Primer / probe composition for capillary electrophoresis analysis, detection method and application

Abstract

The invention provides a primer / probe composition for capillary electrophoresis analysis, a detection method and application. The primer / probe composition comprises a forward primer, a reverse primer and a nucleic acid probe, the 5'end of the nucleic acid probe carries a fluorescent label, and both the forward primer and the reverse primer do not carry the fluorescent label. Different targets are identified by detecting the nucleic acid probe, so that the length of an amplification product is not limited, only the nucleic acid probe carries a fluorescence signal without generating a non-specific fluorescence signal, the generation of a supersaturated fluorescence signal can be effectively prevented by using the nucleic acid probe with a specific concentration, the fluorescence signals among different targets do not interfere with each other, and the detection sensitivity is high. And multicolor fluorescence can be used at the same time.

Description

Technical Field

[0001] This invention belongs to the field of biochemistry, specifically relating to a primer / probe composition, detection method, and application for capillary electrophoresis analysis. Background Technology

[0002] Capillary electrophoresis (CE) is a detection technique that uses electrophoresis to arrange nucleic acids in ascending order of fragment length to detect targets. The general process typically includes: 1. Designing and synthesizing fluorescently labeled primers; 2. Amplifying fluorescently labeled nucleic acids of different lengths using polymerase chain reaction (PCR); 3. Separating the amplified products using capillary electrophoresis; 4. Determining the presence of the target nucleic acid in the sample based on the fluorescence position and intensity of the amplified products.

[0003] The current disadvantages of capillary electrophoresis detection technology include: 1. Different detection targets require primer design to ensure that the forward and reverse primers are at different distances from the amplification target sites, thus obtaining fragments of different lengths; 2. The PCR amplification efficiency of amplification products of different lengths decreases with increasing length; 3. Due to the presence of a large number of different primers in the same reaction system, non-specific amplification is likely to occur, and non-specific amplification products generated by fluorescently labeled primers can easily interfere with the target fluorescence signal; 4. High-concentration samples are prone to producing supersaturated fluorescence signals, causing the baseline to rise, which affects the determination of adjacent target sites. Summary of the Invention

[0004] Therefore, the purpose of this invention is to overcome the deficiencies in the prior art and provide a primer / probe composition, detection method, and application for capillary electrophoresis analysis. In particular, the primer / probe composition of this invention can be used for the detection of single and multiple target nucleic acids.

[0005] Before describing the content of this invention, the following terms are defined as follows:

[0006] The term "forward primer" refers to the primer that binds upstream of the positive strand (sense strand, coding strand) of a double-stranded DNA.

[0007] The term "reverse primer," also known as downstream primer, refers to the primer that binds downstream of the negative strand (complementary strand) in double-stranded DNA.

[0008] The term "nt" refers to nucleotide, which is a class of compounds composed of purine or pyrimidine bases, ribose or deoxyribose, and phosphate.

[0009] The term "PCR" refers to polymerase chain reaction.

[0010] The term "CE" refers to capillary electrophoresis.

[0011] The term "dNTP" refers to deoxyribonucleoside triphosphate.

[0012] The term "DNA polymerase" refers to a class of enzymes that use parental DNA as a template to catalyze the polymerization of substrate dNTP molecules to form daughter DNA.

[0013] The term "nucleic acid probe" refers to a type of nucleotide chain composed of single or mixed ribonucleotides and deoxyribonucleotides.

[0014] The term "nucleotide length difference" refers to the difference in length between any nucleic acid probe and the nearest nucleic acid probe.

[0015] The term "regular DNA" refers to deoxyribonucleic acid, which is composed of four deoxyribonucleotides (adenine deoxyribonucleotide, guanine deoxyribonucleotide, cytosine deoxyribonucleotide, and thymine deoxyribonucleotide) as basic building blocks.

[0016] The term "regular RNA" refers to ribonucleic acid, which is composed of four types of ribonucleotides (adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, and uracil ribonucleotide) as basic building blocks.

[0017] The term "DNA probe" refers to a labeled fragment of DNA.

[0018] The term "RNA probe" refers to a labeled RNA fragment.

[0019] The term "DNA / RNA chimeric probe" refers to a labeled fragment composed of both deoxyribonucleotides and ribonucleotides.

[0020] The term "non-complementary nucleotide" refers to a nucleotide chain that cannot form stable hydrogen bonds with the template chain.

[0021] The term "ddNTP" refers to dideoxyribonucleoside triphosphates, including ddATP, ddTTP, ddGTP, and ddCTP.

[0022] The term "Spacer modification" refers to intercalary arm modifications consisting of straight carbon chains or ethylene glycol, including Spacer C3, Spacer C6, Spacer C9, etc.

[0023] The term "TE buffer" refers to a liquid reagent composed of Tris and EDTA that stabilizes nucleic acids and resists pH changes when small amounts of acid / base are added.

[0024] The term "locked nucleic acid" refers to an oligonucleotide derivative. Locked nucleic acids have a similar phosphate backbone to DNA and RNA, but the 2' and 4' ribose of locked nucleic acids form oxymethylene bridges, thiomethylene bridges, or aminomethylene bridges through dehydration, making them bicyclic nucleotide derivatives.

[0025] The term "hypoxanthine" refers to 6-hydroxypurine, whose English name is Hypoxanthine, represented by the capital letter "I". It can pair complementaryly with adenine, cytosine, and uracil.

[0026] The term "Alexa Fluor 405" refers to one of the Alexa Fluor series of fluorescent dyes, with a maximum excitation wavelength of 401 nm and a maximum emission wavelength of 421 nm. Representative manufacturers include, but are not limited to, Thermo Fisher Scientific and Molecular Probes.

[0027] The term "Alexa Fluor 350" refers to one of the Alexa Fluor series of fluorescent dyes, with a maximum excitation wavelength of 346 nm and a maximum emission wavelength of 442 nm. Representative manufacturers include, but are not limited to, Thermo Fisher Scientific and Molecular Probes.

[0028] The term "FAM" refers to a fluorescent dye whose main component contains 5(6)-carboxyfluorescein (5-(and-6)-Carboxyfluorescein, molecular formula: C 21 H 12 O7), with a maximum excitation wavelength of 493-494nm and a maximum emission wavelength of 518nm. Representative manufacturers include, but are not limited to, Sangon Biotech (Shanghai) Co., Ltd. and Thermo Fisher Scientific.

[0029] The term "Alexa Fluor 488" refers to one of the Alexa Fluor series of fluorescent dyes, with a maximum excitation wavelength of 496 nm and a maximum emission wavelength of 519 nm. Representative manufacturers include, but are not limited to, Thermo Fisher Scientific and Molecular Probes.

[0030] The term "Atto 488" refers to a fluorescent dye with a maximum excitation wavelength of 499 nm and a maximum emission wavelength of 520 nm. Representative manufacturers include, but are not limited to, AAT Bioquest in the United States.

[0031] The term "TET" refers to a fluorescent dye whose main component contains (4,6-dichlorotriazine)aminofluorescein (molecular formula: C). 21 H8C l4 O7), with a maximum excitation wavelength of 521nm and a maximum emission wavelength of 536-542nm. Representative manufacturers include, but are not limited to, Sangon Biotech (Shanghai) Co., Ltd. and Thermo Fisher Scientific.

[0032] The term "VIC" refers to a fluorescent dye with a maximum excitation wavelength of 525–538 nm and a maximum emission wavelength of 545–554 nm. Representative manufacturers include, but are not limited to, Sangon Biotech (Shanghai) Co., Ltd. and Thermo Fisher Scientific.

[0033] The term "R6G" refers to a fluorescent dye whose main component contains rhodamine 6G (molecular formula: C6G). 28 H 31 ClN2O3), with a maximum excitation wavelength of 522-530nm and a maximum emission wavelength of 546-548nm, and representative manufacturers include, but are not limited to, Sangon Biotech (Shanghai) Co., Ltd.

[0034] The term "JOE" refers to a fluorescent dye whose main component contains 4',5'-dichloro-2',7'-dimethoxyfluorescein (molecular formula: C). 23 H 14 Cl2O9), with a maximum excitation wavelength of 520nm and a maximum emission wavelength of 548nm, is produced by companies including but not limited to Sangon Biotech (Shanghai) Co., Ltd. and Thermo Fisher Scientific.

[0035] The term "HEX" refers to a fluorescent dye whose main component contains the structure 2',4,4',5',7,7'-hexachlorofluorescein (molecular formula: C6H6). 25H9Cl6NO9), with a maximum excitation wavelength of 533–535 nm and a maximum emission wavelength of 550–556 nm. Representative manufacturers include, but are not limited to, Sangon Biotech (Shanghai) Co., Ltd. and Thermo Fisher Scientific.

[0036] The term "Alexa Fluor 532" refers to one of the Alexa Fluor series of fluorescent dyes, with a maximum excitation wavelength of 532 nm and a maximum emission wavelength of 553 nm. Representative manufacturers include, but are not limited to, Thermo Fisher Scientific and Molecular Probes.

[0037] The term "Cy3" refers to: the anthocyanin fluorescent dye Cy3 (molecular formula: C). 30 H 37 ClN2O2), with a maximum excitation wavelength of 552-555nm and a maximum emission wavelength of 565-570nm, and representative manufacturers include, but are not limited to, Sangon Biotech (Shanghai) Co., Ltd. and Thermo Fisher Scientific.

[0038] The term "Alexa Fluor 555" refers to one of the Alexa Fluor series of fluorescent dyes, with a maximum excitation wavelength of 555nm and a maximum emission wavelength of 565nm. Representative manufacturers include, but are not limited to, Thermo Fisher Scientific and Molecular Probes.

[0039] The term "NED" refers to a fluorescent dye with a maximum excitation wavelength of 545–546 nm and a maximum emission wavelength of 567–575 nm. Representative manufacturers include, but are not limited to, Sangon Biotech (Shanghai) Co., Ltd. and Thermo Fisher Scientific.

[0040] The term "Alexa Fluor 546" refers to one of the Alexa Fluor series of fluorescent dyes, with a maximum excitation wavelength of 556 nm and a maximum emission wavelength of 573 nm. Representative manufacturers include, but are not limited to, Thermo Fisher Scientific and Molecular Probes.

[0041] The term "TAMRA" refers to a fluorescent dye whose main component is 5-carboxytetramethylrhodamine (molecular formula: C12-C ... 31 H 28 N4O6), with a maximum excitation wavelength of 552-565nm and a maximum emission wavelength of 578-580nm. Representative manufacturers include, but are not limited to, Sangon Biotech (Shanghai) Co., Ltd. and Thermo Fisher Scientific.

[0042] The term "ROX" refers to a fluorescent dye whose main component contains X-rhodamine (molecular formula: C). 39 H 36 N4O6), with a maximum excitation wavelength of 578–585 nm and a maximum emission wavelength of 602–605 nm, is produced by companies including but not limited to Sangon Biotech (Shanghai) Co., Ltd. and Thermo Fisher Scientific.

[0043] The term "Texas Red" refers to a fluorescent dye with a maximum excitation wavelength of 586–595 nm and a maximum emission wavelength of 603–615 nm. Representative manufacturers include, but are not limited to, Sangon Biotech (Shanghai) Co., Ltd. and AAT Bioquest (USA).

[0044] The term "Alexa Fluor 568" refers to one of the Alexa Fluor series of fluorescent dyes, with a maximum excitation wavelength of 578 nm and a maximum emission wavelength of 603 nm. Representative manufacturers include, but are not limited to, Thermo Fisher Scientific and Molecular Probes.

[0045] The term "Alexa Fluor 594" refers to one of the Alexa Fluor series of fluorescent dyes, with a maximum excitation wavelength of 590 nm and a maximum emission wavelength of 617 nm. Representative manufacturers include, but are not limited to, Thermo Fisher Scientific and Molecular Probes.

[0046] The term "Alexa Fluor 633" refers to one of the Alexa Fluor series of fluorescent dyes, with a maximum excitation wavelength of 632 nm and a maximum emission wavelength of 647 nm. Representative manufacturers include, but are not limited to, Thermo Fisher Scientific and Molecular Probes.

[0047] The term "Alexa Fluor 647" refers to one of the Alexa Fluor series of fluorescent dyes, with a maximum excitation wavelength of 650 nm and a maximum emission wavelength of 665 nm. Representative manufacturers include, but are not limited to, Thermo Fisher Scientific and Molecular Probes.

[0048] The term "Cy5" refers to: the anthocyanin fluorescent dye Cy5 (molecular formula: C). 33 H 39KN2O8S2), with a maximum excitation wavelength of 643-651nm and a maximum emission wavelength of 667-670nm, is produced by companies including but not limited to Sangon Biotech (Shanghai) Co., Ltd. and Thermo Fisher Scientific.

[0049] The term "SIZE" refers to a standard substance used to determine the position of electrophoretic migration.

[0050] The term "Sanger sequencer" refers to a gene sequencer based on dideoxy chain termination sequencing.

[0051] The term "P" refers to phosphorylation.

[0052] To achieve the above objectives, a first aspect of the present invention provides a primer / probe composition for capillary electrophoresis analysis, the primer / probe composition comprising:

[0053] Forward primer;

[0054] Reverse primer; and

[0055] Nucleic acid probes carrying fluorescent markers;

[0056] Neither the forward primer nor the reverse primer carries a fluorescent label, and the fluorescent label is preferably located at the 5' end of the nucleic acid probe.

[0057] According to the primer / probe composition of the first aspect of the present invention, wherein,

[0058] The nucleic acid probe is a probe group with a nucleotide length difference of 1 to 100, and the nucleotide length difference of each nucleic acid probe in the probe group is preferably 1 to 50, more preferably 1 to 20, and even more preferably 1 to 10.

[0059] The forward primer sequence has 15 to 60 nucleotides, preferably 18 to 40, more preferably 18 to 30, and even more preferably 20 to 25.

