Anti-tetanus toxin neutralizing antibody and application

Abstract

The present disclosure provides an anti-tetanus toxin neutralizing antibody as a new generation of tetanus passive immune formulations. The antibody can be completely human-derived, can be specifically combined with the full length of tetanus toxin and AB fragments thereof, has the characteristics of high affinity, high specificity and small toxic and side effects, avoids the problems of large adverse reaction and short half-life period of animal-derived monoclonal antibodies, can be prepared in a large scale through mammalian cells, and has clear and stable components.

Description

Technical Field

[0001] The present invention belongs to the field of immunology and genetic engineering, and specifically relates to anti-tetanus toxin neutralizing antibodies and applications. Background Art

[0002] Tetanus is a potentially fatal disease, a bacterial infection caused by Clostridium tetani. Clostridium tetani is widely present in the natural environment. Clostridium tetani invades the human body through breaks in the skin or mucous membranes, reproduces in an anaerobic environment and produces exotoxins, causing an acute, toxic disease characterized by sustained tonic contractions and paroxysmal spasms of skeletal muscles throughout the body. Severe patients may experience laryngeal spasm, suffocation, lung infection and organ failure. In the absence of medical intervention, the mortality rate of severe patients is close to 100%. Even with active comprehensive treatment, the global mortality rate is still 30% to 50%.

[0003] At present, passive immunization preparations used clinically to prevent and treat tetanus mainly include tetanus antitoxin (TAT), horse tetanus immunoglobulin F(ab')2 and human tetanus immunoglobulin (HTIG). However, the above passive immunization preparations have great defects: due to different physical constitutions of the human body and different acceptance of horse serum TAT, many people will have adverse reactions such as allergic reactions, anaphylactic shock or serum sickness. Therefore, horse serum TAT is not suitable for everyone. HTIG can overcome the adverse reactions of horse serum TAT during clinical use, but due to the difficulty and high price of human blood sources, there is a risk of exogenous virus contamination. Therefore, the industrial production and clinical application of HTIG are greatly limited. Clinically, there is an urgent need for tetanus passive immunization preparations with better safety, lower cost and industrial production. Summary of the invention

[0004] In order to solve at least one of the above problems, the present disclosure provides an anti-tetanus toxin neutralizing antibody and its application. The neutralizing antibody provided by the present disclosure has the advantages of high affinity, high specificity, and small toxic side effects, while avoiding the defect of large adverse reactions of animal-derived monoclonal antibodies.

[0005] According to one aspect of the present disclosure, an anti-tetanus toxin neutralizing antibody or an antigen-binding fragment thereof is provided, wherein the antibody or the antigen-binding fragment thereof comprises: (1) the following three heavy chain variable region complementarity determining regions (HCDRs): HCDR1 having an amino acid sequence of HCDR1 contained in a heavy chain variable region as shown in any one of SEQ ID NOs: 6, 13, 20, 27, and 34, or an amino acid sequence having one or more amino acids substituted, deleted, or added compared to the amino acid sequence of HCDR1 contained in the heavy chain variable region; HCDR2 having an amino acid sequence of HCDR2 contained in a heavy chain variable region as shown in any one of SEQ ID NOs: 6, 13, 20, 27, and 34, or an amino acid sequence having one or more amino acids substituted, deleted, or added compared to the amino acid sequence of HCDR2 contained in the heavy chain variable region; HCDR3 having an amino acid sequence of SEQ ID NOs: 6, 13, 20, 27, 34, or an amino acid sequence having one or more amino acids substituted, deleted or added compared to the amino acid sequence of HCDR3 contained in the heavy chain variable region; and / or (2) the following three light chain variable region complementarity determining regions (LCDRs): LCDR1 having an amino acid sequence of LCDR1 contained in a light chain variable region as shown in any one of SEQ ID NOs: 7, 14, 21, 28, 35, or an amino acid sequence having one or more amino acids substituted, deleted or added compared to the amino acid sequence of LCDR1 contained in the light chain variable region; LCDR2 having an amino acid sequence of LCDR2 contained in a light chain variable region as shown in any one of SEQ ID NOs: 7, 14, 21, 28, 35, or an amino acid sequence having one or more amino acids substituted, deleted or added compared to the amino acid sequence of LCDR2 contained in the light chain variable region; LCDR3 having an amino acid sequence of SEQ ID NO: The amino acid sequence of LCDR3 contained in the light chain variable region shown in any one of 7, 14, 21, 28, and 35, or an amino acid sequence having one or more amino acids substituted, deleted or added compared to the amino acid sequence of LCDR3 contained in the light chain variable region.

[0006] In some embodiments, each CDR is defined by any numbering system routinely used by those skilled in the art. Exemplary numbering systems include, but are not limited to, Kabat, AbM, Chothia, Contact, IMGT, or a combination thereof.

[0007] In some embodiments, the antibody or antigen-binding fragment thereof comprises: three HCDRs contained in the heavy chain variable region as shown in SEQ ID NO: 6, or an amino acid sequence having one or several amino acid substitutions, deletions or additions compared to the amino acid sequence of the three HCDRs contained in the heavy chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity thereto, and three LCDRs contained in the light chain variable region as shown in SEQ ID NO: 7, or an amino acid sequence having one or several amino acid substitutions, deletions or additions compared to the amino acid sequence of the three LCDRs contained in the light chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity thereto.

[0008] In some embodiments, the antibody or antigen-binding fragment thereof comprises: three HCDRs contained in the heavy chain variable region as shown in SEQ ID NO: 13, or an amino acid sequence having one or several amino acid substitutions, deletions or additions compared to the amino acid sequence of the three HCDRs contained in the heavy chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity thereto, and three LCDRs contained in the light chain variable region as shown in SEQ ID NO: 14, or an amino acid sequence having one or several amino acid substitutions, deletions or additions compared to the amino acid sequence of the three LCDRs contained in the light chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity thereto.

[0009] In some embodiments, the antibody or antigen-binding fragment thereof comprises: three HCDRs contained in the heavy chain variable region as shown in SEQ ID NO: 20, or an amino acid sequence having one or several amino acid substitutions, deletions or additions compared to the amino acid sequence of the three HCDRs contained in the heavy chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity thereto, and three LCDRs contained in the light chain variable region as shown in SEQ ID NO: 21, or an amino acid sequence having one or several amino acid substitutions, deletions or additions compared to the amino acid sequence of the three LCDRs contained in the light chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity thereto.

[0010] In some embodiments, the antibody or antigen-binding fragment thereof comprises: three HCDRs contained in the heavy chain variable region as shown in SEQ ID NO: 27, or an amino acid sequence having one or several amino acid substitutions, deletions or additions compared to the amino acid sequence of the three HCDRs contained in the heavy chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity thereto, and three LCDRs contained in the light chain variable region as shown in SEQ ID NO: 28, or an amino acid sequence having one or several amino acid substitutions, deletions or additions compared to the amino acid sequence of the three LCDRs contained in the light chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity thereto.

[0011] In some embodiments, the antibody or antigen-binding fragment thereof comprises: three HCDRs contained in the heavy chain variable region as shown in SEQ ID NO: 34, or an amino acid sequence having one or several amino acid substitutions, deletions or additions compared to the amino acid sequence of the three HCDRs contained in the heavy chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity thereto, and three LCDRs contained in the light chain variable region as shown in SEQ ID NO: 35, or an amino acid sequence having one or several amino acid substitutions, deletions or additions compared to the amino acid sequence of the three LCDRs contained in the light chain variable region, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity thereto.

