Ferulate decarboxylase high-activity mutant and application thereof

Abstract

The invention discloses a ferulic acid decarboxylase high-activity mutant and application thereof, and belongs to the technical field of enzyme engineering and gene engineering. The amino acid sequence of the ferulic acid decarboxylase mutant disclosed by the invention is SEQ ID NO. 7, SEQ ID NO. 14 or SEQ ID NO. 16. The technical problem of low catalytic activity of natural ferulate decarboxylase Fdc1 is solved, and the ferulate decarboxylase Fdc1 can be used for biosynthesis of 4-acetoxystyrene. According to the mutant disclosed by the invention, the decarboxylation activity of ferulate decarboxylase on 4-acetoxycinnamic acid is improved, and the industrial application potential of the ferulate decarboxylase is improved.

Description

[0001] The present invention is a divisional application of a Chinese invention with an application date of November 22, 2023, an application number of 202311572551.0, and an invention name of “A high-activity combined mutant of ferulic acid decarboxylase and its application”. Technical Field

[0002] The invention relates to a high-activity mutant of ferulic acid decarboxylase and application thereof, belonging to the technical field of enzyme engineering and gene engineering. Background Art

[0003] Ferulic acid decarboxylase Fdc1 is a reversible aromatic carboxylase that is dependent on the cofactor prFMN (prenylated flavin mononucleotide). Fdc1 was originally found to act on the decarboxylation of ferulic acid to produce 4-vinylguaiacol. Further studies have shown that it can catalyze a wide range of α,β-unsaturated carboxylic acids represented by cinnamic acid to produce styrene. At present, there are few reports on the catalytic reaction of cinnamic acid derivative 4-acetoxycinnamic acid, and the latter's decarboxylation product 4-acetoxystyrene is an important monomer for the synthesis of photoresist poly 4-acetoxystyrene materials. However, the catalytic efficiency of ferulic acid decarboxylase Fdc1 for the non-natural substrate 4-acetoxycinnamic acid is very low, which hinders its application in industry.

[0004] The ferulic acid decarboxylase Fdc1 was used as a biocatalyst to synthesize 4-acetoxystyrene. The reaction conditions were mild and green. However, the low activity of ferulic acid decarboxylase on this substrate limits its industrial application potential. The engineering modification of enzymes is an important method to solve the above problems. The use of directed evolution and semi-rational design strategies to improve the catalytic activity of ferulic acid decarboxylase Fdc1 is of great significance for improving the industrial application prospects of ferulic acid decarboxylase Fdc1. Summary of the invention

[0005] In order to solve the problems existing in the prior art, the present invention provides a high-activity mutant of ferulic acid decarboxylase and its application, which solves the technical problem of low catalytic activity of natural ferulic acid decarboxylase Fdc1, and can be used for the biosynthesis of 4-acetoxystyrene. The present invention uses 4-acetoxycinnamic acid as a substrate, analyzes the potential interaction sites of Fdc1 with 4-acetoxycinnamic acid, constructs a saturated mutant library of the interaction sites of Fdc1 with 4-acetoxycinnamic acid, establishes a high-throughput screening method, screens and obtains a series of mutants with improved enzyme activity and performs iterative combination design, and finally obtains a high-activity Fdc1 mutant and applies it to the biosynthesis of 4-acetoxystyrene.

[0006] In order to achieve the above object, the technical solution adopted by the present invention includes:

[0007] In a first aspect, the present invention provides a ferulic acid decarboxylase mutant, wherein the amino acid sequence of the ferulic acid decarboxylase mutant is SEQ ID NO.7, SEQ ID NO.14 or SEQ ID NO.16.

[0008] In a second aspect, the present invention provides a recombinant plasmid carrying a gene encoding the mutant.

[0009] In a third aspect, the present invention provides a recombinant engineering strain carrying the recombinant plasmid expressing the above-mentioned gene.

[0010] Furthermore, the engineered strain is Escherichia coli.

[0011] In a fourth aspect, the present invention provides use of the mutant, the recombinant plasmid or the recombinant engineered strain in the preparation of 4-acetoxystyrene.

[0012] Furthermore, taking 4-acetoxycinnamic acid as a substrate, the ferulic acid decarboxylase mutant or the recombinant engineering strain is added to a reaction system containing the 4-acetoxycinnamic acid substrate to generate 4-acetoxystyrene.

[0013] Beneficial effects:

[0014] The invention aims at Fdc1 from wild-type saccharomyces cerevisiae, constructs a ferulic acid decarboxylase mutant containing a P441S mutation site, and uses the mutant to catalyze 4-acetoxycinnamic acid to produce 4-acetoxystyrene. The invention confirms that the amino acid residue at position 441 has a great influence on the catalytic effect of ferulic acid decarboxylase, and the proline at position 441 is mutated to serine, which increases the activity of the ferulic acid decarboxylase by 3.8 times compared with the wild-type ferulic acid decarboxylase. The invention provides a certain basis for the study of the catalytic mechanism of the enzyme, and the mutant thereof increases the industrial application potential of the enzyme. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The reaction equation of ferulic acid decarboxylase Fdc1 catalyzing the decarboxylation of 4-acetoxycinnamic acid;