[0060] The reverse primer sequence has 15 to 60 nucleotides, preferably 18 to 40, more preferably 19 to 31, and even more preferably 19 to 26; and / or

[0061] The fluorescent marker is selected from one or more of the following: fluorescent markers with a maximum fluorescence emission wavelength of 400–525 nm, fluorescent markers with a maximum fluorescence emission wavelength of 526–560 nm, fluorescent markers with a maximum fluorescence emission wavelength of 561–580 nm, fluorescent markers with a maximum fluorescence emission wavelength of 581–620 nm, and fluorescent markers with a maximum fluorescence emission wavelength of 621–670 nm; wherein:

[0062] Preferably, the fluorescent marker with a maximum emission wavelength of 400-525 nm is selected from one or more of the following: Alexa Fluor 405, Alexa Fluor 350, FAM, Alexa Fluor 488, Atto 488, more preferably FAM or Alexa Fluor 488, and most preferably FAM;

[0063] Preferably, the fluorescent marker with a maximum emission wavelength of 526-560 nm is selected from one or more of the following: JOE, TET, R6G, VIC, HEX, Alexa Fluor 532, more preferably from one or more of the following: JOE, VIC, TET, and even more preferably JOE or VIC;

[0064] Preferably, the fluorescent marker with a maximum emission wavelength of 561-580 nm is selected from one or more of the following: Cy3, Alexa Fluor 555, NED, Alexa Fluor 546, TAMRA, more preferably Cy3 or NED, and most preferably Cy3;

[0065] Preferably, the fluorescent marker with a maximum emission wavelength of 581-620 nm is selected from one or more of the following: ROX, Texas Red, Alexa Fluor 568, Alexa Fluor 594, more preferably ROX or Texas Red, and most preferably ROX; and / or

[0066] Preferably, the fluorescent marker with a maximum emission wavelength of 621-670 nm is selected from one or more of the following: Cy5, Alexa Fluor 633, Alexa Fluor 647, more preferably Cy5 or Alexa Fluor 647, and most preferably Cy5.

[0067] According to the primer / probe composition of the first aspect of the present invention, wherein the nucleic acid probe is selected from one or more of the following: DNA probe, RNA probe, DNA / RNA chimeric probe, preferably a DNA probe or an RNA probe, and most preferably a DNA probe; wherein:

[0068] The DNA probe is selected from one or more of the following: conventional DNA probes, DNA probes containing locked nucleic acids, DNA probes containing hypoxanthine, preferably conventional DNA probes; and / or

[0069] The RNA probe is selected from one or more of the following: conventional RNA probes, RNA probes containing locked nucleic acids, RNA probes containing hypoxanthine, preferably conventional RNA probes;

[0070] Preferably, the 3' end of the nucleic acid probe further carries a marker for inhibiting the extension of the nucleic acid probe. The marker for inhibiting the extension of the nucleic acid probe is preferably selected from one or more of the following: fluorescent markers, phosphate groups, non-complementary nucleotides, ddNTPs, and spacer modifications. More preferably, it is selected from one or more of the following: phosphate groups, non-complementary nucleotides, and ddNTPs. More preferably, it is a phosphate group or ddNTP.

[0071] A second aspect of the present invention provides an improved capillary electrophoresis detection method, the improved capillary electrophoresis detection method comprising the following steps:

[0072] 1) Prepare the reaction system using the primer / probe composition for capillary electrophoresis analysis as described in the first aspect;

[0073] 2) The reaction system prepared in step 1) was amplified by PCR to obtain the amplification product;

[0074] 3) Separate the amplified products from step 2) by capillary electrophoresis.

[0075] According to the capillary electrophoresis detection method of the second aspect of the present invention, step 1) includes:

[0076] a) Design and synthesize forward and reverse primers, and fluorescently label the nucleic acid probe;

[0077] b) Prepare the reaction system by combining the designed and synthesized forward and reverse primers, the fluorescently labeled nucleic acid probe, reaction buffer, DNA polymerase, dNTPs, the sample to be tested, and the negative sample.

[0078] According to the capillary electrophoresis detection method of the second aspect of the present invention, wherein in step b):

[0079] The negative sample is selected from one or more of the following: purified water, TE buffer, plasmid sample without target nucleic acid, microbial isolate, tissue sample, preferably selected from one or more of the following: purified water, TE buffer, plasmid sample without target nucleic acid, microbial isolate, more preferably selected from one or more of the following: purified water, TE buffer, plasmid sample without target nucleic acid; and / or

[0080] The reaction buffer is Tris-hydrochloric acid buffer or PBS buffer; and the reaction buffer preferably contains cations, which are preferably selected from one or more of the following: magnesium ions, potassium ions, sodium ions, calcium ions, and more preferably magnesium ions or potassium ions.

[0081] According to the capillary electrophoresis detection method of the second aspect of the present invention, wherein the reaction system prepared in step b) comprises:

[0082] The concentration of the forward primer is 50 nM to 5000 nM, preferably 100 nM to 2000 nM, and more preferably 100 nM to 300 nM;

[0083] The concentration of the reverse primer is 50 nM to 5000 nM, preferably 100 nM to 2000 nM, and more preferably 100 nM to 300 nM;

[0084] The concentration of the nucleic acid probe is 5nM to 500nM, preferably 5nM to 200nM, and more preferably 5nM to 15nM.

[0085] According to the capillary electrophoresis detection method of the second aspect of the present invention, in step a):

[0086] The operation of fluorescently labeling the nucleic acid probe further includes one or more of the following:

[0087] (1) The 5' end of the nucleic acid probe is fluorescently labeled, and the 3' end of the nucleic acid probe is modified.

[0088] (2) The 5' end of the nucleic acid probe is fluorescently labeled, while ensuring that the 3' base of the nucleic acid probe is not completely complementary to the template.

[0089] (3) The 3' end of the nucleic acid probe is fluorescently labeled.

[0090] According to the capillary electrophoresis detection method of the second aspect of the present invention, the improved capillary electrophoresis detection method further includes:

[0091] 4) The target nucleic acid in the test sample is analyzed and interpreted by comparing the fluorescence signal intensity of the nucleic acid probe.

[0092] A third aspect of the invention provides the use of the primer / probe composition of the first aspect in the preparation of reagent products and / or detection devices for capillary electrophoresis analysis; wherein:

[0093] The reagent product is preferably a reagent kit; and / or

[0094] The detection device is preferably a capillary electrophoresis apparatus or a DNA sequencer;

[0095] Preferably, the DNA sequencer is a Sanger sequencer.

[0096] According to one specific embodiment, the primers used in this invention include a forward primer, a reverse primer, and a nucleic acid probe. The forward primer is not fluorescently labeled, the reverse primer is not fluorescently labeled, and the nucleic acid probe has a fluorescent label at the 5' end and a label at the 3' end to inhibit nucleic acid probe elongation.

[0097] The operation steps are as follows:

[0098] First, select a suitable reaction system, add reaction buffer (containing DNA polymerase and dNTPs), forward primer, reverse primer, nucleic acid probe, and the sample to be tested or negative sample to prepare a suitable reaction system.

[0099] Secondly, select a suitable reaction procedure for PCR amplification.

[0100] Finally, the PCR products were subjected to electrophoresis, and the fluorescence signal intensity of the target nucleic acid probe and the non-target nucleic acid probe were compared to determine whether the target nucleic acid was positive.

[0101] The technical problem to be solved by this invention is as follows:

[0102] 1. Current capillary electrophoresis (CE) detection technology distinguishes different targets by separating amplification products of different lengths. This invention identifies different targets by detecting nucleic acid probes, making target identification independent of the length of amplification products.

[0103] 2. Current capillary electrophoresis (CE) detection technology uses amplification primers carrying fluorescent labels. When non-specific amplification occurs in the primers, the non-specific amplification products can affect the interpretation of the target signal. In the amplification system of this invention, only the nucleic acid probe carries a fluorescent signal, and no additional signal is generated.

[0104] 3. Current capillary electrophoresis (CE) detection techniques use primer overload. When the concentration of the target nucleic acid sequence in the sample is too high, a saturation annealing peak will occur, interfering with the interpretation of adjacent target sites. This invention effectively prevents the generation of oversaturated fluorescence signals by using nucleic acid probes of specific concentrations.

[0105] Existing technology involves fluorescently labeling the 5' end of the forward primer, generating different fluorescently labeled products during PCR, and then separating the products of different lengths by electrophoresis.

[0106] In the primer / probe composition and detection method for capillary electrophoresis of the present invention, the forward primer does not carry a fluorescent label, and only the nucleic acid probe carries a fluorescent label. During the PCR process, the nucleic acid probe is cleaved, and the fluorescent signal of the nucleic acid probe disappears or weakens during electrophoresis.

[0107] Compared with the prior art, the primer / probe composition and detection method for capillary electrophoresis of the present invention may have the following beneficial effects, but are not limited to:

[0108] 1. This invention identifies different target sites by detecting nucleic acid probes, so that target site identification is not limited by the length of amplification products.

[0109] 2. In the amplification system of this invention, only the nucleic acid probe carries a fluorescent signal, and no non-specific fluorescent signal is generated.

[0110] 3. This invention can effectively prevent the generation of oversaturated fluorescence signals by using nucleic acid probes of specific concentrations.

[0111] 4. Fluorescence signals from different targets do not interfere with each other, and multicolor fluorescence can be used simultaneously. Attached Figure Description

[0112] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings, wherein:

[0113] Figure 1 The primer / probe composition for capillary electrophoresis of the present invention shown in Example 1 is illustrated. The nucleic acid probe 5' carries a FAM fluorescent label and 3' is phosphorylated. The detection effect of the present invention is used when the lengths of the nucleic acid probes differ by 1 nt.

[0114] Figure 2 Example 2 illustrates the primer / probe composition of the present invention for capillary electrophoresis, wherein the nucleic acid probe 5' carries a FAM fluorescent label and 3' is phosphorylated, and the detection effect of the present invention is used when the lengths of the nucleic acid probes differ by 2 nt.

[0115] Figure 3 Example 3 illustrates the primer / probe composition of the present invention for capillary electrophoresis, wherein the nucleic acid probe 5' carries a FAM fluorescent label and 3' is phosphorylated, and the detection effect of the present invention is used when the lengths of the nucleic acid probes differ by 3 nt.

[0116] Figure 4 Example 4 illustrates the primer / probe composition of the present invention for capillary electrophoresis, in which the nucleic acid probe 5' carries a FAM fluorescent label and 3' is phosphorylated. The detection effect of the present invention is achieved when the lengths of the nucleic acid probes differ by 4 nt.

[0117] Figure 5 Example 5 illustrates the primer / probe composition of the present invention for capillary electrophoresis, wherein the nucleic acid probe 5' carries a FAM fluorescent label and 3' is phosphorylated, and the detection effect of the present invention is used when the lengths of the nucleic acid probes differ by 5 nt.

[0118] Figure 6Example 6 illustrates the primer / probe composition of the present invention for capillary electrophoresis, wherein the nucleic acid probe 5' carries a FAM fluorescent label and 3' is phosphorylated, and the detection effect of the present invention is used when the lengths of the nucleic acid probes differ by 6 nt.

[0119] Figure 7 Example 7 illustrates the primer / probe composition of the present invention for capillary electrophoresis, wherein the nucleic acid probe 5' carries a FAM fluorescent label and 3' is phosphorylated, and the detection effect of the present invention is used when the lengths of the nucleic acid probes differ by 7 nt.

[0120] Figure 8 Example 8 illustrates the primer / probe composition of the present invention for capillary electrophoresis, in which the nucleic acid probe 5' carries a FAM fluorescent label and 3' is phosphorylated. The detection effect of the present invention is achieved when the lengths of the nucleic acid probes differ by 8 nt.

[0121] Figure 9 Example 9 illustrates the primer / probe composition of the present invention for capillary electrophoresis, in which the nucleic acid probe 5' carries a FAM fluorescent label and 3' is phosphorylated. The detection effect of the present invention is achieved when the lengths of the nucleic acid probes differ by 9 nt.

[0122] Figure 10 The primer / probe composition of the present invention for capillary electrophoresis in Example 10 is shown. The nucleic acid probe 5' carries a FAM fluorescent label and 3' is phosphorylated. The detection effect of the present invention is used when the lengths of the nucleic acid probes differ by 10 nt.

[0123] Figure 11 The primer / probe composition for capillary electrophoresis of the present invention shown in Example 11 is illustrated. The nucleic acid probe 5' carries a FAM fluorescent label and 3' is phosphorylated. The detection effect of the present invention is used when the lengths of the nucleic acid probes differ by 20 nt.

[0124] Figure 12 The primer / probe composition of the present invention for capillary electrophoresis in Example 12 is shown, and the detection effect of the present invention is shown when the nucleic acid probe 3' carries a FAM fluorescent label.

[0125] Figure 13 The primer / probe composition of the present invention for capillary electrophoresis in Example 13 is shown, wherein the nucleic acid probe 5' carries a VIC fluorescent label, and the detection effect of the present invention is achieved when the 3' is phosphorylated.

[0126] Figure 14 The primer / probe composition of the present invention for capillary electrophoresis in Example 14 is shown, and the detection effect of the present invention is shown when the nucleic acid probe 5' carries a JOE fluorescent label.

[0127] Figure 15The primer / probe composition of the present invention for capillary electrophoresis in Example 15 is shown, wherein the nucleic acid probe 5' carries a Cy3 fluorescent label, and the detection effect of the present invention is achieved when the 3' is phosphorylated.

[0128] Figure 16 The primer / probe composition of the present invention for capillary electrophoresis in Example 16 is shown, wherein the nucleic acid probe 5' carries a ROX fluorescent label, and the detection effect of the present invention is achieved when the 3' is phosphorylated.

[0129] Figure 17 The primer / probe composition of the present invention for capillary electrophoresis in Example 17 is shown, wherein the nucleic acid probe 5' carries a Cy5 fluorescent label, and the detection effect of the present invention is achieved when the 3' is phosphorylated.

[0130] Figure 18 The effect of simultaneous electrophoresis of probes with different fluorescent labels in Example 18 is shown.

[0131] Figure 19 A schematic diagram of the primer / probe composition and detection method for capillary electrophoresis of the present invention is shown.

[0132] Figure 20 A schematic diagram of a detection method in the prior art is shown. Detailed Implementation

[0133] The present invention will be further illustrated below with specific embodiments. However, it should be understood that these embodiments are merely for more detailed and specific illustration and should not be construed as limiting the present invention in any way.

[0134] This section provides a general description of the materials and testing methods used in the experiments of this invention. While many of the materials and methods of operation used to achieve the objectives of this invention are well known in the art, the invention is still described in as much detail as possible herein. It will be apparent to those skilled in the art that, unless otherwise stated in the context, the materials and methods of operation used in this invention are well known in the art.