[0012] In some embodiments, the antibody or antigen-binding fragment thereof comprises: (1) the following three heavy chain variable region complementarity determining regions (HCDRs): HCDR1, which has an amino acid sequence as shown in the general formula (1), wherein the general formula (1) is X1X2X3X4X5X6X7X8YX9X 10 As shown, wherein X1 is selected from G, X2 is selected from F or G, X3 is selected from S or T, X4 is selected from F, I or M, X5 is selected from G, S or T, X6 is selected from T, S or D, X7 is selected from Q, D, Y or H, X8 is selected from S, D, Y or R, X9 is absent or selected from Y, X 10 Not present or selected from Y; HCDR2, which has an amino acid sequence as shown in the general formula (2), wherein the general formula (2) is X1IX2X3YX4GX5X6X7X8YX9X 10 X 11As shown, wherein X1 is selected from I, X2 is selected from S, H or F, X3 is selected from SYH, X4 is selected from TLS, X5 is selected from S, E or G, X6 is selected from S or T, X7 is selected from Y, T or R, X8 is absent or selected from G or I, X9 is absent or selected from T, X 10 Not present or selected from I, X 11 Not present or selected from I; HCDR3, which has an amino acid sequence as shown in the general formula (3), wherein the general formula (3) is X1X2X3X4X5X6X7X8X9X 10 X 11 X 12 X13X 14 X 15 X 16 X 17 X 18 X 19 X 20 X 21 X 22 X 23 As shown, wherein X1 is selected from A or T, X2 is selected from T or R, X3 is selected from LGFT, X4 is selected from P, S, Y, I or N, X5 is selected from G, T or Y, X6 is selected from G, V, D, L or N, X7 is selected from F, H, S, D or W, X8 is selected from I, P, F, K or does not exist, X9 is selected from T, W, A or does not exist, X 10 Selected from F, L, G or not present, X 11 Selected from F, D, R or not present, X 12 Selected from G, L, W or not present, X 13 Selected from E, F or not present, X 14 Selected from V or not present, X 15 Selected from L or absent, X 16 Selected from P or not present, X 17 Selected from R or not present, X 18 Selected from L, G or not present, X 19 Selected from G, P or not present, X 20 Selected from W or not present, X 21 Selected from L or absent, X 22 Selected from D or not present, X 23 selected from P or absent; and / or, (2) the following three light chain variable region complementarity determining regions (LCDR): LCDR1, which has an amino acid sequence as shown in the general formula (4), wherein the general formula (4) is X1X2X3X4X5X6X7X8X9X 10 X 11 LX 12As shown, wherein X1 is selected from Q, X2 is selected from S, E or T, X3 is selected from I or V, X4 is selected from S, T, V or L, X5 is selected from K, N, R, S or H, X6 is selected from Y, F, N or S, X7 is selected from Y, S or does not exist, X8 is selected from D, X9 is selected from N or does not exist, X 10 Selected from K or not present, X 11 Select N or not exist, X 12 is selected from Y or is absent; LCDR2, which has an amino acid sequence as shown in the general formula (5), the general formula (5) is shown as X1X2X3, wherein X1 is selected from E, H, A, G or W, X2 is selected from T or A, and X3 is selected from S; LCDR3, which has an amino acid sequence as shown in the general formula (6), the general formula (6) is shown as X1X2X3YX4X5SX6X7X8TX9X 10 X 11 As shown, wherein X1 is selected from Q or H, X2 is selected from Q, X3 is selected from N, Y or G, X4 is selected from F, D, L or Y, X5 is selected from S, T or F, X6 is selected from P, L, V, S or T, X7 is selected from P, H or R, X8 is selected from R, L, H, T or Y, and X9 is selected from T or does not exist.

[0013] In these embodiments, HCDR1-3 and LCDR1-3 are defined by the IMGT system.

[0014] In some embodiments, the antibody or antigen-binding fragment thereof comprises: a HCDR1 having an amino acid sequence as shown in any one of SEQ ID NOs: 1, 8, 15, 22 or 29, an amino acid sequence having one or more amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto; and / or a HCDR2 having an amino acid sequence as shown in any one of SEQ ID NOs: 2, 9, 16, 23 or 30, an amino acid sequence having one or more amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto; and / or a HCDR3 having an amino acid sequence as shown in any one of SEQ ID NOs: 2, 9, 16, 23 or 30, an amino acid sequence having one or more amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto. NO:3, 10, 17, 24 or 31, an amino acid sequence having one or more amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto; and / or, LCDR1, an amino acid sequence having an amino acid sequence as shown in any one of SEQ ID NO:4, 11, 18, 25 or 32, an amino acid sequence having one or more amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto; and / or, LCDR2, an amino acid sequence as shown in SEQ ID NO:4, 11, 18, 25 or 32, an amino acid sequence having one or more amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto. NO: the amino acid sequence shown in any one of ETS, HAS, AAS, GAS or WAS, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto of one amino acid substitution, deletion or addition; and / or LCDR3, which has an amino acid sequence as shown in any one of 5, 12, 19, 26 or 33, an amino acid sequence having one or several amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto.

[0015] In some embodiments, the antibody or antigen-binding fragment thereof comprises: HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, or an amino acid sequence having one or several amino acid substitutions, deletions or additions compared to the amino acid sequences of the HCDR1, HCDR2 and HCDR3, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto, and / or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 4, the amino acid sequence of ETS and SEQ ID NO: 5, or an amino acid sequence having one or several amino acid substitutions, deletions or additions compared to the amino acid sequences of the LCDR1, LCDR2 and LCDR3, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto.

[0016] In some embodiments, the antibody or antigen-binding fragment thereof comprises: HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, or an amino acid sequence having one or several amino acid substitutions, deletions or additions compared to the amino acid sequences of the HCDR1, HCDR2 and HCDR3, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto, and / or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 11, the amino acid sequence of HAS and SEQ ID NO: 12, or an amino acid sequence having one or several amino acid substitutions, deletions or additions compared to the amino acid sequences of the LCDR1, LCDR2 and LCDR3, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto.

[0017] In some embodiments, the antibody or antigen-binding fragment thereof comprises: HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17, or an amino acid sequence having one or several amino acid substitutions, deletions or additions compared to the amino acid sequences of HCDR1, HCDR2 and HCDR3, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto, and / or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 18, an amino acid sequence of AAS and SEQ ID NO: 19, or an amino acid sequence having one or several amino acid substitutions, deletions or additions compared to the amino acid sequences of LCDR1, LCDR2 and LCDR3, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto.

[0018] In some embodiments, the antibody or antigen-binding fragment thereof comprises: HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24, or an amino acid sequence having one or several amino acid substitutions, deletions or additions compared to the amino acid sequences of said HCDR1, HCDR2 and HCDR3, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto, and / or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 25, the amino acid sequence of GAS and SEQ ID NO: 26, or an amino acid sequence having one or several amino acid substitutions, deletions or additions compared to the amino acid sequences of said LCDR1, LCDR2 and LCDR3, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto.

[0019] In some embodiments, the antibody or antigen-binding fragment thereof comprises: HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO: 29, SEQ ID NO: 30 and SEQ ID NO: 31, or an amino acid sequence having one or several amino acid substitutions, deletions or additions compared to the amino acid sequences of the HCDR1, HCDR2 and HCDR3, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto, and / or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 32, the amino acid sequence WAS and SEQ ID NO: 33, or an amino acid sequence having one or several amino acid substitutions, deletions or additions compared to the amino acid sequences of the LCDR1, LCDR2 and LCDR3, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto.

[0020] In some embodiments, the antibody or antigen-binding fragment thereof comprises: a heavy chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 6, 13, 20, 27, 34, an amino acid sequence having one or several amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto; and / or a light chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 7, 14, 21, 28, 35, an amino acid sequence having one or several amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto.

[0021] In some embodiments, the antibody or antigen-binding fragment thereof comprises: a heavy chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 6, an amino acid sequence having one or several amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto; and a light chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 7, an amino acid sequence having one or several amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto.

[0022] In some embodiments, the antibody or antigen-binding fragment thereof comprises: a heavy chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 13, an amino acid sequence having one or several amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity thereto; and a light chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 14, an amino acid sequence having one or several amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity thereto.

[0023] In some embodiments, the antibody or antigen-binding fragment thereof comprises: a heavy chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 20, an amino acid sequence having one or several amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity thereto; and a light chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 21, an amino acid sequence having one or several amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity thereto.

