Primer and probe combination for detecting human HLA-B*58: 01 allele and application of primer and probe combination

Abstract

The invention discloses a primer and probe combination for detecting human HLA-B * 58: 01 allele and application of the primer and probe combination. The primer and probe combination comprises a detection forward primer, a detection reverse primer and a detection TaqMan probe which are used for genotyping, and further comprises an internal reference forward primer, an internal reference reverse primer and an internal reference Taqman probe which are used for sample quality control. The primer and probe combination disclosed by the invention adopts an AS TaqMan qPCR method, has the remarkable advantages of low unit cost, short time consumption and simplicity in operation on the basis of ensuring accuracy, and has a very good application prospect in allopurinol medication guidance.

Description

Technical Field

[0001] The present invention relates to a primer and probe combination for detecting human HLA-B*58:01 allele, and specifically to a primer and probe combination for detecting human HLA-B*58:01 allele based on the AS-qPCR principle, a kit containing the primer and probe combination, and an application of the primer and probe combination and the kit in detecting HLA-B*58:01 allele, and belongs to the technical field of gene detection. Background Art

[0002] In recent years, with the change of dietary structure, the incidence of metabolic diseases such as hyperlipidemia and hyperuricemia has also increased year by year. Hyperuricemia is a metabolic disease caused by purine metabolism disorder in the body, which leads to increased uric acid production or decreased excretion. The common symptom is called gout, which is an acute or chronic disease caused by urate crystals and deposition in bones, joints, soft tissues and other parts of the body. It is directly related to hyperuricemia. Hyperuricemia may only have fluctuations or persistent increases in blood uric acid without related clinical symptoms. As the disease progresses, arthritis, tophi, nephropathy and other lesions may gradually appear. Some patients may also have conjunctivitis, keratitis and scleritis.

[0003] Commonly used drugs for the treatment of gout include colchicine, phenhydramine and allopurinol. Colchicine is currently the first-line drug for the treatment of gout. It can inhibit the migration of multinucleated cells to the joints and inhibit their phagocytic function. At the same time, it inhibits the release of lactic acid and lysosomal enzymes by cells that have entered the joint cavity, prevents cell mitosis, and can quickly relieve pain. However, since colchicine has a direct inhibitory effect on the bone marrow, it can cause serious adverse reactions such as agranulocytosis and aplastic anemia, so it is limited to use as an analgesic drug during the acute attack of gout. Phenymarone and allopurinol are often used in the remission period of gout symptoms, but their mechanisms of action are completely different. Among them, phenymarone is a uricosuric drug that has a strong and reversible inhibitory effect on the renal proximal tubule urate-anion exchange system, thereby reducing the reabsorption of uric acid and achieving the effect of lowering blood uric acid; allopurinol is a drug that resists uric acid synthesis. Allopurinol and its metabolite oxypurinol can inhibit xanthine oxidase, prevent hypoxanthine and xanthine from being metabolized into uric acid, thereby reducing the production of uric acid, reducing the uric acid content in blood and urine to a level below solubility, and preventing uric acid from forming crystals and depositing in other tissues. Allopurinol can also inhibit the synthesis of new purines in the body by acting on hypoxanthine-guanine phosphate nucleic acid transferase, reducing the raw materials for uric acid production upstream. As an inhibitor of the last step of the uric acid synthesis process, allopurinol is one of the few drugs that can inhibit uric acid production.

[0004] At present, the clinical use of allopurinol is greatly restricted. However, due to the unique mechanism of action, there is no other drug that can replace its inhibitory effect on uric acid production. Patients with its indications can only take the drug at the risk of serious adverse reactions at any time. Although allopurinol has significant efficacy and low price, it is the first choice in clinical practice. However, because allopurinol is prone to allergic reactions, and once it occurs, the mortality rate can reach 30%-50%, so how to reduce the adverse reactions caused by patients' drug trials has become an urgent problem to be solved.