[0135] The reagents and instruments used in the following examples are as follows:

[0136] Reagents:

[0137] 2*qRT-PCR Premix [v7] (with UDG) was purchased from Hangzhou Huakui Jinpei Biotechnology Co., Ltd.; Hi-Di TM Formamide was purchased from Thermo Fisher Scientific; the Nucleic Acid Extraction Kit (Magnetic Bead Method), catalog number: RT-A(SG)-200, was purchased from Zhongyuan Huiji Biotechnology Co., Ltd.

[0138] instrument:

[0139] The electrophoresis apparatus was purchased from Applied Biosystems, model 3500Dx.

[0140] In the primer / probe compositions specifically used in Examples 1-18 below, the sequences of the forward primers are as shown in SEQ ID NO. 1-16, the sequences of the reverse primers are as shown in SEQ ID NO. 17-32, and the sequences of the nucleic acid probes are as shown in SEQ ID NO. 33-58.

[0141] SEQ ID NO. 1: GAAGCATGGTATGAATTTCGTG.

[0142] SEQ ID NO. 2: GGAGGAAGTAAACACTCAGAAAGA.

[0143] SEQ ID NO. 3: CTTGAACCATTGCAGTCACC.

[0144] SEQ ID NO.4: TCTTCTAACCGAGGTCGAAACGTA.

[0145] SEQ ID NO. 5: CGTACGAACACTTTATCACCACTA.

[0146] SEQ ID NO. 6: CAGGCAAGTTAAGGTTAGATAGCA.

[0147] SEQ ID NO.7: AGCCACAACACTTAAATTCACTC.

[0148] SEQ ID NO. 8: GACAGAACCCGGTATTTCAG.

[0149] SEQ ID NO.9: CATATCTTAATCCGCAATACCACTC.

[0150] SEQ ID NO. 10: CTACTTCAGCAAATTTGACCCA.

[0151] SEQ ID NO. 11: CTCACCAGAAGTTGTTTGTATCAC.

[0152] SEQ ID NO. 12: TTAGGGTGGGAACTCTAACGA.

[0153] SEQ ID NO.13:TCAGTAGTAGACCATGTGAATTCC。

[0154] SEQ ID NO.14:TTCTCCGTTGGCTTAGTAAATGTC。

[0155] SEQ ID NO.15:TTGATCTAGAAATTGCCCTCCT。

[0156] SEQ ID NO.16:CTACAAGCGCGTGTATGATGAG。

[0157] SEQ ID NO.17:ACCTGCACAATTACAGCCAA。

[0158] SEQ ID NO.18:CCACTCTGGTCATATGCATTCAATCT。

[0159] SEQ ID NO.19:CTCGTCTTGAAGGAAGTACAATCTA。

[0160] SEQ ID NO.20:GTCTTGTCTTTAGCCATTCCA。

[0161] SEQ ID NO.21:AGCCACTAATTGCATTACCAAG。

[0162] SEQ ID NO.22:TGAAGATTAATGCGGCTTGTAG。

[0163] SEQ ID NO.23:GATGAGCTAGTGTGCAAATGG。

[0164] SEQ ID NO.24:AGTTTGGCAATTCATCCTCCAC。

[0165] SEQ ID NO.25:CTAGCATCAGTTAACGGATTAATGG。

[0166] SEQ ID NO.26:GCTTAATAGGCAATGCATTCCA。

[0167] SEQ ID NO.27:GTTTAAGAGTCAGCGCGCAGTA。

[0168] SEQ ID NO.28:CCATTACTAGCAATTCGA。

[0169] SEQ ID NO. 29: CTGTGAATATGGGAGGTTTCATCA.

[0170] SEQ ID NO. 30: GGAGGTAAGCTCTAGTATGTAAGG.

[0171] SEQ ID NO. 31: CCAATTCGGTTCAGTCTAATCC.

[0172] SEQ ID NO. 32: CATGTCCTTATGCCGCTTTC.

[0173] SEQ ID NO.33: FAM-ATGCATAACAGCATCAACACCAACACGACT-P (Since the standard format of the sequence listing attached to this application cannot reflect FAM- and P, the sequence information described herein shall prevail for SEQ ID NO.33).

[0174] SEQ ID NO.34: FAM-TAAATGGAACATTCCTCAAACACCCCAATGG-P (Since the standard format of the sequence listing attached to this application cannot reflect FAM- and P, SEQ ID NO.34 is based on the sequence information described herein).

[0175] SEQ ID NO.35: FAM-ACGTAAAATCCAGAATCAGGGTGATCCTCTAA-P (Since the standard format of the sequence listing attached to this application cannot reflect FAM- and P, the sequence information described herein shall prevail for SEQ ID NO.35).

[0176] SEQ ID NO.36: FAM-TCAGGCCCCCTCAAAGCCGAGATCGCACAGAGAC-P (Since the standard format of the sequence listing attached to this application cannot reflect FAM- and P, the sequence information described herein shall prevail for SEQ ID NO.36).

[0177] SEQ ID NO.37: FAM-ATGTTCTAAGCACGCTAATCTCTATAGAGCATATGT-P (Since the standard format of the sequence listing attached to this application cannot reflect FAM- and P, SEQ ID NO.37 is based on the sequence information described herein).

[0178] SEQ ID NO.38: FAM-TTAGCAGACAAATTCCCAGTTCTTCAC-P (Since the standard format of the sequence listing attached to this application cannot reflect FAM- and P, SEQ ID NO.38 is based on the sequence information described herein).

[0179] SEQ ID NO.39: FAM-ATCATTGAGACCTACCATAACCCACCTATCAGGAC-P (Since the standard format of the sequence listing attached to this application cannot reflect FAM- and P, the sequence information described herein shall prevail for SEQ ID NO.39).

[0180] SEQ ID NO.40: FAM-TTCAATAATGCGCACATCAGGATCATAGCTGTCCACC-P (Since the standard format of the sequence listing attached to this application cannot reflect FAM- and P, the sequence information described herein shall prevail for SEQ ID NO.40).

[0181] SEQ ID NO.41: FAM-AAAAGCGCTGCATATGACCCAGTTA-P (Since the standard format of the sequence listing attached to this application cannot reflect FAM- and P, the sequence information described herein shall prevail for SEQ ID NO.41).

[0182] SEQ ID NO.42: FAM-TACATTGCATTCATCAATTTGTAGCACCTGACGATCATTAG-P (Since the standard format of the sequence listing attached to this application cannot reflect FAM- and P, the sequence information described herein shall prevail for SEQ ID NO.42).

[0183] SEQ ID NO.43: FAM-AAGACCAACTTCAGCGCACTCTCGAGGACGCCGAGGCTCT-P (Since the standard format of the sequence listing attached to this application cannot reflect FAM- and P, the sequence information described herein shall prevail for SEQ ID NO.43).

[0184] SEQ ID NO.44: FAM-CTTTGAGGATTTGCTCCATCTTACGATATTGCTACCTTCTGTACTGGCC AP (Since the standard format of the sequence listing attached to this application cannot reflect FAM- and P, the sequence information described herein shall prevail for SEQ ID NO.44).

[0185] SEQ ID NO.45: FAM-AGAACTACAAATTATCACTTTGATACTAGCCCTATTAATCGCA-P (Since the standard format of the sequence listing attached to this application cannot reflect FAM- and P, the sequence information described herein shall prevail for SEQ ID NO.45).

[0186] SEQ ID NO.46: FAM-CAGGTCCTCGTCGCCGTACA-P (Since the standard format of the sequence listing attached to this application cannot reflect FAM- and P, SEQ ID NO.46 is based on the sequence information described herein).

[0187] SEQ ID NO.47:

[0188] TCAGCTAATGACAACTCGAGCCTTACTGGCGATATGGTCCAA-FAM (Since the standard format of the sequence listing attached to this application cannot reflect FAM, SEQ ID NO.47 shall be based on the sequence information described herein).

[0189] SEQ ID NO.48:

[0190] TTCAATAATGCGCACATCAGGATCATAGCTGTCCACC-FAM (Since the standard format of the sequence listing attached to this application cannot reflect FAM, SEQ ID NO.48 shall be based on the sequence information described herein).

[0191] SEQ ID NO.49: JOE-TACATTGCATTCATCAATTTGTAGCACCTGACGATCAGATCTT (Because the standard format of the sequence listing attached to this application cannot reflect JOE, the sequence information described herein shall prevail for SEQ ID NO.49).

[0192] SEQ ID NO.50: JOE-TAATAGTTATGTCATCCCTCTTATTAATCATCATCCTAGCCCTTTCAGAC (Since the standard format of the sequence listing attached to this application cannot reflect JOE, the sequence information described herein shall prevail for SEQ ID NO.50).

[0193] SEQ ID NO.51: VIC-TACATTGCATTCATCAATTTGTAGCACCTGACGATCATTAG-P (Since the standard format of the sequence listing attached to this application cannot reflect VIC and P, SEQ ID NO.51 is based on the sequence information described herein).

[0194] SEQ ID NO.52: VIC-TAAATGGAACATTCCTCAAACACCCCAATGG-P (Since the standard format of the sequence listing attached to this application cannot reflect VIC and P, the sequence information described herein shall prevail for SEQ ID NO.52).

[0195] SEQ ID NO.53: Cy3-TCAGCTAATGACAACTCGAGCCTTACTGGCGATATGGTCCAA-P (Since the standard format of the sequence listing attached to this application cannot reflect Cy3 and P, the sequence information described herein shall prevail for SEQ ID NO.53).

[0196] SEQ ID NO.54: Cy3-TAAATGGAACATTCCTCAAACACCCCAATGG-P (Since the standard format of the sequence listing attached to this application cannot reflect Cy3 and P, the sequence information described herein shall prevail for SEQ ID NO.54).

[0197] SEQ ID NO.55: ROX-TAAATGGAACATTCCTCAAACACCCCAATGG-P (Since the standard format of the sequence listing attached to this application cannot reflect ROX and P, the sequence information described herein shall prevail for SEQ ID NO.55).

[0198] SEQ ID NO.56: ROX-TTCAATAATGCGCACATCAGGATCATAGCTGTCCACC-P (Since the standard format of the sequence listing attached to this application cannot reflect ROX and P, the sequence information described herein shall prevail for SEQ ID NO.56).

[0199] SEQ ID NO.57: CY5-TCAGCTAATGACAACTCGAGCCTTACTGGCGATATGGTCCAA-P (Since the standard format of the sequence listing attached to this application cannot reflect Cy5 and P, the sequence information described herein shall prevail for SEQ ID NO.57).

[0200] SEQ ID NO.58: CY5-TAATAGTTATGTCATCCCTCTTATTAATCATCATCCTAGCCCTAAGTCT-P (Since the standard format of the sequence listing attached to this application cannot reflect Cy5 and P, the sequence information described herein shall prevail for SEQ ID NO.58).

[0201] The standard substance SIZE used in Examples 1-18 below for determining electrophoretic migration positions has a 5' fluorescent label Alexa fluor 633 and a 3' phosphorylation label. This standard substance for determining electrophoretic migration positions consists of multiple fluorescently labeled nucleic acid sequences, which are mixed with PCR amplification products during electrophoresis pretreatment and serve to indicate the position of nucleic acid probes during electrophoresis. Specific information is shown in SEQ ID NO. 59-61:

[0202] SEQ ID NO. 59: Alexa fluor 633-ATAAGACTCGGCGGTTACTC-P (Because the standard format of the sequence listing attached to this application cannot represent Alexa fluor 633 and P, therefore,

[0203] (SEQ ID NO.59 is subject to the sequence information described herein).

[0204] SEQ ID NO. 60: Alexa fluor 633-AGTGTAAGACTCGGCGGTTTGGTACTTCACACTACACACG-P (Since the standard format of the sequence listing attached to this application cannot represent Alexa fluor 633 and P, the sequence information described herein shall prevail for SEQ ID NO. 60).

[0205] SEQ ID NO. 61: Alexa fluor 633-TCCATCAGGACGGGGAATAACTATCTCCAACGTACATTGGCACTGATTTAGATGGTGACGACCTGTGCCG-P (Since the standard format of the sequence listing attached to this application cannot represent Alexa fluor 633 and P, SEQ ID NO. 61 is based on the sequence information described herein).

[0206] Example 1

[0207] This embodiment illustrates the primer / probe composition and detection method for capillary electrophoresis of the present invention.

[0208] The sequences of the forward primers used in this embodiment are SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3; the sequences of the reverse primers are SEQ ID NO.17, SEQ ID NO.18, and SEQ ID NO.19; and the sequences of the nucleic acid probes are SEQ ID NO.33, SEQ ID NO.34, and SEQ ID NO.35. The fluorescent label used is FAM. The forward primers, reverse primers, and nucleic acid probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0209] 1. Sample collection: The test sample HKU1 used in this embodiment is a plasmid containing the inserted coronavirus HKU1 fragment (purchased from Beijing Qingke Biotechnology Co., Ltd.); sample InfB is a reference material for influenza B virus Victoria lineage (purchased from Guangzhou Starda Biotechnology Co., Ltd.); sample PIV-3 is a reference material for parainfluenza virus type 3 (purchased from Guangzhou Starda Biotechnology Co., Ltd.).

[0210] 2. Sample Pretreatment: Nucleic acid extraction was performed on the samples using a nucleic acid extraction kit (magnetic bead method) (catalog number: RT-A(SG)-200, purchased from Zhongyuan Huiji Biotechnology Co., Ltd.). The extraction steps were performed according to the instructions for the nucleic acid extraction kit (magnetic bead method). Specific procedures are as follows:

[0211] a) Preparation of working solution: Mix 500 μL of extraction reagent I, 4 μL of magnetic bead solution, and 15 μL of proteinase K.

[0212] b) Lysis: Mix the working solution with 200 μL of sample and lyse at 55 °C for 4 min. Adsorb magnetic beads for 1 min, then discard the supernatant;

[0213] c) Add 600 μL of extraction reagent II and mix well. Adsorb magnetic beads for 1 min, then discard the supernatant;

[0214] d) Dissolve nucleic acids in 50 μL of elution buffer at 80 °C. Adsorb magnetic beads for 30 s, and use the supernatant for later use.

[0215] 3. PCR amplification:

[0216] Prepare the PCR reaction system: Mix the buffer (2*qRT-PCR Premix [v7] (with UDG)) thoroughly. Add the forward primer, reverse primer, nucleic acid probe, and template according to the PCR reaction system. Mix well and place in a PCR amplification instrument for PCR amplification.

