A peptide CPP-K4 derived from HNRNPK targeting human pluripotent stem cells and its application

Abstract

The present invention provides a polypeptide CPP-K4 derived from HNRNPK targeting human pluripotent stem cells and its application, belonging to the field of molecular biotechnology. In hPSCs, ESRG can bind to HNRNPK and regulate its stability. Studies have found that ESRG maintains the self-renewal and pluripotency of hPSCs through HNRNPK. Based on this, a polypeptide CPP-K4 derived from HNRNPK is designed and synthesized, which can specifically prevent the binding of ESRG and HNRNPK. The polypeptide CPP-K4 can specifically target the long non-coding RNA-ESRG that is specifically and highly expressed in hPSCs to differentiate hPSCs. This is expected to further reveal the molecular mechanism of ESRG in hPSCs, lay the foundation for clarifying the self-renewal and pluripotency mechanism of hPSCs, achieving the directed differentiation of hPSCs and clinical application, and has important scientific significance and research value.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biotechnology, and in particular relates to a polypeptide CPP-K4 derived from HNRNPK targeting human pluripotent stem cells and applications thereof. Background Art

[0002] Human pluripotent stem cells (hPSCs) possess unlimited self-renewal capacity and can differentiate into all cell types in the human body. hPSCs primarily include human embryonic stem cells (hESCs) and human induced pluripotent stem cells (iPSCs). It is currently believed that hiPSCs (induced pluripotent stem cells) possess properties similar to hESCs (human embryonic stem cells), avoiding the ethical issues associated with establishing hESC lines. Furthermore, individual-specific hiPSCs may prevent immune rejection after transplantation, making hiPSCs promising candidates for the development of ideal "seed cells" for tissue and organ regeneration and repair.

[0003] Exploring the mechanisms of hPSC self-renewal and pluripotency is crucial for understanding human embryonic development and cell differentiation, and forms the basis for the use of hPSCs in cell replacement therapy and tissue engineering. It has been discovered that the maintenance of hPSC self-renewal and pluripotency is regulated by multiple factors, including transcription factors, signaling pathways, epigenetic factors, and the metabolome. However, the mechanisms underlying hPSC self-renewal and pluripotency remain largely unresolved and warrant further exploration.

[0004] The lncRNA ESRG, a gene previously discovered and named by our research team, is unique to humans and primates. It can be used as a marker for detecting early-stage reprogrammed human cells, as well as for identifying undifferentiated hPSCs and residual hPSCs among differentiated cells. The specificity of ESRG expression suggests that it may play a unique role as a novel marker in maintaining the stemness of hPSCs.

[0005] HNRNPK is an RNA-binding protein that regulates mRNA splicing, stability, transcription, and post-translational modification. The protein contains three KH domains (K homology domains), a nuclear localization signal (NLS), a nuclear shuttling domain (KNS), and a K protein interactive region (KI). However, the function of HNRNPK in human pluripotent stem cells (hPSCs) has not been reported to date, worthy of further investigation, especially the biological significance of its binding to ESRG, which is highly expressed in hPSCs. Summary of the Invention

[0006] To address the aforementioned technical issues, the present invention provides a peptide derived from HNRNPK in human pluripotent stem cells, CPP-K4, and its application, which specifically inhibits the binding of ESRG and HNRNPK. This peptide, CPP-K4, can specifically target the long noncoding RNA (ESRG), which is highly expressed in hPSCs, leading to their differentiation.

[0007] To achieve the above objectives, the present invention first provides a polypeptide CPP-K4 derived from HNRNPK targeting human pluripotent stem cells, the amino acid sequence of the polypeptide CPP-K4 is shown in SEQ ID NO.1.

[0008] Based on a general inventive concept, the present invention also provides a use of a polypeptide CPP-K4 derived from HNRNPK targeting human pluripotent stem cells in blocking the binding of ESRG to HNRNPK.

[0009] Based on a general inventive concept, the present invention also provides a use of a polypeptide CPP-K4 derived from HNRNPK targeting human pluripotent stem cells in clearing undifferentiated human pluripotent stem cells remaining in differentiated cells.

[0010] Based on a general inventive concept, the present invention also provides a use of a polypeptide CPP-K4 derived from HNRNPK targeting human pluripotent stem cells in the preparation of an anti-tumor drug.