[0016] Figure 2 Cofactor and substrate binding pocket of ferulic acid decarboxylase Fdc1 from Saccharomyces cerevisiae;

[0017] Figure 3 Absorption wavelength scanning of 4-acetoxycinnamic acid, 4-acetoxystyrene and reaction background;

[0018] Figure 4 Liquid chromatogram of substrate 4-acetoxycinnamic acid and product 4-acetoxystyrene;

[0019] Figure 5 Determination of relative enzyme activity of ferulic acid decarboxylase mutants towards substrate 4-acetoxycinnamic acid. DETAILED DESCRIPTION

[0020] In order to better explain the present invention and facilitate understanding, the present invention is described in detail below through specific implementation modes in conjunction with the accompanying drawings.

[0021] In order to better understand the above technical scheme, exemplary embodiments of the present invention will be described in more detail below. It should be understood that the present invention can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided in order to enable a clearer and more thorough understanding of the present invention, and to be able to fully convey the scope of the present invention to those skilled in the art.

[0022] The ferulic acid decarboxylase Fdc1 derived from Saccharomyces cerevisiae mainly acts on α,β-unsaturated carboxylic acids represented by ferulic acid and cinnamic acid, but the decarboxylation efficiency of 4-acetoxycinnamic acid is very low. The present invention improves the decarboxylation activity of the ferulic acid decarboxylase Fdc1 derived from Saccharomyces cerevisiae on 4-acetoxycinnamic acid by a semi-rational design method, selects amino acid residues that directly interact with the substrate around the enzyme catalytic active center by means of molecular docking and enzyme structure analysis, designs NNK degenerate primers to construct a mutant library, selects mutants with improved catalytic activity on 4-acetoxycinnamic acid, and then adopts a strategy of combined active center saturation mutation to perform multiple rounds of superimposed mutations, so that the catalytic activity of the ferulic acid decarboxylase is further improved.

[0023] The raw materials used in the present invention, unless otherwise specified, are conventional commercially available products; the methods used in the present invention, unless otherwise specified, are conventional methods in the art.

[0024] The ferulic acid decarboxylase library constructed by the invention is based on a wild-type saccharomyces cerevisiae source sequence (such as SEQ ID NO.1), and saturation mutation and iterative combination mutation are performed on one or more of the 397th, 398th, 438th or 441st amino acid residues in the amino acid sequence SEQ ID NO.3 encoded by the wild-type saccharomyces cerevisiae source sequence (such as SEQ ID NO.1), and the obtained ferulic acid decarboxylase mutants contain one or more of the F397V, I398L, T438P, P441S or P441V sites.

[0025] The invention screens ferulic acid decarboxylase capable of efficiently decarboxylating 4-acetoxycinnamic acid based on spectroscopy, and the selected wavelength is 301 nm at which the substrate and the product have obvious differences.

[0026] The relative enzyme activity of the ferulic acid decarboxylase mutant of the present invention for the substrate 4-acetoxycinnamic acid is determined based on high performance liquid chromatography, and the test conditions are: a certain volume of crude enzyme solution (containing about 20 ng of enzyme), 0.5 mM 4-acetoxycinnamic acid and 50 mM PBS buffer (pH 6.0), reacting at 30° C. for 20 minutes, and the detection wavelength is 254 nm.

[0027] Example 1 Construction of a saturated mutant plasmid library of ferulic acid decarboxylase

[0028] The crystal structure of ferulic acid decarboxylase from Saccharomyces cerevisiae was downloaded from the Protein Data Bank (PDB), which is numbered as 4ZAC. Through structural analysis, the C chain of 4ZAC was selected as the initial model and the missing amino acid residues were repaired. Then, the structure was preprocessed by deleting water and the pdb file was saved. The three-dimensional structure of the small molecule 4-acetoxycinnamic acid was searched and downloaded from the PubChem (https: / / pubchem.ncbi.nlm.nih.gov / ) database, and the mechanical structure was optimized using Guassian software.

[0029] The substrate 4-acetoxycinnamic acid was docked with ferulic acid decarboxylase from Saccharomyces cerevisiae using Autodock Vina software to obtain the structure of the protein-substrate-cofactor complex: the first step is to prepare the coordinate file, export the protein and small molecule into a specific coordinate file format pdbqt, hydrogenate the protein, calculate the charge, and add the atom type; hydrogenate the small molecule, calculate the charge, determine the torque center, and select the rotatable bond; the second step is to set up the docking box, including the center coordinates and size parameters, and create a configuration file containing the docking parameters in AutoDockTools; the third step is to run the AutoDock vina program to extract the binding conformation with the minimum Binding Energy, which is the optimal binding conformation.

[0030] Finally, the amino acid residues near the substrate and cofactor binding pockets were determined by Pymol software analysis (see Figure 2, the cartoon figure in the figure is Fdc1 protein, the spherical models are substrate 4-acetoxycinnamic acid and cofactor prFMN, and the stick model is the mutant site to be constructed). At the same time, proteins with a sequence similarity of more than 30% with the ferulic acid decarboxylase Fdc1 from Saccharomyces cerevisiae were selected on the NCBI website for sequence alignment, and the distribution of homologous sequences of amino acid residues near the binding pocket of ferulic acid decarboxylase from Saccharomyces cerevisiae was calculated. Finally, 13 amino acid sites were determined to construct the screening library of NNK (I189, K190, F283, M286, P319, T326, I330, F397, I398, T438, F440, P441, L442), and their distribution positions are shown in Figure 2 .