[0217] Table 1 PCR reaction system

[0218]

[0219]

[0220] Table 2: PCR reaction conditions

[0221]

[0222] 4. Capillary electrophoresis

[0223] Prepare the electrophoresis premix according to the formula in Table 3.

[0224] Table 3: Preparation of Electrophoresis Premix Solution

[0225] reagents Sample volume <![CDATA[Hi-Di TM Formamide]]> 985μL SEQ ID NO.59 (1μM) 5μL SEQ ID NO.60 (1μM) 5μL SEQ ID NO.61 (1μM) 5μL

[0226] The PCR amplification products were prepared according to the formula in Table 4 using Applied Biosystems. TM Electrophoresis was performed at 3500Dx.

[0227] Table 4: Electrophoresis Solution Preparation

[0228] reagents Sample volume Electrophoresis premix 9μL PCR amplification products 1μL

[0229] Table 5: Electrophoresis Parameters

[0230]

[0231] 5. By comparing the fluorescence signal intensity differences between nucleic acid probes that can complementaryly pair with the detected nucleic acid and those that cannot, the presence of the target nucleic acid in the sample can be determined. When the sample is negative, the number of fluorescence signals is consistent with the number of fluorescently labeled nucleic acid probes added to the system, and there is no significant difference in fluorescence signal intensity at different locations. When the sample is positive, the number of fluorescence signals is less than the number of fluorescently labeled nucleic acid probes added to the system, or there is a significant difference in fluorescence signal intensity at different locations. In this case, the disappearance or weakening of the fluorescence signal indicates that the target at that location is positive.

[0232] like Figure 1 As shown, the nucleic acid probes differ in length by 1 nt, and can be distinguished by electrophoresis. When the sample being tested is HKU1, the fluorescence signal peak of the nucleic acid probe corresponding to HKU1 is significantly reduced; when the sample being tested is InfB, the fluorescence signal peak of the nucleic acid probe corresponding to InfB is significantly reduced; when the sample being tested is PIV-3, the fluorescence signal peak of the nucleic acid probe corresponding to PIV-3 is significantly reduced. Existing technologies determine whether a sample contains a target by the presence of a characteristic fluorescence signal peak, while this invention determines whether a sample contains a target by the weakening of a characteristic fluorescence signal peak.

[0233] Example 2

[0234] This embodiment illustrates the primer / probe composition and detection method for capillary electrophoresis of the present invention.

[0235] The sequences of the forward primers used in this embodiment are SEQ ID NO.1, SEQ ID NO.3, and SEQ ID NO.4; the sequences of the reverse primers are SEQ ID NO.17, SEQ ID NO.19, and SEQ ID NO.20; and the sequences of the nucleic acid probes are SEQ ID NO.33, SEQ ID NO.35, and SEQ ID NO.36. The fluorescent label used is FAM. The forward primers, reverse primers, and nucleic acid probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0236] 1. Sample collection: The test sample HKU1 used in this embodiment is a plasmid containing the inserted coronavirus HKU1 fragment (purchased from Beijing Qingke Biotechnology Co., Ltd.); sample PIV-3 is a parainfluenza virus type 3 reference material (purchased from Guangzhou Starda Biotechnology Co., Ltd.); sample InfA is an influenza A virus H1N1 reference material (purchased from Guangzhou Starda Biotechnology Co., Ltd.).

[0237] 2. Sample Pretreatment: Nucleic acid extraction was performed on the samples using a nucleic acid extraction kit (magnetic bead method) (catalog number: RT-A(SG)-200, purchased from Zhongyuan Huiji Biotechnology Co., Ltd.). The extraction steps were performed according to the instructions of the nucleic acid extraction kit (magnetic bead method). The specific operation was the same as in Example 1.

[0238] 3. PCR amplification:

[0239] Prepare the PCR reaction system: Mix the buffer (2*qRT-PCR Premix [v7] (with UDG)) thoroughly. Add the forward primer, reverse primer, nucleic acid probe, and template according to the PCR reaction system. Mix well and place in a PCR amplification instrument for PCR amplification.

[0240] Table 6 PCR Reaction System

[0241]

[0242] Table 7: PCR reaction conditions

[0243]

[0244] 4. Capillary electrophoresis

[0245] Prepare the electrophoresis premix according to the formula in Table 8.

[0246] Table 8: Preparation of Electrophoresis Premix Solution

[0247] reagents Sample volume <![CDATA[Hi-Di TM Formamide]]> 985μL SEQ ID NO.59 (1μM) 5μL SEQ ID NO.60 (1μM) 5μL SEQ ID NO.61 (1μM) 5μL

[0248] The PCR amplification products were prepared according to the formula in Table 9 using Applied Biosystems. TM Electrophoresis was performed at 3500Dx.

[0249] Table 9: Electrophoresis Solution Preparation

[0250] reagents Sample volume Electrophoresis premix 9μL PCR amplification products 1μL

[0251] Table 10: Electrophoresis Parameters

[0252]

[0253] 5. By comparing the fluorescence signal intensity differences between nucleic acid probes that can complementaryly pair with the detected nucleic acid and those that cannot, the presence of the target nucleic acid in the sample can be determined. When the sample is negative, the number of fluorescence signals is consistent with the number of fluorescently labeled nucleic acid probes added to the system, and there is no significant difference in fluorescence signal intensity at different locations. When the sample is positive, the number of fluorescence signals is less than the number of fluorescently labeled nucleic acid probes added to the system, or there is a significant difference in fluorescence signal intensity at different locations. In this case, the disappearance or weakening of the fluorescence signal indicates that the target at that location is positive.

[0254] like Figure 2 As shown, the nucleic acid probes differ in length by 2 nt, and can be distinguished by electrophoresis. When the sample being tested is HKU1, the fluorescence signal peak of the nucleic acid probe corresponding to HKU1 is significantly reduced; when the sample being tested is PIV-3, the fluorescence signal peak of the nucleic acid probe corresponding to PIV-3 is significantly reduced; when the sample being tested is InfA, the fluorescence signal peak of the nucleic acid probe corresponding to InfA is significantly reduced. Compared with existing technologies, which determine whether a sample contains a target by the presence of a characteristic fluorescence signal peak, this invention determines whether a sample contains a target by the weakening of the characteristic fluorescence signal peak.

[0255] Example 3

[0256] This embodiment illustrates the primer / probe composition and detection method for capillary electrophoresis of the present invention.

[0257] The sequences of the forward primers used in this embodiment are SEQ ID NO.2, SEQ ID NO.4, and SEQ ID NO.8; the sequences of the reverse primers are SEQ ID NO.18, SEQ ID NO.20, and SEQ ID NO.24; and the sequences of the nucleic acid probes are SEQ ID NO.34, SEQ ID NO.36, and SEQ ID NO.40. The fluorescent label used is FAM. The forward primers, reverse primers, and nucleic acid probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0258] 1. Sample collection: The test sample InfB used in this embodiment is a reference material for influenza B virus Victoria lineage (purchased from Guangzhou Starda Biotechnology Co., Ltd.); sample InfA is a reference material for influenza A virus H1N1 (purchased from Guangzhou Starda Biotechnology Co., Ltd.); sample ADV-E is a reference material for adenovirus type 4 (purchased from Guangzhou Starda Biotechnology Co., Ltd.).

[0259] 2. Sample Pretreatment: Nucleic acid extraction was performed on the samples using a nucleic acid extraction kit (magnetic bead method) (catalog number: RT-A(SG)-200, purchased from Zhongyuan Huiji Biotechnology Co., Ltd.). The extraction steps were performed according to the instructions of the nucleic acid extraction kit (magnetic bead method). The specific operation was the same as in Example 1.

[0260] 3. PCR amplification:

[0261] Prepare the PCR reaction system: Mix the buffer (2*qRT-PCR Premix [v7] (with UDG)) thoroughly. Add the forward primer, reverse primer, nucleic acid probe, and template according to the PCR reaction system. Mix well and place in a PCR amplification instrument for PCR amplification.

[0262] Table 11 PCR reaction system

[0263]

[0264] Table 12: PCR reaction conditions:

[0265]

[0266] 4. Capillary electrophoresis

[0267] Prepare the electrophoresis premix according to the formula in Table 13.

[0268] Table 13: Preparation of Electrophoresis Premix Solution

[0269] reagents Sample volume <![CDATA[Hi-Di TM Formamide]]> 985μL SEQ ID NO.59 (1μM) 5μL SEQ ID NO.60 (1μM) 5μL SEQ ID NO.61 (1μM) 5μL

[0270] The PCR amplification products were prepared according to the formula in Table 14 using Applied Biosystems.TM Electrophoresis was performed at 3500Dx.

[0271] Table 14: Electrophoresis Solution Preparation

[0272] reagents Sample volume Electrophoresis premix 9μL PCR amplification products 1μL

[0273] Table 15: Electrophoresis Parameters

[0274]

[0275]

[0276] 5. By comparing the fluorescence signal intensity differences between nucleic acid probes that can complementaryly pair with the detected nucleic acid and those that cannot, the presence of the target nucleic acid in the sample can be determined. When the sample is negative, the number of fluorescence signals is consistent with the number of fluorescently labeled nucleic acid probes added to the system, and there is no significant difference in fluorescence signal intensity at different locations. When the sample is positive, the number of fluorescence signals is less than the number of fluorescently labeled nucleic acid probes added to the system, or there is a significant difference in fluorescence signal intensity at different locations. In this case, the disappearance or weakening of the fluorescence signal indicates that the target at that location is positive.

[0277] like Figure 3 As shown, the nucleic acid probes differ in length by 3 nt, and can be distinguished by electrophoresis. When the sample being tested is InfB, the fluorescence signal peak of the nucleic acid probe corresponding to InfB is significantly reduced; when the sample being tested is InfA, the fluorescence signal peak of the nucleic acid probe corresponding to InfA is significantly reduced; and when the sample being tested is ADV-E, the fluorescence signal peak of the nucleic acid probe corresponding to ADV-E is significantly reduced. Compared with existing technologies, which determine whether a sample contains a target by the presence of a characteristic fluorescence signal peak, this invention determines whether a sample contains a target by the weakening of the characteristic fluorescence signal peak.

[0278] Example 4

[0279] This embodiment illustrates the primer / probe composition and detection method for capillary electrophoresis of the present invention.

[0280] The sequences of the forward primers used in this embodiment are SEQ ID NO.6, SEQ ID NO.2, and SEQ ID NO.7; the sequences of the reverse primers are SEQ ID NO.22, SEQ ID NO.18, and SEQ ID NO.23; and the sequences of the nucleic acid probes are SEQ ID NO.38, SEQ ID NO.34, and SEQ ID NO.39. The fluorescent label used is FAM. The forward primers, reverse primers, and nucleic acid probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0281] 1. Sample collection: The SARS-CoV-2 sample used in this embodiment is a plasmid containing a SARS-CoV-2 fragment (purchased from Beijing Qingke Biotechnology Co., Ltd.); the InfB sample is a reference material for the Victoria lineage of influenza B virus (purchased from Guangzhou Starda Biotechnology Co., Ltd.); and the PIV-2 sample is a reference material for parainfluenza virus type 2 (purchased from Guangzhou Starda Biotechnology Co., Ltd.).

[0282] 2. Sample Pretreatment: Nucleic acid extraction was performed on the samples using a nucleic acid extraction kit (magnetic bead method) (catalog number: RT-A(SG)-200, purchased from Zhongyuan Huiji Biotechnology Co., Ltd.). The extraction steps were performed according to the instructions of the nucleic acid extraction kit (magnetic bead method). The specific operation was the same as in Example 1.

[0283] 3. PCR amplification:

[0284] Prepare the PCR reaction system: Mix the buffer (2*qRT-PCR Premix [v7] (with UDG)) thoroughly. Add the forward primer, reverse primer, nucleic acid probe, and template according to the PCR reaction system. Mix well and place in a PCR amplification instrument for PCR amplification.

[0285] Table 16 PCR Reaction System

[0286]

[0287] Table 17: PCR reaction conditions:

[0288]

[0289] 4. Capillary electrophoresis

[0290] Prepare the electrophoresis premix according to the formula in Table 18.

[0291] Table 18: Preparation of Electrophoresis Premix Solution

[0292] reagents Sample volume <![CDATA[Hi-Di TM Formamide]]> 985μL SEQ ID NO.59 (1μM) 5μL SEQ ID NO.60 (1μM) 5μL SEQ ID NO.61 (1μM) 5μL

[0293] The PCR amplification products were prepared according to the formula in Table 19, using Applied Biosystems. TM Electrophoresis was performed at 3500Dx.

[0294] Table 19: Electrophoresis Solution Preparation

[0295] reagents Sample volume Electrophoresis premix 9μL PCR amplification products 1μL

[0296] Table 20: Electrophoresis Parameters

[0297]

[0298] 5. By comparing the fluorescence signal intensity differences between nucleic acid probes that can complementaryly pair with the detected nucleic acid and those that cannot, the presence of the target nucleic acid in the sample can be determined. When the sample is negative, the number of fluorescence signals is consistent with the number of fluorescently labeled nucleic acid probes added to the system, and there is no significant difference in fluorescence signal intensity at different locations. When the sample is positive, the number of fluorescence signals is less than the number of fluorescently labeled nucleic acid probes added to the system, or there is a significant difference in fluorescence signal intensity at different locations. In this case, the disappearance or weakening of the fluorescence signal indicates that the target at that location is positive.

[0299] like Figure 4 As shown, the nucleic acid probes differ in length by 4 nt, and can be distinguished by electrophoresis. When the sample being tested is SARS, the fluorescence signal peak of the nucleic acid probe corresponding to SARS is significantly reduced; when the sample being tested is InfB, the fluorescence signal peak of the nucleic acid probe corresponding to InfB is significantly reduced; when the sample being tested is PIV-2, the fluorescence signal peak of the nucleic acid probe corresponding to PIV-2 is significantly reduced. Compared with existing technologies, which determine whether a sample contains the target by the presence of a characteristic fluorescence signal peak, this invention determines whether a sample contains the target by the weakening of the characteristic fluorescence signal peak.

[0300] Example 5

[0301] This embodiment illustrates the primer / probe composition and detection method for capillary electrophoresis of the present invention.