[0011] Preferably, the tumor is caused by residual undifferentiated human pluripotent stem cells among differentiated cells.

[0012] Preferably, the present invention also provides a method for using a polypeptide CPP-K4 derived from HNRNPK targeting human pluripotent stem cells in transferring ESRG from the nucleus to the cytoplasm.

[0013] The mechanism of treatment of this regimen is as follows:

[0014] Given that a major issue with the use of hPSCs in regenerative medicine is the risk of tumorigenesis caused by the presence of undifferentiated hPSCs in differentiated cells, we have designed a peptide derived from HNRNPK with high specificity and few side effects, taking advantage of the fact that ESRG is specifically and highly expressed only in hPSCs among normal cells or tissues. This peptide blocks the binding of ESRG to HNRNPK and eliminates undifferentiated hPSCs remaining in differentiated cells, effectively preventing the potential tumorigenic risk of hPSC-based therapeutic products. This lays the foundation for the safe application of hPSCs in clinical treatment in the future and has important clinical translational value.

[0015] After the addition of CPP-K4, the localization of ESRG in the cell nucleus decreased and the localization in the cytoplasm increased, blocking part of the binding of ESRG to HNRNPK in the cell nucleus, and part of ESRG was taken out of the cell nucleus.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] (1) Taking advantage of the fact that ESRG is specifically and highly expressed only in hPSCs in normal cells or tissues, a peptide CPP-K4 derived from HNRNPK with good specificity and few side effects was designed to block the binding of ESRG and HNRNPK and eliminate the undifferentiated hPSCs remaining in differentiated cells, effectively preventing the potential tumorigenic risk of hPSCs therapeutic products, laying the foundation for the safe application of hPSCs in clinical treatment in the future, and having important clinical translational value.

[0018] (2) This study further reveals the molecular mechanism of ESRG in hPSCs, laying the foundation for clarifying the self-renewal and pluripotency mechanisms of hPSCs, achieving the directed differentiation of hPSCs and clinical applications, and has important scientific significance and research value. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0020] Figure 1 Figure 1 shows the binding relationship between ESRG and HNRNPK in Experimental Example 1. A shows the specific binding sites of ESRG and HNRNPK predicted by the catRAPID website. B shows the localization of ESRG and HNRNPK observed by RNA-FISH combined with immunofluorescence. C shows WB detection of HNRNPK in RNA pull-down samples, silver staining on gel, and RIP combined with qRT-PCR assay to detect the binding of ESRG and HNRNPK in hPSCs. D shows the structural diagram of HNRNPK protein. E-F show the specific binding regions of ESRG and HNRNPK in 293T cell lines detected by RIP combined with qRT-PCR assay and RNA pull-down assay, respectively. G-H show the binding of ESRG to K4 of HNRNPK in 293T cell lines detected by RIP combined with qRT-PCR assay and RNA pull-down assay, respectively. * indicates P < 0.05, *** indicates P < 0.001, Bar = 100 μm.

[0021] Figure 2 Figure 1 shows the binding relationship between ESRG and HNRNPK in Experimental Example 1. A shows the expression of stemness factors after knocking down the expression of HNRNPK in H9 cells. B shows the morphology of hPSCs H9 cells after HNRNPK knockdown. C shows the expression of stemness factors after overexpressing HNRNPK in H9 cells. D shows the AP activity of H9 cells after knocking down HNRNPK by AP staining. E shows the proliferation of H9 cells after knocking down HNRNPK by CCK8. F shows the apoptosis level of H9 cells after knocking down HNRNPK by flow cytometry. G shows the expression of endoderm, mesoderm, and ectoderm markers after knocking down HNRNPK in H9 cells by qRT-PCR. ** indicates P < 0.01, and *** indicates P < 0.001.

[0022] Figure 3 Figure 1 shows the binding relationship between ESRG and HNRNPK in Experimental Example 1. A shows the expression of stemness factors detected after knocking down HNRNPK in RC1 cells. B shows the morphology of hPSCs RC1 cells after HNRNPK knockdown. Bar = 100 μm. C shows the expression of stemness factors detected after overexpressing HNRNPK in RC1 cells. D shows the AP activity of RC1 cells detected after knocking down HNRNPK. Bar = 100 μm. E shows the proliferation of RC1 cells detected by CCK8 after knocking down HNRNPK. ** indicates P < 0.01, and *** indicates P < 0.001.

