Application of triterpenoid cyclase gene in regulation and control of rice grain size

Abstract

The invention discloses an application of a triterpenoid cyclase gene in regulation and control of rice grain size. The invention provides application of OsOSC10 protein or related biological materials thereof in regulation and control of plant grain development (size and weight). The related biological material is a nucleic acid molecule capable of expressing the OsOSC10 protein or an expression cassette, a recombinant vector, a recombinant bacterium or a transgenic cell line containing the nucleic acid molecule; the OsOSC10 protein is a protein as shown in SEQ ID No.1 or a protein which is subjected to substitution and / or deletion and / or addition of one or more amino acid residues, or a protein which has more than 99%, more than 95%, more than 90%, more than 85% or more than 80% of homology in sequence and has the same function, or a fusion protein obtained after the N end and / or C end of the protein are / is connected with a label. The invention has important significance for cultivating high-yield plants, especially rice varieties.

Description

Technical Field

[0001] The invention relates to the field of plant genetic engineering, and in particular to the application of a triterpene cyclase gene in regulating rice grain size. Background Art

[0002] Rice (Oryza sativa L.) is a major food crop in my country. Increasing rice yield per unit area has always been an important goal of breeding and production. Grain weight is a factor affecting rice yield, while grain length and grain width are important factors affecting grain weight.

[0003] Although there have been many reports on the regulatory mechanisms of rice yield-related traits, there are still many unknown areas that need to be studied. Identifying and discovering new yield trait regulatory genes and studying the regulatory mechanisms and internal connections of these genes not only have important theoretical significance, but also have potential application value for actual rice production.

[0004] There are 12 triterpene cyclase genes (OSCs) in rice, among which OsOSC10 can catalyze the substrate 2,3-oxidosqualene to produce friedelin. However, the biological function of this enzyme is still unclear. Summary of the invention

[0005] The present invention claims to protect the application of a triterpene cyclase gene in regulating rice grain size.

[0006] In the first aspect, the present invention claims any of the following uses of OsOSC10 protein or its related biological materials:

[0007] P1, regulating plant grain development;

[0008] P2, regulating plant seed size;

[0009] P3, regulating plant grain width;

[0010] P4, regulating plant seed weight;

[0011] P5. Regulate plant yield;

[0012] P6. Regulates cell number in plant bran.

[0013] The relevant biological material is a nucleic acid molecule capable of expressing the OsOSC10 protein, or an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic cell line containing the nucleic acid molecule.

[0014] The expression cassette refers to a DNA capable of expressing OsOSC10 in a host cell, and the DNA may include not only a promoter for initiating transcription of the OsOSC10 gene, but also a terminator for terminating transcription of the OsOSC10 gene. Further, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters, tissue, organ and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to, the ubiquitin gene Ubiqutin promoter (pUbi); the constitutive promoter 35S of cauliflower mosaic virus; the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiol 120:979-992); the chemically inducible promoter from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiocarboxylic acid S-methyl ester)); the tomato proteinase inhibitor II promoter (PIN2) or the LAP promoter (both of which can be induced by methyl jasmonate); heat shock promoters (U.S. Pat. No. 5,187,267); tetracycline-inducible promoters (U.S. Pat. No. 5,057,422); seed-specific promoters, such as millet seed-specific promoter pF128 (CN101063139B (China Patent No. 2007 1 0099169.7)), seed storage protein-specific promoters (e.g., promoters of phaseolin, napin, oleosin, and soybean beta conglycin (Beachy et al. (1985) EMBO J. 4:3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are cited in their entirety. Suitable transcription terminators include, but are not limited to, Agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and nopaline and octopine synthase terminators (see, for example, Odell et al. (1996) EMBO J. 4:3047-3053). 985 )Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627).

[0015] A recombinant expression vector containing the OsOSC10 gene expression cassette is constructed. The plant expression vector used can be a binary Agrobacterium vector or a Gateway system vector, such as pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pGWB411, pGWB412, pGWB405, pCAMBIA1391-Xa or pCAMBIA1391-Xb. When ZmGW3 is used to construct a recombinant expression vector, any enhanced, constitutive, tissue-specific or inducible promoter can be added before its transcription initiation nucleotide, such as cauliflower mosaic virus (CAMV) 35S promoter, ubiquitin gene Ubiqutin promoter (pUbi), etc., which can be used alone or in combination with other plant promoters; in addition, when the gene of the present invention is used to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers, and these enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive, and can be natural or synthetic. The translation initiation region can come from the transcription initiation region or the structural gene.

[0016] In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes (GUS gene, luciferase gene, etc.), antibiotic resistance markers (gentamicin marker, kanamycin marker, etc.) or chemical resistance marker genes (such as herbicide resistance genes), etc.

[0017] In the above applications, the vector may be a plasmid, a cosmid, a phage or a viral vector.

[0018] In the above application, the microorganism may be yeast, bacteria, algae or fungi. The bacteria may be from Escherichia, Erwinia, Agrobacterium (such as Agrobacterium tumefaciens EHA105), Flavobacterium, Alcaligenes, Pseudomonas, Bacillus, etc.

[0019] The OsOSC10 protein is any of the following:

[0020] (A1) a protein having an amino acid sequence of SEQ ID No. 1;

[0021] (A2) a protein having the same function as that of rice, wherein one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 1 are replaced and / or deleted and / or added;

[0022] (A3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity with the amino acid sequence defined in any one of (A1) to (A2) and having the same function as that of rice;

[0023] (A4) A fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of the protein defined in any one of (A1) to (A3).

[0024] In the above proteins, the protein tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The protein tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc.

[0025] In the above-mentioned proteins, identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for the identity of a pair of amino acid sequences, the identity value (%) can be obtained.

[0026] In the above proteins, the homology of more than 95% may be at least 96%, 97%, 98% identity. The homology of more than 90% may be at least 91%, 92%, 93%, 94% identity. The homology of more than 85% may be at least 86%, 87%, 88%, 89% identity. The homology of more than 80% may be at least 81%, 82%, 83%, 84% identity.