[0302] The sequences of the forward primers used in this embodiment are SEQ ID NO.6, SEQ ID NO.3, and SEQ ID NO.8; the sequences of the reverse primers are SEQ ID NO.22, SEQ ID NO.19, and SEQ ID NO.24; and the sequences of the nucleic acid probes are SEQ ID NO.38, SEQ ID NO.35, and SEQ ID NO.40. The fluorescent label used is FAM. The forward primers, reverse primers, and nucleic acid probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0303] 1. Sample collection: The SARS-CoV-2 sample used in this embodiment is a plasmid containing a SARS-CoV-2 fragment (purchased from Beijing Qingke Biotechnology Co., Ltd.); the PIV-3 sample is a parainfluenza virus type 3 reference material (purchased from Guangzhou Starda Biotechnology Co., Ltd.); and the ADV-E sample is an adenovirus type 4 reference material (purchased from Guangzhou Starda Biotechnology Co., Ltd.).

[0304] 2. Sample Pretreatment: Nucleic acid extraction was performed on the samples using a nucleic acid extraction kit (magnetic bead method) (catalog number: RT-A(SG)-200, purchased from Zhongyuan Huiji Biotechnology Co., Ltd.). The extraction steps were performed according to the instructions of the nucleic acid extraction kit (magnetic bead method). The specific operation was the same as in Example 1.

[0305] 3. PCR amplification:

[0306] Prepare the PCR reaction system: Mix the buffer (2*qRT-PCR Premix [v7] (with UDG)) thoroughly. Add the forward primer, reverse primer, nucleic acid probe, and template according to the PCR reaction system. Mix well and place in a PCR amplification instrument for PCR amplification.

[0307] Table 21 PCR Reaction System

[0308]

[0309] Table 22: PCR reaction conditions:

[0310]

[0311] 4. Capillary electrophoresis

[0312] Prepare the electrophoresis premix according to the formula in Table 23.

[0313] Table 23: Preparation of Electrophoresis Premix Solution

[0314] reagents Sample volume <![CDATA[Hi-Di TM Formamide]]> 985μL SEQ ID NO.59 (1μM) 5μL SEQ ID NO.60 (1μM) 5μL SEQ ID NO.61 (1μM) 5μL

[0315] The PCR amplification products were prepared according to the formula in Table 24 using Applied Biosystems. TM Electrophoresis was performed at 3500Dx.

[0316] Table 24: Electrophoresis Solution Preparation

[0317]

[0318]

[0319] Table 25: Electrophoresis Parameters

[0320]

[0321] 5. By comparing the fluorescence signal intensity differences between nucleic acid probes that can complementaryly pair with the detected nucleic acid and those that cannot, the presence of the target nucleic acid in the sample can be determined. When the sample is negative, the number of fluorescence signals is consistent with the number of fluorescently labeled nucleic acid probes added to the system, and there is no significant difference in fluorescence signal intensity at different locations. When the sample is positive, the number of fluorescence signals is less than the number of fluorescently labeled nucleic acid probes added to the system, or there is a significant difference in fluorescence signal intensity at different locations. In this case, the disappearance or weakening of the fluorescence signal indicates that the target at that location is positive.

[0322] like Figure 5 As shown, the nucleic acid probes differ in length by 5 nt, and can be distinguished by electrophoresis. When the sample being tested is SARS, the fluorescence signal peak of the nucleic acid probe corresponding to SARS is significantly reduced; when the sample being tested is PIV-3, the fluorescence signal peak of the nucleic acid probe corresponding to PIV-3 is significantly reduced; when the sample being tested is ADV-E, the fluorescence signal peak of the nucleic acid probe corresponding to ADV-E is significantly reduced. Compared with existing technologies, which determine whether a sample contains the target by the presence of a characteristic fluorescence signal peak, this invention determines whether a sample contains the target by the weakening of the characteristic fluorescence signal peak.

[0323] Example 6

[0324] This embodiment illustrates the primer / probe composition and detection method for capillary electrophoresis of the present invention.

[0325] The sequences of the forward primers used in this embodiment are SEQ ID NO.9, SEQ ID NO.2, and SEQ ID NO.8; the sequences of the reverse primers are SEQ ID NO.25, SEQ ID NO.18, and SEQ ID NO.24; and the sequences of the nucleic acid probes are SEQ ID NO.41, SEQ ID NO.34, and SEQ ID NO.40. The fluorescent label used is FAM. The forward primers, reverse primers, and nucleic acid probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0326] 1. Sample collection: The sample MP used in this embodiment is a sample from a patient infected with Mycoplasma pneumoniae; sample InfB is a reference material for influenza B virus Victoria lineage (purchased from Guangzhou Starda Biotechnology Co., Ltd.); sample ADV-E is a reference material for adenovirus type 4 (purchased from Guangzhou Starda Biotechnology Co., Ltd.).

[0327] 2. Sample Pretreatment: Nucleic acid extraction was performed on the samples using a nucleic acid extraction kit (magnetic bead method) (catalog number: RT-A(SG)-200, purchased from Zhongyuan Huiji Biotechnology Co., Ltd.). The extraction steps were performed according to the instructions of the nucleic acid extraction kit (magnetic bead method). The specific operation was the same as in Example 1.

[0328] 3. PCR amplification:

[0329] Prepare the PCR reaction system: Mix the buffer (2*qRT-PCR Premix [v7] (with UDG)) thoroughly. Add the forward primer, reverse primer, nucleic acid probe, and template according to the PCR reaction system. Mix well and place in a PCR amplification instrument for PCR amplification.

[0330] Table 26 PCR Reaction System

[0331]

[0332] Table 27: PCR reaction conditions:

[0333]

[0334] 4. Capillary electrophoresis

[0335] Prepare the electrophoresis premix according to the formula in Table 28.

[0336] Table 28: Preparation of Electrophoresis Premix Solution

[0337] reagents Sample volume <![CDATA[Hi-Di TM Formamide]]> 985μL SEQ ID NO.59 (1μM) 5μL SEQ ID NO.60 (1μM) 5μL SEQ ID NO.61 (1μM) 5μL

[0338] The PCR amplification products were prepared according to the formula in Table 29 using Applied Biosystems. TM Electrophoresis was performed at 3500Dx.

[0339] Table 29: Electrophoresis Solution Preparation

[0340] reagents Sample volume Electrophoresis premix 9μL PCR amplification products 1μL

[0341] Table 30: Electrophoresis Parameters

[0342]

[0343] 5. By comparing the fluorescence signal intensity differences between nucleic acid probes that can complementaryly pair with the detected nucleic acid and those that cannot, the presence of the target nucleic acid in the sample can be determined. When the sample is negative, the number of fluorescence signals is consistent with the number of fluorescently labeled nucleic acid probes added to the system, and there is no significant difference in fluorescence signal intensity at different locations. When the sample is positive, the number of fluorescence signals is less than the number of fluorescently labeled nucleic acid probes added to the system, or there is a significant difference in fluorescence signal intensity at different locations. In this case, the disappearance or weakening of the fluorescence signal indicates that the target at that location is positive.

[0344] like Figure 6 As shown, the nucleic acid probes differ in length by 6 nt, and can be distinguished by electrophoresis. When the sample being tested is MP, the fluorescence signal peak of the nucleic acid probe corresponding to MP is significantly reduced; when the sample being tested is InfB, the fluorescence signal peak of the nucleic acid probe corresponding to InfB is significantly reduced; and when the sample being tested is ADV-E, the fluorescence signal peak of the nucleic acid probe corresponding to ADV-E is significantly reduced. Compared with existing technologies, which determine whether a sample contains a target by the presence of a characteristic fluorescence signal peak, this invention determines whether a sample contains a target by the weakening of the characteristic fluorescence signal peak.

[0345] Example 7

[0346] This embodiment illustrates the primer / probe composition and detection method for capillary electrophoresis of the present invention.

[0347] The sequences of the forward primers used in this embodiment are SEQ ID NO.6, SEQ ID NO.4, and SEQ ID NO.10; the sequences of the reverse primers are SEQ ID NO.22, SEQ ID NO.20, and SEQ ID NO.26; and the sequences of the nucleic acid probes are SEQ ID NO.38, SEQ ID NO.36, and SEQ ID NO.42. The fluorescent label used is FAM. The forward primers, reverse primers, and nucleic acid probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0348] 1. Sample collection: The SARS-CoV-2 sample used in this embodiment is a plasmid containing a SARS-CoV-2 fragment (purchased from Beijing Qingke Biotechnology Co., Ltd.); the InfA sample is a reference material for influenza A virus H1N1 (purchased from Guangzhou Starda Biotechnology Co., Ltd.); and the PIV-4 sample is a reference material for parainfluenza virus type 4 (purchased from Guangzhou Starda Biotechnology Co., Ltd.).

[0349] 2. Sample Pretreatment: Nucleic acid extraction was performed on the samples using a nucleic acid extraction kit (magnetic bead method) (catalog number: RT-A(SG)-200, purchased from Zhongyuan Huiji Biotechnology Co., Ltd.). The extraction steps were performed according to the instructions of the nucleic acid extraction kit (magnetic bead method). The specific operation was the same as in Example 1.

[0350] 3. PCR amplification:

[0351] Prepare the PCR reaction system: Mix the buffer (2*qRT-PCR Premix [v7] (with UDG)) thoroughly. Add the forward primer, reverse primer, nucleic acid probe, and template according to the PCR reaction system. Mix well and place in a PCR amplification instrument for PCR amplification.

[0352] Table 31 PCR Reaction System

[0353]

[0354] Table 32: PCR reaction conditions:

[0355]

[0356] 4. Capillary electrophoresis

[0357] Prepare the electrophoresis premix according to the formula in Table 33.

[0358] Table 33: Preparation of Electrophoresis Premix Solution

[0359] reagents Sample volume <![CDATA[Hi-Di TM Formamide]]> 985μL SEQ ID NO.59 (1μM) 5μL SEQ ID NO.60 (1μM) 5μL SEQ ID NO.61 (1μM) 5μL

[0360] The PCR amplification products were prepared according to the formula in Table 34 using Applied Biosystems. TM Electrophoresis was performed at 3500Dx.

[0361] Table 34: Electrophoresis Solution Preparation

[0362] reagents Sample volume Electrophoresis premix 9μL PCR amplification products 1μL

[0363] Table 35: Electrophoresis Parameters

[0364]

[0365] 5. By comparing the fluorescence signal intensity differences between nucleic acid probes that can complementaryly pair with the detected nucleic acid and those that cannot, the presence of the target nucleic acid in the sample can be determined. When the sample is negative, the number of fluorescence signals is consistent with the number of fluorescently labeled nucleic acid probes added to the system, and there is no significant difference in fluorescence signal intensity at different locations. When the sample is positive, the number of fluorescence signals is less than the number of fluorescently labeled nucleic acid probes added to the system, or there is a significant difference in fluorescence signal intensity at different locations. In this case, the disappearance or weakening of the fluorescence signal indicates that the target at that location is positive.

[0366] like Figure 7 As shown, the nucleic acid probes differ in length by 7 nt, and can be distinguished by electrophoresis. When the sample being tested is SARS, the fluorescence signal peak of the nucleic acid probe corresponding to SARS is significantly reduced; when the sample being tested is InfA, the fluorescence signal peak of the nucleic acid probe corresponding to InfA is significantly reduced; when the sample being tested is PIV-4, the fluorescence signal peak of the nucleic acid probe corresponding to PIV-4 is significantly reduced. Compared with existing technologies, which determine whether a sample contains the target by the presence of a characteristic fluorescence signal peak, this invention determines whether a sample contains the target by the weakening of the characteristic fluorescence signal peak.

[0367] Example 8

[0368] This embodiment illustrates the primer / probe composition and detection method for capillary electrophoresis of the present invention.

[0369] The sequences of the forward primers used in this embodiment are SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.13; the sequences of the reverse primers are SEQ ID NO.22, SEQ ID NO.23, and SEQ ID NO.29; and the sequences of the nucleic acid probes are SEQ ID NO.38, SEQ ID NO.39, and SEQ ID NO.45. The fluorescent label used is FAM. The forward primers, reverse primers, and nucleic acid probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0370] 1. Sample collection: The SARS-CoV-2 sample used in this embodiment is a plasmid containing a SARS-CoV-2 fragment (purchased from Beijing Qingke Biotechnology Co., Ltd.); the PIV-2 sample is a parainfluenza virus type 2 reference material (purchased from Guangzhou Starda Biotechnology Co., Ltd.); and the RSV-A sample is a respiratory syncytial virus type A reference material (purchased from Guangzhou Starda Biotechnology Co., Ltd.).

[0371] 2. Sample Pretreatment: Nucleic acid extraction was performed on the samples using a nucleic acid extraction kit (magnetic bead method) (catalog number: RT-A(SG)-200, purchased from Zhongyuan Huiji Biotechnology Co., Ltd.). The extraction steps were performed according to the instructions of the nucleic acid extraction kit (magnetic bead method). The specific operation was the same as in Example 1.

[0372] 3. PCR amplification:

[0373] Prepare the PCR reaction system: Mix the buffer (2*qRT-PCR Premix [v7] (with UDG)) thoroughly. Add the forward primer, reverse primer, nucleic acid probe, and template according to the PCR reaction system. Mix well and place in a PCR amplification instrument for PCR amplification.

[0374] Table 36 PCR Reaction System

[0375]

[0376] Table 37: PCR reaction conditions:

[0377]

[0378] 4. Capillary electrophoresis

[0379] Prepare the electrophoresis premix according to the formula in Table 38.

[0380] Table 38: Preparation of Electrophoresis Premix Solution

[0381]

[0382]

[0383] The PCR amplification products were prepared according to the formula in Table 39, using Applied Biosystems. TM Electrophoresis was performed at 3500Dx.

[0384] Table 39: Preparation of Electrophoresis Solution

[0385] reagents Sample volume Electrophoresis premix 9μL PCR amplification products 1μL

[0386] Table 40: Electrophoresis Parameters

[0387]

[0388] 5. By comparing the fluorescence signal intensity differences between nucleic acid probes that can complementaryly pair with the detected nucleic acid and those that cannot, the presence of the target nucleic acid in the sample can be determined. When the sample is negative, the number of fluorescence signals is consistent with the number of fluorescently labeled nucleic acid probes added to the system, and there is no significant difference in fluorescence signal intensity at different locations. When the sample is positive, the number of fluorescence signals is less than the number of fluorescently labeled nucleic acid probes added to the system, or there is a significant difference in fluorescence signal intensity at different locations. In this case, the disappearance or weakening of the fluorescence signal indicates that the target at that location is positive.

