A genetically engineered bacterium for efficiently synthesizing ectoine and its construction method

Abstract

The present invention relates to a genetic engineering bacterium for efficiently synthesizing ectoine and a construction method thereof, which includes a related protein degradation tag, an expression vector and a construction method thereof. The present invention regulates the diaminopimelate decarboxylase gene lysA and the homoserine dehydrogenase gene metL by adding a protein degradation tag, and at the same time introduces an exogenous gene cluster ectABC to construct an expression pathway of ectoine in a host cell to synthesize ectoine from scratch. The construction method of the present invention ensures the content of essential amino acids required for the life metabolism of the bacterial body, promotes the growth of the strain, and achieves the purpose of high-yield ectoine. The present invention mutates the amino acid sequence of the protein degradation tag on the basis of the regulation of the protein degradation tag, and finds that the mutated protein degradation tag is more helpful to increase the yield of ectoine.

Description

Technical Field

[0001] The present invention relates to the technical fields of genetic engineering and fermentation engineering, and particularly relates to a genetically engineered bacterium for efficiently synthesizing ectoine and a method for constructing the same. Background Art

[0002] Ectoine is an amino acid derivative existing in microorganisms, specifically belonging to cyclic amino acids. Ectoine mainly exists in moderately halophilic bacteria, such as Halomonas Elongata, and non-halophilic bacteria such as Streptomyces and Escherichia coli. As a natural substance with various biological and medical functions, ectoine has broad application prospects in the fields of cosmetics, skin care products, medicine, etc.

[0003] Currently, there are mainly two methods for synthesizing ectoine: chemical synthesis method and biological synthesis method. The chemical synthesis method has many problems, including complex production process, low synthesis yield, many by-products with similar chemical properties to the target product, and high difficulty in downstream separation and purification. The biological synthesis method mainly adopts enzyme catalysis method and fermentation method. In the biological fermentation method, it is necessary to construct a biological metabolic pathway of ectoine in the bacterial cells. The synthesis process of ectoine can be completed in three steps. First, aspartokinase (LysC) catalyzes aspartic acid to generate β-aspartyl phosphate; then aspartate semialdehyde dehydrogenase (AsD) catalyzes β-aspartyl phosphate to generate aspartate-β-semialdehyde; finally, aspartate-β-semialdehyde is catalyzed by three enzymes encoded by ectABC to complete the synthesis of ectoine. At the same time, the metabolic pathways of lysine and homoserine also start from aspartate-β-semialdehyde, so there is a certain carbon flux metabolic competition with ectoine.

[0004] In existing research, when there is a metabolic flux competition pathway with the main expression metabolic pathway, the common practice is to knock out the expression genes of the branch pathway to achieve complete interception of the branch metabolic flux. In the research of ectoine, the common method for intercepting the branch metabolism is to knock out the lysine expression gene lysA and the homoserine dehydrogenase gene metL. This approach is reasonable at the design level, but it may have a negative impact on the growth of the bacterial cells. The life metabolism of the bacterial cells requires essential amino acids such as lysine and threonine. Direct gene knockout leads to the hindrance of the production of these amino acids, which in turn affects the growth of the strain and ultimately results in a decrease in the yield of ectoine.

[0005] Therefore, seeking a genetically engineered bacterium that does not affect the metabolic pathways of other necessary products and can efficiently synthesize ectoine and a method for constructing the same has become an urgent technical problem in this field. Summary of the Invention

[0006] The object of the present invention is to overcome the deficiencies of the prior art and provide a genetically engineered bacterium that does not affect the metabolic pathways of other necessary products and can efficiently synthesize ectoine, as well as a method for constructing the same.

[0007] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0008] In the first aspect, the present invention provides a protein degradation tag (small subunit ribosomal protein S1, ssrA), and the amino acid sequence of the protein degradation tag is any one of those shown in SEQ ID NO: 1-9.

[0009] As a preferred embodiment of the first aspect of the present invention, the amino acid sequence of the protein degradation tag is any one of those shown in SEQ ID NO: 1-4.

[0010] In the second aspect, the present invention provides an expression vector, and the expression vector includes a dual-promoter plasmid, a lysine decarboxylase gene lysA fragment, a nucleic acid fragment encoding protein degradation tag A, a homoserine dehydrogenase gene metL fragment, and a nucleic acid fragment encoding protein degradation tag B; the lysine decarboxylase gene lysA fragment and the nucleic acid fragment encoding protein degradation tag A are sequentially connected in series behind the first promoter of the dual-promoter plasmid, and the homoserine dehydrogenase gene metL fragment and the nucleic acid fragment encoding protein degradation tag B are sequentially connected in series behind the second promoter of the dual-promoter plasmid; the amino acid sequences encoded by the nucleic acid fragment encoding protein degradation tag A and the nucleic acid fragment encoding protein degradation tag B are the same or different.

[0011] As a preferred embodiment of the second aspect of the present invention, protein degradation tag A or B is independently selected from any one of protein degradation tags LAA, LAA+2, LAA+8, DAS+2, DAS+8, and their mutant tags LAA+2*, LAA+8*, DAS+2*, DAS+8*.

[0012] As a preferred embodiment of the second aspect of the present invention, the amino acid sequence of the protein degradation tag is as follows:

[0013] The amino acid sequence of protein degradation tag LAA+2* is as shown in SEQ ID NO: 1;

[0014] The amino acid sequence of protein degradation tag LAA+8* is as shown in SEQ ID NO: 2;

[0015] The amino acid sequence of protein degradation tag DAS+2* is as shown in SEQ ID NO: 3;

[0016] The amino acid sequence of the protein degradation tag DAS+8* is shown in SEQ ID NO: 4;

[0017] The amino acid sequence of the protein degradation tag LAA is shown in SEQ ID NO: 5;

[0018] The amino acid sequence of the protein degradation tag LAA+2 is shown in SEQ ID NO: 6;

[0019] The amino acid sequence of the protein degradation tag LAA+8 is shown in SEQ ID NO: 7;

[0020] The amino acid sequence of the protein degradation tag DAS+2 is shown in SEQ ID NO: 8;

[0021] The amino acid sequence of the protein degradation tag DAS+8 is shown in SEQ ID NO: 9.