[0023] Figure 4 The binding relationship between ESRG and HNRNPK in Experimental Example 1, A is the protein level of HNRNPK detected by WB after knocking down / overexpressing ESRG in H9 and RC1 cells, B is the protein level of HNRNPK detected by WB after incubation of H9 and RC1 cells with CHX (20 μg / ml) for different time periods (siControl vs siESRG), C is the protein level of H9 and RC1 cells incubated with MG132 (20 μM) (siControl vs The protein level of HNRNPK was detected by WB 4 hours after siESRG. D: After H9 and RC1 cells were incubated with MG132 (20 μM), immunoprecipitation experiments were performed using HNRNPK antibodies, and the precipitated complex was detected by Ub antibody. E: The ubiquitin ligase RNF8 that interacts with HNRNPK was found using the Biogrid database. F: After H9 and RC1 cells were knocked down with siRNARNF8 and siRNAESRG, HNRNPK protein expression was detected by WB. G: After H9 and RC1 cells were treated with siControl or siESRG, the interaction between HNRNPK and RNF8 was detected by Co-IP.

[0024] Figure 5In Experimental Example 2, ESRG maintains hPSCs self-renewal and pluripotency by binding to HNRNPK. A shows the protein levels of stemness factors and AKT-related pathway proteins detected by Western blotting after ESRG knockdown and HNRNPK overexpression in H9 and RC1 cells. B shows the cell morphology and growth observed after ESRG knockdown and HNRNPK overexpression in H9 and RC1 cells. C shows the AP activity detected after ESRG knockdown and HNRNPK overexpression in H9 and RC1 cells. D shows the apoptosis rate of cells detected by flow cytometry after ESRG knockdown and HNRNPK overexpression in H9 and RC1 cells. E shows the DNA damage detected by comet assay after ESRG knockdown and HNRNPK overexpression in H9 and RC1 cells. Olive Tail Moment represents the olive tail moment, which calculates the distance between the center of the "comet head" and the center of the "comet tail". ** indicates P < 0.01, *** indicates P < 0.001. Bar = 100 μm.

[0025] Figure 6 The polypeptide CPP-K4 blocks the ESRG-HNENPK interaction in Experimental Example 4. A shows the morphology of H9 cells after the addition of the HNRNPK-derived peptide K4. B shows the AP activity detected in H9 cells after the addition of the HNRNPK-derived peptide K4. Bar = 100 μm. C shows the protein expression of stemness factors in H9 cells after the addition of the HNRNPK-derived peptide K4. D shows the localization of the HNRNPK-derived peptide K4 and ESRG in H9 cells detected simultaneously by RNA-FISH and immunofluorescence techniques. Bar = 100 μm. DETAILED DESCRIPTION

[0026] In order to make the technical problems, technical solutions and advantages to be solved by the present invention clearer, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.

[0027] The following examples are provided to illustrate the present invention but are not intended to limit the scope of the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the methods, steps or conditions of the present invention are within the scope of the present invention.

[0028] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art; unless otherwise specified, the reagents used in the examples are commercially available.

[0029] Experimental Example 1

[0030] The binding relationship between ESRG and HNRNPK was investigated.

[0031] The catRAPID website was used to predict whether ESRG binds to HNRNPK. catRAPID mainly uses the secondary structure and hydrogen bonds of RNA and protein to predict the possibility of RNA-protein binding.

[0032] Figure 1 A prediction result shows that ESRG and HNRNPK bind to each other (the red grid indicates the binding location, and the darker the color, the stronger the binding ability). To better understand the molecular mechanism of ESRG binding to HNRNPK in hPSCs, RNA-FISH technology combined with immunofluorescence experiments were used to detect the subcellular localization of ESRG and HNRNPK proteins in hPSCs H9 cells. The results showed that ESRG RNA and HNRNPK protein were co-localized in the cell nucleus ( Figure 1 B); RNA pull-down and RIP confirmed that ESRG and HNRNPK can bind to each other in hPSCs (H9 cells and RC1 cells) ( Figure 1 C), draw the schematic diagram of the structure of HNRNPK protein ( Figure 1 D), which mainly contains three KH domains, a nuclear localization signal, a signal site that promotes HNRNPK nuclear shuttling, and a KI domain. It is currently known that the KH1 domain can bind to DNA and RNA, while KH2 and KH3 can only bind to RNA. HNRNPK is divided into three truncations based on the distribution of domains and tagged with Flag, namely K1, K2, and K3. These three truncations and ESRG were transfected into 293T cells for RIP and RNA pull-down experiments, and it was found that ESRG bound to the K3 truncations of HNRNPK ( Figure 1 EF). It was found that the K3 truncation of HNRNPK contained an RGG domain, which was further transformed into the truncation K4, and it was found that ESRG bound to it ( Figure 1 GH):