[0027] In the application, the expression level and / or activity of the OsOSC10 protein in the plant increases, promoting the grain development of the plant. The expression level and / or activity of the OsOSC10 protein in the plant decreases, inhibiting the grain development of the plant.

[0028] In the plant, the expression amount and / or activity of the OsOSC10 protein increases, the grain of the plant increases, and / or the grain width increases, and / or the grain weight increases, and / or the plant yield increases, and / or the number of cells in the plant bran increases. In the plant, the expression amount and / or activity of the OsOSC10 protein decreases, the grain of the plant decreases, and / or the grain width decreases, and / or the grain weight decreases, and / or the plant yield decreases, and / or the number of cells in the plant bran decreases.

[0029] In a second aspect, the present invention claims the use of a substance capable of increasing the expression level and / or activity of OsOSC10 protein in a plant in any one of (a1) to (a5):

[0030] (a1) promoting grain development of the plant;

[0031] (a2) increasing the width of seeds of the plant;

[0032] (a3) increasing the grain weight of the plant;

[0033] (a4) increasing the yield of the plant;

[0034] (a5) increasing the number of cells in the bran of the plant.

[0035] The OsOSC10 protein may be any one of the proteins described in (A1) to (A4) above.

[0036] In a specific embodiment of the present invention, the promoting of the grain development of the plant in (a1) is specifically manifested as the enlargement of the grains of the plant.

[0037] In a third aspect, the present invention claims the use of a substance capable of reducing the expression level and / or activity of OsOSC10 protein in plants in (b1)-(b5):

[0038] (b1) inhibiting seed development of the plant;

[0039] (b2) reducing the width of seeds of the plant;

[0040] (b3) reducing the grain weight of the plant;

[0041] (b4) reducing the yield of said plant;

[0042] (b5) reducing the number of cells in the bran of the plant.

[0043] The OsOSC10 protein may be any one of the proteins described above (A1) to (A4).

[0044] In a specific embodiment of the present invention, the inhibition of grain development of the plant in (b1) is specifically manifested as the grain size of the plant being reduced.

[0045] In a fourth aspect, the present invention claims protection for any of the following methods:

[0046] Method A: A method for promoting plant seed development, comprising the step of increasing the expression level and / or activity of OsOSC10 protein in a recipient plant. The OsOSC10 protein may be any one of the proteins described in (A1) to (A4) above.

[0047] Method B: A method for cultivating plants with enlarged grains and / or increased grain width and / or increased grain weight and / or increased plant yield and / or increased cell number in plant bran, comprising the step of increasing the expression level and / or activity of OsOSC10 protein in a recipient plant. The OsOSC10 protein may be any one of the proteins shown in (A1) to (A4) above.

[0048] In a fifth aspect, the present invention claims protection for any of the following methods:

[0049] Method C: A method for inhibiting plant seed development, comprising the step of reducing the expression level and / or activity of OsOSC10 protein in a recipient plant. The OsOSC10 protein may be any one of the proteins shown in (A1) to (A4) above.

[0050] Method D: A method for cultivating plants with reduced grains and / or reduced grain width and / or reduced grain weight and / or reduced plant yield and / or reduced cell number in plant bran, comprising the step of reducing the expression level and / or activity of OsOSC10 protein in a recipient plant. The OsOSC10 protein may be any one of the proteins shown in (A1) to (A4) above.

[0051] In a sixth aspect, the present invention claims protection for any of the following methods:

[0052] Method E: A method for cultivating a transgenic plant with enlarged grains and / or increased grain width and / or increased grain weight and / or increased plant yield and / or increased cell number in plant bran, comprising the following steps: introducing a nucleic acid molecule capable of expressing an OsOSC10 protein into a recipient plant to obtain a transgenic plant; the transgenic plant has enlarged grains and / or increased grain width and / or increased grain weight and / or increased plant yield and / or increased cell number in plant bran compared to the recipient plant. The OsOSC10 protein may be any one of the proteins shown in (A1)-(A4) above.

[0053] Method F: A method for cultivating a transgenic plant with reduced grains and / or reduced grain width and / or reduced grain weight and / or reduced plant yield and / or reduced cell number in plant bran, comprising the following steps: inhibiting the expression of a nucleic acid molecule capable of expressing an OsOSC10 protein in a recipient plant to obtain a transgenic plant; the transgenic plant has reduced grains and / or reduced grain width and / or reduced grain weight and / or reduced plant yield and / or reduced cell number in plant bran compared to the recipient plant. The OsOSC10 protein may be any one of the proteins shown in (A1)-(A4) above.

[0054] In the method E, the nucleic acid molecule capable of expressing the OsOSC10 protein can be introduced into the recipient plant in the form of a recombinant expression vector.

[0055] The nucleic acid molecule (OsOSC10 gene) can be modified as follows before being introduced into the recipient plant to achieve better expression effects:

[0056] 1) Modifying the gene sequence adjacent to the initiation methionine to allow efficient initiation of translation; for example, using a sequence known to be effective in plants;

[0057] 2) Connected to various plant-expressed promoters to facilitate their expression in plants; the promoters may include constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, tissue-preferred and tissue-specific promoters; the choice of promoter will vary with the temporal and spatial requirements of expression, and also depends on the target species; for example, a tissue or organ-specific expression promoter, depending on the stage of development at which the receptor is required; although it has been demonstrated that many promoters derived from dicotyledons can function in monocotyledons and vice versa, ideally, dicotyledon promoters are selected for expression in dicotyledons, and monocotyledon promoters are selected for expression in monocotyledons;

[0058] 3) Connecting with a suitable transcription terminator can also improve the expression efficiency of the gene of the present invention; for example, tml derived from CaMV, E9 derived from rbcS; any available terminator known to work in plants can be connected with the gene of the present invention;

[0059] 4) Introduction of enhancer sequences, such as intron sequences (e.g. from Adhl and bronzel) and viral leader sequences (e.g. from TMV, MCMV and AMV).

[0060] In a specific embodiment of the present invention, the recombinant expression vector is specifically a recombinant plasmid obtained by cloning a nucleic acid molecule capable of expressing the OsOSC10 protein into a pH7WG2D vector.