[0022] As a preferred embodiment of the second aspect of the present invention, the coding nucleic acid sequence of the protein degradation tag is as follows:

[0023] The nucleic acid sequence encoding the SEQ ID NO: 1 sequence is shown in SEQ ID NO: 10;

[0024] The nucleic acid sequence encoding the SEQ ID NO: 2 sequence is shown in SEQ ID NO: 11;

[0025] The nucleic acid sequence encoding the SEQ ID NO: 3 sequence is shown in SEQ ID NO: 12;

[0026] The nucleic acid sequence encoding the SEQ ID NO: 4 sequence is shown in SEQ ID NO: 13;

[0027] The nucleic acid sequence encoding the SEQ ID NO: 5 sequence is shown in SEQ ID NO: 14;

[0028] The nucleic acid sequence encoding the SEQ ID NO: 6 sequence is shown in SEQ ID NO: 15;

[0029] The nucleic acid sequence encoding the SEQ ID NO: 7 sequence is shown in SEQ ID NO: 16;

[0030] The nucleic acid sequence encoding the SEQ ID NO: 8 sequence is shown in SEQ ID NO: 17;

[0031] The nucleic acid sequence encoding the SEQ ID NO: 9 sequence is shown in SEQ ID NO: 18.

[0032] In a third aspect, the present invention provides a genetically engineered bacterium, which contains an expression vector overexpressing the gene cluster ectABC and the expression vector described in the second aspect.

[0033] In a fourth aspect, the present invention provides a method for constructing the above-mentioned genetically engineered bacterium, comprising the following steps:

[0034] S1. Integrate the gene cluster ectABC onto the plasmid pRSFDuet-1 to obtain the plasmid pRSF-ectABC;

[0035] S2. Connect the lysine decarboxylase gene lysA fragment to the back of the first T7 promoter of the plasmid pETDuet-1 through homologous recombination technology to obtain plasmid A;

[0036] S3. Connect the homoserine dehydrogenase gene metL fragment to the back of the second T7 promoter of plasmid A through homologous recombination technology to obtain plasmid B;

[0037] S4. Transform the plasmid obtained in step S1 and the plasmid obtained in step S3 into competent host cells, and culture the host cells in a liquid medium to obtain the genetically engineered bacterium.

[0038] As a preferred embodiment of the fourth aspect of the present invention, plasmid A contains the lysA gene fragment and a nucleic acid fragment encoding the protein degradation tag A; plasmid B contains the lysA gene fragment, a nucleic acid fragment encoding the protein degradation tag A, the metL gene fragment, and a nucleic acid fragment encoding the protein degradation tag B; the protein degradation tag A or B is independently selected from any one of the protein degradation tags LAA, LAA+2, LAA+8, DAS+2, DAS+8 and their mutant tags LAA+2*, LAA+8*, DAS+2*, DAS+8*; the sequence of the nucleic acid fragment encoding the protein degradation tag A is as shown in SEQ ID NO: 10-18; the sequence of the nucleic acid fragment encoding the protein degradation tag B is as shown in SEQ ID NO: 10-18; the competent host cell is E.coli BL21(DE3)ΔlysAΔmetL.

[0039] In a fifth aspect, the present invention provides a method for preparing ectoine, which includes the step of fermenting using the above-mentioned genetically engineered bacterium.

[0040] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0041] The present invention regulates the diaminopimelate decarboxylase gene lysA and the homoserine dehydrogenase gene metL by adding protein degradation tags, and at the same time introduces an exogenous gene cluster ectABC to construct a pathway for the expression of ectoine in host cells to de novo synthesize ectoine. The construction method of the present invention ensures the content of essential amino acids required for the life metabolism of the bacterial cells, such as lysine, threonine, etc., promotes the growth of the strain, and achieves the purpose of high-yield ectoine production.

[0042] On the basis of the regulation by protein degradation tags, the present invention mutates and optimizes the amino acid sequence of the protein degradation tag, and finds that the mutated protein degradation tag is more helpful for improving the yield of ectoine.

[0043] In addition, the present invention also combines different types of protein degradation tags with the lysA gene and the metL gene respectively, screens out the most suitable protein degradation tags for different target expression genes, and regulates the expression of the lysA gene and the metL gene by combining the target expression gene with its most suitable protein degradation tag, so that the host cell can generate ectoine to the maximum extent, thereby improving the yield of ectoine. Brief Description of the Drawings

[0044] Figure 1 It is a schematic diagram of the ectoine metabolic pathway regulated by the present invention. Detailed Embodiments

[0045] To better illustrate the purpose, technical solution and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0046] The plasmids pRSFDuet-1, pACYCDuet-1 and the recombinant plasmid of the present invention were synthesized by General Biosystems (Anhui) Co., Ltd. The nucleic acid sequence of the gene cluster ectABC related to the ectoine synthesis pathway derived from Halomonas elongata is shown in SEQ ID NO: 19.

[0047] The Gene ID of the diaminopimelate decarboxylase gene lysA derived from Escherichia coli is 947313;

[0048] The Gene ID of the homoserine dehydrogenase gene metL derived from Escherichia coli is 948433.

[0049] Preparation of genetically defective Escherichia coli: The diaminopimelate decarboxylase gene lysA or / and the homoserine dehydrogenase gene metL in Escherichia coli were knocked out respectively by the CRISPER method to obtain Escherichia coli E. coli BL21(DE3)ΔlysA with the lysA gene knocked out, E. coli BL21(DE3)ΔmetL with the metL gene knocked out, and E. coli BL21(DE3)ΔlysAΔmetL with both the lysA gene and the metL gene knocked out. The CRISPER method is a conventional gene editing tool used by those skilled in the art for gene editing. By designing sgRNA based on the clear target gene sequence, the effect of knocking out the target gene can be achieved.