[0033] Flag tag: 5′-GACTACAAAGACGATGACGACAAG-3′; (SEQ ID NO. 2)

[0034] K1:

[0035] 5′-GCTAGCGCCACCATGGACTACAAAGACGATGACGACAAGGAAACTGAACAG CCAGAAGAAACCTTCCCTAACACTGAAACCAATGGTGAATTTGGTAAACGCCCTGCAGAAGATATGGAAGAGGAACAAGCATTTAAAAGATCTAGAAACACTGATGAGATGGTTGAATTACGCATTCTGCTTCAGAGCAAGAATGCTGGGGCAGTGATTGGAAAAGGAGGCAAGAATATTAAGGCTCTCCGTACAGACTACAATGCCAGTGTTTCAGTCCCAGACAGCAGTGGCCCCGAGCGCATATTGAGTATCAGTGCTGATATTGAAACAATTGGAGAAATTCTGAAGAAAATCATCTAAGGTACC-3′;(SEQID NO.3)

[0036] K2:

[0037] 5′-GCTAGCGCCACCATGGACTACAAAGACGATGACGACAAGCCTACCTTGGAAGAGG GCCTGCAGTTGCCATCACCCACTGCAACCAGCCAGCTCCCGCTCGAATCTGATGCTGTGGAATGCTTAAATTACCAACACTATAAAGGAAGTGACTTTGACTGCGAGTTGAGGCTGTTGATTCATCAGAGTCTAGCAGGAGGAATTATTGGGGTCAAAGGTGCTAAAATCAAAGAACTTCGAGAGAACACTCAAACCACCATCAAGCTTTTCCAGGAATGCTGTCCTCATTCCACTGACAGAGTTGTTCTTATTGGAGGAAAACCCGATAGGGTTGTAGAGTGCATAAAGATCATCCTTTAAGGTACC-3′;(SEQ ID NO.4)

[0038] K3:

[0039] 5′-GCTAGCGCCACCATGGACTACAAAGACGATGACGACAAGGATCTTATATCTGAGTC TCCCATCAAAGGACGTGCACAGCCTTATGATCCCAATTTTTACGATGAAACCTATGATTATGGTGGTTTTACAATGATGTTTGATGACCGTCGCGGACGCCCAGTGGGATTTCCCATGCGGGGAAGAGGTGGTTTTGACAGAATGCCTCCTGGTCGGGGTGGGCGTCCCATGCCTCCATCTAGAAGAGATTATGATGATATGAGCCCTCGTCGAGGACCACCTCCCCCTCCTCCCGGACGAGGCGGCCGGGGTGGTAGCAGAGCTCGGAATCTTCCTCTTCCTCCACCACCACCACCTAGAGGGGGAGACCTCATGGCCTATGACAGAAGAGGGAGACCTGGAGACCGTTACGACGG CATGGTTGGTTTCAGTGCTGATGAAACTTGGGACTCTGCAATAGATACATGGAGCCCATCAGAATGGCAGATGGCTTATGAACCACAGGGTGGCTCCGGATATGATTATTCCTATGCAGGGGGTCGTGGCTCATATGGTGATCTTGGTGGACCTATTATTACTACACAAGTAACTATTCCCAAAGATTTGGCTGGATCTATTATTGGCAAAGGTGGTCAGCGGATTAAACAAATCCGTCATGAGTCGGGAGCTTCGATCAAAATTGATGAGCCTTTAGAAGGATCCGAAGATCGGATCATTACCATTACAGGAACACAGGACCAGATACAGAATGCACAGTATTTGCTGCAGAACAGTGTGAAGCAGTATTCTGGAAAGTTTTTCTAAGGTACC-3′;(SEQ ID NO.5)

[0040] K4:

