Primer pair for amplifying biological marker and application of primer pair in preparation of reagent or kit for diagnosing cardiac insufficiency of densification

Abstract

The invention relates to the technical field of gene diagnosis markers, in particular to a primer pair for amplifying a biological marker and application of the primer pair in preparation of a reagent or a kit for diagnosing myocardial insufficiency. The primer pair comprises an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is as shown in SEQ ID NO. 1, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO. 2. The primer pair provided by the invention can amplify a biological marker of myocardial insufficiency, the biological marker comprises a 6061 basic group which is located at a human TTN gene DNA sequence GenBank accession number 63923, is mutated from C to T, and is a nonsense mutation, gene sequencing is carried out on a patient with myocardial insufficiency in clinical diagnosis, and the primer pair can be used for amplifying the myocardial insufficiency. Gene mutation disease co-separation verification is carried out in a family, and the pathogenicity of the biological marker is verified.

Description

[0001] The present invention is a divisional application with an application date of August 4, 2021, patent application number 202110889836.1, and invention name “Primer pairs for amplifying biological markers and their use in the preparation of reagents or kits for diagnosing myocardial incomplete compaction”. Technical Field

[0002] The present invention relates to the technical field of gene diagnosis markers, in particular to a primer pair for amplifying biological markers and an application of the primer pair in preparing a reagent or a kit for diagnosing myocardial noncompaction. Background Art

[0003] Noncompaction of ventricular myocardium (NVM) is a hereditary cardiomyopathy that seriously endangers human health. It is caused by the failure of the ventricular myocardial trabeculae to compact in the early embryonic development, resulting in the persistence of trabeculated myocardium. It is characterized by many protruding trabeculae in the ventricles, deep recesses between trabeculae, and decreased ventricular systolic and diastolic function. It can lead to malignant arrhythmias, severe heart failure, systemic embolism, and sudden death, with a poor prognosis. In March 2006, the American College of Cardiology's new definition and classification criteria for cardiomyopathy classified NVM as hereditary cardiomyopathy. NVM is mainly inherited in an autosomal dominant manner, and more than 44% of cases are familial. NVM shows a high degree of genetic heterogeneity. NVM can exist in isolation, and it is also common to coexist with other diseases (such as congenital heart disease or primary cardiomyopathy). However, to date, the pathogenesis of NVM is still unclear, and the pathogenic genes of most NVM in the population have not been confirmed. At present, the main problems in the prevention and treatment of NVM are as follows: diagnosis mainly relies on imaging manifestations, and there is a lack of genetic diagnostic standards; the pathological mechanism is still unclear, and there is a lack of reliable precision therapeutic intervention targets. Therefore, seeking reliable genetic diagnostic markers and clarifying the pathogenesis of NVM are scientific issues that need to be urgently addressed in the field of NVM. Therefore, it is of great significance for the precise diagnosis and treatment of NVM to search for new possible pathogenic mutations through gene sequencing of NVM patients, verify the pathogenicity of new mutations in families, and construct disease models at the cytological level for functional verification. Summary of the invention

[0004] In order to solve the above problems, the present invention provides a primer pair for amplifying biological markers and its use in preparing a reagent or kit for diagnosing myocardial incomplete compaction. The primer pair provided by the present invention can amplify biological markers of myocardial incomplete compaction, and on the basis of the currently known NVM pathogenic mutations, it supplements the pathogenic mutation spectrum of myocardial incomplete compaction, which is of great significance for the accurate diagnosis and treatment of NVM.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides the use of a mutant base as a biological marker in the preparation of a reagent or a kit for diagnosing or predicting myocardial noncompaction, wherein the mutant base includes the 6061st base of the human TNN gene DNA sequence GenBank accession number 63923, which is mutated from C to T.

[0007] The invention provides the use of c.C6061>T:p.R2021X of human TTN gene as a detection target in preparing a kit for auxiliary diagnosis or auxiliary prediction of myocardial noncompaction.

[0008] The present invention also provides the use of a reagent or primer pair for detecting a biological marker in preparing a reagent or kit for predicting the prognosis of a patient with myocardial noncompaction, wherein the biological marker includes the 6061st base located in the human TNN gene DNA sequence with GenBank accession number 63923, which is mutated from C to T.

[0009] The present invention also provides a primer pair for amplifying a biological marker of myocardial noncompaction, the primer pair comprising an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2.

