Method for detecting viable bacteroides fragilis

Abstract

According to the invention, a specific primer sequence is designed aiming at B. fragilia, and a detection reagent for detecting viable bacteria of B. fragilia, a corresponding detection kit and a detection method are provided. The detection method has strong specificity and high sensitivity, and can accurately quantify viable bacteria. In addition, by means of the detection method, the colonization condition of the B.fragiis in the M-SHIME system can be researched.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a method for detecting live Bacteroides fragilis (B. fragilis). Background Art

[0002] The human intestinal microbial ecosystem simulation system (M-SHIME) was jointly developed by Molly et al. in 1993 (Molly et al., 1993). Since 2010, this name has been jointly registered by ProDigest and Ghent University. The SHIME system generally consists of five interconnected compartments (constant temperature anaerobic containers) that fully simulate the upper digestive tract (stomach, small intestine) and the lower digestive tract (ascending colon, transverse colon and descending colon). The first two tanks follow the batch "fill-draw" principle, and three times a day, a nutrient medium with a defined composition is added to the stomach tank, and pancreatic juice and bile are added to the small intestine tank. The culture medium consists of specific carbohydrates and proteins. The first and second stomach tanks and small intestine tanks are controlled at a constant speed, constant volume, constant pH range, constant temperature, and anaerobic conditions, using a batch culture mode, feeding three times a day, and a digestion time of 4 hours. The three colon tanks behind are cultured in a continuous culture mode under constant speed, constant volume, constant pH range, constant temperature, and anaerobic conditions. Depending on the specific human microbiome of interest, the three colon tanks can control the residence time from 24 to 72 hours by controlling the volume and outflow rate.

[0003] Since the SHIME system was developed in 1993, it has only directly added mucin to the nutrient medium, and there is no system that simulates the mucosa of the human intestine. It belongs to the luminal system (Luminal SHIME, L-SHIME). The mucosal microbiota is part of the intestinal microbial ecosystem, that is, the microbiota that can colonize the mucus layer covering the intestinal epithelium. Because the mucosal microbiota is very close to the host epithelial cells, it is believed to have a stronger ability to regulate intestinal health and thus regulate human health. The development of an intestinal simulator that accurately simulates mucosal microbial colonization is considered to be a major advantage for better understanding the host-microbe interaction group. It is based on this concept that the new generation of Van den Abbeele et al. (2013) at the University of Ghent decided to continue to optimize SHIME by combining microbial membrane carriers (microcosms) covered with mucin agar to simulate mucosal microbial colonization. The main finding of this so-called M-SHIME or mucosal Mucin-SHIME is that the colonization of the mucosal environment is characterized by a higher abundance of Clostridium butyrate-producing IV and XIVa clusters. This phylogenetic group is believed to be the key to delivering butyrate as the main energy source to colon-forming cells and improving intestinal barrier function by strengthening tight junctions. The M-SHIME colon tank simulates the individual's luminal and mucosal microbiota.

[0004] The focus of the system is mainly on the simulation of colonic microbial communities. Since representative microbial inocula cannot be obtained in the human colon area, fecal microbiota is selected as the inoculum for the SHIME colon tank. Because the colon is a plug-flow system, the colonic microbiota undergoes community and metabolic changes during the transportation from the proximal colon to the distal rectum, and finally forms a fecal microbiota. From the perspective of engineering practice, the adaptation time from fecal bacteria back to colonic bacteria is preferably 5 to 10 times its residence time. Taking a male individual with an intestinal residence time of 48 hours as an example, this will require 10 to 20 days of adaptation time after inoculating the fecal microbiota in the colon tank of the SHIME system. Different bacteria have different adaptation times. After inoculation of fecal bacteria, various microbial communities have been changing continuously. High-abundance groups (such as Bacteroidetes) are stable at 10 days, while low-abundance groups such as Lactobacillus require 15 days to reach stability.

[0005] In the study of the human intestinal microbial ecology simulation system (M-SHIME), the quantification of specific microorganisms (especially live bacteria) is one of the key points of the detection project. B. fragilis is a common dominant flora in the human intestine. In order to determine the colonization of B. fragilis during the operation of the M-SHIME system, it is required to quantitatively detect the live B. fragilis in the system. The current detection method is the qPCR absolute quantification method. However, conventional qPCR amplification cannot distinguish the DNA of dead and live bacteria, and the result obtained is the sum of live and dead bacteria. In addition, the Bacteroides bile esculin agar (BBE) plate live bacteria count method is also commonly used to detect live B. fragilis bacteria. However, BBE is actually a Bacteroides-specific culture medium and has no specificity for the growth and culture of B. fragilis. Therefore, it is often used for the separation and purification of Bacteroides microorganisms and the live bacteria count of pure bacteria. The detection of live B. fragilis bacteria in complex samples such as M-SHIME system samples lacks the ability to distinguish other Bacteroides.

[0006] The nucleic acid cross-linking reagent Propidium Monoazide (PMA) is a dead cell-specific dye that can penetrate into dead bacteria with damaged cell membranes and cross-link to DNA after photoactivation. PMA-modified DNA cannot be amplified (this product inhibits the amplification reaction of PCR polymerase). qPCR (Quantitative Real-time PCR) is a method that uses fluorescent chemicals to measure the total amount of products after each polymerase chain reaction (PCR) cycle in a DNA amplification reaction. The present invention establishes a PMA-qPCR detection method to achieve quantitative detection of live B. fragilis bacteria. Summary of the invention

[0007] In view of the above problems, the purpose of the present invention is to provide a method for quantitatively detecting live B. fragilis bacteria, which can not only selectively distinguish dead bacteria from live bacteria, but also quickly and accurately quantitatively detect live B. fragilis bacteria in M-SHIME system samples.

[0008] To this end, the technical solution adopted in the present invention is as follows:

[0009] In a first aspect, the present invention provides a detection reagent, characterized in that the detection reagent comprises an upstream primer, a downstream primer and a probe, and the sequences of the upstream primer, the downstream primer and the probe are as follows:

[0010] Upstream primer: CCTCTTTGCACCGGGTAAAA;

[0011] Downstream primer: CCTGACGGACAATTTCATCGA;

[0012] Probe: FAM-AGCCAACGAAGCACCTCCCGCTATC-BHQ1.