[0024] In some embodiments, the antibody or antigen-binding fragment thereof comprises: a heavy chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 27, an amino acid sequence having one or several amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity thereto; and a light chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 28, an amino acid sequence having one or several amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity thereto.

[0025] In some embodiments, the antibody or antigen-binding fragment thereof comprises: a heavy chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 34, an amino acid sequence having one or several amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity thereto; and a light chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 35, an amino acid sequence having one or several amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, or 99% sequence identity thereto.

[0026] In some embodiments, the antibody or antigen-binding fragment may be of, but is not limited to, IgA, IgD, IgE, IgG or IgM type.

[0027] In some embodiments, the light chain of the antibody or antigen-binding fragment comprises a kappa light chain or a lambda light chain.

[0028] In some embodiments, the antibody or antigen-binding fragment may be of IgG type, for example, may be of IgG1, IgG2, IgG3 or IgG4 type.

[0029] In some embodiments, the antibody or antigen-binding fragment includes, but is not limited to, scFv, Fab, Fab', (Fab')2, Fv fragment, dsFv, linear antibody, bispecific antibody and multispecific antibody; In some embodiments, the antibody or antigen-binding fragment includes, but is not limited to, a murine antibody, a chimeric antibody, a humanized antibody, or a fully human antibody.

[0030] According to another aspect of the present disclosure, a nucleic acid molecule is provided, which encodes the antibody or antigen-binding fragment thereof.

[0031] In some embodiments, the nucleic acid molecule has a nucleotide sequence as shown in SEQ ID NO:36, or a nucleotide sequence having at least 65%, 70%, 75%, 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto, and / or a nucleotide sequence as shown in SEQ ID NO:37, or a nucleotide sequence having at least 65%, 70%, 75%, 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto.

[0032] In some embodiments, the nucleic acid molecule has a nucleotide sequence as shown in SEQ ID NO:38, or a nucleotide sequence having at least 65%, 70%, 75%, 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto, and / or a nucleotide sequence as shown in SEQ ID NO:39, or a nucleotide sequence having at least 65%, 70%, 75%, 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto.

[0033] In some embodiments, the nucleic acid molecule has a nucleotide sequence as shown in SEQ ID NO:40, or a nucleotide sequence having at least 65%, 70%, 75%, 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto, and / or a nucleotide sequence as shown in SEQ ID NO:41, or a nucleotide sequence having at least 65%, 70%, 75%, 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto.

[0034] In some embodiments, the nucleic acid molecule has a nucleotide sequence as shown in SEQ ID NO:42, or a nucleotide sequence having at least 65%, 70%, 75%, 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto, and / or a nucleotide sequence as shown in SEQ ID NO:43, or a nucleotide sequence having at least 65%, 70%, 75%, 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto.

[0035] In some embodiments, the nucleic acid molecule has a nucleotide sequence as shown in SEQ ID NO:44, or a nucleotide sequence having at least 65%, 70%, 75%, 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto, and / or a nucleotide sequence as shown in SEQ ID NO:45, or a nucleotide sequence having at least 65%, 70%, 75%, 80%, 85%, 88%, 90%, 92%, 95%, 97%, 98%, 99% sequence identity thereto.

[0036] According to yet another aspect of the present disclosure, an expression vector is provided, comprising the nucleic acid molecule.

[0037] In some embodiments, the expression vector includes a prokaryotic expression vector and a eukaryotic expression vector.

[0038] In some embodiments, the eukaryotic expression vector includes a yeast expression vector, a mammalian expression vector, an insect expression vector, and the like.

[0039] According to yet another aspect of the present disclosure, a host cell is provided, comprising the nucleic acid molecule and / or the expression vector.

[0040] In some embodiments, the host cell is selected from a prokaryotic cell and a eukaryotic cell.

[0041] In some embodiments, the prokaryotic cells include bacterial cells, Escherichia coli, and Streptomyces.

[0042] In some embodiments, the eukaryotic cells include yeast cells, mammalian cells, insect cells, etc.

[0043] In some embodiments, the mammal is selected from humans, monkeys, mice, rats, hamsters, goats, sheep, cows, pigs, dogs, or cats.

[0044] In some embodiments, the mammalian cells include CHO cells, 293 cells, Vero cells, BHK cells, NS0 cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells or hybridoma cells.

[0045] According to another aspect of the present disclosure, a chimeric antigen receptor is provided, which includes an extracellular antigen binding domain, a transmembrane domain and an intracellular signaling domain, wherein the extracellular antigen binding domain comprises the antibody or antigen-binding fragment thereof described in the present disclosure.

[0046] According to another aspect of the present disclosure, an antibody-drug conjugate is provided, comprising: the antibody or antigen-binding fragment thereof described in the present disclosure; and a drug covalently linked to the antibody or antigen-binding fragment thereof. According to another aspect of the present disclosure, a detection kit is provided, comprising the antibody or antigen-binding fragment thereof.

[0047] According to yet another aspect of the present disclosure, a composition is provided, comprising the antibody or the antigen-binding fragment thereof.

[0048] In some embodiments, the composition further comprises one or more additional drugs.

[0049] In some embodiments, the medicament comprises a medicament for preventing and / or treating Clostridium tetani infection.

[0050] In some embodiments, the composition can be in the form of a chimeric antigen receptor, which includes an extracellular antigen binding domain, a transmembrane domain, and an intracellular signaling domain, wherein the extracellular antigen binding domain comprises an antibody or antigen-binding fragment thereof described in the present disclosure.

[0051] In some embodiments, a modified immune cell is provided, comprising the chimeric antigen receptor.

[0052] In some embodiments, the composition can be in the form of an antibody-drug conjugate, which comprises the antibody or antigen-binding fragment thereof; and a drug covalently linked to the antibody or antigen-binding fragment thereof.

[0053] In some embodiments, the composition can be in the form of a multispecific antibody, which is formed by coupling a first antibody or a fragment thereof with other antibodies or fragments thereof or antibody analogs, wherein the first antibody or fragment thereof is the antibody or antigen-binding fragment thereof described in the present disclosure.

[0054] In some embodiments, the multispecific antibody is a bispecific antibody, a trispecific antibody, or a tetraspecific antibody, and each antibody or fragment or antibody analog thereof retains the original binding specificity.

[0055] In some embodiments, the composition further comprises a pharmaceutically acceptable carrier and / or excipient.

[0056] According to another aspect of the present disclosure, provided is the use of the antibody or antigen-binding fragment thereof, the nucleic acid molecule, the expression vector, the host cell, the detection kit and / or the pharmaceutical composition in the preparation of a product for detecting, preventing and / or treating Clostridium tetani infection.

[0057] According to another aspect of the present disclosure, a method for detecting tetanus toxin is provided, the method comprising the step of detecting using the antibody or antigen-binding fragment thereof.

[0058] According to another aspect of the present disclosure, there is provided a method for preventing and / or treating Clostridium tetani ( Clostridium tetani ) infection, comprising administering to a subject a therapeutically effective amount of the antibody or antigen-binding fragment thereof or the pharmaceutical composition.

[0059] Beneficial Effects

[0060] The present disclosure provides an anti-tetanus toxin neutralizing antibody as a new generation of tetanus passive immunization preparation. The antibody can be fully human, and has the characteristics of high affinity, high specificity, and small toxic and side effects. At the same time, it avoids the problems of large adverse reactions and short half-life of animal-derived monoclonal antibodies, and can be prepared in large quantities by mammalian cells, with clear and stable components. Based on clinical needs, the fully human anti-tetanus toxin neutralizing antibody explored and developed as a new generation of tetanus passive immunization preparation has important medical value. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1 Binding curves of antibodies to full-length tetanus toxin and tetanus toxin AB fragment are shown.