[0010] Preferably, the biological marker includes the 6061st base located in the human TTN gene DNA sequence with GenBank accession number 63923, which is mutated from C to T.

[0011] The present invention also provides the use of the primer pair in preparing a reagent or a kit for diagnosing myocardial noncompaction.

[0012] The present invention also provides the use of the primer pair in preparing a reagent or a kit for predicting the prognosis of patients with myocardial noncompaction.

[0013] The present invention also provides the use of the primer pair in preparing a reagent or a kit for predicting the risk of asymptomatic gene mutation carriers developing myocardial noncompaction in the future.

[0014] The present invention also provides a reagent or a kit for diagnosing myocardial noncompaction, wherein the reagent or the kit comprises the above-mentioned primer pair.

[0015] The present invention also provides a reagent or a kit for predicting the prognosis of patients with myocardial noncompaction, wherein the reagent or the kit comprises the above-mentioned primer pair.

[0016] The present invention also provides a reagent or a kit for predicting the risk of asymptomatic gene mutation carriers developing myocardial noncompaction in the future, wherein the reagent or the kit comprises the above-mentioned primer pair.

[0017] Beneficial effects:

[0018] The present invention provides a primer pair for amplifying a biological marker of myocardial incomplete compaction, the primer pair comprising an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2. The primer pair provided by the present invention can amplify a biological marker of myocardial incomplete compaction, the biological marker comprising the 6061st base located in the human TTN gene DNA sequence GenBank accession number 63923, which mutates from C to T, which is a nonsense mutation. The present invention verifies the pathogenicity of the biological marker by sequencing the genes of patients clinically diagnosed with myocardial incomplete compaction and performing co-segregation verification of gene mutation diseases in the family. Therefore, the biological marker can be used as a new genetic diagnostic marker for myocardial incomplete compaction, and is used for auxiliary diagnosis of myocardial incomplete compaction. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The results of gene mutation sequencing in patients with myocardial noncompaction and healthy controls in their families in Example 1 of the present invention;

[0020] Figure 2 This is a schematic diagram of the construction process of the sgRNA-PX459 plasmid vector in Example 2 of the present invention;

[0021] Figure 3 This is a fragment map of the successful construction of the sgRNA-PX459 vector in Example 2 of the present invention;

[0022] Figure 4 This is a schematic diagram of the stable cell line obtained in Example 2 of the present invention.

[0023] Figure 5 The effect of the TTN p.R2021X mutation on the expression of TTN mRNA content in cardiomyocytes in Example 3 of the present invention, wherein WT represents the wild-type cell group, and Mutant represents the TTN p.R2021X mutant cell group;

[0024] Figure 6 The effect of TTN p.R2021X mutation on mitochondrial function of cardiomyocytes in Example 4 of the present invention, wherein WT represents the wild-type cell group, Mutant represents the TTN p.R2021X mutant cell group, and the ordinate in A represents the extracellular oxygen consumption rate;

[0025] Figure 7 The effect of TTN p.R2021X mutation on the autophagy function of cardiomyocytes in Example 5 of the present invention;

[0026] Figure 8 is a grayscale strip diagram of the effect of the TTN p.R2021X mutation in Example 6 of the present invention on different proteins in the mTORC1 signaling pathway of cardiomyocytes, wherein p-mTOR, p-S6 and p-4EBP1 represent the phosphorylated mTOR protein, the phosphorylated S6 protein and the phosphorylated 4EBP1 protein, respectively;

[0027] Fig. 9 This is a graph showing the relative expression levels of different proteins in the cardiomyocyte mTORC1 signaling pathway caused by the TTN p.R2021X mutation in Example 6 of the present invention. DETAILED DESCRIPTION

[0028] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0029] The invention provides the use of c.C6061>T:p.R2021X of human TTN gene as a detection target in preparing a kit for auxiliary diagnosis or auxiliary prediction of myocardial noncompaction.

[0030] The present invention provides the use of a mutant base as a biological marker in the preparation of a reagent or kit for diagnosing or predicting myocardial incomplete compaction, wherein the mutant base includes the 6061st base of the human TTN gene DNA sequence GenBank accession number 63923, which is mutated from C to T. The present invention verifies the pathogenicity of the biological marker by performing gene sequencing on patients clinically diagnosed with myocardial incomplete compaction and performing co-segregation verification of gene mutation disease in the family. Therefore, the biological marker can be used as a new genetic diagnostic marker for myocardial incomplete compaction, and is used for auxiliary diagnosis of myocardial incomplete compaction.