[0389] like Figure 8 As shown, the nucleic acid probes differ in length by 8 nt, and can be distinguished by electrophoresis. When the sample being tested is SARS, the fluorescence signal peak of the nucleic acid probe corresponding to SARS is significantly reduced; when the sample being tested is PIV-2, the fluorescence signal peak of the nucleic acid probe corresponding to PIV-2 is significantly reduced; and when the sample being tested is RSV-A, the fluorescence signal peak of the nucleic acid probe corresponding to RSV-A is significantly reduced. Compared with existing technologies, which determine whether a sample contains the target by the presence of a characteristic fluorescence signal peak, this invention determines whether a sample contains the target by the weakening of the characteristic fluorescence signal peak.

[0390] Example 9

[0391] This embodiment illustrates the primer / probe composition and detection method for capillary electrophoresis of the present invention.

[0392] The sequences of the forward primers used in this embodiment are SEQ ID NO.9, SEQ ID NO.4, and SEQ ID NO.13; the sequences of the reverse primers are SEQ ID NO.25, SEQ ID NO.20, and SEQ ID NO.29; and the sequences of the nucleic acid probes are SEQ ID NO.41, SEQ ID NO.36, and SEQ ID NO.45. The fluorescent label used is FAM. The forward primers, reverse primers, and nucleic acid probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0393] 1. Sample collection: The sample MP used in this embodiment is a sample from a patient infected with Mycoplasma pneumoniae; sample InfA is a reference material for influenza A virus H1N1 (purchased from Guangzhou Starda Biotechnology Co., Ltd.); sample RSV-A is a reference material for respiratory syncytial virus type A (purchased from Guangzhou Starda Biotechnology Co., Ltd.).

[0394] 2. Sample Pretreatment: Nucleic acid extraction was performed on the samples using a nucleic acid extraction kit (magnetic bead method) (catalog number: RT-A(SG)-200, purchased from Zhongyuan Huiji Biotechnology Co., Ltd.). The extraction steps were performed according to the instructions of the nucleic acid extraction kit (magnetic bead method). The specific operation was the same as in Example 1.

[0395] 3. PCR amplification:

[0396] Prepare the PCR reaction system: Mix the buffer (2*qRT-PCR Premix [v7] (with UDG)) thoroughly. Add the forward primer, reverse primer, nucleic acid probe, and template according to the PCR reaction system. Mix well and place in a PCR amplification instrument for PCR amplification.

[0397] Table 41 PCR Reaction System

[0398]

[0399] Table 42: PCR reaction conditions:

[0400]

[0401] 4. Capillary electrophoresis

[0402] Prepare the electrophoresis premix according to the formula in Table 43.

[0403] Table 43: Preparation of Electrophoresis Premix Solution

[0404]

[0405]

[0406] The PCR amplification products were prepared according to the formula in Table 44 using Applied Biosystems. TM Electrophoresis was performed at 3500Dx.

[0407] Table 44: Preparation of Electrophoresis Solution

[0408] reagents Sample volume Electrophoresis premix 9μL PCR amplification products 1μL

[0409] Table 45: Electrophoresis Parameters

[0410]

[0411] 5. By comparing the fluorescence signal intensity differences between nucleic acid probes that can complementaryly pair with the detected nucleic acid and those that cannot, the presence of the target nucleic acid in the sample can be determined. When the sample is negative, the number of fluorescence signals is consistent with the number of fluorescently labeled nucleic acid probes added to the system, and there is no significant difference in fluorescence signal intensity at different locations. When the sample is positive, the number of fluorescence signals is less than the number of fluorescently labeled nucleic acid probes added to the system, or there is a significant difference in fluorescence signal intensity at different locations. In this case, the disappearance or weakening of the fluorescence signal indicates that the target at that location is positive.

[0412] like Figure 9 As shown, the nucleic acid probes differ in length by 9 nt, and can be distinguished by electrophoresis. When the sample being tested is MP, the fluorescence signal peak of the nucleic acid probe corresponding to MP is significantly reduced; when the sample being tested is InfA, the fluorescence signal peak of the nucleic acid probe corresponding to InfA is significantly reduced; when the sample being tested is RSV-A, the fluorescence signal peak of the nucleic acid probe corresponding to RSV-A is significantly reduced. Compared with existing technologies, which determine whether a sample contains a target by the presence of a characteristic fluorescence signal peak, this invention determines whether a sample contains a target by the weakening of the characteristic fluorescence signal peak.

[0413] Example 10

[0414] This embodiment illustrates the primer / probe composition and detection method for capillary electrophoresis of the present invention.

[0415] The sequences of the forward primers used in this embodiment are SEQ ID NO.1, SEQ ID NO.11, and SEQ ID NO.12; the sequences of the reverse primers are SEQ ID NO.17, SEQ ID NO.27, and SEQ ID NO.28; and the sequences of the nucleic acid probes are SEQ ID NO.33, SEQ ID NO.43, and SEQ ID NO.44. The fluorescent label used is FAM. The forward primers, reverse primers, and nucleic acid probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0416] 1. Sample collection: The test sample HKU1 used in this embodiment is a plasmid with an inserted coronavirus HKU1 fragment (purchased from Beijing Qingke Biotechnology Co., Ltd.); sample ADV-B is an adenovirus type 7 reference (purchased from Guangzhou Starda Biotechnology Co., Ltd.); sample CH is a plasmid with an inserted chlamydia fragment (purchased from Beijing Qingke Biotechnology Co., Ltd.).

[0417] 2. Sample Pretreatment: Nucleic acid extraction was performed on the samples using a nucleic acid extraction kit (magnetic bead method) (catalog number: RT-A(SG)-200, purchased from Zhongyuan Huiji Biotechnology Co., Ltd.). The extraction steps were performed according to the instructions of the nucleic acid extraction kit (magnetic bead method). The specific operation was the same as in Example 1.

[0418] 3. PCR amplification:

[0419] Prepare the PCR reaction system: Mix the buffer (2*qRT-PCR Premix [v7] (with UDG)) thoroughly. Add the forward primer, reverse primer, nucleic acid probe, and template according to the PCR reaction system. Mix well and place in a PCR amplification instrument for PCR amplification.

[0420] Table 46 PCR Reaction System

[0421]

[0422] Table 47: PCR reaction conditions:

[0423]

[0424] 4. Capillary electrophoresis

[0425] Prepare the electrophoresis premix according to the formula in Table 48.

[0426] Table 48: Preparation of Electrophoresis Premix Solution

[0427] reagents Sample volume <![CDATA[Hi-Di TM Formamide]]> 985μL SEQ ID NO.59 (1μM) 5μL SEQ ID NO.60 (1μM) 5μL SEQ ID NO.61 (1μM) 5μL

[0428] The PCR amplification products were prepared according to the formula in Table 49 using Applied Biosystems. TM Electrophoresis was performed at 3500Dx.

[0429] Table 49: Preparation of Electrophoresis Solution

[0430] reagents Sample volume Electrophoresis premix 9μL PCR amplification products 1μL

[0431] Table 50: Electrophoresis Parameters

[0432]

[0433] 5. By comparing the fluorescence signal intensity differences between nucleic acid probes that can complementaryly pair with the detected nucleic acid and those that cannot, the presence of the target nucleic acid in the sample can be determined. When the sample is negative, the number of fluorescence signals is consistent with the number of fluorescently labeled nucleic acid probes added to the system, and there is no significant difference in fluorescence signal intensity at different locations. When the sample is positive, the number of fluorescence signals is less than the number of fluorescently labeled nucleic acid probes added to the system, or there is a significant difference in fluorescence signal intensity at different locations. In this case, the disappearance or weakening of the fluorescence signal indicates that the target at that location is positive.

[0434] like Figure 10 As shown, the nucleic acid probes differ in length by 10 nt, and can be distinguished by electrophoresis. When the sample being tested is HKU1, the fluorescence signal peak of the nucleic acid probe corresponding to HKU1 is significantly reduced; when the sample being tested is ADV-B, the fluorescence signal peak of the nucleic acid probe corresponding to ADV-B is significantly reduced; when the sample being tested is CH, the fluorescence signal peak of the nucleic acid probe corresponding to CH is significantly reduced. Compared with existing technologies, which determine whether a sample contains a target by the presence of a characteristic fluorescence signal peak, this invention determines whether a sample contains a target by the weakening of the characteristic fluorescence signal peak.

[0435] Example 11

[0436] This embodiment illustrates the primer / probe composition and detection method for capillary electrophoresis of the present invention.

[0437] The sequences of the forward primers used in this embodiment are SEQ ID NO.16 and SEQ ID NO.11, the sequences of the reverse primers are SEQ ID NO.32 and SEQ ID NO.27, and the sequences of the nucleic acid probes are SEQ ID NO.46 and SEQ ID NO.43. The fluorescent label used is FAM. The forward primers, reverse primers, and nucleic acid probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0438] 1. Sample collection: The test sample ADV-C used in this embodiment is adenovirus type 2 reference material (purchased from Guangzhou Starda Biotechnology Co., Ltd.); the test sample ADV-B is adenovirus type 7 reference material (purchased from Guangzhou Starda Biotechnology Co., Ltd.).

[0439] 2. Sample Pretreatment: Nucleic acid extraction was performed on the samples using a nucleic acid extraction kit (magnetic bead method) (catalog number: RT-A(SG)-200, purchased from Zhongyuan Huiji Biotechnology Co., Ltd.). The extraction steps were performed according to the instructions of the nucleic acid extraction kit (magnetic bead method). The specific operation was the same as in Example 1.

[0440] 3. PCR amplification:

[0441] Prepare the PCR reaction system: Mix the buffer (2*qRT-PCR Premix [v7] (with UDG)) thoroughly. Add the forward primer, reverse primer, nucleic acid probe, and template according to the PCR reaction system. Mix well and place in a PCR amplification instrument for PCR amplification.

[0442] Table 51 PCR Reaction System

[0443]

[0444] Table 52: PCR reaction conditions:

[0445]

[0446] 4. Capillary electrophoresis

[0447] Prepare the electrophoresis premix according to the formula in Table 53.

[0448] Table 53: Preparation of Electrophoresis Premix Solution

[0449] reagents Sample volume <![CDATA[Hi-Di TM Formamide]]> 985μL SEQ ID NO.59 (1μM) 5μL SEQ ID NO.60 (1μM) 5μL SEQ ID NO.61 (1μM) 5μL

[0450] The PCR amplification products were prepared according to the formula in Table 54 using Applied Biosystems. TM Electrophoresis was performed at 3500Dx.

[0451] Table 54: Electrophoresis Solution Preparation

[0452] reagents Sample volume Electrophoresis premix 9μL PCR amplification products 1μL

[0453] Table 55: Electrophoresis Parameters

[0454]

[0455] 5. By comparing the fluorescence signal intensity differences between nucleic acid probes that can complementaryly pair with the detected nucleic acid and those that cannot, the presence of the target nucleic acid in the sample can be determined. When the sample is negative, the number of fluorescence signals is consistent with the number of fluorescently labeled nucleic acid probes added to the system, and there is no significant difference in fluorescence signal intensity at different locations. When the sample is positive, the number of fluorescence signals is less than the number of fluorescently labeled nucleic acid probes added to the system, or there is a significant difference in fluorescence signal intensity at different locations. In this case, the disappearance or weakening of the fluorescence signal indicates that the target at that location is positive.

[0456] like Figure 11As shown, the nucleic acid probes differ in length by 20 nt, and can be distinguished by electrophoresis. When the sample being tested is ADV-C, the fluorescence signal peak of the corresponding nucleic acid probe is significantly reduced; when the sample being tested is ADV-B, the fluorescence signal peak of the corresponding nucleic acid probe is significantly reduced. Compared with existing technologies, which determine whether a sample contains the target by the presence of a characteristic fluorescence signal peak, this invention determines whether a sample contains the target by the weakening of the characteristic fluorescence signal peak.

[0457] Example 12

[0458] This embodiment illustrates the primer / probe composition and detection method for capillary electrophoresis of the present invention.

[0459] The sequences of the forward primers used in this embodiment are SEQ ID NO.14 and SEQ ID NO.8, the sequences of the reverse primers are SEQ ID NO.30 and SEQ ID NO.24, and the sequences of the nucleic acid probes are SEQ ID NO.47 and SEQ ID NO.48. The fluorescent label used is FAM. The forward primers, reverse primers, and nucleic acid probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0460] 1. Sample collection: The pcDNA sample used in this embodiment is a plasmid with a random inserted fragment (purchased from Beijing Qingke Biotechnology Co., Ltd.); the ADV-E sample is an adenovirus type 4 reference (purchased from Guangzhou Starda Biotechnology Co., Ltd.).

[0461] 2. Sample Pretreatment: Nucleic acid extraction was performed on the samples using a nucleic acid extraction kit (magnetic bead method) (catalog number: RT-A(SG)-200, purchased from Zhongyuan Huiji Biotechnology Co., Ltd.). The extraction steps were performed according to the instructions of the nucleic acid extraction kit (magnetic bead method). The specific operation was the same as in Example 1.

[0462] 3. PCR amplification:

[0463] Prepare the PCR reaction system: Mix the buffer (2*qRT-PCR Premix [v7] (with UDG)) thoroughly. Add the forward primer, reverse primer, nucleic acid probe, and template according to the PCR reaction system. Mix well and place in a PCR amplification instrument for PCR amplification.

[0464] Table 56 PCR Reaction System

[0465]

[0466] Table 57: PCR reaction conditions:

[0467]

[0468] 4. Capillary electrophoresis

[0469] Prepare the electrophoresis premix according to the formula in Table 58.

[0470] Table 58: Preparation of Electrophoresis Premix Solution

[0471] reagents Sample volume <![CDATA[Hi-Di TM Formamide]]> 985μL SEQ ID NO.59 (1μM) 5μL SEQ ID NO.60 (1μM) 5μL SEQ ID NO.61 (1μM) 5μL

[0472] The PCR amplification products were prepared according to the formula in Table 59 using Applied Biosystems. TM Electrophoresis was performed at 3500Dx.