[0050] Example 1

[0051] The example provides a protein degradation tag, and its amino acid sequence is any one of the following:

[0052] 1) AANDENYGSALAA (SEQ ID NO: 1);

[0053] 2) AANDENYDSE SGSNYALAA (SEQ ID NO: 2);

[0054] 3) AANDENYGSADAS (SEQ ID NO: 3);

[0055] 4) AANDENYDSESGSNYADAS (SEQ ID NO: 4);

[0056] 5) AANDENYALAA (SEQ ID NO: 5);

[0057] 6) AANDENYNYALAA (SEQ ID NO: 6);

[0058] 7) AANDENYSESESENYALAA (SEQ ID NO: 7);

[0059] 8) AANDENYNYADAS (SEQ ID NO: 8);

[0060] 9) AANDENYSESESENYADAS (SEQ ID NO: 9);

[0061] The protein degradation tags ssrA with the above different amino acid sequences are respectively named as: LAA + 2*(SEQ ID NO: 1), LAA + 8*(SEQ ID NO: 2), DAS + 2*(SEQ ID NO: 3), DAS + 8*(SEQ ID NO: 4), LAA(SEQ ID NO: 5), LAA + 2(SEQ ID NO: 6), LAA + 8(SEQ ID NO: 7), DAS + 2(SEQ ID NO: 8), DAS + 8(SEQ ID NO: 9).

[0062] Preferably, the amino acid sequence of the protein degradation tag is any one of those shown in SEQ ID NO: 1-4.

[0063] Example 2

[0064] This example provides an expression vector, which includes a dual-promoter plasmid, a diaminopimelate decarboxylase gene lysA fragment, a nucleic acid fragment encoding protein degradation tag A, a homoserine dehydrogenase gene metL fragment, and a nucleic acid fragment encoding protein degradation tag B; the diaminopimelate decarboxylase gene lysA fragment and the nucleic acid fragment encoding protein degradation tag A are successively connected in series behind the first promoter of the dual-promoter plasmid, and the homoserine dehydrogenase gene metL fragment and the nucleic acid fragment encoding protein degradation tag B are successively connected in series behind the second promoter of the dual-promoter plasmid; the amino acid sequences encoded by the nucleic acid fragment encoding protein degradation tag A and the nucleic acid fragment encoding protein degradation tag B are the same or different.

[0065] Preferably, protein degradation tag A or B is independently selected from any one of protein degradation tags LAA, LAA + 2, LAA + 8, DAS + 2, DAS + 8 and their mutant tags LAA + 2*, LAA + 8*, DAS + 2*, DAS + 8*.

[0066] Preferably, protein degradation tag A or B is independently selected from any one of protein degradation tags LAA + 2*, LAA + 8*, DAS + 2*, DAS + 8*.

[0067] The amino acid sequence of protein degradation tag LAA + 2* is AANDENYGSALAA(SEQ ID NO: 1);

[0068] The amino acid sequence of protein degradation tag LAA + 8* is AANDENYDSE SGSNYALAA(SEQ ID NO: 2);

[0069] The amino acid sequence of protein degradation tag DAS + 2* is AANDENYGSADAS(SEQ ID NO: 3);

[0070] The amino acid sequence of the protein degradation tag DAS + 8* is AANDENYDSESGSNYADAS (SEQ ID NO: 4);

[0071] The amino acid sequence of the protein degradation tag LAA is AANDENYALAA (SEQ ID NO: 5);

[0072] The amino acid sequence of the protein degradation tag LAA + 2 is AANDENYNYALAA (SEQ ID NO: 6);

[0073] The amino acid sequence of the protein degradation tag LAA + 8 is AANDENYSESESENYALAA (SEQ ID NO: 7);

[0074] The amino acid sequence of the protein degradation tag DAS + 2 is AANDENYNYADAS (SEQ ID NO: 8);

[0075] The amino acid sequence of the protein degradation tag DAS + 8 is AANDENYSESESENYADAS (SEQ ID NO: 9).

[0076] The nucleotide sequences encoding the above protein degradation tags are as follows:

[0077] The nucleic acid sequence encoding the SEQ ID NO: 1 sequence is as follows:

[0078] GCAGCAAATGATGAAAATTATGGTAGCGCACTGGCAGCA (SEQ ID NO: 10);

[0079] The nucleic acid sequence encoding the SEQ ID NO: 2 sequence is as follows:

[0080] GCAGCAAATGATGAAAATTATGATAGCGAAAGCGGTAGCAATTATGCAC TGGCAGCA (SEQ ID NO: 11);

[0081] The nucleic acid sequence encoding the SEQ ID NO: 3 sequence is as follows:

[0082] GCAGCAAATGATGAAAATTATGGTAGCGCAGATGCAAGC (SEQ ID NO: 12);

[0083] The nucleic acid sequence encoding the SEQ ID NO: 4 sequence is as follows:

[0084] GCAGCAAATGATGAAAATTATGATAGCGAAAGCGGTAGCAATTATGCAG ATGCAAGC(SEQ ID NO: 13);

[0085] The nucleic acid sequence encoding the SEQ ID NO: 5 sequence is as follows:

[0086] GCCGCCAATGACGAAAATTACGCATTGGCAGCC(SEQ ID NO: 14);

[0087] The nucleic acid sequence encoding the SEQ ID NO: 6 sequence is as follows:

[0088] GCGGCGAACGATGAGAACTATAATTACGCTTTGGCTGCT(SEQ ID NO: 15);

[0089] The nucleic acid sequence encoding the SEQ ID NO: 7 sequence is as follows:

[0090] GCAGCAAACGATGAGAACTATTCGGAATCGGAGAGTGAAAACTACGCG TTGGCTGCA(SEQ ID NO: 16);

[0091] The nucleic acid sequence encoding the SEQ ID NO: 8 sequence is as follows:

[0092] GCCGCTAATGATGAAAACTACAATTATGCGGATGCATCC(SEQ ID NO: 17);

[0093] The nucleic acid sequence encoding the SEQ ID NO: 9 sequence is as follows:

[0094] GCAGCCAACGACGAAAACTATAGCGAAAGCGAGTCAGAGAACTATGCG GATGCCAGT(SEQ ID NO: 18);

[0095] Preferably, the dual promoter plasmid can be the pACYCDuet-1 plasmid.