[0013] In a second aspect, the present invention provides a detection kit, which comprises the above-mentioned detection reagent.

[0014] In some embodiments, the kit further comprises auxiliary reagents required for qPCR amplification reaction and propidium bromide azide (PMA).

[0015] In some embodiments, auxiliary reagents include 2×ChamQ Geno-SNP Probe Master Mix, ddH2O.

[0016] In a third aspect, the present invention provides a method for detecting live B. fragilis bacteria, the detection method comprising:

[0017] (I) Propidium azide bromide (PMA) sample pretreatment;

[0018] (II) Performing qPCR detection on live B. fragilis bacteria using the above detection reagent or detection kit.

[0019] In some embodiments, in step (I), the working concentration of PMA is 1 mg / mL to 25 mg / mL, for example 5 mg / mL.

[0020] In some embodiments, step (I) is specifically:

[0021] Take a sample, add PMA; after mixing, treat at room temperature away from light; then expose to light with a halogen lamp.

[0022] In some embodiments, in step (I),

[0023] After adding PMA, the PMA concentration is 1 to 25 μg / mL, preferably 5 μg / mL;

[0024] And / or, the treatment time at room temperature and away from light is 1 min to 10 min, preferably 5 min;

[0025] And / or, perform exposures on ice with constant shaking.

[0026] In some embodiments, step (I) is specifically:

[0027] Take 1 mL of sample and add an appropriate amount of 5 mg / mL PMA solution to make the PMA concentration 5 μg / mL; mix well

[0028] Then, keep the sample away from light at room temperature for 5 min; expose the sample with a 500 W halogen lamp for 5 min, with the vertical distance between the light source and the core tube being 20 cm. During the exposure period, the sample was placed on ice and continuously shaken.

[0029] In some embodiments, step (I) is specifically:

[0030] Take 1 mL of sample and standard solution of different concentrations, add appropriate amount of 5 mg / mL PMA solution to make PMA concentration 1-25 μg / mL (preferably 5 μg / mL), mix well, incubate at room temperature away from light for 1 min-10 min (preferably 5 min) to allow PMA to penetrate the damaged cell membrane and enter the cell, expose with a 500W halogen lamp for 5-10 min (preferably 5 min), and the vertical distance between the light source and the centrifuge tube is 20 cm. During the exposure, place the centrifuge tube on ice and shake it continuously to avoid local overheating and ensure sufficient reaction.

[0031] In some embodiments, step (II) comprises the following steps:

[0032] (i) Extraction of sample DNA;

[0033] (ii) performing qPCR detection on the sample DNA in step (i) using the above detection reagent or detection kit.

[0034] In some embodiments, step (i) is specifically:

[0035] The sample after PMA pretreatment was taken and centrifuged to obtain a precipitate; the precipitate was resuspended in BTL buffer, treated with Proteinase K solution, resuspended in BTL buffer, centrifuged, resuspended in anhydrous ethanol, centrifuged, treated with GBC adsorption column, and treated with TE elution buffer to obtain sample DNA.

[0036] In some embodiments, the GBC adsorption column treatment includes washing with WB buffer and washing with DNA washing buffer.

[0037] In some embodiments, step (i) is specifically:

[0038] (1) taking the sample after PMA pretreatment and centrifuging to obtain a precipitate;

[0039] (2) Add BTL buffer to the precipitate and shake to resuspend;

[0040] (3) Add Proteinase K solution, mix well, and treat in a water bath;

[0041] (4) Add BTL buffer, shake, and let stand;

[0042] (5) Centrifugation and taking the supernatant;

[0043] (6) Add anhydrous ethanol and shake to mix;

[0044] (7) Centrifugation;

[0045] (8) Aspirate the supernatant, add it to the GBC adsorption column, centrifuge, and discard the waste liquid;

[0046] (9) Add WB buffer to the GBC adsorption column, centrifuge, and discard the waste liquid;

[0047] (10) Add DNA washing buffer to the GBC adsorption column, centrifuge, and discard the waste liquid;

[0048] (11) Add DNA washing buffer to the GBC adsorption column again, centrifuge, and discard the waste liquid;

[0049] (12) Centrifuge and discard the waste liquid;

[0050] (13) Transfer the GBC adsorption column into a centrifuge tube, add TE elution buffer to the hanging hole in the middle of the adsorption membrane, leave it at room temperature, centrifuge, and collect the solution into a centrifuge tube to obtain the sample DNA.

[0051] In some embodiments, step (i) is specifically:

[0052] (1) Take 1 mL of PMA pretreated sample or standard solution, centrifuge at 12000 rpm for 3 minutes, and aspirate the supernatant, being careful not to aspirate the sediment at the bottom (about 30 μL left);

[0053] (2) Add 200 μL of Buffer BTL to the pellet and vortex to resuspend;

[0054] (3) Add 20 μL of Proteinase K (20 mg / mL) solution and mix well; place in a 55°C water bath for 10 min until the bacteria are completely dissolved, and shake once every 5 min;

[0055] (4) Add 220 μL Buffer BL, shake for 15 seconds, and place at 70°C for 10 minutes until the solution becomes clear;

[0056] (5) Centrifuge at 12000 rpm for 1 min, transfer the supernatant to a 1.5 mL centrifuge tube, and remove all the solution;

[0057] (6) Add 220 μL of anhydrous ethanol and shake thoroughly for 15 seconds;

[0058] (7) 12000 rpm, brief centrifugation for 30 s;

[0059] (8) Pipette all the solution obtained in the previous step and add it to a GBC adsorption column (the adsorption column is placed in a collection tube), centrifuge at 12000 rpm for 1 minute, discard the waste liquid, and place the GBC adsorption column in the collection tube;

[0060] (9) Add 500 μL Buffer WB to the GBC adsorption column, centrifuge at 12,000 rpm for 1 min, discard the waste liquid, and place the GBC adsorption column in a collection tube;