[0062] Figure 2 The results of the mouse challenge protection experiment are shown. DETAILED DESCRIPTION

[0063] Tetanus toxin ( Tetanospasmin TeNT is a neurotoxin with extremely strong toxicity, second only to botulinum toxin (BoNT). The toxin has a special affinity for the central nervous system, which can prevent inhibitory synaptic terminals from releasing inhibitory neurotransmitters, causing an imbalance in the excitation and inhibition of muscle activity, resulting in strong contraction of the extensor and flexor muscles at the same time, causing muscle rigidity and spasm, and forming tetanus-specific symptoms such as trismus and opisthotonos. TeNT is a polypeptide chain with a molecular weight of 150 kD. After being translated by bacterial or host proteases, it is cut into an active double-chain form connected by a single disulfide bond: a light chain (fragment A) and a heavy chain (fragment B and fragment C), which are 50 kD and 100 kD, respectively. Fragment A is a zinc metalloprotease that can cut the relevant membrane proteins that transmit neurotransmitters on the nerve cell membrane, inhibit the release of neurotransmitters, and keep the excitement transmitted; fragment B encodes a translocation domain that mediates the entry of the toxin active site into the cell; fragment C is a receptor binding domain that can be transported into the central nervous system by retrograde axons. Many studies have shown that antibodies against fragments AB are likely to have neutralizing activity.

[0064] The present invention separates peripheral blood mononuclear cells (PBMC) from the blood of volunteers who have been immunized with commercial tetanus vaccine and have produced protective antibodies, screens monoclonal antibodies that can specifically bind to the full length of tetanus toxin and its AB fragments, and further screens five candidate antibodies, whose sequences are shown in Table 1.

[0065]

[0066] The anti-tetanus toxin fully humanized neutralizing antibodies provided by the present disclosure are all able to specifically bind to tetanus toxin, and have strong neutralizing activity and high affinity. The anti-tetanus toxin neutralizing antibodies provided by the present disclosure can completely protect mice from tetanus toxin attack in a mouse neutralization protection experiment. In addition, the anti-tetanus toxin neutralizing antibodies provided by the present disclosure are free of allergens and exogenous virus contamination, have high safety, and can be widely used in various populations.

[0067] definition Unless otherwise defined, all technical and scientific terms used in this disclosure have the same meaning as commonly used in the field to which this disclosure belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0068] As used herein, the articles "a," "an," and "an" include plural referents unless the context clearly dictates otherwise.

[0069] The expression "about" as used herein is understood by one of ordinary skill in the art and varies within a certain range depending on the context in which it is used. If one of ordinary skill in the art is not aware of the use of the term based on the context in which it is used, "about" will mean up to plus or minus 10% of the specified value.

[0070] The term "specific binding" as used herein refers to binding selectivity for an antigen and can be distinguished from unwanted or non-specific binding. The ability of an antigen-binding molecule to bind to a specific antigen can be measured by enzyme-linked immunosorbent assay (ELISA) or other techniques familiar to those skilled in the art (e.g., surface plasmon resonance (SPR) technology and traditional binding assays).

[0071] The term "affinity" or "binding affinity" as used herein refers to the strength of the non-covalent interaction between a single binding site of a molecule (e.g., an antibody) and its binding ligand (e.g., an antigen). Binding affinity can generally be expressed as an affinity constant (KD), which is the ratio of the dissociation rate constant (kd) to the association rate constant (ka). Thus, equivalent affinities can include different rate constants as long as the ratio of the rate constants remains the same. Affinity can be measured by conventional methods known in the art, such as surface plasmon resonance (SPR). In some embodiments, when using tetanus toxin C fragment as the analyte and the antibody as the ligand, the antibody has a binding affinity of approximately less than 10 -6 M, such as approximately less than 10 -7 M, 10 -8 M, 10 -9 M or 10 -10The binding affinity of the binding protein to the predetermined antigen is at least twice that of the binding affinity to a nonspecific antigen (e.g., BSA, casein) other than the predetermined antigen or a closely related antigen.

[0072] The term "antibody" as used herein encompasses various antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, monospecific and multispecific antibodies (e.g., bispecific antibodies or trispecific antibodies), single-chain molecules, and antibody fragments, as long as the desired antigen binding activity is exhibited. In the light and heavy chains of the antibody, the variable region and the constant region are connected by a "J" region of about 12 or more amino acids, and the heavy chain also contains a "D" region of about 3 or more amino acids. Each heavy chain consists of a heavy chain variable region (VH) and a heavy chain constant region (CH). The heavy chain constant region consists of three domains (CH1, CH2, and CH3). Each light chain consists of a light chain variable region (VL) and a light chain constant region (CL). The light chain constant region consists of one domain CL. The constant region of the antibody can mediate the binding of immunoglobulins to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (C1q) of the classical complement system.

[0073] Unless otherwise indicated, "antibody active fragment", "antibody fragment", "target binding fragment" and "antigen binding fragment" are interchangeable in the context of the present invention and refer to antibody fragments that can specifically bind to an antigen, such as fragments that retain one or more CDR regions. Examples of antigen binding fragments include, but are not limited to, Fab, Fab', F(ab')2 and Fv fragments; bispecific antibodies; linear antibodies; single-chain antibody molecules, such as single-chain Fv (ScFv); nanobodies and multispecific antibodies formed from antibody fragments.

[0074] The term "variable region" or "variable domain" used herein refers to the domain of the antibody heavy chain or light chain that participates in the binding of an antigen-binding molecule to an antigen. The variable domains of the heavy and light chains of natural antibodies (VH and VL, respectively) generally have similar structures, wherein each domain comprises four conserved framework regions (FR) and three hypervariable regions (HVR). A single VH or VL domain may be sufficient to confer antigen binding specificity. The term "variable" of the present invention refers to certain segments of the variable domain that are generally different in sequence between antibodies. The V domain mediates antigen binding and defines the specificity of a particular antibody for its specific antigen. However, variability is not uniformly distributed throughout the variable domain. Instead, it is concentrated in three segments called hypervariable regions (HVR) within the light and heavy chain variable domains. The more highly conserved portion of the variable domain is referred to as the framework region (FR). The variable domains of natural heavy and light chains each comprise four FR regions, most of which adopt a β-folded configuration, connected by three HVRs, which form a loop connection, and in some cases form a part of the β-folded structure. The HVRs in each chain are held together by the FR regions and, together with the HVRs of the other chains, contribute to the formation of the antigen-binding site of the antibody. The constant domains are not directly involved in the binding of the antibody to the antigen, but have other effector functions, such as participation in the antibody-dependent cellular toxicity of the antibody.

[0075] The term "hypervariable region" or "HVR" as used herein refers to a region in the variable domain region of an antibody that is highly variable in sequence and / or forms a structurally defined loop ("hypervariable loop"). Typically, a natural four-chain antibody comprises six HVRs: three present in VH (H1, H2, H3) and three present in VL (L1, L2, L3). HVRs typically comprise amino acid residues from hypervariable loops and / or from "complementarity determining regions (CDRs)", which have the highest sequence variability and / or are involved in antigen recognition. It will be understood by those skilled in the art that, unless otherwise specified, "CDRs" and "complementarity determining regions" of a given antibody or region thereof (e.g., a variable region) should be understood to encompass "CDRs" and "complementarity determining regions" as defined by any one of those known in the art. It is well known to those skilled in the art that the CDR of an antibody can be defined in the art by a variety of methods, such as the Kabat definition rule based on sequence variability, the Chothia definition rule based on the position of the structural loop region, the Martin definition rule based on the sequence and framework region, the IMGT definition rule based on the amino acid sequence alignment of germline V genes, the reference tool for antibody humanization design based on CDR transplantation, etc. It should be understood by those skilled in the art that, unless otherwise specified, the terms "CDR" and "complementarity determining region" of a given antibody or a region thereof (e.g., a variable region) should be understood to cover CDRs defined by any of the above-mentioned known schemes described in the present invention, and the amino acid sequences corresponding to the defined CDR definition rules should also fall within the scope of protection of the present invention.

[0076] The term "chimeric antibody" as used herein refers to an antibody that combines antibody fragments from different species. Specifically, for example, a monoclonal antibody from one species (e.g., mouse) has its Fc constant region replaced with an Fc constant region from a species (e.g., human) via DNA recombination technology.