[0096] Since the nucleic acid sequence of the protein degradation tag is directly linked after the nucleic acid sequence of the expressed gene (lysA gene or metL gene). Therefore, the primers for synthesizing and amplifying the expressed gene also contain the part that can amplify the protein degradation tag, and the primers can amplify both the expressed gene and the protein degradation tag at the same time. The primers are synthesized by General Biology (Anhui) Co., Ltd., and the primers are shown in Tables 1 and 2.

[0097] Example 3

[0098] This embodiment provides a method for constructing recombinant Escherichia coli, which includes the following steps:

[0099] S1. Integrate the gene cluster ectABC into the plasmid pRSFDuet-1 to obtain the plasmid pRSF-ectABC;

[0100] S2. Connect the fragment of the diaminopimelate decarboxylase gene lysA from Escherichia coli to the back of the first T7 promoter of the plasmid pETDuet-1 through homologous recombination technology to obtain plasmid A;

[0101] S3. Connect the fragment of the homoserine dehydrogenase gene metL from Escherichia coli to the back of the second T7 promoter of plasmid A through homologous recombination technology to obtain plasmid B;

[0102] S4. Transform the plasmid obtained in step S1 and the plasmid obtained in step S3 into competent Escherichia coli, and culture the Escherichia coli in a liquid medium to obtain the recombinant Escherichia coli.

[0103] Preferably, the plasmid A contains the lysA gene fragment and the nucleic acid fragment encoding the protein degradation tag A.

[0104] Preferably, the plasmid B contains the lysA gene fragment, the nucleic acid fragment encoding the protein degradation tag A, the metL gene fragment, and the nucleic acid fragment encoding the protein degradation tag B.

[0105] Preferably, the protein degradation tag A or B is independently selected from any one of the protein degradation tags LAA, LAA+2, LAA+8, DAS+2, DAS+8 and their mutant tags LAA+2*, LAA+8*, DAS+2*, DAS+8*.

[0106] Preferably, the protein degradation tag A or B is independently selected from any one of the protein degradation tags LAA+2*, LAA+8*, DAS+2*, DAS+8*.

[0107] Preferably, the competent Escherichia coli is E.coli BL21(DE3)ΔlysAΔmetL.

[0108] The nucleic acid sequence of ectABC is as follows:

[0109] atgaacgcaaccacagagccctttacaccctccgccgacctggccaagcccagcgtggccgatgccgtggtcggccatgaggcctcacc

[0110] gctcttcatccgcaagccaagccccgatgacggctggggcatctacgagctggtcaagtcctgtccgcctctcgacgtcaattccgcctacgcctat

[0111] ctgttgctggccacccagttccgcgatagctgcgccgtggcgaccaacgaagagggcgagatcgtcggcttcgtttccggctacgtgaagagcaa

[0112] cgcccccgatacctatttcctctggcaggttgccgtgggcgagaaggcacgtggcaccggcctggcccgtcgtctggtggaagccgtgatgacac

[0113] gcccggaaatggccgaggtccaccatctcgagaccactatcacgcccgacaaccaggcgtcctggggcttgttccgccgtctcgccgatcgctg

[0114] gcaggcgccgttgaacagccgcgaatacttctccaccgatcaactcggcggtgagcatgacccggaaaacctcgttcgcatcggcccgttccaga

[0115] ccgaccagatctgagccgggacgccgcctggccggcccggtacgggccggcaacccgtcttttcgttttatcactttccccccacaggaggtcgc

[0116] aatgcagacccagattctcgaacgcatggagtccgacgttcggacctactcccgctccttcccggtcgtcttcaccaaggcgcgcaatgcccgcct

[0117] gaccgacgaggaagggcgcgagtacatcgacttcctggccggtgccggcaccctgaactacggccacaacaacccgcacctcaagcaggcgc

[0118] tgctcgactatatcgacagcgacggcatcgtccacggcctggacttctggactgcggccaagcgcgactatctggaaaccctggaagaggtgatc

[0119] ctcaagccgcgcggtctcgactacaaggtgcatctgcccggaccgactggcaccaacgccgtcgaggcggccattcgcctggcccgggtcgcc

[0120] aaggggcgccacaatatcgtctccttcaccaacggctttcatggcgtcaccatgggcgcgctggcgaccaccggtaaccgcaagttccgcgagg

[0121] ccaccggtggcgtgccgacccaggctgcttccttcatgccgttcgatggctacctcggcagcagcaccgacaccctcgactacttcgagaagctg

[0122] ctcggcgacaagtccggcggcctggacgtgcccgcggcggtgatcgtcgagacagtgcagggcgagggcggtatcaatgtcgccggcctgga

[0123] gtggctcaagcgcctcgagagcatctgccgcgccaatgacatcctgctgatcatcgacgacatccaggcgggctgcggccggaccggcaagttc

[0124] ttcagcttcgagcatgccggcatcacgccggatatcgtgaccaactccaagtcgctgtccggttacggcctgccgttcgctcacgtcctgatgcgcc

[0125] ccgagctcgacaagtggaagcccggtcagtacaacggcaccttccgcggcttcaacctggctttcgccactgctgctgccgccatgcgcaagtac

[0126] tggagcgacgacaccttcgagcgtgacgtgcagcgcaaggctcgcatcgtcgaggaacgcttcggcaagatcgccgcctggctgagcgagaac

[0127] ggcatcgaggcctccgagcgcggccgcgggctgatgcggggcatcgacgtgggttccggcgatatcgccgacaagatcacccaccaagccttc

[0128] gagaacgggttgatcatcgaaaccagcggtcaggacggcgaagtggtcaagtgcctgtgcccgctgaccattcccgacgaagacctggtcgag