[0061] In the method F, inhibiting the expression of the nucleic acid molecule capable of expressing the OsOSC10 protein in the recipient plant can be achieved by any technical means that can achieve this purpose, such as specifically cutting the nucleic acid molecule by sequence-specific nuclease (such as CRISPR / Cas9 nuclease), thereby reducing its expression in the recipient plant.

[0062] In the present invention, it is specifically achieved by CRISPER / Cas9 technology; the 5'-N X -NGG-3' or 5'-CCN-N X -3' sequence arrangement is the target sequence; N represents any one of A, G, C and T, 14≤X≤30, and X is an integer (such as 20), N X represents X consecutive deoxyribonucleotides. More specifically, in a specific embodiment of the present invention, the target sequence is specifically SEQ ID No.3 or SEQ ID No.4.

[0063] In the above method, the recombinant expression vector or gene editing vector is introduced into the recipient plant, specifically by transforming plant cells or tissues using conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated, and the transformed plant tissue is cultivated into a plant.

[0064] In the above method, the transgenic plant is understood to include not only the first to second generation transgenic plants, but also their progeny. For transgenic plants, the gene can be propagated in the species, and the gene can also be transferred into other varieties of the same species using conventional breeding techniques, especially including commercial varieties. The transgenic plant includes seeds, callus, complete plants and cells.

[0065] In the above aspects, the nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA.

[0066] The nucleic acid molecule capable of expressing the OsOSC10 protein may be any of the following:

[0067] (B1) DNA molecule represented by SEQ ID No. 2 (CDS sequence of OsOSC10 gene);

[0068] (B2) a DNA molecule that hybridizes with the DNA molecule defined in (B1) under stringent conditions and encodes the OsOSC10 protein;

[0069] (B3) A DNA molecule that has 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology with the DNA sequence defined in any one of (B1) to (B2) and encodes the OsOSC10 protein.

[0070] In the above nucleic acid molecules, the stringent conditions may be as follows: 50°C, hybridization in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M Na3PO4 and 1mM EDTA, rinsed at 50°C, 2×SSC, 0.1% SDS; it may also be: 50°C, hybridization in a mixed solution of 7% SDS, 0.5M Na3PO4 and 1mM EDTA, rinsed at 50°C, 1×SSC, 0.1% SDS; it may also be: 50°C, hybridization in a mixed solution of 7% SDS, 0.5M Na3PO4 and 1mM EDTA, rinsed at 50°C, 0.5×SSC, 0.1% SDS; it may also be: 50°C, hybridization in a mixed solution of 7% SDS, 0.5M Na3PO4 and 1mM EDTA, rinsed at 50°C, 0.1×SSC, 0.1% Rinse in SDS; alternatively: hybridize in a mixed solution of 7% SDS, 0.5M Na3PO4 and 1mM EDTA at 50°C, rinse in 0.1×SSC, 0.1% SDS at 65°C; alternatively: hybridize in a solution of 6×SSC, 0.5% SDS at 65°C, then wash the membrane once with 2×SSC, 0.1% SDS and once with 1×SSC, 0.1% SDS.

[0071] In the above nucleic acid molecules, homology refers to the identity of nucleotide sequences. The identity of nucleotide sequences can be determined using homology search sites on the Internet, such as the BLAST webpage on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for the identity of a pair of nucleotide sequences, the identity value (%) can be obtained.

[0072] In the above nucleic acid molecules, the homology of more than 95% may be at least 96%, 97%, 98% identity. The homology of more than 90% may be at least 91%, 92%, 93%, 94% identity. The homology of more than 85% may be at least 86%, 87%, 88%, 89% identity. The homology of more than 80% may be at least 81%, 82%, 83%, 84% identity.

[0073] In a seventh aspect, the present invention claims protection for the application of any of the methods described in the fourth to sixth aspects above in plant breeding.

[0074] In the above aspects, the plant may be a monocot or a dicot.

[0075] Furthermore, the monocotyledonous plant may be a Poaceae plant.

[0076] Furthermore, the grass plant may be a rice plant.

[0077] In a specific embodiment of the present invention, the plant is rice, specifically rice Zhonghua 11.

[0078] In the above aspects, the grain weight can be expressed as thousand-grain weight.

[0079] Experiments have shown that, on the one hand, the present invention overexpresses OsOSC10 in rice ZH11, and on the other hand, uses the CRISPR-Cas9 method to mutate the OsOSC10 gene. The results show that overexpression can promote the increase of rice grain width and grain weight; after mutation, the grain width can be reduced and the grain weight can be reduced. Further detection found that the number of cells in the bran of overexpressed rice plants increased, while the number of cells in the bran of mutant rice plants decreased, indicating that OsOSC10 regulates the size of rice grains by affecting the number of cells in the inner and outer palea during grain maturation. It can be seen that the OsOSC10 gene plays an important role in regulating the grain weight and grain width of rice grains, and the present invention is of great significance for cultivating high-yield plants, especially rice varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0080] Figure 1 is the expression level of OsOSC10 in different tissues of rice.

[0081] Figure 2 This is the nucleotide sequence of the OsOSC10 mutant material.

[0082] Figure 3 This is the amino acid sequence of the OsOSC10 mutant material.

[0083] Figure 4 The results of PCR identification of OsOSC10 overexpression materials. a is the identification of positive plants of OsOSC10 overexpression materials; b is the analysis of OsOSC10 gene expression in positive plants of OsOSC10 overexpression materials.

[0084] Figure 5Analysis of suberinone content in OsOSC10 transgenic materials. a is the chromatogram of suberinone in each material, and the arrow indicates the position of suberinone in the chromatogram; b is the quantitative analysis of suberinone content in each material. In a and b, osc10-Cr is the OsOSC10 Crispr mutant material, and OSC10-OE is the OsOSC10 overexpression material. The quantitative data of osc10-Cr are the averages of the four mutants osc10Cr-1, osc10Cr-2, osc10Cr-3, and osc10Cr-4. The quantitative data of OSC10-OE are the averages of the two overexpression strains OSC10-OE-1 and OSC10-OE-2.