[0061] (10) Add 600 μL DNA Wash Buffer to the GBC adsorption column, centrifuge at 12000 rpm for 1 min, discard the waste liquid, and place the GBC adsorption column in a collection tube;

[0062] (11) Add 600 μL DNA Wash Buffer to the GBC adsorption column, centrifuge at 12,000 rpm for 1 min, discard the waste liquid, and place the GBC adsorption column in a collection tube;

[0063] (12) Centrifuge at 12000 rpm for 2 minutes and discard the waste liquid to completely dry the residual rinse liquid in the adsorption material;

[0064] (13) Transfer the GBC adsorption column into a clean centrifuge tube, add 100 μL of elution buffer TE to the hanging hole in the middle of the adsorption membrane, leave it at room temperature for 5 minutes, centrifuge it at 12000 rpm for 2 minutes, and collect the solution in a centrifuge tube as a DNA amplification template for subsequent PCR.

[0065] In some embodiments, step (ii) is specifically:

[0066] (a) preparing a qPCR reaction system, including the above-mentioned detection reagent or detection kit and sample DNA;

[0067] (b) Reaction conditions: 95°C for 30 s, 95°C for 10 s, 60°C for 30 s, for a total of 40 cycles;

[0068] (c) After the qPCR reaction, the Ct value was detected and the number of viable B. fragilis cells in the sample was calculated based on the standard curve of the viable cell count of the standard solution.

[0069] In some embodiments, in step (c), establishing a standard curve of the viable bacterial count of the standard solution includes the following steps: establishing a standard curve of a linear equation with the logarithmic value of the viable bacterial count of the standard solution as the horizontal axis (x) and the Ct value as the vertical axis (y).

[0070] In some embodiments, the ratio of the upstream primer, the downstream primer and the probe in step (a) is 1:1:1.

[0071] In some embodiments, step (ii) is specifically:

[0072] (a) The qPCR reaction system was set up as 20 μL, including: 2×ChamQ Geno-SNP Probe Master Mix 10 μL, B fragilis F (10 μM) 0.4 μL, B fragilis R (10 μM) 0.4 μL, B fragilis FB (10 μM) 0.4 μL, ddH2O 6.8 μL, DNA template 2 μL;

[0073] (b) The reaction conditions were set as: 95°C for 30 s, 95°C for 10 s, and 60°C for 30 s, for a total of 40 cycles;

[0074] (c) After the qPCR reaction, the Ct value was detected. According to the viable bacterial count of the standard solution, the logarithmic value of the viable bacterial count of B. fragilis in the standard curve was calculated. The logarithmic value of the bacterial content of the standard solution was used as the horizontal axis (x) and the Ct value was used as the vertical axis (y) to establish a linear equation. The Ct value of the M-SHIME system sample was substituted into the above linear equation to obtain the logarithmic value of the viable bacterial count of B. fragilis in the sample solution, and the viable bacterial count of B. fragilis in the sample was finally calculated according to the dilution multiple of the sample solution.

[0075] In a fourth aspect, the present invention provides the use of the above detection reagent, the above detection kit and the above detection method in the detection of live B. fragilis bacteria.

[0076] Fifth Aspect

[0077] The present invention provides an M-SHIME system, which is used for colonization research of B. fragilis;

[0078] The system includes a digestive system main body, a time control system, a temperature control system, a pH control system, a gas circuit control system and other parts.

[0079] The digestive system consists of five parts: stomach tank, small intestine tank, ascending colon tank, transverse colon tank and descending colon tank, and each digestive tank is connected by a silicone tube;

[0080] The intestinal digestion tank (small intestine tank, ascending colon tank, transverse colon tank and descending colon tank) is a transformation of a 1L quadruple fermentation tank, including a temperature electrode, a pH electrode, a defoaming electrode, a jacket water inlet, an air inlet, a feed port, a sampling tube port, an inoculation port, etc.;

[0081] The stomach tank is an additional tank, which is composed of a 1L blue-capped bottle, a beaker and a magnetic stirrer;

[0082] The stomach tank cover includes an air inlet, a feed inlet and a feed outlet.

[0083] In some embodiments, the stomach can is time-controlled by a timing socket, and the peristaltic pump is turned on within the specified time to pump the nutrient solution and digestive fluid into the corresponding tank of the M-SHIME system; the stomach can does not monitor pH changes; the temperature control system of the stomach can is implemented by a magnetic stirrer.

[0084] In some embodiments, the time control system, pH control system, and temperature control system of the intestinal digestion tanks (small intestine tank, ascending colon tank, transverse colon tank, and descending colon tank) are realized by the control of the quadruple tank's built-in computer system.

[0085] In some embodiments, the gas control system maintains an anaerobic environment in the culture tank by manually aerating binary gas every day.

[0086] In some embodiments, the device further comprises a blue-capped bottle I containing gastric juice and nutrient solution (mixed solution), a blue-capped bottle II containing small intestinal juice, and a blue-capped bottle III containing waste fluid;

[0087] The blue-cap bottle I is connected to the stomach tank and liquid is transferred by a peristaltic pump;

[0088] The blue-cap bottle II is connected to the small intestine tank, and liquid transfer is performed via a peristaltic pump;

[0089] The blue cap bottle III is connected to the descending colon tank.

[0090] In some embodiments, the temperature of the stomach tank, small intestine tank, ascending colon tank, transverse colon tank and descending colon tank is set to 37°C, the stirring speed is 100 rpm, and the pH of the small intestine tank, ascending colon tank, transverse colon tank and descending colon tank is 6.0-7.0, 5.0-6.0, 6.0-6.5 and 6.0-7.0, respectively.

[0091] In some embodiments, human intestinal microorganisms are inoculated into ascending colon tanks, transverse colon tanks, and descending colon tanks and cultured overnight.