[0077] The term "humanized antibody" as used herein refers to an antibody comprising a human immunoglobulin framework region and one or more CDRs from a non-human (e.g., mouse, rat, rabbit or synthetic) immunoglobulin. Except for the CDRs, all other parts in the humanized antibody are substantially identical to the corresponding parts of the natural human immunoglobulin sequence.

[0078] The term "fully human antibody" as used herein is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences. As used herein, the term "fully human antibody" refers to almost every part of its protein molecule (e.g., CDR, FR, CL, HC domains (e.g., CH1, CH2, CH3), hinges, VL, VH) that is almost non-immunogenic in the human body, and has only small sequence changes or variations relative to human natural immunoglobulins. Therefore, fully human antibodies are different from chimeric or humanized antibodies. It should be noted that fully human antibodies can be produced by human cells, non-human animals, or prokaryotic or eukaryotic cells that can express functionally rearranged human immunoglobulin (e.g., heavy chain and / or light chain) genes.

[0079] As used herein, the term "nucleic acid molecule" refers to any one or more nucleic acid segments, such as DNA or RNA fragments, present in a polynucleotide.

[0080] As used herein, "percent homology", "% homology" or "% sequence identity" is used in the context of the present invention to describe the degree of similarity between two nucleotide sequences or two amino acid sequences, and has the same meaning as "percent identity". The percent homology of two sequences can be calculated as follows, after the two sequences are aligned, by dividing the number of positions where the residues are identical by the total length of the aligned sequences and multiplying by 100%. Methods and tools for aligning two amino acid sequences or nucleotide sequences are well known in the art, such as the BLAST suite provided on the NCBI website. As used herein, having "at least 80% sequence identity" to a sequence refers to having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence.

[0081] As used herein, the terms "vector" or "expression vector" and "expression construct" are used interchangeably to refer to a DNA molecule that introduces a specific gene operably linked thereto into a target cell and directs expression. The vectors include vectors that are self-replicating nucleic acid structures as well as vectors that are incorporated into the genome of a host cell into which they have been introduced. The expression vectors of the present invention comprise expression cassettes. The expression vectors can perform transcription of large amounts of stable mRNA. Once the expression vector is within the target cell, the cellular transcription and / or translation machinery generates a ribonucleic acid molecule or protein encoded by the gene.

[0082] The term "host cell" as used herein is used interchangeably and refers to a cell into which an exogenous nucleic acid has been introduced, and also includes the offspring of such cells. Host cells include "transformants / transformants" and "transformed cells", including primary transformed cells and offspring derived therefrom. The nucleic acid of the offspring may not be completely identical to the parent cell and may contain mutations. Host cells include cultured cells, for example cultured mammalian cells, such as CHO cells, 293 cells, Vero cells, BHK cells, NS0 cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells or hybridoma cells, yeast cells, insect cells and plant cells. Host cells of the present disclosure also include cells contained in transgenic animals, transgenic plants or cultured plants or animal tissues.

[0083] The term "pharmaceutical composition" as used herein includes the monoclonal antibody of the present disclosure and a pharmaceutically acceptable carrier. The pharmaceutical composition can be in the form of various oral or parenteral preparations. The pharmaceutical composition is formulated using conventional diluents or excipients including fillers, fillers, binders, wetting agents, disintegrants, and surfactants. Solid oral preparations include tablets, pills, powders, granules, capsules, etc. These solid preparations can be prepared by mixing at least one compound with one or more excipients, such as starch, calcium carbonate, sucrose, lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate or talc can also be used. In addition, liquid oral preparations include suspensions, solutions, emulsions and syrups, etc. In addition to water and liquid paraffin, which are usually used as simple diluents, various excipients may also be included, such as wetting agents, sweeteners, flavors, preservatives, etc. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized agents, suppositories, etc. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, etc. can be used as non-aqueous solvents and suspending agents. The main ingredients of suppositories can include semi-synthetic fatty acid esters, polyethylene glycol, Tween 61, cocoa butter, laurel fat, glycerin gelatin, etc.

[0084] The pharmaceutical composition may have any one formulation selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, solutions, emulsions, syrups, sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations and suppositories.

[0085] The pharmaceutical composition of the present disclosure can be administered in a pharmaceutically effective amount. "Pharmaceutically effective amount" means that its dosage is sufficient to treat the disease, with a reasonable benefit / risk ratio applicable to any medical treatment. The effective dosage level of the composition can be determined according to the type of subject, the severity of the disease, the age and gender of the subject, the activity of the drug, the sensitivity to the drug, the administration time, the route of administration, the excretion rate, the treatment time, the drug used in combination with the composition, and other known factors in the medical field. The pharmaceutical composition of the present disclosure can be used alone or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents. The composition can be administered in one or more dosage forms. Considering all of the above factors, it is crucial to administer the composition at the minimum amount that can show the maximum effect without causing side effects, and this minimum amount can be easily determined by those skilled in the art.

[0086] The term "pharmaceutically acceptable carrier" as used herein refers to a carrier or diluent that does not cause significant stimulation to an organism and does not eliminate the biological activity and properties of the administered compound. Pharmaceutically acceptable carriers that can be used to formulate the disclosed compositions into liquid solution forms include physiological saline, sterile water, Ringer's solution, buffered saline, glucose solution, maltodextrin solution, glycerol, ethanol, and a mixture of two or more thereof. If desired, the disclosed compositions may also contain other conventional additives, such as antioxidants, buffers and antibacterial agents. In addition, the disclosed compositions may also include diluents, dispersants, surfactants, adhesives and lubricants to configure them into injectable preparations, such as aqueous solutions, suspensions and emulsions, pills, capsules, granules and tablets.

[0087] As used herein, the term "treating" a disease in a subject or "treating" a subject having or suspected of having a disease refers to administering a drug therapy, such as administering one or more pharmaceutical agents, to a subject, thereby reducing or preventing worsening of at least one symptom of the disease. Thus, in one embodiment, "treating" refers, inter alia, to delaying progression, accelerating remission, inducing remission, increasing remission, accelerating recovery, increasing the efficacy of alternative therapies, or reducing resistance to alternative therapies, or a combination thereof.

[0088] The term "diagnosis" or "detection" as used herein includes determining whether tetanus toxin exists in a subject or a sample to be tested, and accordingly determining whether the subject or the subject from which the sample is derived is infected with Clostridium tetani.

[0089] The term "prevention" as used herein is art-recognized and, when used in connection with conditions such as local recurrence, is well known in the art and includes administration to reduce the occurrence of or delay the onset of symptoms of a medical condition in a subject relative to a subject not receiving the composition. The composition of the present invention can be administered as a food, such as a nutritional supplement. Generally, the composition of the present invention is used to treat humans, but it can be used to treat animals, such as poultry, pigs, cats, dogs, horses or rabbits. If administered to an animal, oral gavage can be used.

[0090] Examples and drawings are provided below to help understand the present disclosure. However, it should be understood that these examples and drawings are only used to illustrate the present disclosure, but do not constitute any limitation. The actual protection scope of the present disclosure is set forth in the claims. It should be noted that for those skilled in the art, several variations and improvements made on the basis of this invention conception all belong to the protection scope of the present disclosure. The reagents and / or kits used in the following examples are all commercially available or can be synthesized by known methods. Example Example 1 Flow cytometric sorting of B cells and screening and purification of anti-tetanus toxin neutralizing antibodies

[0091] The following steps are involved: 1. PBMC isolation and memory B cell sorting 10 mL of venous blood was collected from volunteers who had been immunized with commercial tetanus vaccine (from Chengdu Olin Biotechnology Co., Ltd.) and had produced protective antibodies and placed in an anticoagulant tube containing sodium citrate. PBMC (peripheral blood mononuclear cell) was separated from the 10 mL blood sample using Ficoll (polysucrose). After PBMC counting, single antigen-specific memory B cells were sorted from PBMC into a 96-well PCR (Polymerase Chain Reaction) plate using a SONY SH800 flow cytometer so that each well contained one B cell. The 96-well plate containing B cells was placed in a refrigerator at -80 °C for future use.