[0085] Figure 6 This is the grain type analysis of OsOSC10 transgenic materials. osc10-Cr is the OsOSC10 Crispr mutant material, and OSC10-OE is the OsOSC10 overexpression material. The quantitative data of osc10-Cr is the average of the four mutants osc10Cr-1, osc10Cr-2, osc10Cr-3, and osc10Cr-4. The quantitative data of OSC10-OE is the average of the two overexpression lines OSC10-OE-1 and OSC10-OE-2.

[0086] Figure 7 The results are for the analysis of grain length and 1000-grain weight of OsOSC10 transgenic materials. osc10-Cr is the OsOSC10 Crispr mutant material, and OSC10-OE is the OsOSC10 overexpression material. The quantitative data of osc10-Cr are the average values ​​of the four mutants osc10Cr-1, osc10Cr-2, osc10Cr-3, and osc10Cr-4. The quantitative data of OSC10-OE are the average values ​​of the two overexpression lines OSC10-OE-1 and OSC10-OE-2.

[0087] Figure 8 Analysis of cell size and number in the grain bran of OsOSC10 transgenic materials. a is the microscopic observation of the cells in the grain bran of OsOSC10 transgenic materials; b is the analysis of cell size and cell number in the grain bran of OsOSC10 transgenic materials. In a and b, osc10-Cr is the OsOSC10 Crispr mutant material, and OSC10-OE is the OsOSC10 overexpression material. The quantitative data of osc10-Cr are the averages of the four mutants osc10Cr-1, osc10Cr-2, osc10Cr-3, and osc10Cr-4. The quantitative data of OSC10-OE are the averages of the two overexpression lines OSC10-OE-1 and OSC10-OE-2. DETAILED DESCRIPTION

[0088] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0089] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0090] The amino acid sequence of the OsOSC10 protein involved in the following examples is shown in SEQ ID No.1, and the CDS sequence of the coding gene corresponding to the protein is shown in SEQ ID No.2.

[0091] Example 1. Analysis of OsOSC10 gene expression pattern

[0092] 1. Total RNA extraction from different tissues of rice

[0093] Rice Zhonghua 11 (abbreviated as ZH11) was used as the material, and the following 15 tissue parts were selected: embryo, radicle and coleoptile at the seed germination stage; root, stem and leaf at the seedling stage; root, stem, leaf, stamen, pistil, palea and lemma at the mature stage; embryo and endosperm at the filling stage for RNA extraction. The total RNA extraction method is as follows (TRIzol method):

[0094] (1) Preparation of 1000× DEPC aqueous solution: Dissolve 1 mL of DEPC in 1 L of distilled water and stir overnight with a magnetic stirrer until fully dissolved.

[0095] (2) Soak the centrifuge tubes and stainless steel balls required for RNA extraction in the prepared DEPC solution. After soaking for about 10 hours, sterilize with high temperature and high pressure to decompose DEPC;

[0096] (3) Materials from various rice tissues (approximately 100 mg) were placed in a 2 mL RNase-free centrifuge tube containing a stainless steel bead (treated with DEPC) and quickly frozen in liquid nitrogen;

[0097] (4) Crushing the sample using a ball mill (frequency 30 Hz, crushing 20 s);

[0098] (5) Quickly add 1 mL of TRIzol solution, vortex until the sample and TRIzol solution are thoroughly mixed, and then leave at room temperature for 5 min;

[0099] (6) Add 200 μL of chloroform, vortex mix immediately, and let stand at room temperature for about 3 min;

[0100] (7) Centrifuge at 12,000 rpm for 15 min at low temperature (4°C), and then transfer 600 μL of the supernatant into a new 1.5 mL RNase-free centrifuge tube;

[0101] (8) Add an equal volume (600 μL) of pre-cooled isopropanol, vortex to mix, and let stand at room temperature for about 10 min;

[0102] (9) Centrifuge again at low temperature (4°C) for 15 min (12,000 rpm), discard the supernatant, and add 1 mL of 75% ethanol to wash the RNA precipitate;

[0103] (10) Centrifuge at 7,500 rpm for 5 min at 4°C and discard the supernatant;

[0104] (11) Use a pipette to remove the remaining solution, open the tube cap, and let it stand at room temperature for 5-10 min until the RNA precipitate becomes translucent;

[0105] (12) Add 30 μL RNase-free ddH2O to dissolve the precipitate, vortex to mix, and centrifuge at 7,500 rpm at 4°C for 1 min;

[0106] (13) The quality of the total RNA obtained was detected by agarose gel electrophoresis (sample volume: 1 μL).

[0107] 2. Removal of genomic DNA from total RNA

[0108] In order to prevent the DNA contained in the extracted total RNA from affecting subsequent experiments, DNase enzyme is needed to remove the DNA.

[0109] (1) Preparation of DNA removal reaction solution:

[0110]

[0111] After vortex mixing, incubate at 37°C for 1 h;

[0112] (2) After the reaction, add 50 μL RNase-free ddH2O and vortex to mix, then add 50 μL Tris-saturated phenol and 50 μL chloroform:isoamyl alcohol (volume ratio 24:1) solution, mix thoroughly, and centrifuge at 12,000 rpm for 10 min at 4°C;

[0113] (3) Pipette 100 μL of the upper layer solution into a new 1.5 mL centrifuge tube (RNase-free), add 100 μL of chloroform:isoamyl alcohol (volume ratio 24:1) solution again, vortex to mix, and centrifuge at 12,000 rpm at 4°C for 10 min;

[0114] (4) Pipette 100 μL of the upper solution into a new 1.5 mL RNase-free centrifuge tube, add 1 / 10 volume (10 μL) of 3 M sodium acetate (NaAc) solution, then add 2.5 volumes (250 μL) of pre-cooled anhydrous ethanol, vortex to mix, and place in a -20°C refrigerator for 1 hour or overnight;

[0115] (5) Centrifuge at 12,000 rpm for 30 min at 4°C. Discard the supernatant and wash the RNA precipitate twice with 75% ethanol and dry.