[0092] In some embodiments, 200 mL of nutrient solution + 100 mL of gastric juice is pumped into the stomach tank by a peristaltic pump at 6:00, 12:00 and 18:00 every day. After staying in the stomach tank for 4 hours, all the liquid is transferred to the small intestine tank by a peristaltic pump, and 100 mL of small intestinal juice is added. After reacting for 4 hours, it is transferred to the ascending colon tank at a flow rate of 200 mL / h.

[0093] In some embodiments, the ascending colon tank, transverse colon tank, and descending colon tank are connected by silicone tubes, and the volumes are maintained at 500 mL, 800 mL, and 600 mL, respectively, and are transferred at a flow rate of 50 mL / h and finally moved to a waste tank.

[0094] In some embodiments, dual gas is ventilated through the top to maintain pressure balance.

[0095] In some embodiments, the mucin agar-attached microbial film carrier is replaced periodically.

[0096] In some embodiments, the specific operation of inoculating human intestinal microorganisms into the ascending colon tank, the transverse colon tank and the descending colon tank is:

[0097] Collect one sample of feces from a healthy host who has no history of taking antibiotics in the past six months; collect the feces immediately after defecation into a 50mL centrifuge tube and temporarily place it in an anaerobic glove box;

[0098] Take about 40g of fresh feces and divide it into 5 portions. Add 40mL of sterile PBS buffer to each portion of fresh feces, vortex and oscillate to mix evenly, let it stand for 10 minutes, discard the obvious precipitate on the bottom layer, take the upper turbid liquid, centrifuge at 4℃, 1000rpm for 10 minutes, take 50mL of the supernatant and inoculate it into the ascending colon tank, transverse colon tank and descending colon tank.

[0099] In some embodiments, the nutrient solution formula is:

[0100] Arabinogalactan 1g / L, pectin 2g / L, xylan 1g / L, starch 3g / L, anhydrous glucose 0.4g / L, soy peptone 1g / L, yeast extract powder 3g / L, L-cysteine ​​hydrochloride·monohydrate 0.5g / L, sodium bicarbonate 0.4g / L, Tween 80 1g / L, hemin 0.005g / L.

[0101] In some embodiments, the gastric juice formula is: 2 g / L NaCl, 3.2 g / L pepsin and 7 mL of 37% concentrated hydrochloric acid.

[0102] In some embodiments, the small intestinal fluid formula is: 6 g / L bile salts, 0.9 g / L pancreatic enzymes and 12.5 g / L sodium bicarbonate.

[0103] In some embodiments, the pH adjusters are 0.5 M NaOH solution and 0.5 M HCl solution.

[0104] In some embodiments, the specific preparation method of the mucin agar-attached microbial membrane carrier is:

[0105] Add 50 g of gastric mucin and 10 g of technical agar powder to 1000 mL of purified water and boil to obtain mucin agar;

[0106] A string of microbial carriers strung with iron wire (one string for every 20 microbial carriers) is put into the mucin agar, and cooled until the mucin agar powder is slightly solidified, thereby obtaining a microbial film carrier attached to the mucin agar.

[0107] Among them, the above-mentioned nutrient solution, gastric juice and small intestinal juice are placed in a refrigerator at 2-8°C for storage after preparation.

[0108] The sixth aspect

[0109] The present invention provides a method for studying the colonization of B. fragilis using the M-SHIME system, the method comprising:

[0110] After the above system was operated for two weeks, the pH changes in the stomach tank-small intestine tank were used to simulate the feeding and fasting drug administration conditions;

[0111] After eating, a single dose or multiple doses of B. fragilis live bacteria preparation were introduced, and samples were taken daily to detect B. fragilis in the system;

[0112] Use the pH drop of the colon tank to simulate the pathological process;

[0113] The colonization of B. fragilis after administration under normal / pathological conditions was investigated.

[0114] In some embodiments, the pathological condition is 4.6-6.0 for the ascending colon and 5.0-5.6 for the descending colon.

[0115] In some embodiments, the live bacteria preparation is live bacteria powder.

[0116] In some embodiments, the B. fragilis is ZY-312 (deposit number is CGMCC No. 10685).

[0117] In some embodiments, fed and fasted include both pre-meal administration and post-meal administration.

[0118] In some embodiments, a single dose is a single addition of about 1×10 9 CFU / mL B. fragilis live bacteria powder, multiple doses for three consecutive days, twice a day, add about 1×10 9 CFU / mL B. fragilis live bacteria powder.

[0119] In some embodiments, the method further comprises detecting the number of viable B. fragilis in the system sample using the above-mentioned detection reagent, the above-mentioned detection kit or the above-mentioned detection method.

[0120] The present invention introduces a nucleic acid cross-linking reagent, Propidium Monoazide (PMA), which is cross-linked to the DNA of dead bacteria B. fragilis after photoactivation. The DNA of dead bacteria B. fragilis modified by PMA cannot be amplified. After the B. fragilis primer probe labeled with fluorescein is mixed with the template DNA, a thermal cycle of high temperature denaturation, low temperature renaturation, and proper temperature extension is completed, and the polymerase chain reaction rules are followed. The B. fragilis probe complementary to the template DNA is cut off, and the fluorescein is free in the reaction system and emits fluorescence under specific light excitation. As the number of cycles increases, the amplified target gene fragment increases exponentially, and the Ct value is obtained by real-time detection of the corresponding fluorescence signal intensity that changes with amplification. At the same time, several B. fragilis standards with known template concentrations are used as controls to obtain the number of B. fragilis in the M-SHIME system sample.

[0121] The technical effects of the present invention are:

[0122] Compared with other detection methods of target bacteria in intestinal microecological simulation systems, the detection method of the present invention can quantitatively detect the target bacteria.

[0123] (1) The primers have strong specificity. The primer sequences are derived from the glutamine synthetase gene of B. fragilis and the sequences have been optimized. The target gene fragment is 221 bp long. The primers were compared with the nucleic acid database of the NCBI official website (https: / / www.ncbi.nlm.nih.gov / ) using Nucleotide BLAST. The specificity for B. fragilis is nearly 100%, and species other than B. fragilis cannot be amplified.