[0005] Allopurinol adverse reactions are mainly characterized on the skin, such as SJS, TEN, etc. As a delayed hypersensitivity reaction, the SJS / TEN usually shows symptoms several weeks after taking the medicine, and patients usually go to the dermatology department first after dermatitis occurs. Once the medication history is not clearly described, it is very easy to cause missed diagnosis and misdiagnosis, thereby delaying the timing of drug withdrawal and treatment. The skin is the largest organ in the human body, and it is the most frequent and closest contact with the outside world, so the skin is called the first line of defense of the human body, and the subcutaneous tissue and internal organs are more or less protected to a certain extent. At the same time, the skin is also an external reflection of the physiological function state of the human body. Many internal organ diseases can often be reflected on the skin, which should not be ignored. After the skin has drug rash, it will accumulate to the lungs, heart, brain, kidneys and other organs, causing organ lesions. If it is not treated in time or treated improperly, the rash will ulcerate and form erosion, resulting in a greater risk of infection. If the erosion area is too large, it will induce systemic infectious diseases, which will seriously endanger life safety.

[0006] Human leukocyte antigen (HLA) is a product encoded by the HLA gene complex and is located on the short arm of chromosome 6. HLA is an expression product of the human histocompatibility complex (MHC) and is an important antigenic substance that constitutes transplant rejection. The study of HLA was initially carried out under the impetus of organ transplantation research, so HLA is also called transplant antigen. HLA is divided into class I antigen, class II antigen and class III antigen according to its distribution and function. Classical HLA class I antigens include HLA-A, HLA-B, HLA-C; HLA class II antigens include HLA-DP, HLA-DQ, HLA-DR. Non-classical HLA classes I and II include HLA-F, E, H, X, DN, DO, DM, etc. Complement and others belong to class III molecules. HLA class I is distributed on the surface of almost all cells in the body, and class II is mainly a glycoprotein located on the surface of macrophages and B lymphocytes. The HLA gene is the region with the highest gene density and the richest polymorphism in the currently known human chromosomes. HLA is a cell surface molecule that is mainly involved in the presentation of processed antigen peptides for T cell activation and plays an important role in it, constituting one of the most important immune systems of the body. HLA-B is a human leukocyte antigen class I molecule with extremely high polymorphism, up to 6096 subtypes, and the difference between each subtype is only one or a few bases. Such characteristics make the detection of this gene relatively difficult. After a large number of studies, it has been shown that the occurrence of adverse reactions to allopurinol is significantly correlated with HLA-B*58:01. Whether this gene can be accurately typed affects the guidance of allopurinol medication.

[0007] CN 103484533 A discloses a specific primer and probe combination for detecting HLA-B*5801 alleles, which includes a pair of specific primers and two corresponding detection fluorescent probes. The patent requires two probes for detection, which is costly. In addition, it uses a housekeeping gene internal reference, and the quality control accuracy of DNA sample extraction is not high. Summary of the invention

[0008] The purpose of the present invention is to provide a primer and probe combination for detecting human HLA-B*58:01 allele. The primer and probe are based on the AS-qPCR principle and are suitable for a qPCR instrument. By detecting three specific sites on the human HLA-B*58:01 allele, the gene can be accurately typed. The quality control system and the detection system are detected simultaneously in the same tube, and there is no need to operate two tubes separately, which greatly simplifies the detection process and has the significant advantages of low cost, simple operation, good repeatability and high accuracy.

[0009] In order to achieve the above object, the present invention adopts the following technical solutions:

[0010] A primer and probe combination for detecting human HLA-B*58:01 alleles, the primer and probe combination comprising a detection forward primer, a detection reverse primer and a detection Taqman probe for detection and genotyping. The 3' terminal bases of the detection forward primer and the detection reverse primer are modified by mismatch technology, as follows:

[0011] Detection forward primer: 5′GGCCGGAGTATTGGGATG3′;

[0012] Detection reverse primer: 5′CCGCGGCCTCTGGGA3′;

[0013] Detection Taqman probe: 5'ACCTGCGGATCGCGCTCCG3'.

[0014] Furthermore, the primer and probe combination also includes an internal reference forward primer, an internal reference reverse primer and an internal reference Taqman probe for quality control of the extracted sample DNA, as follows:

[0015] Internal reference forward primer NCF: 5′GTCCAGGACCCACACTTGCT3′;

[0016] Internal control reverse primer NCR: 5′AAGGAATTTCCAGAAGTATGACTACAGA3′;

[0017] Internal reference Taqman probe: 5'TCCTCGTGTTTCCTGATCCTGCCTTG3'.