[0031] The present invention also provides the use of a reagent or primer pair for detecting a biological marker in the preparation of a reagent or kit for predicting the prognosis of a patient with myocardial noncompaction, wherein the biological marker includes a 6061th base located in the human TNN gene DNA sequence GenBank accession number 63923, which is mutated from C to T. The present invention verifies the pathogenicity of the biological marker by performing gene sequencing on patients clinically diagnosed with myocardial noncompaction and performing co-segregation verification of the gene mutation disease in the family. Therefore, the biological marker can be used as a new genetic diagnostic marker for myocardial noncompaction, and is used for auxiliary diagnosis of myocardial noncompaction.

[0032] The present invention also provides a primer pair for amplifying a biological marker of myocardial noncompaction, the primer pair comprising an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1: CAAGAATCACCTCCAGGAAGC, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2: GTGATCTACAGAGCCCTTGGC.

[0033] In the present invention, the biological marker preferably includes a C-to-T mutation at the 6061th base located in the human TTN gene DNA sequence GenBank accession number 63923. The biological marker described in the present invention is a nonsense mutation of the TTN gene, which causes the codon CGA that originally encodes arginine to become the stop codon TGA, causing the expression loss of more than 3000 amino acids behind the Titin protein; the functional manifestation of this mutation is: it can cause myocardial mitochondrial dysfunction, change the energy metabolism mode of myocardial cells, damage the autophagy function of myocardial cells, and activate the activity of the intracellular mTORC1 signaling pathway; the present invention verifies the pathogenicity of the biological marker by sequencing the genes of patients with clinical diagnosis of myocardial incomplete compaction and co-segregation verification of gene mutation diseases in the family. Therefore, the biological marker can be used as a new genetic diagnostic marker for myocardial incomplete compaction, which is used for auxiliary diagnosis of myocardial incomplete compaction.

[0034] The present invention also provides the use of the primer pair in the preparation of a reagent or kit for diagnosing myocardial noncompaction. The primer pair provided by the present invention can amplify the above biological markers, and the expression level of the biological markers can be used as an auxiliary diagnosis of myocardial noncompaction.

[0035] The present invention also provides the use of the above primer pair in the preparation of a reagent or kit for predicting the prognosis of patients with myocardial noncompaction. The primer pair provided by the present invention can amplify the above biological markers, and the expression level of the biological markers can be used as a risk assessment of the prognosis of patients with myocardial noncompaction.

[0036] The present invention also provides the use of the above primer pair in the preparation of a reagent or kit for predicting the risk of asymptomatic gene mutation carriers developing myocardial incomplete compaction in the future. The primer pair provided by the present invention can amplify the above biological markers, and the expression level of the biological markers can be used as a risk assessment for predicting the risk of asymptomatic gene mutation carriers developing myocardial incomplete compaction in the future.

[0037] The present invention also provides a reagent or a kit for diagnosing myocardial noncompaction, wherein the reagent or the kit comprises the above-mentioned primer pair.

[0038] The present invention also provides a reagent or a kit for predicting the prognosis of patients with myocardial noncompaction, wherein the reagent or the kit comprises the above-mentioned primer pair.

[0039] The present invention also provides a reagent or a kit for predicting the risk of asymptomatic gene mutation carriers developing myocardial noncompaction in the future, wherein the reagent or the kit comprises the above-mentioned primer pair.

[0040] To further illustrate the present invention, the primer pairs for amplifying biological markers provided by the present invention and their use in preparing reagents or kits for diagnosing myocardial noncompaction are described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0041] The present invention will be described in detail below through examples.