[0124] (2) High sensitivity, the detection sensitivity reaches about 5×10 3 CFU / μL;

[0125] (3) Live bacteria can be accurately quantified. The PMA of the present invention at an appropriate concentration can penetrate into dead bacteria with damaged cell membranes and modify the DNA of dead cells. The PMA-modified DNA cannot be amplified, and then B. fragilis can be selectively quantified in live bacteria using B. fragilis-specific qPCR primers. BRIEF DESCRIPTION OF THE DRAWINGS

[0126] Figure 1The human intestinal microbial ecological simulation system constructed by the present invention. In the figure, 1-nutrient solution, 2-gastric juice, 3-small intestinal juice, 4-stomach tank, 5-small intestinal tank, 6-ascending colon tank, 7-transverse colon tank, 8-descending colon tank, 9-waste liquid, 10-peristaltic pump, 11-pH electrode, 12-pH adjustment, 13-stirring, 14-temperature electrode.

[0127] Figure 2 This is the pH curve after eating in the human intestinal simulation system.

[0128] Figure 3 This is the qPCR sample standard curve in Example 2.

[0129] Figure 4 This is the qPCR sample standard curve in Example 3.

[0130] Figure 5 This is the qPCR sample standard curve in Example 4. DETAILED DESCRIPTION

[0131] The technical scheme of the present invention will be further described in detail below in conjunction with specific embodiments. It should be understood that the following embodiments are only exemplary descriptions and explanations of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are included in the scope that the present invention is intended to protect.

[0132] Unless otherwise specified, the raw materials and reagents used in the following examples are commercially available or can be prepared by known methods.

[0133] 1L quadruple fermenter: Shanghai Bailun Biotechnology Co., Ltd.

[0134] Propidium azide bromide (PMA): Shanghai Maokang Biotechnology Co., Ltd.

[0135] 2×ChamQ Geno-SNP Probe Master Mix: Nanjing Novogene Biotechnology Co., Ltd.

[0136] Embodiment 1:

[0137] The human intestinal microbial ecological simulation system M-SHIME was constructed to study the colonization of ZY-312 in the human body.

[0138] (1) The gastrointestinal simulation system includes a stomach tank 4, a small intestine tank 5, an ascending colon tank 6, a transverse colon tank 7, and a descending colon tank 8. In addition, there is a blue-capped bottle I containing gastric juice 2 and nutrient solution 1 (mixed solution), a blue-capped bottle II containing small intestinal juice 3, and a blue-capped bottle III containing waste liquid 9. The blue-capped bottle I is connected to the stomach tank and liquid is transferred through a peristaltic pump; the blue-capped bottle II is connected to the small intestine tank and liquid is also transferred through a peristaltic pump 10; the blue-capped bottle III is connected to the descending colon tank. The tanks are connected by silicone tubes. The stomach tank is an additional tank, which includes a 1L blue-capped bottle, a beaker, and a magnetic stirrer. Temperature control is achieved by water bath heating, but the disadvantage is that pH cannot be adjusted. The small intestine tank, the ascending colon tank, the transverse colon tank, and the descending colon tank are four interlayer glass tanks of a 1L quadruple fermentation tank, including a time control system, a temperature control system, a pH control system, and a gas circuit control system. The tanks are provided with a feed port, an air inlet, a sampling port, etc.

[0139] (2) The temperature of the stomach tank, small intestine tank, ascending colon tank, transverse colon tank and descending colon tank was set to 37°C, the stirring speed was set to 100 rpm, and the pH of the small intestine tank, ascending colon tank, transverse colon tank and descending colon tank were set to 6.0-7.0, 5.0-6.0, 6.0-6.5 and 6.0-7.0 respectively. The human intestinal microorganisms were inoculated into the ascending colon tank, transverse colon tank and descending colon tank. The specific inoculation process was to collect one portion of feces from a healthy host with no history of antibiotic use in the past six months. The feces were collected immediately after defecation into a 50 mL centrifuge tube and temporarily placed in an anaerobic glove box. A total of about 40 g of fresh feces was taken and divided into 5 portions. 40 mL of sterile PBS buffer was added to each portion of fresh feces. After vortexing and mixing evenly, it was allowed to stand for 10 minutes, and the obvious precipitation at the bottom was discarded. The upper turbid liquid was taken and centrifuged at 4°C and 1000 rpm for 10 minutes. 50 mL of the supernatant was taken and inoculated into the ascending colon tank, transverse colon tank and descending colon tank. After overnight culture, 200 mL of nutrient solution + 100 mL of gastric juice were pumped into the gastric tank at 6:00, 12:00, and 18:00 every day by a peristaltic pump (the nutrient solution formula was: 1 g / L arabinogalactan, 2 g / L pectin, 1 g / L xylan, 3 g / L starch, 0.4 g / L anhydrous glucose, 1 g / L soy peptone, 3 g / L yeast extract powder, 0.5 g / L L-cysteine ​​hydrochloride monohydrate, 0.4 g / L sodium bicarbonate , Tween 801g / L, hemin chloride 0.005g / L; gastric juice formula is: 2g / L NaCl and 3.2g / L pepsin, and then add 7mL of 37% concentrated hydrochloric acid). After staying in the stomach tank for 4 hours, use a peristaltic pump to transfer all the liquid to the small intestine tank, add 100mL of small intestine liquid (the small intestine liquid formula is 6g / L bile salt, 0.9g / L pancreatic enzyme and 12.5g / L sodium bicarbonate), and transfer to the ascending colon tank at a flow rate of 200mL / h after 4 hours of reaction. The ascending colon tank, transverse colon tank and descending colon tank are connected by silicone tubes, and the volumes are maintained at 500mL, 800mL and 600mL respectively. They are transferred at a flow rate of 50mL / h and finally moved to the waste liquid tank. The top is ventilated continuously to maintain pressure balance. The microbial membrane carrier attached to the mucin agar is replaced regularly.