[0018] Further, the 5' end of the detection Taqman probe and the internal reference Taqman probe are both labeled with a fluorescent group, and the 3' end is both labeled with a quenching group. Among them, the fluorescent group can be a commonly used fluorescent group reported in the prior art, such as VIC, FAM, etc., and the quenching group can be a commonly used quenching group reported in the prior art, such as BHQ1, etc. The fluorescent groups labeled with the detection Taqman probe and the internal reference Taqman probe are different.

[0019] Furthermore, the detection forward primer, detection reverse primer, detection Taqman probe, internal reference forward primer, internal reference reverse primer and internal reference Taqman probe are packaged separately or premixed and packaged.

[0020] The present invention also provides a kit for detecting human HLA-B*58:01 allele, which comprises the above-mentioned primer and probe combination for detecting human HLA-B*58:01 allele.

[0021] Furthermore, the kit also includes TaqMix (also referred to as Mix mixed solution) necessary for PCR reaction. The TaqMix includes Taq DNA polymerase, dNTP mixture, MgCl2, and reaction buffer.

[0022] Furthermore, each allele-specific wild-type forward primer, each allele-specific mutant-type forward primer, each reverse primer, and each TaqMan probe are packaged separately or pre-mixed in the genetic polymorphism kit.

[0023] Furthermore, the detection forward primer, detection reverse primer, detection Taqman probe, internal reference forward primer, internal reference reverse primer and internal reference Taqman probe are packaged separately or premixed in the kit.

[0024] The present invention also provides a method for using the above-mentioned kit, which adds a detection forward primer, a detection reverse primer, a detection Taqman probe, an internal reference forward primer, an internal reference reverse primer and an internal reference Taqman probe into one reaction tube at the same time to construct a dual detection system for the HLA-B*58:01 allele. The detection of the HLA-B*58:01 allele can be achieved through the dual detection system. The kit of the present invention is easy to use, and whether the HLA-B*58:01 allele is present can be determined by only one tube.

[0025] Further, in the constructed dual detection system of HLA-B*58:01 allele, the final concentration of each primer is 0.1-1 μM, such as 0.1 μM, 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM, 0.6 μM, 0.7 μM, 0.8 μM, 0.9 μM, 1.0 μM. The final concentration of each Taqman probe is 0.1-1 μM, such as 0.1 μM, 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM, 0.6 μM, 0.7 μM, 0.8 μM, 0.9 μM, 1.0 μM.

[0026] The present invention also provides the use of the primer and probe combination and the kit in preparing a product for detecting human HLA-B*58:01 allele.

[0027] Furthermore, the present invention also provides a method for detecting human HLA-B*58:01 genotype using the above primer and probe combination and the above kit, which can be used for the diagnosis and treatment of diseases or for non-disease diagnosis and treatment purposes, and comprises the following steps:

[0028] (1) preparing a PCR double detection system: adding a detection forward primer, a detection reverse primer, a detection Taqman probe, an internal reference forward primer, an internal reference reverse primer, an internal reference Taqman probe, TaqMix, a DNA sample, and water into a reaction tube at the same time to obtain a PCR double detection system;

[0029] (2) performing PCR amplification on the PCR dual detection system;

[0030] (3) Directly read the Cq value of the PCR dual detection system and determine whether it is the genotype based on the Cq value of the system.

[0031] Furthermore, the DNA sample is a human oral swab DNA sample.

[0032] Furthermore, the total volume of the prepared PCR dual detection system is about 20 μL. In the PCR dual detection system, the final concentration of each primer is 0.1-1 μM, for example, 0.1 μM, 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM, 0.6 μM, 0.7 μM, 0.8 μM, 0.9 μM, 1.0 μM, preferably 0.2 μM, and the final concentration of each Taqman probe is 0.1-1 μM, for example, 0.1 μM, 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM, 0.6 μM, 0.7 μM, 0.8 μM, 0.9 μM, 1.0 μM, preferably 0.1 μM.

[0033] Further, the reaction procedure of PCR amplification is as follows:

[0034] Stage 1: 37°C, 2 minutes;

[0035] Second stage: 95℃, 5 minutes;

[0036] The third stage: 95°C, 10 seconds; 60°C for 35 seconds, 45 cycles; collecting fluorescence signals at 60°C.