[0042] Example 1

[0043] Gene sequencing technology detects gene mutations in family patients and healthy controls

[0044] Four patients from a sick family were selected as the research subjects. 2 mL of EDTA anticoagulated peripheral venous blood was collected from each patient and genomic DNA was extracted. For the proband, whole exome sequencing was performed using next-generation semiconductor targeted sequencing technology. First, the library was constructed and all exon sequences were amplified. IonTorrent data extraction, sequence alignment, and SNPs and Indels extraction were performed using Ion Torrent Suite v3.2 software. The obtained SNPs and Indels were annotated, and the annotation results were screened (variants in non-targeted regions and common variants with a frequency higher than 1%). The candidate variants were evaluated for sequencing quality using the gene visualization software Integrated GenomicsViewer (IGV, v2.1) to eliminate false positive variants, and conservative analysis and prediction of impaired In silico protein function were performed. Using Sanger sequencing, the suspected pathogenic variants screened were successively verified as probands and co-segregation in families, and a biological marker associated with myocardial noncompaction was identified. The biological marker is located in the human TTN gene DNA sequence with GenBank accession number 63923, where there is a C-to-T mutation (sequencing results are shown in Figure 1 ), the mutation was named according to the nomenclature of the Human Genome Variation Society (http: / / www.hgvs.orgmutnomen), and the biological marker was named TTN p.R2021X. The specific method is as follows:

[0045] 1. Whole exome sequencing

[0046] (1) DNA library construction

[0047] 1) First, the DNA sample is atomized and then ultrasonically fragmented to obtain fragments with an average size of about 200 bp.

[0048] 2) The broken fragments were end-repaired, tailed, purified, A-tailed at the 3' end, and connected to the Illumina sequencing adapter.

[0049] 3) PCR amplify the DNA fragment with the adapter and purify the product to form a DNA adapter library

[0050] 4) Hybridize the adapter library with the SureSelect capture library and wash out the unhybridized fragments to form a capture library

[0051] 5) Perform PCR amplification on the captured library and purify the product.

[0052] (2) Illumina GA-II platform sequencing

[0053] Accurately quantify the effective concentration of the library (library effective concentration> 2nM, IlluminaGA-II sequencing after the library is qualified)

[0054] (3) Bioinformatics analysis

[0055] The sequencing results were aligned with the human reference genome sequence (UCSChg19) using BWAmem software, and the variation detection software was GATK.

[0056] 2. Sanger sequencing to screen for pathogenic mutations

[0057] (1) Primer design: TTN-F: CAAGAATCACCTCCAGGAAGC (shown in SEQ ID NO. 1); TTN-R: GTGATCTACAGAGCCCTTGGC (shown in SEQ ID NO. 2).

[0058] (2) PCR amplification:

[0059] Reaction system (25 μl)

[0060] Reagent components Volume (μL) DNA (20ng) 1μL Primer-F 1μL Primer-R 1μL 2×GC buffer 12.5ul dNTP 4ul LaTaq 0.25ul <![CDATA[ddH 2 The]]> 5.25ul Total 25ul

[0061] Reaction conditions

[0062]

[0063] (3) The PCR product was sent to a sequencing company for Sanger sequencing. Sequence alignment was performed according to the human genome standard sequence (Genome Preference Consortium GRCh37, hg19), and mutations were interpreted using Chromas or CoCodeAligner and GeneRunner software.

[0064] Example 2

[0065] CRISPR / Cas9 technology was used to construct a gene mutation cell model in rat cardiomyocytes cultured in vitro

[0066] First, the sgRNA target site was selected and designed: the rat TTN genome sequence and exon sequence were downloaded through Ensemb. The targeted sgRNA was designed according to the mutation site determined in Example 1 using a professional website (http: / / crispr.mit.edu / ); the second step was the construction and sequencing verification of the sgRNA-PX459 plasmid vector; the third step was the transfection of the sgRNA-PX459 plasmid and cell sorting, and the T7E1 enzyme cutting experiment was used to identify the sgRNA shearing efficiency. The specific experimental process is as follows:

[0067] 1. Selection and design of sgRNA target sites

[0068] The rat TTN genomic sequence and exon sequence were downloaded from Ensembl (http: / / www.ensembl.org / index.htmL). Targeting sgRNA was designed using a professional website (http: / / crispr.mit.edu / ), as shown in Table 1.

[0069] Table 1 Nucleotide sequences of targeting sgRNA

[0070]

[0071] 2. Sequencing verification of sgRNA PX459 plasmid vector construction

[0072] First, the PX459 plasmid was digested with BbsI and recovered by gel annealing, the sgRNA was annealed to form a double strand, and then the double-stranded sgRNA was ligated with the plasmid recovered by gel ligation using T4 ligase. Figure 2 After transformation, sterilization and plasmid extraction, the ligated product was sequenced and verified by forward sequencing primer CTTGATGTACTGCCAAGGGC (shown in SEQ ID NO.7). The results showed that both pairs of sgRNA sequences were correctly linked to the plasmid, indicating that the sgRNA-PX459 vector was successfully constructed. Figure 3 .