[0092] 2. Single-cell PCR amplification of fully human monoclonal antibodies 1) Reverse transcription PCR: Add all IgG1 subtype-specific primers for heavy chain and κ light chain and Maxima H Minus reverse transcriptase (Thermo) to a 96-well PCR plate containing a single B cell, reverse transcribe at 50°C for 30 min, and inactivate the reverse transcriptase at 85°C for 5 min. Store the obtained cDNA product at -80°C.

[0093] 2) Nested PCR: First round of reaction: 2µL cDNA product was used as template, and hot start ultra-high fidelity DNA polymerase (TransStart(®) FastPfu DNA polymerase, Quanshijin Biotechnology) for rapid PCR was added, dNTPs and nested PCR primers. Reaction conditions: pre-denaturation at 98℃ for 5min, followed by 40 PCR cycles, each cycle was: 98℃×30s, 55℃ (heavy chain V H , κ light chain Vκ) × 1 min, 72℃ × 1 min, and finally extension at 72℃ for 5 min.

[0094] Second round of reaction: Using the PCR product of the first round of reaction as a template, add a hot start ultra-high fidelity DNA polymerase for rapid PCR (TransStart(®) FastPfu DNA polymerase, Quanshijin Bio), dNTPs and nested PCR primers. Reaction conditions: pre-denaturation at 98°C for 5 min, then 35 PCR cycles, each cycle is: 98°C × 30 s, 58°C (heavy chain V H ) / 60℃ (κ light chain Vκ) × 1 min, 72℃ × 1 min, and finally extended at 72℃ for 5 min to obtain a nested PCR amplification product containing the heavy chain and light chain variable region sequences.

[0095] The sequences of the IgG1 subtype-specific primers for the heavy chain and κ light chain, and the sequences of the nested PCR primers are described in Liao HX, et al., High-throughput isolation of immunoglobulin genes from single human B cells and expression as monoclonal antibodies. J Virol Methods. 2009 Jun; 158(1-2): 171-9.

[0096] 3) Agarose gel electrophoresis 5 μL of nested PCR amplification product was detected by 1.5% agarose gel electrophoresis, and paired positive clones were sequenced to obtain the antibody variable region sequence, and a linear expression frame was constructed for the sequence.

[0097] 3. Construct a linear expression frame to express the recombinant antibody The expression vector constructed with pcDNA3.4 as the backbone was used as a template, and CMV primer-F: GGCTTGACCGACAATTGCATGAAGAATC (SEQ ID NO: 46) and CMV primer-R: GGCCCTCACCCCAGTCAG (SEQID NO: 47) were used to obtain the enhancer sequence, promoter sequence and antibody leader peptide fragment by PCR amplification.

[0098] The heavy chain constant region sequence, WPRE and Poly (A) fragment were amplified by PCR using heavy chain constant region primer-F: GTCAAGGACTACTTCCCCGAAC (SEQ ID NO: 48) and constant region primer-R: AGCCCTGGGCCTTCACCCGAACTTG (SEQ ID NO: 49) as primers.

[0099] The kappa light chain constant region sequence, WPRE and Poly (A) fragment were amplified by PCR using kappa light chain constant region primer-F: TGCCTCTGTTGTGTGCCTGC (SEQ ID NO: 50) and constant region primer-R: AGCCCTGGGCCTTCACCCGAACTTG (SEQ ID NO: 51) as primers.

[0100] All the fragments amplified above were purified by magnetic bead purification, and the nested PCR amplification products containing the heavy chain and light chain variable region sequences were combined with the above expression elements (enhancer + promoter + leader peptide), constant region (heavy chain, κ light chain), WPRE and Poly (A) fragments using overlapping PCR technology to construct a linear expression frame. After completion, 5 µL of the linear expression frame amplification product was detected by 1% agarose gel electrophoresis and sequenced to confirm that the constructed antibody linear expression frame was constructed correctly.

[0101] The correctly constructed and purified heavy chain and light chain linear expression cassettes were co-transfected into 293 cells using transfection reagent PEI. The cells were cultured in a 37°C 5% CO2 incubator for 72 hours, and the cell supernatant was collected for detection.

[0102] 4. ELISA screening of candidate antibodies with binding activity Tetanus toxoid or tetanus AB fragment (Wuhan Huamei Bioengineering Co., Ltd.) was used as the antigen, and the antigen was diluted to 2μg / mL with the coating solution and then coated on a 96-well ELISA plate. Each well contained a volume of 100μL and an overnight coating at 4°C, and was blocked with a blocking solution at 37°C for 2h. The collected supernatant containing the antibody was incubated at 37°C for 1h as the primary antibody, and goat anti-human IgG-HRP (1:20000 dilution) was incubated at 37°C for 1h as the secondary antibody. After adding the substrate colorimetric solution, it was placed at room temperature and away from light for 10min, and the reaction was terminated with 2M sulfuric acid. The detection and analysis were performed at a wavelength of 450nm. The results showed that no less than 100 monoclonal antibodies could specifically bind to tetanus toxoid (full length TT) or tetanus AB fragment.

[0103] 5. Expression plasmid construction and antibody preparation After sequence alignment, repeated sequences and similar sequences were eliminated, and five candidate antibodies, Ab017, Ab024, Ab043, Ab051, and Ab095, were finally selected for further study. Their CDR region and variable region sequences are shown in Table 1.

[0104] The expression plasmids were constructed for the five candidate antibodies to prepare the antibodies. The specific method is as follows: the linear expression frame amplification products containing heavy chains and light chains of the five antibodies (obtained in step 3 above) were connected to the PCR-amplified H-3.4 (sequence shown in SEQ ID NO: 49) and L-κ-3.4 (sequence shown in SEQ ID NO: 50) (H-3.4 and L-κ-3.4 were synthesized by Bio-Tech Co., Ltd.) expression vector frames using a seamless cloning kit (One Step Seamless Cloning Mix, Novazon). The vector frame amplification primers are: H-3.4-F: GGCCCTCACCCCAGTCAG (SEQ ID NO: 47), and heavy chain reverse primer 3.4-R: GTCAAGGACTACTTCCCCGAAC (SEQ ID NO: 48) (H-3.4 vector frame); the amplification template vector sequence is shown in SEQ ID NO: 49; L-κ-3.4-F: GGCCCTCACCCCAGTCAG (SEQ ID NO: 47) and κ light chain reverse primer 3.4-R: TGCCTCTGTTGTGTGCCTGC (SEQ ID NO: 50) (L-κ-3.4 vector framework); the amplification template vector sequence is shown in SEQ ID NO: 50; Take 5uL of the vector framework and 1μL of the linear expression frame fragment, add 5μL of 2× cloning premix ligase, and add water to the reaction system to 10μL. Reaction conditions: 50℃ PCR instrument reaction for 15min. After the reaction, place the reaction system on ice to cool down and transform DH5α competent cells to obtain expression plasmids. Add PEI transfection reagent to the plasmid DNA tube diluted with OPM-293 CD05 medium, mix well, incubate the complex at room temperature for 20min, and culture at 37℃ 120rpm 6% CO2 for 5-7 days. Centrifuge at 300g for 5min to collect the supernatant, filter with a 0.2um filter, use protein A affinity purification, replace the collected antibodies with PBS, and detect the antibody concentration. Example 2 ELISA detection of antibody binding activity

[0105] 1. Experimental process Tetanus toxoid or tetanus toxin AB fragment was used as antigen, and the antigen was diluted to 2 μg / mL with coating solution and then coated on 96-well ELISA plate, with a volume of 100 μL per well, overnight coating at 2-8°C, and blocked with blocking solution at 37°C for 2 hours. The five purified antibodies Ab017, Ab024, Ab043, Ab051 and Ab095 were serially diluted and added to the blocked ELISA plate as test samples, incubated at 37°C for 1 hour, washed with goat anti-human IgG-HRP (1:20000 dilution), incubated at 37°C for 1 hour, added substrate color solution, placed at room temperature and away from light for 10 minutes, stopped the reaction with 2M sulfuric acid, and detected and analyzed at 450 / 630nm wavelength. The tetanus toxoid was obtained by Sinovac Biotech using Clostridium tetani CMCC 64008 through fermentation, purification and detoxification. It has the same immunogenicity as tetanus toxin; the tetanus toxin AB fragment (GenBank: AAK72964.2) was synthesized and expressed by Wuhan Huamei Bioengineering Co., Ltd.

