heart index is used to characterize the degree of right ventricular hypertrophy. The formula of the right heart index is: RV / (RV+IS+LV).

[0165] 2.3 Effects of each treatment group on the thickness of the right ventricular anterior wall of mice

[0166] After 35 days, the anterior wall of the right ventricle of the mice in the model group was significantly thickened compared with the control group, and the difference was statistically significant (p < 0.05). Compared with the model group, the anterior wall of the right ventricle of the mice in the treatment group was thinned, and the difference was statistically significant (p < 0.05) ( Figure 6 ).

[0167] 2.4 Effects of each treatment group on right ventricular ejection fraction (EF) of mice

[0168] After 35 days, compared with the control group, the right ventricular ejection fraction of the model group rats increased significantly, and the difference was statistically significant (p < 0.05). Compared with the model group, the right ventricular ejection fraction of the treatment group mice decreased, and the difference was statistically significant (p < 0.05) ( Figure 7 ).

[0169] The above results indicate that knocking out Sestrin2 has a protective effect on right ventricular hypertrophy and other conditions in mice exposed to simulated high-altitude hypotension, and can be developed into a drug that protects against high-altitude hypotension.

[0170] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. Use of Sestrin2 inhibitors in the preparation of products for preventing and / or treating altitude sickness.

2. The use according to claim 1, characterized in that: The Sestrin2 inhibitors include reagents for knocking out or knocking down Sestrin2; Preferably, the reagent for knocking out or knocking down Sestrin2 includes one or more of the reagents required for the CRISPR / Cas system, the reagents required for tissue-specific knockout, or the interfering RNA targeting Sestrin2.

3. The use according to claim 1, characterized in that: The Sestrin2 inhibitor achieves treatment and / or prevention of altitude sickness by inhibiting the expression, function or activity of Sestrin2.

4. The use according to claim 1, characterized in that: The Sestrin2 inhibitor knocks out exons 3-6 or exons 3-8 of Sestrin2; Preferably, the knockout comprises knocking out using a gRNA targeting Sestrin2; further preferably, the sequence of the gRNA comprises SEQ ID NO: 1 and / or 2.

5. The use according to claim 1, characterized in that: The Sestrin2 inhibitor prevents and / or treats altitude sickness by reducing one or more of the following: right heart index, right ventricular anterior wall or right ventricular ejection fraction.

6. The use according to any one of claims 1 to 5, characterized in that: The altitude sickness includes diseases caused by low pressure in the plateau environment, preferably acute altitude sickness or chronic altitude sickness; Preferably, the altitude of the plateau low-pressure environment is above 2500m, preferably 2500-8000m.

7. The use according to any one of claims 1 to 6, characterized in that: The products include medicines, foods or health products.

8. Use of Sestrin2 inhibitors in the preparation of products for preventing and / or treating right ventricular hypertrophy caused by high altitude hypotension environment.

9. A Sestrin2 inhibitor, characterized in that The Sestrin2 inhibitor comprises a gRNA targeting Sestrin2, wherein the sequence of the gRNA comprises SEQ ID NO: 1 and / or 2.

10. Use of a Sestrin2 inhibitor in the preparation of a product for preventing and / or treating altitude sickness by inhibiting the expression of Sestrin2.

Images