[0129] ggactcgacatcctcgagaccagcaccaagcaggcctttagctgatcgcctgaggtgcgccatcgggcctgtccatggcatcctgtatcggtcgg

[0130] ccgtgcgcggccggccagtcattgattcactggagaatcgacatgatcgttcgcaatctcgaagaagcgcgccagaccgaccgtctggtcaccgc

[0131] cgaaaacggcaactgggacagcacccgcctgtcgctggccgaagatggtggcaactgctccttccacatcacccgcatcttcgagggtaccgag

[0132] acccacatccactataagcatcacttcgaggctgtttattgcatcgaaggcgagggcgaagtggaaaccctggccgatggcaagatctggcccatc

[0133] aagccgggtgacatctacatcctcgaccagcacgacgagcacctgctgcgcgccagcaagaccatgcacctggcctgcgtgttcacgccgggc

[0134] ctgaccggcaacgaagtgcaccgcgaagacggttcctacgcacctgccgacgaagccgacgaccagaagccgctgtaa(SEQ ID NO: 19).

[0135] Example 4 Effects of Different Protein Degradation Tags on Ectoine Yield

[0136] Using Escherichia coli E. coli BL21(DE3) as the expression strain, construct the expression plasmids pRSF-ectABC, pACYC-lysA-ssrA, pACYC-metL-ssrA, pACYC-lysA-ssrA1-metL-ssrA2. The specific steps are as follows:

[0137] S1 Integrate the gene cluster ectABC from Halomonas elongata into the pRSFDuet-1 plasmid, constructed by General Company, and the constructed plasmid is pRSF-ectABC;

[0138] S2 Mix the obtained recombinant vector pRSF-ectABC with the competent cells of E. coli BL21(DE3)ΔlysA, E. coli BL21(DE3)ΔmetL, and E. coli BL21(DE3)ΔlysAΔmetL, place them on ice for 30 min, then quickly heat shock (42 °C, 90 s), then quickly place them on ice, let stand for 2 min, and then aseptically add 1 mL of LB liquid medium. Recover the culture at 37 °C and 220 rpm for 1 h to obtain strains Ect01, Ect02, and Ect03 respectively;

[0139] Nine pairs of primers (with the same upstream primer sequences and different downstream primer sequences, capable of simultaneously amplifying lysA and ssrA) were designed for the lysA gene encoding diaminopimelate decarboxylase derived from Escherichia coli for cloning. Different lysA fragments (including the ssrA nucleic acid fragment) obtained by cloning were respectively ligated behind the first T7 promoter of plasmid pACYCDuet-1 through homologous recombination technology to obtain nine plasmids, pACYC-lysA-LAA, pACYC-lysA-LAA+2, pACYC-lysA-LAA+8, pACYC-lysA-DAS+2, pACYC-lysA-DAS+8, pACYC-lysA-LAA+2*, pACYC-lysA-LAA+8*, pACYC-lysA-DAS+2*, pACYC-lysA-DAS+8*. The obtained plasmids were respectively transformed into strain Ect01 to obtain strains Ect0101, Ect0102, Ect0103, Ect0104, Ect0105, Ect0106, Ect0107, Ect0108, Ect0109. The primers used in this step are shown in Table 1 below;

[0140] Table 1: Primers used for amplifying lysA-ssrA

[0141]

[0142]

[0143] Nine pairs of primers (with the same upstream primer sequences and different downstream primer sequences, capable of simultaneously amplifying metL and ssrA) were designed for the metL gene encoding homoserine dehydrogenase derived from Escherichia coli for cloning. Different metL fragments (including the ssrA nucleic acid fragment) obtained by cloning were ligated behind the second T7 promoter of plasmid pACYCDuet-1 to obtain nine different plasmids, pACYC-metL-LAA, pACYC-metL-LAA+2, pACYC-metL-LAA+8, pACYC-metL-DAS+2, pACYC-metL-DAS+8, pACYC-metL-LAA+2*, pACYC-metL-LAA+8*, pACYC-metL-DAS+2*, pACYC-metL-DAS+8*. The obtained plasmids were transformed into strain Ect02 to obtain strains Ect0201, Ect0202, Ect0203, Ect0204, Ect0205, Ect0206, Ect0207, Ect0208, Ect0209. The primers used in this step are shown in Table 2 below;

[0144] Table 2: Primers used for amplifying metL-ssrA

[0145]

[0146]

[0147] Nine pairs of primers (with the same upstream primer sequences and different downstream primer sequences, capable of simultaneously amplifying metL and ssrA) were designed for the homoserine dehydrogenase gene metL derived from Escherichia coli for cloning, and different cloned metL fragments (including the ssrA nucleic acid fragment) were ligated behind the second T7 promoter of the plasmid pACYC-lysA-LAA through homologous recombination technology to obtain nine different plasmids, pACYC-lysA-LAA-metL-LAA, pACYC-lysA-LAA-metL-LAA+2, pACYC-lysA-LAA-metL-LAA+8, pACYC-lysA-LAA-metL-DAS+2, pACYC-lysA-LAA-metL-DAS+8, pACYC-lysA-LAA-metL-LAA+2*, pACYC-lysA-LAA-metL-LAA+8*, pACYC-lysA-LAA-metL-DAS+2*, pACYC-lysA-LAA-metL-DAS+8*; the obtained plasmids were transformed into the Ect03 strain to obtain the Ect0301, Ect0302, Ect0303, Ect0304, Ect0305, Ect0306, Ect0307, Ect0308, and Ect0309 strains respectively. The primers in Table 2 were used in this step.