[0116] (6) Add 15 μL ddH2O (RNase-free) to dissolve the RNA precipitate, and then use agarose gel electrophoresis to detect the quality of the total RNA obtained (sample volume 1 μL).

[0117] 3. RNA Reverse Transcription

[0118] Using Invitrogen SuperScript TM III reverse transcriptase, the steps are as follows:

[0119] (1) oligo(dT) 18 Primers bind to RNA template:

[0120]

[0121] After vortex mixing, centrifuge briefly, react at 65°C for 5 min in a PCR instrument, and immediately place on ice for 3 min;

[0122] (2) cDNA synthesis: Add the following components to the reaction system in (1):

[0123]

[0124]

[0125] Vortex mix and centrifuge briefly, then place in a PCR instrument at 50°C for 1 hour and 70°C for 15 minutes. The obtained cDNA solution was stored at -20°C for later use.

[0126] 4. Quantitative real-time PCR (qRT-PCR)

[0127] The cDNA solution obtained by reverse transcription was diluted 20 times with sterile deionized water and used as a template. qRT-PCR was performed using SuperReal Pre Mix (SYBR Green). The specific primer sequences are as follows:

[0128] OsACTIN-qRT-F: 5'-CGTCAGCAACTGGGATGATATG-3';

[0129] OsACTIN-qRT-R: 5'-TCACCAGAGTCCAACACAATAC-3';

[0130] OsOSC10-qRT-F: 5'-CTACTGCTCAACCGGCCTT-3';

[0131] OsOSC10-qRT-R: 5'-AAGAGTATCCCGCAATAGGCCAT-3'.

[0132] The housekeeping gene OsACTIN (Os03g0718100) in rice was used as the internal reference gene for normalization of cDNA templates. -ΔΔCT The expression of genes in different materials was analyzed by PCR (PCR). Each material contained 4 biological replicates, and the final expression of each gene was the average of the 4 biological replicates. The reaction system was as follows:

[0133]

[0134] The reaction program was: 94°C for 30 s; 94°C for 5 s, 60°C for 10 s, 72°C for 15 s, for 40 cycles.

[0135] The results showed that OsOSC10 was expressed at the highest level in the inner and outer lemma of rice grains, and at lower levels in other tissues ( Figure 1 ).

[0136] Example 2: Role of OsOSC10 in Rice

[0137] 1. Creation of OsOSC10 rice mutant material using CRISPR / Cas technology

[0138] The guide RNA (gRNA) target sequence was linked to the CRISPR / Cas9 plasmid (see "Beifang Wang, et al. Impaired Function of the Calcium-Dependent Protein Kinase, OsCPK12, Leads to Early Senescence in Rice (Oryza sativa L.). Front Plant Sci (2019)") through a one-step reaction using a CRISPR / Cas vector construction kit (BIOGLE, Cat#BGK03), and used for plant transformation. The specific process is as follows:

[0139] (1) The gRNA target sequence (Oligo) was designed using the CRISPR-P website (http: / / crispr.hzau.edu.cn / CRISPR2 / ), which contained an NGG sequence (PAM sequence) and was 20 bp in length.

[0140] The target sequence 1 of OsOSC10 is: 5′-ACATTATTTATCCTCCTTCGTGG-3′ (SEQ ID No. 3);

[0141] The corresponding Oligo1 sequence is as follows:

[0142] Oligo1-F:

[0143] Oligo1-R: 5'- AAAC CCACGAAGGAGGATAAATAATGT CA -3'.

[0144] The target sequence 2 of OsOSC10 is: 5′-TTAGGCCCAAGCTCCATGTTTGG-3′ (SEQ ID No. 4);

[0145] The corresponding Oligo2 sequence is as follows:

[0146] Oligo2-F:

[0147] Oligo2-R: 5'- AAAC CCAAACATGGAGCTTGGGCCTAA CA -3'.

[0148] Among them, the underlined part is the vector-specific recognition sequence after vector enzyme cutting, and the base in the box is the PAM sequence.

[0149] (2) Preparation of oligo dimers. Dissolve the primers to 10 μM and prepare oligo dimers according to the following system: 18 μL Buffer Aneal, 1 μL Oligo-F, 1 μL Oligo-R. Mix well and heat at 95°C for 3 min in a PCR instrument, then cool to 20°C.

[0150] (3) Connect the oligo dimer to the CRISPR / Cas9 vector. The connection system is: 2 μL of CRISPR / Cas9 vector, 1 μL of oligo dimer, 1 μL of enzyme mix, and add ddH2O to supplement the reaction system to 10 μL. After mixing, react at room temperature for 1 hour.

[0151] (4) The ligation product was transformed into E. coli DH5α competent cells and screened using LB plates containing Kanamycin (Kanamycin concentration was 50 μg / mL).

[0152] (5) The positive clones were identified by PCR and sequenced. The sequencing primer was: 5'-CCCAGTCACGACGTTGTAAA-3'.

[0153] (6) The positive clone plasmid was transformed into Agrobacterium EHA105 competent cells and screened using YEB plates containing Rifampin and Kanamycin resistance (100 mg / L Rif, 100 mg / L Kan). A single colony was picked and identified by PCR in the bacterial solution. A single colony was picked and identified by PCR in the bacterial solution, with primers Hyg-F1 / Hyg-R1, and the amplified fragment size was 481 bp.

[0154] Hyg-F1: 5'-CGAGAGCCTGACCTATTGCAT-3';

[0155] Hyg-R1: 5'-CTGCTCCATACAAGCCAACCAC-3'.

[0156] (7) The positive clone solution was inoculated into 50 mL YEB liquid medium (containing 100 mg / L Rif and 100 mg / L Kan) at a ratio of 1:100 (volume ratio) and cultured at 28°C with shaking at 220 rpm until OD 600 =0.5.