[0473] Table 59: Electrophoresis Solution Preparation

[0474] reagents Sample volume Electrophoresis premix 9μL PCR amplification products 1μL

[0475] Table 60: Electrophoresis Parameters

[0476]

[0477] 5. By comparing the fluorescence signal intensity differences between nucleic acid probes that can complementaryly pair with the detected nucleic acid and those that cannot, the presence of the target nucleic acid in the sample can be determined. When the sample is negative, the number of fluorescence signals is consistent with the number of fluorescently labeled nucleic acid probes added to the system, and there is no significant difference in fluorescence signal intensity at different locations. When the sample is positive, the number of fluorescence signals is less than the number of fluorescently labeled nucleic acid probes added to the system, or there is a significant difference in fluorescence signal intensity at different locations. In this case, the disappearance or weakening of the fluorescence signal indicates that the target at that location is positive.

[0478] like Figure 12 As shown, the nucleic acid probe fluorescently labeled at 3' allows for differentiation via electrophoresis. When the sample is pcDNA, the fluorescence signal peak of the corresponding nucleic acid probe is significantly reduced; when the sample is ADV-E, the fluorescence signal peak of the corresponding nucleic acid probe is significantly reduced. Existing technologies determine whether a sample contains the target by the presence of a characteristic fluorescence signal peak, while this invention determines whether the sample contains the target by the weakening of the characteristic fluorescence signal peak.

[0479] Example 13

[0480] This embodiment illustrates the primer / probe composition and detection method for capillary electrophoresis of the present invention.

[0481] The sequences of the forward primers used in this embodiment are SEQ ID NO.2 and SEQ ID NO.10, the sequences of the reverse primers are SEQ ID NO.18 and SEQ ID NO.26, and the sequences of the nucleic acid probes are SEQ ID NO.51 and SEQ ID NO.52. The fluorescent label used is VIC. The forward primers, reverse primers, and nucleic acid probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0482] 1. Sample collection: The test sample InfB used in this embodiment is a reference material for influenza B virus Victoria lineage (purchased from Guangzhou Starda Biotechnology Co., Ltd.); the sample PIV-4 is a reference material for parainfluenza virus type 4 (purchased from Guangzhou Starda Biotechnology Co., Ltd.).

[0483] 2. Sample Pretreatment: Nucleic acid extraction was performed on the samples using a nucleic acid extraction kit (magnetic bead method) (catalog number: RT-A(SG)-200, purchased from Zhongyuan Huiji Biotechnology Co., Ltd.). The extraction steps were performed according to the instructions of the nucleic acid extraction kit (magnetic bead method). The specific operation was the same as in Example 1.

[0484] 3. PCR amplification:

[0485] Prepare the PCR reaction system: Mix the buffer (2*qRT-PCR Premix [v7] (with UDG)) thoroughly. Add the forward primer, reverse primer, nucleic acid probe, and template according to the PCR reaction system. Mix well and place in a PCR amplification instrument for PCR amplification.

[0486] Table 61 PCR Reaction System

[0487]

[0488] Table 62: PCR reaction conditions:

[0489]

[0490] 4. Capillary electrophoresis

[0491] Prepare the electrophoresis premix according to the formula in Table 63.

[0492] Table 63: Preparation of Electrophoresis Premix Solution

[0493] reagents Sample volume <![CDATA[Hi-Di TM Formamide]]> 985μL SEQ ID NO.59 (1μM) 5μL SEQ ID NO.60 (1μM) 5μL SEQ ID NO.61 (1μM) 5μL

[0494] The PCR amplification products were prepared according to the formula in Table 64 using Applied Biosystems. TM Electrophoresis was performed at 3500Dx.

[0495] Table 64: Preparation of Electrophoresis Solution

[0496] reagents Sample volume Electrophoresis premix 9μL PCR amplification products 1μL

[0497] Table 65: Electrophoresis Parameters

[0498]

[0499] 5. By comparing the fluorescence signal intensity differences between nucleic acid probes that can complementaryly pair with the detected nucleic acid and those that cannot, the presence of the target nucleic acid in the sample can be determined. When the sample is negative, the number of fluorescence signals is consistent with the number of fluorescently labeled nucleic acid probes added to the system, and there is no significant difference in fluorescence signal intensity at different locations. When the sample is positive, the number of fluorescence signals is less than the number of fluorescently labeled nucleic acid probes added to the system, or there is a significant difference in fluorescence signal intensity at different locations. In this case, the disappearance or weakening of the fluorescence signal indicates that the target at that location is positive.

[0500] like Figure 13 As shown, when the nucleic acid probe is VIC, it can be distinguished by electrophoresis. When the sample being tested is InfB, the fluorescence signal peak of the nucleic acid probe corresponding to InfB is significantly reduced; when the sample being tested is PIV-4, the fluorescence signal peak of the nucleic acid probe corresponding to PIV-4 is significantly reduced. Compared with the prior art, which determines whether the sample contains the target by the presence of a characteristic fluorescence signal peak, this invention determines whether the sample contains the target by the weakening of the characteristic fluorescence signal peak.

[0501] Example 14

[0502] This embodiment illustrates the primer / probe composition and detection method for capillary electrophoresis of the present invention.

[0503] The sequences of the forward primers used in this embodiment are SEQ ID NO.10 and SEQ ID NO.15, the sequences of the reverse primers are SEQ ID NO.26 and SEQ ID NO.31, and the sequences of the nucleic acid probes are SEQ ID NO.49 and SEQ ID NO.50. The fluorescent label used is JOE. The forward primers, reverse primers, and nucleic acid probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0504] 1. Sample collection: The test sample PIV-4 used in this embodiment is a parainfluenza virus type 4 reference sample (purchased from Guangzhou Starda Biotechnology Co., Ltd.); the sample GAPDH is a pharyngeal swab sample.

[0505] 2. Sample Pretreatment: Nucleic acid extraction was performed on the samples using a nucleic acid extraction kit (magnetic bead method) (catalog number: RT-A(SG)-200, purchased from Zhongyuan Huiji Biotechnology Co., Ltd.). The extraction steps were performed according to the instructions of the nucleic acid extraction kit (magnetic bead method). The specific operation was the same as in Example 1.

[0506] 3. PCR amplification:

[0507] Prepare the PCR reaction system: Mix the buffer (2*qRT-PCR Premix [v7] (with UDG)) thoroughly. Add the forward primer, reverse primer, nucleic acid probe, and template according to the PCR reaction system. Mix well and place in a PCR amplification instrument for PCR amplification.

[0508] Table 66 PCR Reaction System

[0509]

[0510] Table 67: PCR reaction conditions:

[0511]

[0512] 4. Capillary electrophoresis

[0513] Prepare the electrophoresis premix according to the formula in Table 68.

[0514] Table 68: Preparation of Electrophoresis Premix Solution

[0515] reagents Sample volume <![CDATA[Hi-Di TM Formamide]]> 985μL SEQ ID NO.59 (1μM) 5μL SEQ ID NO.60 (1μM) 5μL SEQ ID NO.61 (1μM) 5μL

[0516] The PCR amplification products were prepared according to the formula in Table 69 using Applied Biosystems. TM Electrophoresis was performed at 3500Dx.

[0517] Table 69: Electrophoresis Solution Preparation

[0518] reagents Sample volume Electrophoresis premix 9μL PCR amplification products 1μL

[0519] Table 70: Electrophoresis Parameters

[0520]

[0521] 5. By comparing the fluorescence signal intensity differences between nucleic acid probes that can complementaryly pair with the detected nucleic acid and those that cannot, the presence of the target nucleic acid in the sample can be determined. When the sample is negative, the number of fluorescence signals is consistent with the number of fluorescently labeled nucleic acid probes added to the system, and there is no significant difference in fluorescence signal intensity at different locations. When the sample is positive, the number of fluorescence signals is less than the number of fluorescently labeled nucleic acid probes added to the system, or there is a significant difference in fluorescence signal intensity at different locations. In this case, the disappearance or weakening of the fluorescence signal indicates that the target at that location is positive.

[0522] like Figure 14 As shown, when the 5' fluorescent label of the nucleic acid probe is JOE and the 3' is a non-complementary nucleotide, the nucleic acid probes can be distinguished by electrophoresis. When the sample being tested is PIV-4, the fluorescence signal peak of the nucleic acid probe corresponding to PIV-4 is significantly reduced; when the sample being tested is GAPDH, the fluorescence signal peak of the nucleic acid probe corresponding to GAPDH is significantly reduced. Compared with existing technologies, which determine whether a sample contains the target by the presence of a characteristic fluorescence signal peak, this invention determines whether a sample contains the target by the weakening of the characteristic fluorescence signal peak.

[0523] Example 15

[0524] This embodiment illustrates the primer / probe composition and detection method for capillary electrophoresis of the present invention.

[0525] The sequences of the forward primers used in this embodiment are SEQ ID NO.2 and SEQ ID NO.14, the sequences of the reverse primers are SEQ ID NO.18 and SEQ ID NO.30, and the sequences of the nucleic acid probes are SEQ ID NO.53 and SEQ ID NO.54. The fluorescent label used is Cy3. The forward primers, reverse primers, and nucleic acid probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0526] 1. Sample collection: The InfB sample used in this embodiment is a reference sample of the Victoria lineage of influenza B virus (purchased from Guangzhou Standa Biotechnology Co., Ltd.); the pcDNA sample is a plasmid with inserted random fragments (purchased from Beijing Qingke Biotechnology Co., Ltd.).

[0527] 2. Sample Pretreatment: Nucleic acid extraction was performed on the samples using a nucleic acid extraction kit (magnetic bead method) (catalog number: RT-A(SG)-200, purchased from Zhongyuan Huiji Biotechnology Co., Ltd.). The extraction steps were performed according to the instructions of the nucleic acid extraction kit (magnetic bead method). The specific operation was the same as in Example 1.

[0528] 3. PCR amplification:

[0529] Prepare the PCR reaction system: Mix the buffer (2*qRT-PCR Premix [v7] (with UDG)) thoroughly. Add the forward primer, reverse primer, nucleic acid probe, and template according to the PCR reaction system. Mix well and place in a PCR amplification instrument for PCR amplification.

[0530] Table 7.1 PCR Reaction System

[0531]

[0532] Table 72: PCR reaction conditions:

[0533]

[0534] 4. Capillary electrophoresis

[0535] Prepare the electrophoresis premix according to the formula in Table 73.

[0536] Table 73: Preparation of Electrophoresis Premix Solution

[0537] reagents Sample volume <![CDATA[Hi-Di TM Formamide]]> 985μL SEQ ID NO.59 (1μM) 5μL SEQ ID NO.60 (1μM) 5μL SEQ ID NO.61 (1μM) 5μL

[0538] The PCR amplification products were prepared according to the formula in Table 74 using Applied Biosystems. TM Electrophoresis was performed at 3500Dx.

[0539] Table 74: Preparation of Electrophoresis Solution

[0540] reagents Sample volume Electrophoresis premix 9μL PCR amplification products 1μL

[0541] Table 75: Electrophoresis Parameters

[0542]

[0543] 5. By comparing the fluorescence signal intensity differences between nucleic acid probes that can complementaryly pair with the detected nucleic acid and those that cannot, the presence of the target nucleic acid in the sample can be determined. When the sample is negative, the number of fluorescence signals is consistent with the number of fluorescently labeled nucleic acid probes added to the system, and there is no significant difference in fluorescence signal intensity at different locations. When the sample is positive, the number of fluorescence signals is less than the number of fluorescently labeled nucleic acid probes added to the system, or there is a significant difference in fluorescence signal intensity at different locations. In this case, the disappearance or weakening of the fluorescence signal indicates that the target at that location is positive.

[0544] like Figure 15As shown, when the nucleic acid probe is fluorescently labeled with Cy3, the nucleic acid probes can be distinguished by electrophoresis. When the sample being tested is InfB, the fluorescence signal peak of the nucleic acid probe corresponding to InfB is significantly reduced; when the sample being tested is pcDNA, the fluorescence signal peak of the nucleic acid probe corresponding to pcDNA is significantly reduced. Compared with the prior art, which determines whether the sample contains the target by the presence of a characteristic fluorescence signal peak, this invention determines whether the sample contains the target by the weakening of the characteristic fluorescence signal peak.

[0545] Example 16

[0546] This embodiment illustrates the primer / probe composition and detection method for capillary electrophoresis of the present invention.

[0547] The sequences of the forward primers used in this embodiment are SEQ ID NO.2 and SEQ ID NO.8, the sequences of the reverse primers are SEQ ID NO.18 and SEQ ID NO.24, and the sequences of the nucleic acid probes are SEQ ID NO.55 and SEQ ID NO.56. The fluorescent label used is ROX. The forward primers, reverse primers, and nucleic acid probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0548] 1. Sample collection: The test sample InfB used in this embodiment is a reference material for influenza B virus Victoria lineage (purchased from Guangzhou Starda Biotechnology Co., Ltd.); the sample ADV-E is a reference material for adenovirus type 4 (purchased from Guangzhou Starda Biotechnology Co., Ltd.).

[0549] 2. Sample Pretreatment: Nucleic acid extraction was performed on the samples using a nucleic acid extraction kit (magnetic bead method) (catalog number: RT-A(SG)-200, purchased from Zhongyuan Huiji Biotechnology Co., Ltd.). The extraction steps were performed according to the instructions of the nucleic acid extraction kit (magnetic bead method). The specific operation was the same as in Example 1.

[0550] 3. PCR amplification:

[0551] Prepare the PCR reaction system: Mix the buffer (2*qRT-PCR Premix [v7] (with UDG)) thoroughly. Add the forward primer, reverse primer, nucleic acid probe, and template according to the PCR reaction system. Mix well and place in a PCR amplification instrument for PCR amplification.

[0552] Table 76 PCR Reaction System

[0553]

[0554] Table 77: PCR reaction conditions:

[0555]

[0556] 4. Capillary electrophoresis

[0557] Prepare the electrophoresis premix according to the formula in Table 78.

[0558] Table 78: Preparation of Electrophoresis Premix Solution

[0559] reagents Sample volume <![CDATA[Hi-Di TM Formamide]]> 985μL SEQ ID NO.59 (1μM) 5μL SEQ ID NO.60 (1μM) 5μL SEQ ID NO.61 (1μM) 5μL

[0560] The PCR amplification products were prepared according to the formula in Table 79 using Applied Biosystems. TM Electrophoresis was performed at 3500Dx.