[0037] Furthermore, the method of the present invention can be used to directly determine whether the HLA-B*58:01 gene exists in the DNA sample. As long as the gene exists, the fluorescence channel will be displayed as positive. Taking the fluorescent group as VIC as an example, when the Cq value of the VIC fluorescence channel is positive, the test result is determined to be positive, that is, the genotyping result is HLA-B*58:01; if the Cq value is not detected in the VIC fluorescence channel, the test result is determined to be negative, that is, the genotyping result is not HLA-B*58:01.

[0038] Furthermore, the method of the present invention can be used to guide personalized medication of allopurinol, and can also be used for non-therapeutic applications, such as basic research on HLA-B*58:01 genetic polymorphism, non-disease genotyping, etc.

[0039] Furthermore, when performing PCR amplification, a positive control and a blank control are set for the detection system. The positive control is to replace the DNA sample with a positive plasmid containing the HLA-B*58:01 allele, and the blank control is to replace the DNA sample with physiological saline.

[0040] The beneficial effects of the present invention are:

[0041] 1. The present invention uses two technologies, AS qPCR and Taqman probe, to design a probe primer combination and a kit for detecting human HLA-B*58:01 alleles for use with a matching qPCR instrument, and realizes one-tube parallel detection of HLA-B*58:01 alleles through 1 AS-specific forward primer modified by mismatch technology, 1 AS-specific reverse primer modified by mismatch technology and 1 Taqman probe. When the AS-specific primer completely matches the target sequence, the template can be effectively amplified; when it is not completely matched, the amplification is blocked. The kit is easy to use, simple to operate, short in time, low in unit cost, and accurate and reliable in results. It can be used for medication guidance before taking allopurinol drugs, and can also be used for basic research on human HLA-B*58:01 alleles.

[0042] 2. The internal reference primers and internal reference probes used in the present invention are conserved sequences of adjacent fragments. Compared with the housekeeping gene internal reference, the linkage type between the detection target and its neighboring target is stronger, and the quality control DNA sample is more accurate.

[0043] 3. The kit of the present invention adds one forward primer, one reverse primer and one Taqman probe for detecting the HLA-B*58:01 allele into a detection tube for detection at the same time. Only when all three specific sites in the sample match the primer and probe sequences can the system be amplified normally, the fluorescent probe will generate a fluorescent signal, and a positive detection result will be displayed. It has high specificity and high sensitivity, and has a good application prospect for the guidance of allopurinol medication. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1The figure shows the site map of 5801 forward primer (5801-F), 5801 reverse primer (5801-R), 5801 probe (5801-P), and forward primer (CS-F), probe (CS-P) and reverse primer (CS-R) targeting conserved sequences within the HLA-B*58:01 allele. Among them, 5801-F, 5801-R and 5801-P are designed to recognize three polymorphic sites of the HLA-B*58:01 allele, while CS-F, CS-P and CS-R are used to screen and verify 5801-F, 5801-R and 5801-P.

[0045] Figure 2 A is a qPCR amplification curve for evaluating the amplification efficiency and detection limit of the kit of the present invention. The samples are 40ng / test, 20ng / test, 10ng / test, 5ng / test, 2.5ng / test, and 1.25ng / test of human oral swab cell genomic DNA, three batches, double-tube detection.

[0046] Figure 2 B is a calibration curve for evaluating the amplification efficiency and detection limit of the kit of the present invention. The samples are 40ng / test, 20ng / test, 10ng / test, 5ng / test, 2.5ng / test, and 1.25ng / test of human oral swab cell genomic DNA, three batches, double-dip test, and the average value is obtained for calibration curve plotting. The amplification efficiency is calculated according to the following formula: Amplification efficiency (Eff.) = (10 -1 / 斜率 -1)×100%=81.61%. The test result of the sample with a concentration of 1.25 ng / test is positive, so the detection limit of the primers and probes of the present invention is at least 1.25 ng / test. DETAILED DESCRIPTION

[0047] The present invention is further explained and described below by specific examples, and the following description is only exemplary, so that those skilled in the art can better understand the scheme and advantages of the present invention, and does not limit the scope of protection of the present invention. In the following examples, for the operations and steps not described in detail, they are all technologies reported in the art, and those skilled in the art can implement them according to the prior art.

[0048] Unless otherwise specified, the following primers and Taqman probes were synthesized by the corresponding design companies. Taq mix was purchased from Nanjing Novozymes Co., Ltd.