[0073] 3. Plasmid Transfection

[0074] Transform the plasmid into E. coli Stbl3 strain, incubate the mixture on ice for 10 min, and immediately return to ice bath for 2 min at 42 °C. Add 100 μl of SOC medium plate containing 100 μg / mL ampicillin and incubate at 37 °C overnight.

[0075] Check the plate for colony growth. In each dish, select 2 to 3 colonies to check the correct insertion of gRNA. Verify by DNA Sanger sequencing.

[0076] 4. Cell Transfection

[0077] (1) 1×10 5 Cells were seeded at a high density, complete medium was added, and placed in CO 2 Incubate in an incubator at 37°C overnight;

[0078] (2) Dilute an appropriate amount of ultrapure plasmid DNA to be transfected into serum-free medium, dilute an appropriate amount of Lipo2000 into an appropriate amount of serum-free medium, and let stand for 5 minutes;

[0079] (3) Mix the two solutions, mix well, and leave at room temperature for 15 minutes;

[0080] (4) Wash the cells with serum-free medium, add the mixture dropwise to each cell culture well, shake gently, and incubate at 37°C for 4 h;

[0081] (5) Replace the cell transfection solution with complete culture medium and continue to culture the cells;

[0082] (6) After 48 hours, the cells were subcultured and the selective antibiotic G418 was added to select stable transfectants.

[0083] 5. Monoclonal screening

[0084] (1) Dissolve 1 g of G418 in 1 mL of 1 M HEPES solution, add distilled water to a volume of 10 mL, filter sterilize, and store at 4°C;

[0085] (2) Prepare cell suspension, inoculate equal amounts into multi-well culture plates, and add G418 solution after 6 hours of culture;

[0086] (3) Prepare screening medium by diluting G418 with culture medium according to a concentration gradient within the concentration range of 100 μg / mL to 1000 μg / mL.

[0087] (4) Aspirate the culture medium in the culture wells and add the above-mentioned screening culture medium of different concentrations.

[0088] (5) Change the screening culture medium every 3 days according to the color of the culture medium and the cell growth. After 10-14 days, drug-resistant monoclones may appear. Stop the drug culture, and after the clones gradually grow, take out the monoclones, prepare the cell suspension and count (1 cell / 10μ 1). Add 150μ l culture medium to each well of the 96-well plate, and then add 10μ l cell suspension to each well. After the clones grow up, transfer them to a 24-well plate for further amplification. After the monoclonal cells have grown all over the 24-well plate, take half of the cells to extract genomic DNA, and identify the knockout clones by PCR. Figure 4 , a stable cell line was obtained (constructed using sgRNA2 in Table 1 as the target sequence).

[0089] Example 3

[0090] Expression detection of TTN mRNA in TTN p.R2021X mutant cells and wild-type cells constructed in Example 2

[0091] Total RNA of TTN p.R202 1X mutant cells and wild-type cells were extracted respectively, and the expression levels of TTN mRNA in the two types of cells were detected by qPCR technology. The specific experimental method is as follows:

[0092] qPCR detection of relative mRNA expression

[0093] Using HiScript III 1 from Nanjing Novozyme st The Strand cDNA Synthesis Kit (+gDNAwiper) was used for reverse transcription of mRNA, and the ChamQ Universal SYBR qPCR Master Mix was used for qPCR experiments to detect the expression level of mRNA in cells. The specific steps are as follows:

[0094] 1. mRNA reverse transcription reaction

[0095] (1) Genomic DNA removal reaction: After melting the kit, mix well and centrifuge for later use. Add reagents according to the table below and mix well. React at 42°C for 2 min. 16 μL per reaction:

[0096] Reagent components Volume (μL) <![CDATA[RNase-free ddH 2 The]]> to 16μL 4×gDNAwiper Mix 4μL RNA samples 1 μg

[0097] (2) Preparation of reverse transcription reaction system: Add 5×HiScript III qRT SuperMix and mix well, and perform reverse transcription reaction according to the following program:

[0098] temperature time 37℃ 15min 85℃ 5sec

[0099] After the reverse transcription reaction is completed, the obtained cDNA can be stored at 20°C or used for qPCR reaction immediately.