[0140] (3) After the system has been running for two weeks according to step (2), the pH changes in the stomach tank and small intestine tank are used to simulate the feeding and fasting administration conditions. The ZY-312 in the system is sampled and tested every day. The live bacterial count of single-dose and multiple-dose ZY-312 preparations after feeding is compared. The pH drop in the colon tank is used to simulate the pathological process, and the colonization of ZY-312 administered after feeding in normal / pathological conditions is investigated.

[0141] Example 2: PMA quantitative detection of viable B. fragilis bacteria

[0142] 1. Sample collection and PMA treatment

[0143] Take B. fragilis pure bacterial solution as the standard stock solution, renumber it as T1, and dilute it into standard solutions of different concentrations; take 2 different tubes of B. fragilis pure bacterial solution as the test samples, numbered as ZY-312-A and ZY-312-B. Each test sample is divided into 1mL×6 tubes: 1 tube is used for plate method to measure the number of viable bacteria; the other 2 tubes are heated at 100℃ for 10min to inactivate (as the inactivation control group of plate method and PMA qPCR method respectively); the remaining 3 tubes are used as parallel samples for PMA qPCR quantitative detection.

[0144] Take 1 mL of the sample to be tested and 1 μL of standard solution of different concentrations, add 1 μL of 5 mg / mL PMA solution to each solution to make the PMA concentration 5 μg / mL, mix well, and incubate at room temperature away from light for 5 min to allow PMA to penetrate the damaged cell membrane and enter the cell. Expose the sample with a 500 W halogen lamp for 5 min, with the light source at a vertical distance of 20 cm from the centrifuge tube. During the exposure period, place the centrifuge tube on ice and shake it continuously to avoid local overheating and ensure sufficient reaction.

[0145] 2. DNA extraction of samples to be tested

[0146] (1) Take 1 mL of the PMA-treated sample or standard solution and centrifuge at 12,000 rpm for 3 minutes. Aspirate the supernatant, taking care not to aspirate the precipitate at the bottom (about 30 μL remaining).

[0147] (2) Add 200 μL of Buffer BTL to the pellet and vortex to resuspend.

[0148] (3) Add 20 μL of Proteinase K (20 mg / mL) solution and mix well. Place in a 55°C water bath for 10 min until the bacteria are completely dissolved, and shake once every 5 min.

[0149] (4) Add 220 μL of Buffer BL, shake for 15 seconds, and incubate at 70°C for 10 minutes until the solution becomes clear.

[0150] (5) Centrifuge at 12000 rpm for 1 minute, transfer the supernatant to a 1.5 mL centrifuge tube, and remove all the solution.

[0151] (6) Add 220 μL of anhydrous ethanol and shake thoroughly for 15 seconds until a flocculent precipitate appears.

[0152] (7) Brief centrifugation at 12000 rpm for 30 seconds.

[0153] (8) Pipette all the solution obtained in the previous step and add it to a GBC adsorption column (the adsorption column is placed in a collection tube), centrifuge at 12000 rpm for 1 minute, pour out the waste liquid, and place the GBC adsorption column in the collection tube.

[0154] (9) Add 500 μL of Buffer WB to the GBC adsorption column, centrifuge at 12,000 rpm for 1 min, discard the waste liquid, and place the GBC adsorption column in a collection tube.

[0155] (10) Add 600 μL DNA Wash Buffer to the GBC adsorption column and centrifuge at 12,000 rpm for 1 min. Discard the waste liquid and place the GBC adsorption column in a collection tube.

[0156] (11) Add 600 μL DNA Wash Buffer to the GBC adsorption column, centrifuge at 12,000 rpm for 1 min, discard the waste liquid, and place the GBC adsorption column in a collection tube.

[0157] (12) Centrifuge at 12000 rpm for 2 minutes and discard the waste liquid to completely dry the residual rinse liquid in the adsorption material.

[0158] (13) Transfer the GBC adsorption column into a clean centrifuge tube, add 100 μL of elution buffer TE to the hanging hole in the middle of the adsorption membrane, leave it at room temperature for 5 minutes, centrifuge it at 12000 rpm for 2 minutes, and collect the solution in a centrifuge tube as a DNA amplification template for subsequent PCR.

[0159] 3. qPCR amplification and quantitative detection using B. fragilis primers and probes

[0160] (a) The qPCR reaction system was set up as 20 μL, including: 2×ChamQ Geno-SNP Probe Master Mix 10 μL, B fragilis F (10 μM) 0.4 μL, B fragilis R (10 μM) 0.4 μL, B fragilis FB (10 μM) 0.4 μL, ddH2O 6.8 μL, DNA template 2 μL;

[0161] The qPCR primer sequences were: B fragilis F: CCTCTTTGCACCGGGTAAAA;

[0162] B fragilis R:CCTGACGGACAATTTCATCGA;

[0163] B fragilis FB: FAM-AGCCAACGAAGCACCTCCCGCTATC-BHQ1;

[0164] (b) The reaction conditions were set as: 95°C for 30 s, 95°C for 10 s, and 60°C for 30 s, for a total of 40 cycles;

[0165] (c) After the qPCR reaction is completed, the Ct value is detected. According to the viable bacterial count of the standard solution, the logarithmic value of the viable bacterial count of B. fragilis in the standard curve is calculated, and the logarithmic value of the bacterial content of the corresponding sample is used as the horizontal axis (x), and the Ct value is used as the vertical axis (y) to establish a linear equation. The Ct value of the M-SHIME system sample is substituted into the inverse function of the above linear equation to obtain the logarithmic value of the viable bacterial count of B. fragilis in the sample solution, and the viable bacterial count of B. fragilis in the sample solution is finally calculated according to the dilution multiple of the sample solution and the inverse function of the logarithm (exponential function).

[0166] IV. Experimental Results

[0167] The results of the plate method live bacteria count test were as follows: the live bacteria count of the standard stock solution T1 was 5.0E+09CFU / mL, the live bacteria count of the inactivated control samples was less than 10CFU / mL, the live bacteria count of ZY-312-A was 1.6E+09CFU / mL, and the live bacteria count of ZY-312-B was 1.4E+09CFU / mL.