[0157] (8) Collect the bacteria by centrifugation at 4,000 rpm for 10 min and resuspend them in an equal volume of AAM-AS medium. Then infect rice ZH11 callus. After transgenic seedlings grow, screen positive plants with hygromycin (Hyg) resistance gene primers. Primers Hyg-F / Hyg-R (sequences as above), amplified fragment size 481 bp.

[0158] Four positive mutant materials were randomly selected and recorded as osc10Cr-1, osc10Cr-2, osc10Cr-3 and osc10Cr-4. Among them, osc10Cr-1 and osc10Cr-2 are positive mutants of Oligo1 introduced into OsOSC10. In these two mutants, the 944-945bp nucleotide CT in the OsOSC10 CDS sequence is missing ( Figure 2 ), resulting in premature translation termination of OsOSC10 protein at amino acid 327 ( Figure 3 ); osc10Cr-3 and osc10Cr-4 are positive mutants of Oligo2 introduced into OsOSC10. In these two mutants, the 520-524 bp nucleotide TCCAT in the OsOSC10 CDS sequence is missing ( Figure 2 ), resulting in premature translation termination of OsOSC10 protein at amino acid 179 ( Figure 3 ).

[0159] 2. Creation of OsOSC10 overexpressing rice materials

[0160] (1) The cDNA obtained in the seedling leaves of rice Zhonghua 11 (ZH11) in Example 1 was used as a template to amplify the full-length sequence of OsOSC10 using Phusion high-fidelity DNA polymerase. The corresponding restriction site was added to the 5' end of the PCR primer. The primer used was OsOSC10 OE-F1 / R1, and the specific sequence was as follows:

[0161] OsOSC10 OE-F1: 5'-ATGTGGAAGCTAAAGTTTGGTGAG-3';

[0162] OsOSC10OE-R1: 5'-TTAAGCCCTTTTTGCTAGAAGTCG-3'.

[0163] The reaction system is as follows:

[0164]

[0165] PCR reaction program: 98°C for 2 min; 98°C for 10 s, 58°C for 30 s, 72°C for 2.5 min, 30 cycles; 72°C for 10 min.

[0166] (2) Use the GenStar gel recovery kit to recover the PCR product.

[0167] (3) The PCR product was connected to the pCR8 / GW / TOPO vector (InvitrogenTM, K250020).

[0168] a. Add A to the 3' end of the PCR product. The reaction system is as follows:

[0169]

[0170]

[0171] Mix well, incubate at 72°C for 30 min, and place on ice for 2 min;

[0172] b. Add product A and connect it to pCR8 / GW / TOPO vector. The reaction system is as follows:

[0173]

[0174] Mix well, react at room temperature for 20 min, and then place on ice.

[0175] (4) The ligation product is transformed into competent E. coli cells.

[0176] (5) Pick the positive clones, extract the plasmid after culture, and linearize it with PvuⅠ. The enzyme digestion system is as follows:

[0177]

[0178] (6) The digested product was recovered from the gel and the linearized fragment was connected to the expression vector pH7WG2D (Invitrogen, USA) by LR recombination reaction. The connection system was as follows:

[0179] PvuⅠ recovered product 1μL

[0180] pH7WG2D plasmid 1 μL

[0181] LR Clonase Enzyme mix 0.5μL

[0182] Mix well, react at room temperature for 1 h, add 0.5 μL Proteinase K, and terminate the reaction at 37°C for 10 min.

[0183] (7) The ligation product was transformed into competent E. coli cells, and the transformation product was spread on LB solid medium containing 100 mg / mL Spe and cultured at 37°C overnight.

[0184] (8) The positive clone plasmid was transformed into Agrobacterium EHA105 competent cells and screened using YEB plates containing Rifampin and Kanamycin resistance (100 mg / L Rif, 100 mg / L Kan).

[0185] (9) The positive clone solution was inoculated into 50 mL YEB liquid medium (containing 100 mg / L Rif and 100 mg / L Kan) at a ratio of 1:100 (volume ratio) and cultured at 28°C with shaking at 220 rpm until OD 600 =0.5 and then infected rice ZH11 callus tissue.

[0186] (8) The cells were centrifuged at 4,000 rpm for 10 min to collect the bacteria, and the cells were resuspended in an equal volume of AAM-AS medium. The cells were then infected with rice ZH11 callus tissue. After transgenic seedlings grew out, the primers Hyg-F2 / Hyg-R2 were used to identify transgenic positive plants. Two OsOSC10 gene overexpression materials were obtained, numbered as OSC10-OE-1 and OSC10-OE-2. Figure 4 a).

[0187] Hyg-F2: 5'-TTAGCGAACTGTGGACGAGAACT-3';

[0188] Hyg-R2: 5'-TGGCGTGATTTCATATGCGCGAT-3'.

[0189] In order to further analyze the expression level of OsOSC10 gene in OSC10-OE-1 and OSC10-OE-2, the expression level of OsOSC10 gene in the leaves of overexpression materials and wild-type materials was detected by RT-PCR method. The specific steps are as follows: Take the leaves of wild-type and overexpression materials at the tillering stage and extract and reverse transcribe total RNA using the method of Example 1. Then, the housekeeping gene OsACTIN (Os03g0718100) in rice is used as the internal reference gene to normalize the cDNA template. RT-PCR is performed using the normalized cDNA as a template, and the reaction system is as follows:

[0190]

[0191] After vortex mixing, PCR reaction was performed. The PCR program was: 94°C for 5 min (pre-denaturation); 94°C for 30 s, 60°C for 30 s, 72°C for 30 s, 28 cycles; 72°C for 10 min.

[0192] The results showed that compared with the wild type, the expression level of OsOSC10 in the leaves of OSC10-OE-1 and OSC10-OE-2 overexpressing materials was significantly increased ( Figure 4 (b)

[0193] 3. Detection of suberinone content in OsOSC10 transgenic materials

[0194] Since the expression level of OsOSC10 is highest in the inner and outer lemma of rice grains, the bran of mature grains of wild-type rice ZH11, OsOSC10 mutant (step 1) and overexpression material (step 2) was used for compound detection. The specific steps are as follows:

[0195] (1) Sampling: Immediately freeze the sample in liquid nitrogen and then dry it in a low-temperature vacuum freezer. After the sample is completely dry, accurately weigh 100 mg into a 2.0 mL Eppendorf tube. Add a stainless steel ball and grind it with an MM400 ball mill (Roach, Germany) at a vibration frequency of 20 Hz for 10 min.