[0100] 2.qPCR reaction

[0101] Add reagents according to the table below and mix well. Then transfer 20 μL per reaction to a 96-well PCR reaction plate, with 3 replicate wells for each sample:

[0102] Reagent components 3 reaction volumes (μL) 2×ChamQ Universal SYBR qPCR Master Mix 30μL Forward primer (10 μM) 1.2μL Reverse primer (10 μM) 1.2μL Template cDNA 6μL <![CDATA[ddH 2 The]]> 21.6μL

[0103] The upstream and downstream sequences of the primers are as follows:

[0104] Primer name Primer sequences TTN-F 5'-TTCTCTGTTTGCACTCGGCA-3' SEQ ID NO.8 TTN-R 5'-CAGGTGAGGCTTGGGACTG-3' SEQ ID NO.9 GAPDH-F 5'-ACAGTCAGCCGCATCTTCTT-3' SEQ ID NO.10 GAPDH-R 5'-ATCCGTTGACTCCGACCTTC-3' SEQ ID NO.11

[0105] Note: F represents the forward primer; R represents the reverse primer.

[0106] Follow the procedure below to perform qPCR reaction:

[0107]

[0108]

[0109] After the reaction is completed, according to the obtained cycle number CT value, apply 2 ΔΔCTThe relative expression of mRNA was calculated using the method of GAPDH as the internal reference.

[0110] like Figure 5 As shown, compared with wild-type cells (WT), the expression level of TTN mRNA in the mutant cell group (Mutant) was significantly reduced (mean±SEM, n=3, **p<0.01, ***p<0.001).

[0111] Example 4

[0112] Effects of TTN p.R2021X mutation on mitochondrial function in cardiomyocytes

[0113] In the disease cell model constructed in Example 2, the mutant cells and wild-type cells were tested for mitochondrial oxidative phosphorylation function, and the test items mainly included cell oxygen consumption and ATP content. The experiment used Abcam's Extracellular Oxygen Consumption AssaY (ab197243) kit and Luminescent ATP Detection Assay (ab113849) kit to detect cell oxygen consumption rate and ATP content. The specific experimental steps and experimental parameters were operated according to the product instructions. Figure 6 As shown, compared with wild-type cells, the extracellular oxygen consumption rate (OCR) and ATP of the TTN p.R2021X mutant cell group constructed in Example 2 were significantly reduced (mean±SEM, n=3, *p<0.05, ***p<0.001).

[0114] Example 5

[0115] Effect of TTN p.R2021X mutation on autophagy in cardiomyocytes

[0116] In the disease cell model constructed in Example 2, the lysosomal ultrastructures of mutant cells and wild-type cells were observed under in situ transmission electron microscopy (TEM), as shown in FIG. Figure 7 As shown, under an electron microscope, the number of active lysosomes in wild-type cells was significantly greater than that in mutant cells, indicating that the autophagic function of mutant cells was reduced.

[0117] Example 6

[0118] TTN p.R2021X mutation regulates cardiomyocyte signaling pathways

[0119] In the disease cell model constructed in Example 2, the phosphorylation of the Ser2448 site of the mTOR protein and the expression of its downstream 4EBP1 and S6 proteins were detected by Western blot. The specific experimental process is as follows:

[0120] Western blot was used to detect protein expression

[0121] 1. Preparation of SDS polyacrylamide gel:

[0122] Prepare 10% separation gel, taking 10mL as an example, the specific formula is as follows:

[0123] Element volume Distilled water 4.0mL 30% acrylamide solution 3.3mL 1.5mL / L Tris 2.5mL 10% SDS 100μL 10% Ammonium Persulfate (APS) 100μL TEMED 4μL

[0124] To prepare 5% concentrated gel, take 5mL as an example, the specific formula is as follows:

[0125] Element volume Distilled water 3.5mL 30% acrylamide solution 800μL 1.0mL / L Tris 600μL 10% SDS 50μL 10% APS 50μL TEMED 4μL

[0126] 2. Protein loading and electrophoresis: 30 μg protein was loaded into each well. The electrophoresis process was in constant voltage mode with a voltage of 80 V for about 120 min.