[0168] According to the bacterial content of the standard solution, the logarithm of the content in the standard curve was calculated, and the logarithm of the bacterial content of the corresponding sample was used as the horizontal axis (x), and the Ct value was used as the vertical axis (y) to establish a linear equation. The linear equation is y = -4.0656x + 52.047, R 2 is 0.9921, see Figure 3 According to the Ct value of each sample and the standard curve, the number of viable bacteria in the samples detected by PMA-qPCR was calculated using the inverse function of the linear equation and the exponential formula, as shown in Table 1.

[0169] The PMA qPCR method was used to measure two B. fragilis pure bacterial culture samples, and the viable bacterial counts were 1.0E+09 CFU / mL and 1.4E+09 CFU / mL, respectively. The PMA method / plate method counting results were 60.32% and 97.17%, respectively, which were within the acceptable range.

[0170] Table 1 PMA qPCR quantification of live B. fragilis cells

[0171]

[0172] Example 3 PMA quantitative detection of B. fragilis viable count

[0173] 1. Sample collection and PMA treatment

[0174] Take B. fragilis pure bacterial solution as the standard stock solution, renumber it as T1, and dilute it into standard solutions of different concentrations; take 2 different tubes of B. fragilis pure bacterial solution as the test samples, numbered as ZY-312-C and ZY-312-D. Each test sample is divided into 1mL×6 tubes: 1 tube is used for plate method to measure the number of viable bacteria; the other 2 tubes are heated at 100℃ for 10min to inactivate (as the inactivation control group of plate method and PMA qPCR method respectively); the remaining 3 tubes are used as parallel samples for PMA qPCR quantitative detection.

[0175] Take 1 mL of the sample to be tested and 1 mL of standard solution of different concentrations, add 5 μL of 5 mg / mL PMA solution to each solution to make the PMA concentration 25 μg / mL, mix well, and place in room temperature away from light for 5 min to allow PMA to penetrate the damaged cell membrane and enter the cell. Expose the sample with a 500W halogen lamp for 10 min, and the vertical distance between the light source and the centrifuge tube is 20 cm. During the exposure period, place the centrifuge tube on ice and shake it continuously to avoid local overheating and ensure sufficient reaction.

[0176] Note: The difference between Example 3 and Example 2 is that the processing conditions after sampling are adjusted: the 5 mg / mL PMA solution is adjusted from 1 μL to 5 μL, so that the PMA concentration is 25 μg / mL; the exposure time of the 500 W halogen lamp is adjusted from 5 min to 10 min.

[0177] 2. DNA extraction of samples to be tested

[0178] DNA was extracted according to the method in Example 2.

[0179] 3. qPCR amplification and quantitative detection using B. fragilis primers and probes

[0180] qPCR amplification and quantitative detection were performed according to the method in Example 2.

[0181] IV. Experimental Results

[0182] The results of the plate method live bacteria count test were as follows: the live bacteria count of the standard stock solution T1 was 2.07E+08CFU / mL, the live bacteria count of the inactivated control samples was less than 10CFU / mL, the live bacteria count of ZY-312-C was 4.5E+07CFU / mL, and the live bacteria count of ZY-312-D was 1.4E+08CFU / mL.

[0183] According to the bacterial content of the standard solution, calculate the logarithm of the content in the standard curve, use the logarithm of the bacterial content of the corresponding sample as the abscissa (x), and the Ct value as the ordinate (y), and establish a linear equation, see Figure 4 The linear equation is y = -3.7953x + 49.824, R 2The number of viable bacteria in the samples detected by PMA-qPCR was calculated based on the Ct value of each sample and the standard curve using the inverse function of the linear equation and the exponential formula, as shown in Table 2.

[0184] The PMA qPCR method was used to measure the viable bacterial counts of two B. fragilis pure bacterial culture samples, which were 3.6E+07 CFU / mL and 1.2E+08 CFU / mL, respectively. The counting results of the PMA method / plate method were 80% and 85.71%, respectively, which were within the acceptable range.

[0185] It is worth noting that in Example 3, a higher working concentration of the PMA solution for treating the sample and a longer exposure time to the halogen lamp were adjusted, but there was no significant difference from the results in Example 2. Therefore, the sample treatment conditions in Example 2 are preferred, namely: 1 μL of a 5 mg / mL PMA solution was added to make the PMA concentration 5 μg / mL, after mixing, the mixture was kept at room temperature away from light for 5 min to allow PMA to penetrate the damaged cell membrane and enter the cell, and then the mixture was exposed to light for 5 min at a 500 W halogen lamp.

[0186] Table 2 PMA qPCR quantification of live B. fragilis cells

[0187]

[0188] Example 4 PMA quantitative detection of viable B. fragilis count in M-SHIME system samples

[0189] 1. Sample collection and PMA treatment

[0190] Take the pure bacterial solution of B. fragilis as the standard stock solution, renumber it as T1, and dilute it into standard solutions of different concentrations (see Table 3); take the fermentation solution of the M-SHIME system and number it as S. In sample S, introduce B. fragilis as the test sample in the system of "1mL standard solution (different concentrations) + 1mL S sample". The test samples and numbers are shown in Table 4. Take 1 tube of T1 tube to measure the number of viable bacteria by plate method, which is used to calculate the number of B. fragilis viable bacteria in standard solutions of different concentrations; take 2 tubes of T2 and heat them at 100℃ for 10min for inactivation treatment (as the inactivation control group of plate method and PMA qPCR method respectively).

[0191] Take 1 mL of the sample to be tested and 1 μL of standard solution of different concentrations, add 1 μL of 5 mg / mL PMA solution to each solution to make the PMA concentration 5 μg / mL, mix well, and incubate at room temperature away from light for 5 min to allow PMA to penetrate the damaged cell membrane and enter the cell. Expose the sample with a 500 W halogen lamp for 5 min, with the light source at a vertical distance of 20 cm from the centrifuge tube. During the exposure period, place the centrifuge tube on ice and shake it continuously to avoid local overheating and ensure sufficient reaction.