[0148] Nine pairs of primers were designed for the homoserine dehydrogenase gene metL from Escherichia coli (the upstream primer sequences were the same, while the downstream primer sequences were different, and they could amplify metL and ssrA simultaneously) for cloning. Through homologous recombination technology, different cloned metL fragments (including the ssrA nucleic acid fragment) were ligated behind the second T7 promoter of plasmid pACYC-lysA-LAA+2, resulting in nine different plasmids, namely pACYC-lysA-LAA+2-metL-LAA, pACYC-lysA-LAA+2-metL-LAA+2, pACYC-lysA-LAA+2-metL-LAA+8, pACYC-lysA-LAA+2-metL-DAS+2, pACYC-lysA-LAA+2-metL-DAS+8, pACYC-lysA-LAA+2-metL-LAA+2*, pACYC-lysA-LAA+2-metL-LAA+8*, pACYC-lysA-LAA+2-metL-DAS+2*, and pACYC-lysA-LAA+2-metL-DAS+8*. The obtained plasmids were transformed into Ect03 strain, yielding strains Ect0310, Ect0311, Ect0312, Ect0313, Ect0314, Ect0315, Ect0316, Ect0317, and Ect0318 respectively. The primers in Table 2 were used in this step.

[0149] Nine pairs of primers were designed for the homoserine dehydrogenase gene metL from Escherichia coli (the upstream primer sequences were the same, while the downstream primer sequences were different, and metL and ssrA could be amplified simultaneously) for cloning. Through homologous recombination technology, different cloned metL fragments (including the ssrA nucleic acid fragment) were ligated behind the second T7 promoter of plasmid pACYC-lysA-LAA+8 to obtain nine different plasmids, pACYC-lysA-LAA+8-metL-LAA, pACYC-lysA-LAA+8-metL-LAA+2, pACYC-lysA-LAA+8-metL-LAA+8, pACYC-lysA-LAA+8-metL-DAS+2, pACYC-lysA-LAA+8-metL-DAS+8, pACYC-lysA-LAA+8-metL-LAA+2*, pACYC-lysA-LAA+8-metL-LAA+8*, pACYC-lysA-LAA+8-metL-DAS+2*, pACYC-lysA-LAA+8-metL-DAS+8*. The obtained plasmids were transformed into strain Ect03 to obtain strains Ect0319, Ect0320, Ect0321, Ect0322, Ect0323, Ect0324, Ect0325, Ect0326, and Ect0327, respectively. The primers in Table 2 were used in this step.

[0150] Nine pairs of primers (with the same upstream primer sequences but different downstream primer sequences, capable of simultaneously amplifying metL and ssrA) were designed for the homoserine dehydrogenase gene metL derived from Escherichia coli for cloning, and different cloned metL fragments (including the ssrA nucleic acid fragment) were ligated behind the second T7 promoter of the plasmid pACYC-lysA-DAS+2 through homologous recombination technology to obtain nine different plasmids, pACYC-lysA-DAS+2-metL-LAA, pACYC-lysA-DAS+2-metL-LAA+2, pACYC-lysA-DAS+2-metL-LAA+8, pACYC-lysA-DAS+2-metL-DAS+2, pACYC-lysA-DAS+2-metL-DAS+8, pACYC-lysA-DAS+2-metL-LAA+2*, pACYC-lysA-DAS+2-metL-LAA+8*, pACYC-lysA-DAS+2-metL-DAS+2*, pACYC-lysA-DAS+2-metL-DAS+8*. The obtained plasmids were transformed into the Ect03 strain to obtain strains Ect0328, Ect0329, Ect0330, Ect0331, Ect0332, Ect0333, Ect0334, Ect0335, and Ect0336 respectively. The primers in Table 2 were used in this step.

[0151] Nine pairs of primers were designed for the homoserine dehydrogenase gene metL from Escherichia coli (the upstream primer sequences were the same, while the downstream primer sequences were different, and they could amplify metL and ssrA simultaneously) for cloning. Through homologous recombination technology, different cloned metL fragments (including the ssrA nucleic acid fragment) were ligated behind the second T7 promoter of plasmid pACYC-lysA-DAS+8 to obtain nine different plasmids, namely pACYC-lysA-DAS+8-metL-LAA, pACYC-lysA-DAS+8-metL-LAA+2, pACYC-lysA-DAS+8-metL-LAA+8, pACYC-lysA-DAS+8-metL-DAS+2, pACYC-lysA-DAS+8-metL-DAS+8, pACYC-lysA-DAS+8-metL-LAA+2*, pACYC-lysA-DAS+8-metL-LAA+8*, pACYC-lysA-DAS+8-metL-DAS+2*, and pACYC-lysA-DAS+8-metL-DAS+8*. The obtained plasmids were transformed into strain Ect03 to obtain strains Ect0337, Ect0338, Ect0339, Ect0340, Ect0341, Ect0342, Ect0343, Ect0344, and Ect0345 respectively. The primers in Table 2 were used in this step.

[0152] S10 Design 9 pairs of primers (with the same upstream primer sequences and different downstream primer sequences, capable of simultaneously amplifying metL and ssrA) for the homoserine dehydrogenase gene metL from Escherichia coli for cloning, and ligate the cloned different metL fragments (including the ssrA nucleic acid fragment) behind the second T7 promoter of the plasmid pACYC-lysA-LAA+2* through homologous recombination technology to obtain 9 different plasmids pACYC-lysA-LAA+2*-metL-LAA, pACYC-lysA-LAA+2*-metL-LAA+2, pACYC-lysA-LAA+2*-metL-LAA+8, pACYC-lysA-LAA+2*-metL-DAS+2, pACYC-lysA-LAA+2*-metL-DAS+8, pACYC-lysA-LAA+2*-metL-LAA+2*, pACYC-lysA-LAA+2*-metL-LAA+8*, pACYC-lysA-LAA+2*-metL-DAS+2*, pACYC-lysA-LAA+2*-metL-DAS+8*. Transform the obtained plasmids into the Ect03 strain to obtain the Ect0346, Ect0347, Ect0348, Ect0349, Ect0350, Ect0351, Ect0352, Ect0353, and Ect0354 strains respectively. The primers in Table 2 are used in this step.