[0049] Example 1 Design and optimization of primers and probes

[0050] 1. Design of primers and probes

[0051] In order to establish an amplification reaction for detecting the HLA-B*58:01 allele, we designed allele-specific oligonucleotide chains, including mismatched allele-specific 5801 forward primer (5801-F), mismatched allele-specific 5801 reverse primer (5801-R) and allele-specific 5801 probe (5801-P). At the same time, conservative sequence-binding forward primer (CS-F), probe (CS-P) and reverse primer (CS-R) were synthesized to optimize and verify the above allele-specific oligonucleotide chains ( Figure 1 ). The 5' ends of the 5801-P probe and the probe (CS-P) are both labeled with a VIC fluorescent group, and the 3' ends are both labeled with a BHQ1 quenching group.

[0052] The primer and probe sequences are shown in Table 1:

[0053] Table 1 Primer and probe oligonucleotide sequences

[0054]

[0055] 2. Optimization of the mismatched allele-specific 5801 forward primer (5801-F)

[0056] Using an amplification reaction consisting of allele-specific 5801-F, CS-P, and CS-R, two positive (MB20 and MB21) and two negative (MB3 and MB41) samples were tested to screen for the synthetic mismatched allele-specific 5801-F (mismatch at the 2nd or 5th base at the 3' end). The experimental steps are as follows:

[0057] (1) DNA samples: MB20, MB21, MB3, and MB41, DNA samples extracted from human oral swabs.

[0058] (2) PCR reaction system composition:

[0059] Table 2

[0060]

[0061]

[0062] (3) PCR reaction procedure:

[0063] Stage 1: 37°C, 2 minutes;

[0064] Second stage: 95℃, 5 minutes;

[0065] The third stage: 95°C, 10 seconds; 60°C, 35 seconds, 45 cycles; collecting fluorescence signals at 60°C;

[0066] When performing PCR amplification, both positive control and blank control are set up. The blank control is to replace the DNA sample with sterile saline.

[0067] (4) Filter results

[0068] When the Cq value of the VIC fluorescence channel is positive, the test result is determined to be positive, that is, the genotyping result is HLA-B*58:01; if the Cq value is not detected in the VIC fluorescence channel, the test result is determined to be negative, that is, the genotyping result is not HLA-B*58:01. The test results are shown in Table 3 below.

[0069] Table 3

[0070]

[0071] The screening results showed that only the detection forward primer 5801-F 2-2 could accurately identify negative and positive samples.

[0072] 3. Optimization of the mismatched allele-specific 5801 reverse primer (5801-R)

[0073] Using an amplification reaction consisting of CS-F, CS-P, and allele-specific AS 5801-R, two positive (MB20 and MB21) and two negative (MB3 and MB11) samples were tested to optimize AS 5801-R (mismatch at the 2nd or 5th base at the 3' end). The experimental steps are as follows:

[0074] (1) DNA samples: MB20, MB21, MB3, and MB11, DNA samples extracted from human oral swabs.

[0075] (2) The composition of the PCR reaction system is shown in Table 4:

[0076] Table 4

[0077]

[0078] (3) PCR reaction procedure:

[0079] Stage 1: 37°C, 2 minutes;

[0080] Second stage: 95℃, 5 minutes;

[0081] The third stage: 95°C, 10 seconds; 60°C, 35 seconds, 45 cycles; collecting fluorescence signals at 60°C;

[0082] When performing PCR amplification, both positive control and blank control are set up. The blank control is to replace the DNA sample with sterile saline.

[0083] (4) Filter results

[0084] When the Cq value of the VIC fluorescence channel is positive, the test result is determined to be positive, that is, the genotyping result is HLA-B*58:01; if the Cq value is not detected in the VIC fluorescence channel, the test result is determined to be negative, that is, the genotyping result is not HLA-B*58:01. The screening results are shown in Table 5 below.

[0085] Table 5

[0086]

[0087]

[0088] The results showed that the amplification reactions based on AS 5801-R 2-2, 2-3 and 5-2 could distinguish alleles, among which 5801-R 5-2 had the lowest Cq value for positive samples (the system had the highest amplification efficiency) and the result for negative samples was no detection. Therefore, 5801-R 5-2 was preferred for the detection of HLA-B*58:01 allele.