[0196] (2) Metabolite extraction. Compounds were extracted using alkaline lysis method. Lysis solution formula: KOH 10%, EtOH 80%, ddH2O 10%, betulin 50μg / mL. The specific steps are as follows:

[0197] a. Add 3 mL of lysis buffer to each sample and lyse at 70°C for 2 h. Vortex several times between lysis to ensure adequate lysis.

[0198] b. Centrifuge at 12,000 rpm for 10 min and transfer the supernatant to a glass tube;

[0199] c. Extract three times with an equal volume of n-hexane;

[0200] d. Wash with an equal volume of saturated sodium chloride solution three times to remove impurities;

[0201] e. After blowing dry the n-hexane in the sample with nitrogen, redissolve it with 1 mL of n-hexane.

[0202] (3) Compound detection.

[0203] The compounds in each sample were detected by GC-MS. The specific steps are as follows:

[0204] a. Pipette 500 μL of sample into an Agilent injection bottle, blow dry with nitrogen, add 100 μL of derivatization reagent MSTFA, and derivatize at 60°C for 30 min;

[0205] b. Use Agilent GC-QQQ-MS to analyze the derivatized samples. The GC / MS column model is DB-5HT (30m×0.25mm id., 0.1μm film thickness, Agilent). The injector temperature is 280℃, and the ion source temperature is 200℃. The heating program is: 60℃ for 2min, increase the temperature to 220℃ at a rate of 30℃ / min, maintain for 3min, increase the temperature to 310℃ at a rate of 2℃ / min, and maintain for 5min. The injection volume is 1μL, and the split ratio is 10:1. The carrier gas (nitrogen) flow rate is 1.5mL / min. The mass spectrometer detector scans at a speed of 30 times / second, and the scanning range m / z is 30-550;

[0206] c. Agilent analytical software Qualitative Analysis of MassHunter Acquisition Data was used for compound analysis.

[0207] The results showed that compared with the wild type, the suberinone content in the bran of the OsOSC10 mutant grains (the average of the four mutants osc10Cr-1, osc10Cr-2, osc10Cr-3, and osc10Cr-4) was significantly reduced, while the suberinone content in the OsOSC10 overexpression materials (the average of the two overexpression lines OSC10-OE-1 and OSC10-OE-2) was significantly increased ( Figure 5 ).

[0208] Example 3. Analysis of biological functions of OsOSC10

[0209] 1. Grain shape analysis of OsOSC10 transgenic materials

[0210] The wild-type Zhonghua 11 and OsOSC10 transgenic positive materials (including the OsOSC10 mutant obtained in step 1 of Example 2 and the OsOSC10 overexpression material obtained in step 2) were planted in a rice pond, and the grains of each material were harvested after the grains matured. After the grains were dried in the open air, about 100 grains were randomly selected from each material for phenotypic analysis. Through the grain shape analysis of the mature grains of the OsOSC10 transgenic materials, it was found that compared with the wild type, the grain width of the OsOSC10 overexpression materials (the average value of the grain width of OSC10-OE-1 and OSC10-OE-2) was significantly increased (p<0.05), while the grain width of the mutant materials (the average value of the grain width of osc10Cr-1, osc10Cr-2, osc10Cr-3, and osc10Cr-4) was significantly reduced (p<0.05), indicating that OsOSC10 has a certain regulatory effect on rice grain shape ( Figure 6). Further analysis revealed that the grain length of OsOSC10 overexpression materials and mutant materials was not significantly different from that of the wild type ( Figure 7 ). However, the thousand-grain weight of OsOSC10 transgenic materials changed significantly ( Figure 7 ), which further indicated that OsOSC10 had a certain effect on rice yield.

[0211] 2. Analysis of cell size in the bran of OsOSC10 transgenic material

[0212] In order to explore the reasons why OsOSC10 affects rice grain size, the cell size in the grain bran of each transgenic material at maturity was observed using a scanning electron microscope. The specific steps are as follows:

[0213] (1) Pasting the grain bran of each transgenic material at the mature stage on a stage;

[0214] (2) Spray gold and coat the sample stage using an ion sputtering instrument;

[0215] (3) The samples were observed and photographed using a scanning electron microscope (S-4800 FESEM (Hitachi, Japan) at 10 KV.

[0216] (4) Image J software was used to count the size of cells in each material. The number of cells was the total number of cells observed in the field of view at the same magnification, the cell length was the average of the lengths of 30 cells measured, and the cell width was the average of the widths of 30 cells measured.

[0217] The results showed that compared with the wild type, the number of cells in the bran of the overexpressing materials (the average number of cells in the bran of OSC10-OE-1 and OSC10-OE-2) increased significantly, while the number of cells in the bran of the mutant materials (the average number of cells in the bran of osc10Cr-1, osc10Cr-2, osc10Cr-3, and osc10Cr-4) decreased ( Figure 8 ), indicating that OsOSC10 regulates rice grain size by affecting the number of cells in the inner and outer palea during grain maturation.

[0218] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Use of OsOSC10 protein or its related biological materials in any of the following; P1, regulating plant grain development; P2, regulating plant seed size; P3, regulating plant grain width; P4, regulating plant seed weight; P5. Regulate plant yield; P6, regulating the number of cells in plant bran; The OsOSC10 protein is any of the following: (A1) a protein having an amino acid sequence of SEQ ID No. 1; (A2) a protein having the same function as that of rice, wherein one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 1 are replaced and / or deleted and / or added; (A3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more identity with the amino acid sequence defined in any one of (A1) to (A2) and having the same function as that of rice; (A4) a fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of any one of the proteins defined in (A1) to (A3); The relevant biological material is a nucleic acid molecule capable of expressing the OsOSC10 protein, or an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic cell line containing the nucleic acid molecule.