[0153] S11 Designed 9 pairs of primers for the homoserine dehydrogenase gene metL from Escherichia coli (the upstream primer sequences are the same, and the downstream primers are different, which can amplify metL and ssrA simultaneously) for cloning, and ligated the cloned different metL fragments (including the ssrA nucleic acid fragment) behind the second T7 promoter of the plasmid pACYC-lysA-LAA+8* through homologous recombination technology to obtain 9 different plasmids pACYC-lysA-LAA+8*-metL-LAA, pACYC-lysA-LAA+8*-metL-LAA+2, pACYC-lysA-LAA+8*-metL-LAA+8, pACYC-lysA-LAA+8*-metL-DAS+2, pACYC-lysA-LAA+8*-metL-DAS+8, pACYC-lysA-LAA+8*-metL-LAA+2*, pACYC-lysA-LAA+8*-metL-LAA+8*, pACYC-lysA-LAA+8*-metL-DAS+2*, pACYC-lysA-LAA+8*-metL-DAS+8*. The obtained plasmids were transformed into the Ect03 strain to obtain the strains Ect0355, Ect0356, Ect0357, Ect0358, Ect0359, Ect0360, Ect0361, Ect0362, and Ect0363 respectively. The primers in Table 2 were used in this step.

[0154] Nine pairs of primers were designed for the homoserine dehydrogenase gene metL from Escherichia coli (the upstream primer sequences were the same, and the downstream primers were different, which could amplify metL and ssrA simultaneously) for cloning. Different metL fragments (including the ssrA nucleic acid fragment) cloned were ligated behind the second T7 promoter of plasmid pACYC-lysA-DAS+2* through homologous recombination technology to obtain nine different plasmids pACYC-lysA-DAS+2*-metL-LAA, pACYC-lysA-DAS+2*-metL-LAA+2, pACYC-lysA-DAS+2*-metL-LAA+8, pACYC-lysA-DAS+2*-metL-DAS+2, pACYC-lysA-DAS+2*-metL-DAS+8, pACYC-lysA-DAS+2*-metL-LAA+2*, pACYC-lysA-DAS+2*-metL-LAA+8*, pACYC-lysA-DAS+2*-metL-DAS+2*, pACYC-lysA-DAS+2*-metL-DAS+8*. The obtained plasmids were transformed into Ect03 strain to obtain Ect0364, Ect0365, Ect0366, Ect0367, Ect0368, Ect0369, Ect0370, Ect0371, and Ect0372 strains respectively. The primers in Table 2 were used in this step.

[0155] S13 designed 9 pairs of primers for the homoserine dehydrogenase gene metL from Escherichia coli (the upstream primer sequences were the same, and the downstream primers were different, which could amplify metL and ssrA simultaneously) for cloning, and through homologous recombination technology, the cloned different metL fragments (including ssrA nucleic acid fragments) were ligated behind the second T7 promoter of plasmid pACYC-lysA-DAS+8* to obtain 9 different plasmids pACYC-lysA-DAS+8*-metL-LAA, pACYC-lysA-DAS+8*-metL-LAA+2, pACYC-lysA-DAS+8*-metL-LAA+8, pACYC-lysA-DAS+8*-metL-DAS+2, pACYC-lysA-DAS+8*-metL-DAS+8, pACYC-lysA-DAS+8*-metL-LAA+2*, pACYC-lysA-DAS+8*-metL-LAA+8*, pACYC-lysA-DAS+8*-metL-DAS+2*, pACYC-lysA-DAS+8*-metL-DAS+8*. The obtained plasmids were transformed into Ect03 strain to obtain strains Ect0373, Ect0374, Ect0375, Ect0376, Ect0377, Ect0378, Ect0379, Ect0380, and Ect0381 respectively. The primers in Table 2 were used in this step.

[0156] S14 Fermentation verification was carried out on the above strains:

[0157] Flask fermentation medium: Yeast extract 2 g / L, KH 2 PO 4 3 g / L, Na 2 HPO 4 ·12H 2 O 25 g / L, (NH 4 ) 2 SO 4 16 g / L, MgSO 4 ·7H 2 O 1 g / L, D-glucose 20 g / L, trace element solution 1 ml, biotin 0.1 mg;

[0158] Fermentation culture: The seed culture was inoculated into the batch fermentation medium at an inoculation amount of 20%, 1 mL of trace elements was added, cultured at 35 - 39 °C for 5 - 7 h at a rotation speed of 220 rpm, and induced to culture at 35 - 39 °C by adding 150 μL of 0.2 mmol / L IPTG, thus obtained.

[0159] 5 L tank fermentation medium: Yeast extract 10 g / L, peptone 5 g / L, Na2 HPO 4 ·12H 2 O 25 g / L, KH 2 PO 4 2 g / L, citric acid 2 g / L, NaCl 1 g / L, MgSO 4 ·7H 2 O 1 g / L, biotin 0.1 mg, D - glucose 25 g / L, trace element solution 1 ml;

[0160] Trace elements: ammonium ferric citrate 5.6 g / L, zinc sulfate heptahydrate 0.9 g / L, CoCl 2 ·6H 2 O 0.2 g / L, manganese chloride tetrahydrate 1.0 g / L, CuCl 2 ·2H 2 O 0.10 g / L, boric acid 0.2 g / L, Na 2 MoO4·2H 2 O 0.2 g / L;

[0161] Fermenter culture: Inoculate the seed culture into a fed - batch fermenter at an inoculation amount of 20%. After culturing at 37°C for 5 - 7 h, add 3 ml of 0.2 mmol / L IPTG and induce the culture at 37°C. Control the pH at 7.0 and the dissolved oxygen at 20 - 40%. The rotation speed is related to the dissolved oxygen, and then it is obtained. The fermentation results are shown in Table 3 below:

[0162] Table 3: The constructed strains, the plasmids they contain, and the ECT yields

[0163]

[0164] Judging from the results in Table 3, the yield of the plasmid strain with the protein degradation tag is significantly higher than that of the directly knocked - out strain as a whole. At the same time, the DAS + 8* tag has the best regulatory effect on the LysA protein, and the LAA + 2* tag has the best regulatory effect on the MetL protein.