[0089] 4. Verification of 5801 Probe (5801-P)

[0090] To validate the designed allele-specific probe 5801-P, an amplification reaction consisting of CS-F, allele-specific probe AS 5801-P, and CS-R was used to detect one positive (MB8) and five negative (MB1, MB7, MB10, MB18, MB28) samples.

[0091] The experimental steps are as follows:

[0092] (1) DNA samples: MB8, MB1, MB7, MB10, MB18, and MB28, DNA samples extracted from human oral swabs.

[0093] (2) PCR reaction system composition:

[0094] Table 6

[0095]

[0096] (3) PCR reaction procedure:

[0097] Stage 1: 37°C, 2 minutes;

[0098] Second stage: 95℃, 5 minutes;

[0099] The third stage: 95°C, 10 seconds; 60°C, 35 seconds, 45 cycles; collecting fluorescence signals at 60°C;

[0100] When performing PCR amplification, both positive control and blank control are set up. The blank control is to replace the DNA sample with sterile saline.

[0101] (4) Verification results

[0102] When the Cq value of the VIC fluorescence channel is positive, the test result is judged to be positive, that is, the genotyping result is HLA-B*58:01; if the Cq value is not detected in the VIC fluorescence channel, the test result is judged to be negative, that is, the genotyping result is not HLA-B*58:01. The verification results are shown in Table 7 below.

[0103] Table 7

[0104]

[0105] The results show that the 5801-P probe of the present invention can well distinguish positive samples from negative samples.

[0106] Example 2 Practical application of the kit

[0107] The kit of the present invention uses AS Taqman qPCR technology to amplify the mutant sequence with AS-specific primers modified by mismatch technology. If the detection primer and the detection probe completely match the target sequence, the amplification can be effectively performed; when the match is not complete, the amplification is blocked. The amplification product is detected by Taqman probe, and the genotype of the sample DNA is detected on the real-time fluorescence PCR platform, achieving high specificity and high sensitivity of the detection, and judging the positive and negative results based on the presence or absence of Cq value.

[0108] The method for using the kit of the present invention to detect the HLA-B*58:01 genotype of a sample is as follows:

[0109] (1) Using the German company Qiagen ( DNA samples from oral swabs were extracted using the human oral swab extraction kit produced by DNA Mini Kit (Cat. No.: 51304).

[0110] (2) The forward primer (5801-F 2-2), reverse primer (5801-R5-2), Taqman probe (5801-P) and internal reference forward primer (internal reference F), internal reference reverse primer (internal reference R) and internal reference Taqman probe for sample detection include:

[0111] 5801-F 2-2: 5'GGCCGGAGTATTGGGATG 3', as shown in SEQ ID NO: 1;

[0112] 5801-R 5-2: 5'CCGCGGCCTCTGGGA3', as shown in SEQ ID NO: 2;

[0113] Internal reference F: 5'GTCCAGGACCCACACTTGCT3', as shown in SEQ ID NO: 3;

[0114] Internal reference R: 5'AAGGAATTTCCAGAAGTATGACTACAGA3', as shown in SEQ ID NO: 4;

[0115] Detection Taqman probe 5801-P: VIC-5'ACCTGCGGATCGCGCTCCG3'-BHQ1, as shown in SEQ ID NO: 5;

[0116] Internal reference Taqman probe: FAM-5'TCCTCGTGTTTCCTGATCCTGCCTTG3'-BHQ1, such as SEQ ID NO:6.

[0117] Among them, F: forward primer, R: reverse primer.

[0118] (3) PCR amplification:

[0119] Prepare sample detection qPCR reaction system, the total volume of the system is 20 μL, the composition is as shown in Table 8:

[0120] Table 8

[0121]

[0122] PCR reaction procedure:

[0123] Stage 1: 37°C, 2 minutes;

[0124] Second stage: 95℃, 5 minutes;

[0125] The third stage: 95°C, 10 seconds; 60°C for 35 seconds, 45 cycles; collecting fluorescence signals at 60°C.

[0126] (4) Test results

[0127] When the Cq value of the VIC fluorescence channel is positive, the test result is judged to be positive, that is, the genotyping result is HLA-B*58:01; if the Cq value is not detected in the VIC fluorescence channel, the test result is judged to be negative, that is, the genotyping result is not HLA-B*58:01.

[0128] This kit can be used for genotyping HLA-B*58:01 for diagnostic purposes, and can also be used for genotyping HLA-B*58:01 for non-diagnostic and non-therapeutic purposes, such as for basic research.