[0106] 2. Results The results are as follows Figure 1 As shown, the expressed and purified antibody was diluted to a concentration of about 0.0012 μg / mL and was still able to bind to tetanus toxoid or tetanus AB fragment. Therefore, the five candidate antibodies provided in the embodiments of the present disclosure all have extremely strong binding activity. Example 3 Affinity constant and affinity kinetics analysis of SPR detection antibodies

[0107] 1. Capture method test The antibody affinity test adopts the capture method. Using the Biacore T200 (Situofan) biomacromolecule interaction system, five antibodies, Ab017, Ab024, Ab043, Ab051 and Ab095, were diluted with buffer 1×HBS-EP+ buffer (Situofan) to a concentration of 2μg / mL, and injected into the experimental channel (Fc2) of the Protein A capture chip (Situofan) at a flow rate of 10 μl / min. The capture was performed for 15s to make the capture level about 70RU. The reference channel (Fc1) does not require ligand capture. The analyte tetanus toxin was passed through the chip in increasing concentrations (except Ab024, which was 0.0781-10 nm, and the other antibodies were 0.977-125 nM), and the signal curves were obtained respectively. Each concentration was regarded as 1 cycle. After completing 1 cycle, the chip was regenerated with regeneration fluid to return to the original state of uncaptured antibodies. The regeneration time was 60s. The obtained signal curve was analyzed using the BiaCore T-200 system software to obtain the affinity activity test results of the neutralizing antibody and tetanus toxoid provided in the embodiments of the present disclosure.

[0108] 2. Results As shown in Table 2, the affinity of each neutralizing antibody to tetanus toxoid is 10 -9 The order of magnitude of mol indicates that the antibodies provided by the present disclosure have very high affinity activity and the antibody binding / complex has good stability.

[0109] Example 4 Neutralization protection efficacy determination in mice

[0110] 1. Tetanus toxin L+ determination Take 1 tetanus toxin (from China Food and Drug Inspection Institute), dilute with sterile glycerol and borate buffer diluent (from Shanghai Shangbao Biotechnology Co., Ltd.) to prepare a toxin storage solution. When using, add an appropriate amount of borate buffer diluent to the brown bottle, take an appropriate amount of toxin storage solution and add it to the brown bottle to prepare the toxin application solution. The volume of each test dose solution is 1mL. Take tetanus human immunoglobulin (hTIG) standard (from China Food and Drug Inspection Institute), add borate buffer diluent to 0.5IU / mL, take 1mL and add it to the brown bottle of each toxin application solution, mix evenly, seal, and combine in a 37℃ water bath for 1 hour. Immediately inject subcutaneously into the abdomen of NIH mice, 3 mice for each test dose, and inject 0.4mL per mouse. Observe for 5 days, once in the morning and afternoon. The minimum toxin amount that causes all mice to die within 72 hours to 120 hours is the test dose (1 / 10L+).

[0111] 2. In vivo neutralization protection experiment The experiment was divided into 3 groups: negative control group, hTIG group (0.5IU / mL), and 5 antibody groups (20μg / mL). Each group diluted 1mL of toxin application solution containing 5 test doses (1 / 10L+) and an equal amount of borate buffer diluent, mixed evenly, incubated at 37℃ for 1h, and immediately injected subcutaneously into the abdomen of mice, with 6 mice in each group. In the hTIG group, each mouse was injected with 0.2mL toxin + 0.2mL hTIG; in the antibody group, each mouse was injected with 0.2mL toxin + 0.2mL antibody; in the negative control group, each mouse was injected with 0.2mL toxin + 0.2mL borate buffer diluent.

[0112] 3. Results The results are as follows Figure 2 As shown, when attacked by tetanus toxin under the same conditions, all mice in the negative control group died within 48 hours, and all mice in the hTIG group (0.5 IU / ml) and each antibody group (20 μg / mL) survived within 14 days, indicating that the antibodies provided by the present disclosure can effectively protect animals from the attack of a lethal dose of tetanus toxin at 4 μg, and the effect is equivalent to 0.1 IU hTIG. This shows that the neutralizing antibodies provided by the present disclosure can effectively neutralize the attack of tetanus toxin and protect mice.

[0113] The technical solution of the present disclosure is not limited to the above-mentioned specific embodiments, and all technical variations made according to the technical solution of the present disclosure fall within the protection scope of the present disclosure.

Claims

1. An anti-tetanus toxin neutralizing antibody or an antigen-binding fragment thereof, the antibody or the antigen-binding fragment thereof comprising: (1) The following three heavy chain variable region complementarity determining regions (HCDRs): HCDR1 having the amino acid sequence of HCDR1 contained in the heavy chain variable region as shown in any one of SEQ ID NOs: 6, 13, 20, 27, 34, or an amino acid sequence having one or more amino acids substituted, deleted or added compared to the amino acid sequence of HCDR1 contained in the heavy chain variable region; HCDR2 having the amino acid sequence of HCDR2 contained in the heavy chain variable region as shown in any one of SEQ ID NOs: 6, 13, 20, 27, 34, or an amino acid sequence having one or more amino acids substituted, deleted or added compared to the amino acid sequence of HCDR2 contained in the heavy chain variable region; HCDR3 having the amino acid sequence of HCDR3 contained in the heavy chain variable region as shown in any one of SEQ ID NOs: 6, 13, 20, 27, 34, or an amino acid sequence having one or more amino acids substituted, deleted or added compared to the amino acid sequence of HCDR3 contained in the heavy chain variable region; and / or (2) The following three light chain variable region complementarity determining regions (LCDR): LCDR1 having an amino acid sequence of LCDR1 contained in a light chain variable region as shown in any one of SEQ ID NOs: 7, 14, 21, 28, 35, or an amino acid sequence having one or more amino acids substituted, deleted or added compared to the amino acid sequence of LCDR1 contained in the light chain variable region; LCDR2 having an amino acid sequence of LCDR2 contained in a light chain variable region as shown in any one of SEQ ID NOs: 7, 14, 21, 28, 35, or an amino acid sequence having one or more amino acids substituted, deleted or added compared to the amino acid sequence of LCDR2 contained in the light chain variable region; LCDR3, which has the amino acid sequence of LCDR3 contained in the light chain variable region as shown in any one of SEQ ID NOs: 7, 14, 21, 28, and 35, or an amino acid sequence having one or several amino acids substituted, deleted or added compared to the amino acid sequence of LCDR3 contained in the light chain variable region.

2. The antibody or antigen-binding fragment thereof according to claim 1, characterized in that: The antibody or antigen-binding fragment thereof comprises: The three HCDRs contained in the heavy chain variable region as shown in SEQ ID NO: 6, or an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to the amino acid sequence of the three HCDRs contained in the heavy chain variable region, or an amino acid sequence having at least 80% sequence identity thereto, and the three LCDRs contained in the light chain variable region as shown in SEQ ID NO: 7, or an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to the amino acid sequence of the three LCDRs contained in the light chain variable region, or an amino acid sequence having at least 80% sequence identity thereto; or The three HCDRs contained in the heavy chain variable region as shown in SEQ ID NO: 13, or an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to the amino acid sequence of the three HCDRs contained in the heavy chain variable region, or an amino acid sequence having at least 80% sequence identity thereto, and the three LCDRs contained in the light chain variable region as shown in SEQ ID NO: 14, or an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to the amino acid sequence of the three LCDRs contained in the light chain variable region, or an amino acid sequence having at least 80% sequence identity thereto; or The three HCDRs contained in the heavy chain variable region as shown in SEQ ID NO: 20, or an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to the amino acid sequence of the three HCDRs contained in the heavy chain variable region, or an amino acid sequence having at least 80% sequence identity thereto, and the three LCDRs contained in the light chain variable region as shown in SEQ ID NO: 21, or an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to the amino acid sequence of the three LCDRs contained in the light chain variable region, or an amino acid sequence having at least 80% sequence identity thereto; or The three HCDRs contained in the heavy chain variable region as shown in SEQ ID NO: 27, or an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to the amino acid sequence of the three HCDRs contained in the heavy chain variable region, or an amino acid sequence having at least 80% sequence identity thereto, and the three LCDRs contained in the light chain variable region as shown in SEQ ID NO: 28, or an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to the amino acid sequence of the three LCDRs contained in the light chain variable region, or an amino acid sequence having at least 80% sequence identity thereto; or The three HCDRs contained in the heavy chain variable region as shown in SEQ ID NO: 34, or an amino acid sequence having one or several amino acids substituted, deleted or added compared with the amino acid sequence of the three HCDRs contained in the heavy chain variable region, or an amino acid sequence having at least 80% sequence identity thereto, and the three LCDRs contained in the light chain variable region as shown in SEQ ID NO: 35, or an amino acid sequence having one or several amino acids substituted, deleted or added compared with the amino acid sequence of the three LCDRs contained in the light chain variable region, or an amino acid sequence having at least 80% sequence identity thereto.