[0127] 3. Transfer: The transfer is done by wet transfer. Activate the PVDF membrane in anhydrous methanol for 1 minute, transfer it into ultrapure water and soak it for 5 minutes, and then transfer it into the transfer solution and soak it for 10 minutes. Cut the separation gel and transfer it into the transfer solution and soak it for 10 minutes. Stack the sponge filter paper, separation gel, PVDF membrane, filter paper and sponge from negative electrode to positive electrode in order, and transfer the membrane on ice at 390mA in constant current mode for 70 minutes;

[0128] 4. Blocking: Block the PVDF membrane with protein in 5% skim milk at room temperature for 1 hour;

[0129] 5. Primary antibody incubation: Prepare the antibody according to the table below, cut the membrane according to the molecular weight of the target protein and the sample protein marker, and incubate the primary antibody at 4°C with shaking overnight;

[0130]

[0131] 6. Washing the membrane and incubating with secondary antibodies: Recover the primary antibody and wash the membrane 6 times with Tris buffered saline and Tween 20 (TBST) containing 0.1% Tween 20, shaking for 5 minutes each time. Prepare a secondary antibody conjugated with horseradish peroxidase (HRP) of the corresponding species of the primary antibody, incubate at room temperature for 1 hour, and wash the membrane again to remove non-specific binding;

[0132] 7. Exposure imaging: Add ECL luminescent liquid droplets to the membrane and react for 35 minutes before exposure to obtain grayscale stripes (see Figure 8 ). Analyze the gray value of the bands to calculate the relative protein expression level (see Fig. 9 ).

[0133] like Figure 8 and Fig. 9 As shown, compared with the wild-type cell group (WT), the phosphorylation level of mTOR protein at Ser2448 was significantly increased in the TTN p.R2021X mutant cell group (Mutant) after TTN p.R2021X mutation, and the expression of its downstream related proteins 4EBP1 and S6 also increased accordingly. (mean±SEM, n=4, *p<0.05, **p<0.01, ***p<0.001).

[0134] In summary, the experimental results of Examples 1 to 6 of the present invention show that the TTN p.R2021X mutation is a new pathogenic mutation for myocardial incomplete compaction. The TTN p.R2021X mutation can cause corresponding functional changes in myocardial cells: it can cause myocardial mitochondrial dysfunction, changes in myocardial energy metabolism, damage myocardial autophagy, and activate the activity of the intracellular mTORC1 signaling pathway. Improving myocardial energy metabolism and inhibiting the mTORC signaling pathway are expected to become new targets for the precise treatment of myocardial incomplete compaction.

[0135] The preferred embodiments of the present invention are described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, the technical solution of the present invention can be subjected to a variety of simple modifications, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be regarded as the contents disclosed by the present invention and belong to the protection scope of the present invention.

[0136]

[0137]

Claims

1. Use of c.C6061>T:p.R2021X of human TTN gene as detection target in the preparation of a kit for auxiliary diagnosis or auxiliary prediction of myocardial noncompaction.

2. Use of a mutant base as a biological marker in the preparation of a reagent or kit for diagnosing or predicting myocardial noncompaction, characterized in that: The mutant base includes the 6061st base of the human TTN gene DNA sequence GenBank accession number 63923, which is mutated from C to T.

3. Use of a reagent or primer pair for detecting a biological marker in the preparation of a reagent or kit for predicting the prognosis of a patient with myocardial noncompaction, characterized in that: The biological marker includes the 6061st base located in the human TTN gene DNA sequence with GenBank accession number 63923, which is mutated from C to T.

4. A primer pair for amplifying a biological marker of myocardial noncompaction, characterized in that: The primer pair includes an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2; Preferably, the biological marker includes the 6061st base located in the human TTN gene DNA sequence with GenBank accession number 63923, which is mutated from C to T.

5. Use of the primer pair according to claim 4 in preparing a reagent or a kit for diagnosing myocardial noncompaction.

6. Use of the primer pair according to claim 4 in preparing a reagent or a kit for predicting the prognosis of patients with myocardial noncompaction.

7. Use of the primer pair according to claim 4 in the preparation of a reagent or a kit for predicting the risk of asymptomatic gene mutation carriers developing myocardial noncompaction in the future.

8. A reagent or kit for diagnosing myocardial noncompaction, characterized in that: The reagent or kit comprises the primer pair according to claim 4.

9. A reagent or kit for predicting the prognosis of patients with myocardial noncompaction, characterized in that: The reagent or kit comprises the primer pair according to claim 4.

10. A reagent or kit for predicting the risk of asymptomatic gene mutation carriers developing myocardial noncompaction in the future, characterized in that: The reagent or kit comprises the primer pair according to claim 4.

Images