[0041] 5′-GCTAGCGCCACCATGGACTACAAAGACGATGACGACAAGATGTTTGATGACCGTCG CGGACGCCCAGTGGGATTTCCCATGCGGGGAAGAGGTGGTTTTGACAGAATGCCTCCTG GTCGGGGTGGGTAAGGTACC-3′; (SEQ ID NO. 6)

[0042] Two siHNRNPK sequences were designed and synthesized, namely siHNRNPK-1 and siHNRNPK-2:

[0043] siHNRNPK-1: 5'-CGTTATTGTTGGTGGTTTAAA-3' (SEQ ID NO.7)

[0044] siHNRNPK-2: 5'-TGATGTTTGATGACCGTCGCG-3' (SEQ ID NO.8)

[0045] WB results showed that the interference efficiency of siHNRNPK-1 in hPSCs H9 was higher than that of siHNRNPK-2, and the knockdown efficiency exceeded 80%, and the protein levels of stemness factors OCT4 and SOX2 decreased ( Figure 2 A), cells change from tightly packed to sparsely packed ( Figure 2 B). After overexpression of HNRNPK, SOX2 and OCT4 were significantly upregulated ( Figure 2 C). Figure 2 D The results showed that compared with the control group, after knocking down HNRNPK, the enzyme activity of AP decreased and the stemness of cells decreased. CCK8 assay found that after knocking down HNRNPK in hPSCs H9, the cell proliferation ability was significantly reduced ( Figure 2 E). After knocking down HNRNPK, flow cytometry analysis revealed that the level of cell apoptosis increased significantly ( Figure 2 F). qRT-PCR analysis showed that after knockdown of HNRNPK, the expression of endoderm (OPN, GATA4), mesoderm (GATA2, HAND1), and ectoderm (PAX6, OTX2) markers in hPSCs H9 cells was significantly upregulated ( Figure 2 G). In addition, the same experimental results as those in hPSCs H9 were obtained after knocking down cells using siHNRNPK-1 in hPSCs RC1 (see Figure 3 The results of HNRNPK interference are basically consistent with the previous results of ESRG interference, suggesting that HNRNPK, like ESRG, plays an important role in maintaining the self-renewal and pluripotency of hPSCs.

[0046] We further found that after knocking down ESRG in H9 and RC1 cells, the protein level of HNRNPK decreased significantly. After overexpression of ESRG, the protein level of HNRNPK increased ( Figure 4 A), we speculate that ESRG affects the stability of HNRNPK in hPSCs. H9 and RC1 cells were treated with cycloheximide (CHX) respectively (siControl vs siESRG), and cells were collected at 0, 3, 6, and 9 hours and protein was extracted for WB detection. The results showed that compared with the siControl group, the protein degradation rate of HNRNPK in the siESRG group was faster ( Figure 4 B). ESRG knockdown H9 cells were further treated with 20 μM proteasome inhibitor MG132. WB results showed that the HNRNPK protein level in the MG132-treated group was significantly restored, comparable to the HNRNPK protein level in the ESRG-uninterrupted group ( Figure 4 C).

[0047] Co-IP experiments showed that polyubiquitination chains formed near the HNRNPK band after ESRG knockdown ( Figure 4 D). The above results suggest that ESRG may stabilize HNRNPK protein levels by protecting it from proteasome degradation. We found in the Biogrid database that HNRNPK can bind to the ubiquitin ligase RNF8 ( Figure 4 E), we therefore speculated that RNF8 might bind to HNRNPK and participate in the maintenance of HNRNPK protein stability by ESRG. To verify this hypothesis, ESRG and RNF8 were simultaneously interfered with in hPSCs H9 and RC1 cells. WB results showed that siRNF8 could restore the decrease in HNRNPK protein levels induced by siESRG ( Figure 4 F). Co-IP results showed that the binding between HNRNPK and RNF8 was enhanced after knockdown of ESRG ( Figure 4 G) The above experimental results can be concluded that ESRG maintains the protein level of HNRNPK in hPSCs H9 and RC1 cells by interfering with the ubiquitin ligase RNF8

[0048] Experimental Example 2

[0049] The aim of this study was to investigate the role of ESRG in maintaining the self-renewal and pluripotency of hPSCs by binding to HNRNPK.