2. The use according to claim 1, characterized in that: The expression level and / or activity of the OsOSC10 protein in the plant is increased, thereby promoting the grain development of the plant; and / or The expression level and / or activity of the OsOSC10 protein in the plant is reduced, thereby inhibiting the grain development of the plant; and / or In the plant, the expression level and / or activity of the OsOSC10 protein is increased, the grain size and / or the grain width and / or the grain weight and / or the plant yield and / or the number of cells in the plant bran are increased; and / or In the plant, the expression level and / or activity of the OsOSC10 protein is reduced, the grain size and / or grain width and / or grain weight and / or plant yield and / or the number of cells in the plant bran are reduced.

3. Use of a substance capable of increasing the expression level and / or activity of OsOSC10 protein in plants in any one of (a1) to (a5): (a1) promoting grain development of the plant; (a2) increasing the width of seeds of the plant; (a3) increasing the grain weight of the plant; (a4) increasing the yield of the plant; (a5) increasing the number of cells in the bran of the plant; and / or Use of a substance capable of reducing the expression level and / or activity of OsOSC10 protein in plants in (b1)-(b5): (b1) inhibiting seed development of the plant; (b2) reducing the width of seeds of the plant; (b3) reducing the grain weight of the plant; (b4) reducing the yield of said plant; (b5) reducing the number of cells in the bran of the plant; The OsOSC10 protein is any of the following proteins: (A1) a protein having an amino acid sequence of SEQ ID No. 1; (A2) a protein derived from rice having the same function as the amino acid sequence shown in SEQ ID No. 1, through substitution and / or deletion and / or addition of one or more amino acid residues; (A3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology with the amino acid sequence defined in any one of (A1) to (A2) and having the same function as that of rice; (A4) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein defined in any one of (A1) to (A3).

4. Either of the following methods: Method A: A method for promoting plant grain development, comprising the step of increasing the expression level and / or activity of OsOSC10 protein in a recipient plant; Method B: A method for cultivating plants with enlarged grains and / or increased grain width and / or increased grain weight and / or increased plant yield and / or increased cell number in plant bran, comprising the step of increasing the expression amount and / or activity of OsOSC10 protein in a recipient plant; The OsOSC10 protein is any of the following proteins: (A1) a protein having an amino acid sequence of SEQ ID No. 1; (A2) a protein derived from rice having the same function as the amino acid sequence shown in SEQ ID No. 1, through substitution and / or deletion and / or addition of one or more amino acid residues; (A3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology with the amino acid sequence defined in any one of (A1) to (A2) and having the same function as that of rice; (A4) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein defined in any one of (A1) to (A3).

5. Either of the following methods: Method C: A method for inhibiting plant grain development, comprising the step of reducing the expression level and / or activity of OsOSC10 protein in a recipient plant; Method D: A method for breeding plants with reduced grains and / or reduced grain width and / or reduced grain weight and / or reduced plant yield and / or reduced cell number in plant bran, comprising the step of reducing the expression amount and / or activity of OsOSC10 protein in a recipient plant; The OsOSC10 protein is any of the following proteins: (A1) a protein having an amino acid sequence of SEQ ID No. 1; (A2) a protein derived from rice having the same function as the amino acid sequence shown in SEQ ID No. 1, through substitution and / or deletion and / or addition of one or more amino acid residues; (A3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology with the amino acid sequence defined in any one of (A1) to (A2) and having the same function as that of rice; (A4) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein defined in any one of (A1) to (A3).

6. Either of the following methods: Method E: A method for cultivating a transgenic plant with enlarged grains and / or increased grain width and / or increased grain weight and / or increased plant yield and / or increased cell number in plant bran, comprising the following steps: introducing a nucleic acid molecule capable of expressing an OsOSC10 protein into a recipient plant to obtain a transgenic plant; the transgenic plant has enlarged grains and / or increased grain width and / or increased grain weight and / or increased plant yield and / or increased cell number in plant bran compared with the recipient plant; Method F: A method for cultivating transgenic plants with reduced grains and / or reduced grain width and / or reduced grain weight and / or reduced plant yield and / or reduced cell number in plant bran, comprising the following steps: inhibiting the expression of a nucleic acid molecule capable of expressing the OsOSC10 protein in a recipient plant to obtain a transgenic plant; the transgenic plant has reduced grains and / or reduced grain width and / or reduced grain weight and / or reduced plant yield and / or reduced cell number in plant bran compared with the recipient plant; The OsOSC10 protein is any of the following proteins: (A1) a protein having an amino acid sequence of SEQ ID No. 1; (A2) a protein derived from rice having the same function as the amino acid sequence shown in SEQ ID No. 1, through substitution and / or deletion and / or addition of one or more amino acid residues; (A3) a protein having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology with the amino acid sequence defined in any one of (A1) to (A2) and having the same function as that of rice; (A4) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein defined in any one of (A1) to (A3).

7. The method according to claim 6, characterized in that: In the method E, the nucleic acid molecule capable of expressing the OsOSC10 protein is introduced into the recipient plant in the form of a recombinant expression vector; or In the method F, inhibiting the expression of the nucleic acid molecule capable of expressing the OsOSC10 protein in the recipient plant is achieved by CRISPR / Cas9 gene editing technology.

8. The use or method according to any one of claims 1 to 7, characterized in that: The nucleic acid molecule capable of expressing the OsOSC10 protein is any one of the following: (B1) DNA molecule shown in SEQ ID No. 2; (B2) a DNA molecule that hybridizes with the DNA molecule defined in (B1) under stringent conditions and encodes the OsOSC10 protein; (B3) A DNA molecule that has 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology with the DNA sequence defined in any one of (B1) to (B2) and encodes the OsOSC10 protein.

9. Use of the method according to any one of claims 4 to 8 in plant breeding.

10. The use or method according to any one of claims 1 to 9, characterized in that: The plant is a monocot or a dicot; Further, the monocotyledonous plant is a grass plant; Furthermore, the grass plant is a rice plant; More specifically, the rice plant is rice; and / or The grain weight is thousand-grain weight.

Images