3. The antibody or antigen-binding fragment thereof according to claim 1, characterized in that: The antibody or antigen-binding fragment thereof comprises: HCDR1 having an amino acid sequence as shown in any one of SEQ ID NOs: 1, 8, 15, 22 or 29, an amino acid sequence having one or more amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or HCDR2 having an amino acid sequence as shown in any one of SEQ ID NO: 2, 9, 16, 23 or 30, an amino acid sequence having one or more amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or HCDR3 having an amino acid sequence as shown in any one of SEQ ID NO: 3, 10, 17, 24 or 31, an amino acid sequence having one or more amino acids substituted, deleted or added thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or LCDR1 having an amino acid sequence as shown in any one of SEQ ID NOs: 4, 11, 18, 25 or 32, an amino acid sequence having one or more amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or LCDR2 having an amino acid sequence as shown in ETS, HAS, AAS, GAS or WAS, or an amino acid sequence having an amino acid substitution, deletion or addition compared thereto; and / or LCDR3, which has an amino acid sequence as shown in any one of SEQ ID NO: 5, 12, 19, 26 or 33, an amino acid sequence having one or more amino acids substituted, deleted or added thereto, or an amino acid sequence having at least 80% sequence identity thereto.

4. The antibody or antigen-binding fragment thereof according to claim 1, characterized in that: The antibody or antigen-binding fragment thereof comprises: HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, or an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to the amino acid sequences of said HCDR1, HCDR2 and HCDR3, or an amino acid sequence having at least 80% sequence identity therewith, and / or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 4, the amino acid sequence of ETS and SEQ ID NO: 5, or an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to the amino acid sequences of said LCDR1, LCDR2 and LCDR3, or an amino acid sequence having at least 80% sequence identity therewith; or, HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, or an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to the amino acid sequences of said HCDR1, HCDR2 and HCDR3, or an amino acid sequence having at least 80% sequence identity therewith, and / or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 11, the amino acid sequence of HAS and SEQ ID NO: 12, or an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to the amino acid sequences of said LCDR1, LCDR2 and LCDR3, or an amino acid sequence having at least 80% sequence identity therewith; or, HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17, or an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to the amino acid sequences of said HCDR1, HCDR2 and HCDR3, or an amino acid sequence having at least 80% sequence identity thereto, and / or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 18, an amino acid sequence of AAS and SEQ ID NO: 19, or an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to the amino acid sequences of said LCDR1, LCDR2 and LCDR3, or an amino acid sequence having at least 80% sequence identity thereto; or, HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24, or an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to the amino acid sequences of said HCDR1, HCDR2 and HCDR3, or an amino acid sequence having at least 80% sequence identity thereto, and / or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 25, the amino acid sequence of GAS and SEQ ID NO: 26, or an amino acid sequence having one or more amino acid substitutions, deletions or additions compared to the amino acid sequences of said LCDR1, LCDR2 and LCDR3, or an amino acid sequence having at least 80% sequence identity thereto; or, HCDR1, HCDR2 and HCDR3 as shown in SEQ ID NO: 29, SEQ ID NO: 30 and SEQ ID NO: 31, or an amino acid sequence having one or several amino acid substitutions, deletions or additions compared with the amino acid sequences of said HCDR1, HCDR2 and HCDR3, or an amino acid sequence having at least 80% sequence identity thereto, and / or LCDR1, LCDR2 and LCDR3 as shown in SEQ ID NO: 32, the amino acid sequence WAS and SEQ ID NO: 33, or an amino acid sequence having one or several amino acid substitutions, deletions or additions compared with the amino acid sequences of said LCDR1, LCDR2 and LCDR3, or an amino acid sequence having at least 80% sequence identity thereto.

5. The antibody or antigen-binding fragment thereof according to claim 1, characterized in that: The antibody or antigen-binding fragment thereof comprises: A heavy chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 6, 13, 20, 27, 34, an amino acid sequence having one or more amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or The light chain variable region comprises an amino acid sequence as shown in SEQ ID NO: 7, 14, 21, 28, 35, an amino acid sequence having one or more amino acids substituted, deleted or added thereto, or an amino acid sequence having at least 80% sequence identity thereto.

6. The antibody or antigen-binding fragment thereof according to claim 1, characterized in that: The antibody or antigen-binding fragment thereof comprises: A heavy chain variable region comprising the amino acid sequence as shown in SEQ ID NO: 6, an amino acid sequence having one or more amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80% sequence identity thereto; and a light chain variable region comprising the amino acid sequence as shown in SEQ ID NO: 7, an amino acid sequence having one or more amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or A heavy chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 13, an amino acid sequence having one or more amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80% sequence identity thereto; and a light chain variable region comprising an amino acid sequence as shown in SEQ ID NO: 14, an amino acid sequence having one or more amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or A heavy chain variable region comprising the amino acid sequence as shown in SEQ ID NO: 20, an amino acid sequence having one or more amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80% sequence identity thereto; and a light chain variable region comprising the amino acid sequence as shown in SEQ ID NO: 21, an amino acid sequence having one or more amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or A heavy chain variable region comprising the amino acid sequence as shown in SEQ ID NO: 27, an amino acid sequence having one or more amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80% sequence identity thereto; and a light chain variable region comprising the amino acid sequence as shown in SEQ ID NO: 28, an amino acid sequence having one or more amino acid substitutions, deletions or additions thereto, or an amino acid sequence having at least 80% sequence identity thereto; and / or A heavy chain variable region comprising the amino acid sequence as shown in SEQ ID NO: 34, an amino acid sequence having one or several amino acids substituted, deleted or added thereto, or an amino acid sequence having at least 80% sequence identity thereto; and a light chain variable region comprising the amino acid sequence as shown in SEQ ID NO: 35, an amino acid sequence having one or several amino acids substituted, deleted or added thereto, or an amino acid sequence having at least 80% sequence identity thereto.

7. The antibody or antigen-binding fragment thereof according to claim 1, characterized in that: The antibodies include IgA, IgD, IgE, IgG or IgM types; Alternatively, the antigen-binding fragment includes scFv, Fab, Fab', (Fab')2, Fv fragment, dsFv, bispecific antibodies and multispecific antibodies; Alternatively, the antibody or antigen-binding fragment comprises a murine antibody, a chimeric antibody, a humanized antibody or a fully human antibody.

8. A nucleic acid molecule encoding the antibody or antigen-binding fragment thereof according to any one of claims 1 to 7.

9. A composition comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 7, wherein the composition is in the form of a chimeric antigen receptor, an antibody-drug conjugate, or a multispecific antibody comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 7, Alternatively, the composition further comprises one or more other drugs for preventing and / or treating Clostridium tetani infection. Alternatively, the composition further comprises a pharmaceutically acceptable carrier and / or excipient.

10. Use of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 7, the nucleic acid molecule according to claim 8, or the composition according to claim 9 in the preparation of a product for detecting, preventing and / or treating Clostridium tetani infection.

Images