[0129] Example 3 Evaluation of kit amplification efficiency and detection limit

[0130] DNA was extracted according to the method of Example 2, and 40 ng / test, 20 ng / test, 10 ng / test, 5 ng / test, 2.5 ng / test, and 1.25 ng / test human oral swab cell genomic samples were prepared. Three batches of double-dose tests were performed, and the average value was obtained to plot a calibration curve and calculate the amplification efficiency according to the following formula: Amplification efficiency (Eff.) = (10 -1 / 斜率 –1)×100%, the result is Figure 2 shown.

[0131] The results showed that the standard curve R 2 The amplification efficiency is 81%, which meets the requirement. The detection result of the sample with a concentration of 1.25 ng / μL is normal. Therefore, the detection limit of the primers and probes of the present invention is at least 1.25 ng / test.

Claims

1. A primer and probe combination for detecting human HLA-B*58:01 allele, characterized in that: The method comprises a forward detection primer, a reverse detection primer and a Taqman detection probe, wherein the nucleotide sequence of the forward detection primer is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse detection primer is shown in SEQ ID NO. As shown in SEQ ID NO.2, the nucleotide sequence of the detection Taqman probe is shown in SEQ ID NO.

5.

2. The primer and probe combination according to claim 1, characterized in that: It also includes an internal reference forward primer, an internal reference reverse primer and an internal reference Taqman probe, the nucleotide sequence of the internal reference forward primer is shown in SEQ ID NO.3, the nucleotide sequence of the internal reference reverse primer is shown in SEQ ID NO.4, and the nucleotide sequence of the internal reference Taqman probe is shown in SEQ ID NO.

6.

3. The primer and probe combination according to claim 2, characterized in that: The 5' ends of the detection Taqman probe and the internal reference Taqman probe are both labeled with a fluorescent group, and the 3' ends are both labeled with a quenching group.

4. The primer and probe combination according to claim 3, characterized in that: The fluorescent group includes VIC and FAM, and the quenching group includes BHQ1.

5. A kit for detecting human HLA-B*58:01 allele, characterized in that: A primer and probe combination for detecting human HLA-B*58:01 allele comprising any one of claims 1-4.

6. The kit according to claim 5, characterized in that: It also includes TaqMix necessary for PCR reaction; preferably, the TaqMix includes Taq DNA polymerase, dNTP mixture, MgCl2, and reaction buffer.

7. The primer and probe combination for detecting human HLA-B*58:01 allele according to any one of claims 1 to 4, and the kit for detecting human HLA-B*58:01 allele according to claim 5 or 6 in the preparation of a kit for detecting human Application of products with the HLA-B*58:01 allele.

8. A method for using the kit for detecting human HLA-B*58:01 allele according to claim 5 or 6, characterized in that: Add the detection forward primer, detection reverse primer, detection Taqman probe, internal reference forward primer, internal reference reverse primer and internal reference Taqman probe into a reaction tube at the same time to construct Dual detection system for HLA-B*58:01 allele.

9. The method of use according to claim 8, characterized in that: In the dual detection system of HLA-B*58:01 allele, the final concentration of each primer is 0.1-1 μM, and the final concentration of each Taqman probe is 0.1-1 μM.

10. A method for detecting human HLA-B*58:01 genotype, characterized in that The following steps are involved: (1) preparing a PCR double detection system: adding a detection forward primer, a detection reverse primer, a detection Taqman probe, an internal reference forward primer, an internal reference reverse primer, an internal reference Taqman probe, TaqMix, a DNA sample, and water into a reaction tube at the same time to obtain a PCR double detection system; (2) performing PCR amplification on the PCR dual detection system; (3) Directly read the Cq value of the PCR dual detection system. When the Cq value of the fluorescence channel is positive, the genotype is HLA-B*58:01; when the Cq value of the fluorescence channel is not detected, the genotype is not HLA-B*58:01; Preferably, the DNA sample is a human oral swab DNA sample; Preferably, the reaction procedure of PCR amplification is as follows: Stage 1: 37°C, 2 minutes; Second stage: 95℃, 5 minutes; The third stage: 95°C, 10 seconds; 60°C for 35 seconds, 45 cycles; collecting fluorescence signals at 60°C.

Images