[0561] Table 79: Electrophoresis Solution Preparation

[0562] reagents Sample volume Electrophoresis premix 9μL PCR amplification products 1μL

[0563] Table 80: Electrophoresis Parameters

[0564]

[0565] 5. By comparing the fluorescence signal intensity differences between nucleic acid probes that can complementaryly pair with the detected nucleic acid and those that cannot, the presence of the target nucleic acid in the sample can be determined. When the sample is negative, the number of fluorescence signals is consistent with the number of fluorescently labeled nucleic acid probes added to the system, and there is no significant difference in fluorescence signal intensity at different locations. When the sample is positive, the number of fluorescence signals is less than the number of fluorescently labeled nucleic acid probes added to the system, or there is a significant difference in fluorescence signal intensity at different locations. In this case, the disappearance or weakening of the fluorescence signal indicates that the target at that location is positive.

[0566] like Figure 16 As shown, when the nucleic acid probe is fluorescently labeled ROX, the nucleic acid probes can be distinguished by electrophoresis. When the sample being tested is InfB, the fluorescence signal peak of the nucleic acid probe corresponding to InfB is significantly reduced; when the sample being tested is ADV-E, the fluorescence signal peak of the nucleic acid probe corresponding to ADV-E is significantly reduced. Compared with the prior art, which determines whether the sample contains the target by the presence of a characteristic fluorescence signal peak, this invention determines whether the sample contains the target by the weakening of the characteristic fluorescence signal peak.

[0567] Example 17

[0568] This embodiment illustrates the primer / probe composition and detection method for capillary electrophoresis of the present invention.

[0569] The sequence of the forward primer used in this embodiment is SEQ ID NO.15, the sequence of the reverse primer is SEQ ID NO.31, and the sequences of the nucleic acid probes are SEQ ID NO.57 and SEQ ID NO.58. The fluorescent label used is Cy5. The forward primer, reverse primer, and nucleic acid probe were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0570] 1. Sample collection: The sample GAPDH was a pharyngeal swab sample (provided by Ningbo Fenghua People's Hospital).

[0571] 2. Sample Pretreatment: Nucleic acid extraction was performed on the samples using a nucleic acid extraction kit (magnetic bead method) (catalog number: RT-A(SG)-200, purchased from Zhongyuan Huiji Biotechnology Co., Ltd.). The extraction steps were performed according to the instructions of the nucleic acid extraction kit (magnetic bead method). The specific operation was the same as in Example 1.

[0572] 3. PCR amplification:

[0573] Prepare the PCR reaction system: Mix the buffer (2*qRT-PCR Premix [v7] (with UDG)) thoroughly. Add the forward primer, reverse primer, nucleic acid probe, and template according to the PCR reaction system. Mix well and place in a PCR amplification instrument for PCR amplification.

[0574] Table 81 PCR Reaction System

[0575]

[0576] Table 82: PCR reaction conditions:

[0577]

[0578] 4. Capillary electrophoresis

[0579] Prepare the electrophoresis premix according to the formula in Table 83.

[0580] Table 83: Preparation of Electrophoresis Premix Solution

[0581]

[0582]

[0583] The PCR amplification products were prepared according to the formula in Table 84, using Applied Biosystems. TM Electrophoresis was performed at 3500Dx.

[0584] Table 84: Preparation of Electrophoresis Solution

[0585] reagents Sample volume Electrophoresis premix 9μL PCR amplification products 1μL

[0586] Table 85: Electrophoresis Parameters

[0587]

[0588] 5. By comparing the fluorescence signal intensity differences between nucleic acid probes that can complementaryly pair with the detected nucleic acid and those that cannot, the presence of the target nucleic acid in the sample can be determined. When the sample is negative, the number of fluorescence signals is consistent with the number of fluorescently labeled nucleic acid probes added to the system, and there is no significant difference in fluorescence signal intensity at different locations. When the sample is positive, the number of fluorescence signals is less than the number of fluorescently labeled nucleic acid probes added to the system, or there is a significant difference in fluorescence signal intensity at different locations. In this case, the disappearance or weakening of the fluorescence signal indicates that the target at that location is positive.

[0589] like Figure 17 As shown, when the nucleic acid probe is fluorescently labeled with Cy5, the nucleic acid probes can be distinguished by electrophoresis. When the sample being tested is GAPDH, the fluorescence signal peak of the corresponding nucleic acid probe for GAPDH is significantly reduced. Compared with existing technologies, which determine whether a sample contains the target by the presence of a characteristic fluorescence signal peak, this invention determines whether a sample contains the target by the weakening of the characteristic fluorescence signal peak.

[0590] Example 18

[0591] This example illustrates the effect of fluorescence signals when probes with different fluorescent labels are electrophoresed simultaneously.

[0592] The nucleic acid probe sequences used in this embodiment are SEQ ID NO.39 and SEQ ID NO.40, which use FAM fluorescent labeling, and SEQ ID NO.51 and SEQ ID NO.52, which use VIC fluorescent labeling. The nucleic acid probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0593] 1. System configuration:

[0594] Preparation system: Mix the buffer (2*qRT-PCR Premix[v7](with UDG)) with the nucleic acid probe and water.

[0595] Table 86 PCR System

[0596]

[0597] 2. Capillary electrophoresis

[0598] Prepare the electrophoresis premix according to the formula in Table 87.

[0599] Table 87: Preparation of Electrophoresis Premix Solution

[0600] reagents Sample volume <![CDATA[Hi-Di TM Formamide]]> 985μL SEQ ID NO.59 (1μM) 5μL SEQ ID NO.60 (1μM) 5μL SEQ ID NO.61 (1μM) 5μL

[0601] Prepare the PCR system according to the formula in Table 88, using Applied Biosystems. TM Electrophoresis was performed at 3500Dx.

[0602] Table 88: Preparation of Electrophoresis Solution

[0603] reagents Sample volume Electrophoresis premix 9μL PCR system 1μL

[0604] Table 75: Electrophoresis Parameters

[0605]

[0606] 3. For example Figure 18 As shown, when probes with different fluorescent labels are electrophoresed simultaneously, the fluorescence signals do not interfere with each other between different detection channels. The FAM fluorescence signal appears only in fluorescence channel 1, and the VIC fluorescence signal appears only in fluorescence channel 2.

[0607] Comparison and summary with existing technologies

[0608] Based on the above-described invention and specific implementation scheme, a comparison is made with the schematic diagram of the capillary electrophoresis detection method of the present invention (…). Figure 19 (A schematic diagram of the detection method in the prior art) Figure 20 The advantages of the capillary electrophoresis detection method of the present invention compared with the prior art detection methods are summarized as follows:

[0609] like Figure 20 As shown, the existing capillary electrophoresis (CE) detection technology has the following defects: 1) It limits the length of the amplified products by separating different target sites by separating different amplification product lengths; 2) When amplification primers are used to carry fluorescent labels, non-specific amplification products affect the interpretation of target signals when the primers first show non-specific amplification; 3) When using excessive primers, saturation annealing peaks will be generated when the concentration of target nucleic acid sequences in the sample is too high, interfering with the interpretation of adjacent target sites.

[0610] like Figure 19 As shown, this invention overcomes the above-mentioned defects by adding fluorescent labeling to the 5' end of the nucleic acid probe: 1) By detecting different target sites by nucleic acid probe, the length of the amplification product is not limited; 2) In the amplification system of this invention, only the nucleic acid probe carries the fluorescent signal, and no additional signal is generated; 3) By using a specific concentration of nucleic acid probe, this invention can effectively prevent the generation of oversaturated fluorescent signals.

[0611] Although the invention has been described to a certain extent, it is apparent that appropriate variations can be made to the various conditions without departing from the spirit and scope of the invention. It is understood that the invention is not limited to the described embodiments, but falls within the scope of the claims, which include equivalent substitutions for each of the elements.

Claims

1. A primer / probe composition for capillary electrophoresis analysis, characterized by, The primer / probe combination comprises: a forward primer; a reverse primer; and a nucleic acid probe carrying a fluorescent label; wherein neither the forward primer nor the reverse primer carries a fluorescent label, and the fluorescent label is preferably located at the 5' end of the nucleic acid probe.

2. The primer / probe combination according to claim 1, wherein: the nucleic acid probe is a set of probes with a nucleotide length difference of 1-100, preferably 1-50, more preferably 1-20, and further preferably 1-10; the forward primer sequence has a nucleotide number of 15-60, preferably 18-40, more preferably 18-30, and further preferably 20-25; the reverse primer sequence has a nucleotide number of 15-60, preferably 18-40, more preferably 19-31, and further preferably 19-26; and / or the fluorescent label is selected from one or more of the following: a fluorescent label with a maximum emission wavelength of 400-525 nm, a fluorescent label with a maximum emission wavelength of 526-560 nm, a fluorescent label with a maximum emission wavelength of 561-580 nm, a fluorescent label with a maximum emission wavelength of 581-620 nm, and a fluorescent label with a maximum emission wavelength of 621-670 nm; wherein: preferably, the fluorescent label with a maximum emission wavelength of 400-525 nm is selected from one or more of the following: Alexa Fluor 405, Alexa Fluor 350, FAM, Alexa Fluor 488, Atto 488, more preferably FAM or Alexa Fluor 488, and most preferably FAM; preferably, the fluorescent label with a maximum emission wavelength of 526-560 nm is selected from one or more of the following: JOE, TET, R6G, VIC, HEX, Alexa Fluor 532, more preferably one or more of the following: JOE, VIC, TET, and further preferably JOE or VIC; preferably, the fluorescent label with a maximum emission wavelength of 561-580 nm is selected from one or more of the following: Cy3, Alexa Fluor 555, NED, Alexa Fluor 546, TAMRA, more preferably Cy3 or NED, and most preferably Cy3; preferably, the fluorescent label with a maximum emission wavelength of 581-620 nm is selected from one or more of the following: ROX, Texas Red, Alexa Fluor 568, Alexa Fluor 594, more preferably ROX or Texas Red, and most preferably ROX; and / or preferably, the fluorescent label with a maximum emission wavelength of 621-670 nm is selected from one or more of the following: Cy5, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, IRDye 700DX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX, IRDye 800CW, IRDye 800RX Preferably, the fluorescent label with a maximum emission wavelength of 621-670 nm is selected from one or more of the following: Cy5, Alexa Fluor 633, Alexa Fluor 647, more preferably Cy5 or Alexa Fluor 647, most preferably Cy5.

3. The primer / probe composition according to claim 1 or 2, characterized in that, The nucleic acid probe is selected from one or more of the following: a DNA probe, an RNA probe, a DNA / RNA chimeric probe, preferably a DNA probe or an RNA probe, most preferably a DNA probe; wherein: The DNA probe is selected from one or more of the following: a conventional DNA probe, a DNA probe comprising locked nucleic acids, a DNA probe comprising inosine, preferably a conventional DNA probe; and / or The RNA probe is selected from one or more of the following: a conventional RNA probe, an RNA probe comprising locked nucleic acids, an RNA probe comprising inosine, preferably a conventional RNA probe; Preferably, the 3' end of the nucleic acid probe further carries a label for inhibiting extension of the nucleic acid probe, which is preferably selected from one or more of the following: a fluorescent label, a phosphate group, a non-complementary nucleotide, a ddNTP, a Spacer modification, more preferably selected from one or more of the following: a phosphate group, a non-complementary nucleotide, a ddNTP, further preferably a phosphate group or a ddNTP.

4. An improved capillary electrophoresis detection method, characterized by, The improved capillary electrophoresis detection method comprises the following steps: 1) using the primer / probe combination for capillary electrophoresis analysis according to any one of claims 1 to 3 to prepare a reaction system; 2) amplifying the reaction system prepared in step 1) by PCR to obtain an amplification product; 3) separating the product amplified in step 2) by capillary electrophoresis.

5. The capillary electrophoresis detection method according to claim 4, characterized by, In step 1), the following steps are included: a) designing and synthesizing a forward primer and a reverse primer, and fluorescently labeling the nucleic acid probe; b) preparing a reaction system with the designed and synthesized forward primer and reverse primer, the fluorescently labeled nucleic acid probe, a reaction buffer, a DNA polymerase, dNTPs, a sample to be tested, and a negative sample.

6. The capillary electrophoresis detection method according to claim 5, characterized by, In step b), the following are included: The negative sample is selected from one or more of the following: purified water, TE buffer, a plasmid sample not containing the target nucleic acid, a microbial isolate, a tissue sample, preferably selected from one or more of the following: purified water, TE buffer, a plasmid sample not containing the target nucleic acid, a microbial isolate, more preferably selected from one or more of the following: purified water, TE buffer, a plasmid sample not containing the target nucleic acid; and / or The reaction buffer is a Tris-hydrochloric acid buffer or a PBS buffer; and the reaction buffer preferably contains a cation, which is preferably selected from one or more of the following: magnesium ions, potassium ions, sodium ions, calcium ions, more preferably magnesium ions or potassium ions.

7. The capillary electrophoresis detection method according to claim 5 or 6, characterized by, In the reaction system prepared in step b), the following are included: The concentration of the forward primer is 50 nM to 5000 nM, preferably 100 nM to 2000 nM, more preferably 100 nM to 300 nM; The concentration of the reverse primer is 50nM-5000nM, preferably 100nM-2000nM, more preferably 100nM-300nM; The concentration of the nucleic acid probe is 5nM-500nM, preferably 5nM-200nM, more preferably 5nM-15nM.

8. The capillary electrophoresis detection method according to any one of claims 5 to 7, characterized by, In the step a): The operation of fluorescently labeling the nucleic acid probe further comprises one or more of: (1) fluorescently labeling the 5' end of the nucleic acid probe while modifying the 3' end of the nucleic acid probe, (2) fluorescently labeling the 5' end of the nucleic acid probe while making the 3' end base of the nucleic acid probe incompletely complementary to the template, and (3) fluorescently labeling the 3' end of the nucleic acid probe.

9. The capillary electrophoresis detection method according to any one of claims 4 to 8, characterized by, The improved capillary electrophoresis detection method further comprises: 4) analyzing and interpreting the target nucleic acid in the sample to be tested by comparing the fluorescence signal intensity of the nucleic acid probe.

10. Use of the primer / probe combination of any one of claims 1-3 in the preparation of a reagent product and / or a detection device for capillary electrophoresis analysis; wherein: The reagent product is preferably a kit; and / or The detection device is preferably a capillary electrophoresis instrument or a DNA sequencer; Preferably, the DNA sequencer is a Sanger sequencer.

Images