[0165] Table 4: The constructed strains, the plasmids they contain, and the ECT yields

[0166]

[0167]

[0168]

[0169]

[0170]

[0171]

[0172] By transferring plasmids into the strain with lysA and metL genes knocked out for gene complementation, and using a degrading protein to regulate the expression of these two genes on the plasmid, from the results, the overall regulatory effect of DAS + 8* tag is the best, and the combination of DAS + 8* and LAA + 8* gives the highest-yielding strain.

[0173] Fermentation verification in Example 5

[0174] The strain Ect0343 obtained in Example 4 (containing plasmids pRSF-ectABC, pACYC-lysA-DAS + 8-metL-LAA + 8*) was fermented in a 5 L fermenter:

[0175] Fermentation medium: Yeast extract 10 g / L, peptone 5 g / L, Na 2 HPO 4 ·12H 2 O 25 g / L, KH 2 PO 4 2 g / L, citric acid 2 g / L, NaCl 1 g / L, MgSO 4 ·7H 2 O 1 g / L, biotin 0.1 mg, D-glucose 25 g / L, trace element solution 1 ml;

[0176] Trace elements: Ferric ammonium citrate 5.6 g / L, zinc sulfate heptahydrate 0.9 g / L, CoCl 2 ·6H 2 O 0.2 g / L, manganese chloride tetrahydrate 1.0 g / L, CuCl 2 ·2H 2 O 0.10 g / L, boric acid 0.2 g / L, Na 2 MoO4·2H 2 O 0.2 g / L;

[0177] Fermenter culture: The seed culture was inoculated into the fed-batch fermenter at an inoculation amount of 20%. After culturing at 37 °C for 5 - 7 h, 3 ml of 0.2 mmol / L IPTG was added for induction culture at 37 °C. The pH was controlled at 7.0, and the dissolved oxygen was controlled at 20 - 40%. The rotation speed was associated with the dissolved oxygen, and thus obtained; The fermentation results are as follows in the table:

[0178] Table 5: Fermentation results of strain ect0603

[0179] Strain number ECT yield (g / L) Ect0343 86.9

[0180] As can be seen from Table 5, when the strain Ect0343 was verified by 5-L fermenter fermentation, the ectoine yield reached 86.9 g / L at 60 h of fermentation.

[0181] The present invention lies in the first use of the protein degradation tag ssrA to regulate the expression levels of the diaminopimelate decarboxylase gene lysA and the homoserine dehydrogenase gene metL, and at the same time, the purpose of increasing the ectoine yield is achieved through this combined regulation.

Claims

1. A genetically engineered bacterium, characterized in that: The genetically engineered bacteria contain expression vector 1 and expression vector 2; The expression vector 1 is an expression vector for overexpressing the gene cluster ectABC; The expression vector 2 comprises a dual promoter plasmid, a diaminopimelate decarboxylase gene lysA fragment, a nucleic acid fragment encoding a protein degradation tag A, a homoserine dehydrogenase gene metL fragment, and a nucleic acid fragment encoding a protein degradation tag B; The diaminopimelate decarboxylase gene lysA fragment and the protein degradation tag A encoding nucleic acid fragment are sequentially connected in series and located behind the first promoter of the dual-promoter plasmid, and the homoserine dehydrogenase gene metL fragment and the protein degradation tag B encoding nucleic acid fragment are sequentially connected in series and located behind the second promoter of the dual-promoter plasmid; The amino acid sequences encoded by the nucleic acid fragment encoding protein degradation tag A and the nucleic acid fragment encoding protein degradation tag B are different; The protein degradation tag A is LAA+8*, and the amino acid sequence of the protein degradation tag LAA+8* is shown in SEQ ID NO: 2; The protein degradation tag B is DAS+8*, and the amino acid sequence of the protein degradation tag DAS+8* is shown in SEQ ID NO:

4.

2. The genetically engineered bacterium according to claim 1, characterized in that The encoding nucleic acid sequence of the protein degradation tag is as follows: The nucleic acid sequence encoding the sequence of SEQ ID NO: 2 is shown in SEQ ID NO: 11; The nucleic acid sequence encoding the sequence of SEQ ID NO:4 is shown in SEQ ID NO:

13.

3. A method for constructing the genetically engineered bacteria according to claim 1, characterized in that: The steps include: S1. Integrate the gene cluster ectABC into the pRSFDuet-1 plasmid to obtain the plasmid pRSF-ectABC; S2. The lysA fragment of the diaminopimelate decarboxylase gene was connected to the first T7 promoter of the plasmid pETDuet-1 by homologous recombination technology to obtain plasmid A; S3. The homoserine dehydrogenase gene metL fragment was connected to the second T7 promoter of plasmid A by homologous recombination technology to obtain plasmid B; S4. Transforming the plasmid of step S1 and the plasmid of step S3 into competent host cells, and culturing the host cells in liquid culture medium to obtain the genetically engineered bacteria.

4. The construction method according to claim 3, characterized in that: The plasmid A contains a lysA gene fragment and a nucleic acid fragment encoding a protein degradation tag A; the plasmid B contains a lysA gene fragment, a nucleic acid fragment encoding a protein degradation tag A, a metL gene fragment and a nucleic acid fragment encoding a protein degradation tag B; The protein degradation tag A is LAA+8*, and the amino acid sequence of the protein degradation tag LAA+8* is shown in SEQ ID NO: 2; The protein degradation tag B is DAS+8*, and the amino acid sequence of the protein degradation tag DAS+8* is shown in SEQ ID NO: 4; The sequence of the nucleic acid fragment encoding the protein degradation tag A is shown in SEQ ID NO: 11; The sequence of the nucleic acid fragment encoding the protein degradation tag B is shown in SEQ ID NO: 13; The competent host cell is E. coli BL21 (DE3) ΔlysAΔmetL.

5. A method for preparing tetrahydropyrimidine, characterized in that: The step of using the genetically engineered bacteria described in claim 1 to carry out fermentation.

Images