[0050] A HNRNPK restoration experiment was conducted: knocking down ESRG while overexpressing HNRNPK restored HNRNPK expression levels. WB analysis showed that knocking down ESRG while overexpressing HNRNPK in hPSCs H9 and RC1 cells restored HNRNPK levels in the cells. At the same time, the protein levels of stemness factors OCT4 and SOX2 were also restored, AKT expression was upregulated, and p-AKT (S473) was activated ( Figure 5 A), and the cell morphology and AP activity were partially restored ( Figure 5 BC). Flow cytometry revealed that knocking down ESRG and simultaneously overexpressing HNRNPK in hPSCs H9 and RC1 cells could reduce the level of cell apoptosis ( Figure 5 D). Comet assay showed that knocking down ESRG and overexpressing HNRNPK in hPSCs H9 and RC1 cells reduced DNA damage ( Figure 5 E). The above results further confirmed the hypothesis that ESRG may play a role through HNRNPK.

[0051] Experimental Example 3

[0052] The peptide CPP-K4 was designed and synthesized.

[0053] Given that an important issue in the use of hPSCs for regenerative medicine is the risk of tumorigenesis caused by the presence of undifferentiated hPSCs in differentiated cells, we have designed a peptide derived from HNRNPK that blocks the binding of ESRG to HNRNPK and eliminates the undifferentiated hPSCs remaining in differentiated cells, taking advantage of the fact that ESRG is specifically and highly expressed only in hPSCs in normal cells or tissues. This peptide has the potential to effectively prevent the potential tumorigenic risk of hPSCs therapeutic products, lay the foundation for the safe application of hPSCs in clinical treatment in the future, and has important clinical translational value. We have previously demonstrated that ESRG can interact with the K4 truncated form of HNRNPK in hPSCs ( Figure 1 GH), and its K4 truncation was designed and synthesized into a polypeptide: CPP-K4.

[0054] Experimental Example 4

[0055] The peptide CPP-K4 was used to investigate whether it could block the ESRG-HNENPK interaction.

[0056] After 24 hours of single-cell plating of HPSCs H9 cells, 40 μmol CPP-K4 was added to the culture medium when the medium was changed. After 36 hours, the morphology of hPSCs H9 cells was observed to change from compact to sparse ( Figure 6 A), AP enzyme activity decreases and cell stemness decreases ( Figure 6B), the levels of stemness factors OCT4 and SOX2 proteins decreased ( Figure 6 C). RNA-FISH combined with immunofluorescence experiments were used to observe whether the subcellular localization of ESRG in hPSCs H9 cells changed after the addition of CPP-K4. Fluorescence results showed that after the addition of 40 μmol CPP-K4 for 36 hours, the localization of ESRG in the cell nucleus decreased and the localization in the cytoplasm increased ( Figure 6 D) The results of this experiment indicate that the addition of the HNRNPK-derived K4 peptide partially blocked the binding of ESRG to HNRNPK in the cell nucleus, and some ESRG was taken out of the cell nucleus.

[0057] The above is only a preferred embodiment of the present invention, and the scope of protection of the present invention is not limited to the above embodiment. For those skilled in the art, improvements and modifications obtained without departing from the technical concept of the present invention should also be considered as the scope of protection of the present invention.

Claims

1. A polypeptide CPP-K4 derived from HNRNPK targeting human pluripotent stem cells, characterized in that: The amino acid sequence of the polypeptide CPP-K4 is shown in SEQ ID NO.

1.

2. A use of the polypeptide CPP-K4 derived from HNRNPK targeting human pluripotent stem cells as claimed in claim 1 for blocking the binding between ESRG and HNRNPK, characterized in that: The application is not for the purpose of disease diagnosis or treatment.

3. A use of the polypeptide CPP-K4 derived from HNRNPK targeting human pluripotent stem cells as claimed in claim 1 for eliminating undifferentiated human pluripotent stem cells remaining in differentiated cells, characterized in that: The application is not for the purpose of disease diagnosis or treatment.

4. A use of the polypeptide CPP-K4 derived from HNRNPK targeting human pluripotent stem cells as claimed in claim 1 in the preparation of an anti-tumor drug, characterized in that: The tumor is caused by residual undifferentiated human pluripotent stem cells among differentiated cells.

5. A use of the polypeptide CPP-K4 derived from HNRNPK targeting human pluripotent stem cells as claimed in claim 1 in transferring ESRG from the nucleus to the cytoplasm, characterized in that: The application is not for the purpose of disease diagnosis or treatment.

Images