[0192] Table 3 Preparation of standard solutions of different concentrations

[0193]

[0194]

[0195] Table 4 Correspondence table of sample numbers to be tested

[0196]

[0197] 2. DNA extraction of samples to be tested

[0198] DNA was extracted according to the method in Example 2.

[0199] 3. qPCR amplification and quantitative detection using B. fragilis primers and probes

[0200] qPCR amplification and quantitative detection were performed according to the method in Example 2.

[0201] IV. Experimental Results

[0202] According to the bacterial content of the standard solution, the logarithm of the content in the standard curve was calculated, and the logarithm of the bacterial content of the corresponding sample was used as the horizontal axis (x), and the Ct value was used as the vertical axis (y) to establish a linear equation. The linear equation is y = -3.3363x + 48.82, R 2 is 0.9912, see Figure 5 According to the Ct value of each sample and the standard curve, the number of viable bacteria in the samples detected by PMA-qPCR was calculated using the inverse function of the linear equation and the exponential formula. The calculation of the number of viable bacteria in the samples detected by PMA-qPCR is shown in Table 5.

[0203] The PMA qPCR method was used to measure the number of viable B. fragilis in the M-SHIME system samples, and the recovery rate was between 51.29% and 82.91%, which was within an acceptable range.

[0204] Table 5 PMA qPCR quantification of live B. fragilis cells

[0205]

[0206] The above is an explanation of the embodiments of the present invention. However, the present invention is not limited to the above embodiments. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A detection reagent, comprising an upstream primer, a downstream primer and a probe, wherein the sequences of the upstream primer, the downstream primer and the probe are as follows: Upstream primer: CCTCTTTGCACCGGGTAAAA; Downstream primer: CCTGACGGACAATTTCATCGA; Probe: FAM-AGCCAACGAAGCACCTCCCGCTATC-BHQ1.

2. A detection kit, comprising the detection reagent according to claim 1; Preferably, the detection kit further comprises auxiliary reagents required for qPCR amplification reaction and propidium azide bromide (PMA).

3. A method for detecting live B. fragilis bacteria, the detection method comprising: (I) Propidium azide bromide (PMA) pretreatment of samples; (II) performing qPCR detection on live B. fragilis bacteria using the detection reagent of claim 1 or the detection kit of claim 2; Preferably, step (I) specifically comprises: taking a sample, adding PMA; mixing, treating at room temperature away from light; and then exposing to light with a halogen lamp.

4. The detection method according to claim 3, characterized in that: In step (I), after adding PMA, the PMA concentration is 1 to 25 μg / mL, preferably 5 μg / mL; And / or, the treatment time at room temperature and away from light is 1 min to 10 min, preferably 5 min; and / or, exposures were performed on ice with constant shaking; Preferably, step (I) specifically comprises: Take 1 mL of sample and add appropriate amount of 5 mg / mL PMA solution to make the PMA concentration 5 μg / mL; after mixing, keep in dark for 5 min at room temperature; expose with a 500 W halogen lamp for 5 min, and the vertical distance between the light source and the heart tube is 20 cm. During the exposure, the sample is placed on ice and shaken continuously.

5. The detection method according to claim 3, characterized in that: Step (II) comprises the following steps: (i) Extraction of sample DNA; (ii) performing qPCR detection on the sample DNA in step (i) using the detection reagent according to claim 1 or the detection kit according to claim 2.

6. The detection method according to claim 5, characterized in that: Step (i) specifically comprises: taking the sample after PMA pretreatment and centrifuging to obtain a precipitate; resuspending the precipitate in BTL buffer, treating with Proteinase K solution, resuspending in BTL buffer, centrifuging, resuspending in anhydrous ethanol, centrifuging, treating with GBC adsorption column, and treating with TE elution buffer to obtain sample DNA.

7. The detection method according to claim 5, characterized in that: Step (ii) is specifically: (a) preparing a qPCR reaction system, comprising using the detection reagent of claim 1 or the detection kit of claim 2 and sample DNA; (b) Reaction conditions: 95°C for 30 s; 95°C for 10 s, 60°C for 30 s, for a total of 40 cycles; (c) After the qPCR reaction is completed, the Ct value is detected, and the number of viable B. fragilis cells in the sample is calculated based on the standard curve of the number of viable cells in the standard solution; Preferably, in step (c), establishing a standard curve of the viable count of the standard solution comprises the following steps: establishing a standard curve of a linear equation with the logarithmic value of the viable count of the standard solution as the abscissa (x) and the Ct value as the ordinate (y); Preferably, in step (a), the ratio of the upstream primer, the downstream primer and the probe is 1:1:

1.

8. Use of the detection reagent according to claim 1, the detection kit according to claim 2, or the detection method according to any one of claims 3 to 7 in the detection of live B. fragilis.

9. A M-SHIME system for colonization studies of B. fragilis; The system includes a digestive system body, a time control system, a temperature control system, a pH control system, and a gas circuit control system; Preferably, the digestive system body includes five parts: a stomach tank, a small intestine tank, an ascending colon tank, a transverse colon tank, and a descending colon tank, and each digestive tank is connected by a silicone tube; Intestinal digestion tanks (small intestine tank, ascending colon tank, transverse colon tank and descending colon tank) include temperature electrode, pH electrode, defoaming electrode, jacket water inlet, air inlet, feed port, sampling tube port, inoculation port, etc.; The gastric tank consists of a blue-capped bottle, a beaker, and a magnetic stirrer.

10. A method for studying the colonization of B. fragilis using the M-SHIME system of claim 9, the method comprising: After the M-SHIME system of claim 9 has been in operation for two weeks, the pH changes in the stomach tank-small intestine tank are used to simulate the feeding and fasting administration conditions; After eating, a single dose or multiple doses of B. fragilis live bacteria preparation is introduced, and samples are taken every day to detect B. fragilis in the system, and the number of live B. fragilis in the system sample is detected using the detection reagent according to claim 1, the detection kit according to claim 2, or the detection method according to any one of claims 3 to 7; The colonization of B. fragilis after administration under normal / pathological conditions was investigated.

Images