[0031] After codon optimization for Escherichia coli, the invention clones the gene fdc1 (SEQ ID NO.1) encoding ferulic acid decarboxylase from Saccharomyces cerevisiae and the gene ubix (SEQ ID NO.2) encoding isopropyltransferase from Pseudomonas aeruginosa into the BamⅠ / HindⅢ restriction site and NdeⅠ / XhoⅠ restriction site of the expression vector pACYCDuet-1 to obtain the recombinant plasmid pACYCDuet-UbiX-Fdc1. The ferulic acid decarboxylase mutant provided by the invention is obtained by mutation of the nucleotide sequence shown in SEQ ID NO.1, and the amino acid sequence of ferulic acid decarboxylase is SEQ ID NO.3.

[0032] Example 2 Obtaining a saturated mutant library of ferulic acid decarboxylase

[0033] Degenerate primers were designed to construct a mutant library: NNK degenerate primers contained 32 (4×4×2) codon combinations (N=A / C / G / T, K=G / T), covering all 20 amino acids. A site-directed saturation mutagenesis strategy was adopted, with the recombinant plasmid pACYCDuet-UbiX-Fdc1 as the template, a pair of oligonucleotides with mutation sites as amplification primers, and PrimeSTAR high-fidelity enzyme for whole plasmid amplification to obtain a recombinant plasmid library with specific mutation sites.

[0034] The target gene was amplified using the following amplification primers, where the underline indicates the mutation site, the primer name with F indicates the upstream primer, and the primer name with R indicates the downstream primer:

[0035] I189-F:TACCGGCCTGGTG NNK AAACCGCAGCATATT

[0036] I189-R:TGCTGCGGTTT MNN CACCAGGCCGGTAAT

[0037] K190-F:GCCTGGTGATT NNK CCGCAGCATATTCGT

[0038] K190-R:AATATGCTGCGG MNN AATCACCAGGCCGGT

[0039] F283-F:TGGAAGGCCCG NNK GGCGAAATGCATGGCTAT

[0040] F283-R:GCATTTCGCC MNN CGGGCCTTCCAGATGGGTA

[0041] M286-F:CCGTTTGGCGAA NNK CATGGCTATGTGTTTA

[0042] M286-R:CACATAGCCATG MNN TTCGCCAAACGGGCCTT

[0043] P319-F:GGTTAGCAAC NNK GGCCTGTGCACCGAT

[0044] P319-R:GCACAGGCC MNN GTTGCTAACCGGCAGA

[0045] T326-F:TGCACCGATGAA NNK CATACCCTGATTGGCAG

[0046] T326-R:CAATCAGGGTATG MNN TTCATCGGTGCACAGG

[0047] I330-F:AAACCCATACCCTG NNK GGCAGCCTGGTGGC

[0048] I330-R:GCCACCAGGCTGCC MNN CAGGGTATGGGTTT

[0049] F397-F:CAAAGTGGGC NNK ATTGTGCATGAAATTATTCT

[0050] F397-R:ATTTCATGCACAAT MNN GCCCACTTTGGTGCGA

[0051] I398-F:AAGTGGGCTTT NNK GTGCATGAAATTATTCT

[0052] I398-R:TAATTTCATGCAC MNN AAAGCCCACTTTGGT

[0053] T438-F:TTTGATGATGTG NNK AGCTTTCCGCT

[0054] T438-R:AGCGGAAAGCT MNN CACATCATCAAA

[0055] F440-F:TTTGATGATGTGACGAGC NNK CCGCTGGCGCCGTTTGTGA

[0056] F440-R:TCACAAACGGCGCCAGCGG MNN GCTCGTCACATCATCAAA

[0057] P441-F:ATGTGACGAGCTTT NNK CTGGCGCCGTTTGT

[0058] P441-R:ACAAACGGCGCCAG MNN AAAGCTCGTCACAT

[0059] L442-F:ATGATGTGACGAGCTTTCCG NNK GCGCCGTTTGTGAGTCAG

[0060] L442-R:AAACGGCGC MNN CGGAAAGCTCGTCACATCATCAAACGCCAT

[0061] PrimeSTAR Max high-fidelity enzyme was used to amplify the Fdc1 gene containing a specific mutation site. It is worth noting that the extension products of the forward and reverse primers were paired after annealing to form an open circular plasmid with a nick, and the template plasmid, i.e., the wild-type plasmid, was mixed in the system. The template plasmid needed to be removed by cutting the PCR product with DpnⅠ.

[0062] Next, the DpnⅠ digestion product was transferred into the Escherichia coli competent cells BL21 (DE3) through plasmid heat shock transformation. 20 μL of the digestion product was added to the competent cells BL21 (DE3) and spread on the LB solid plate containing 50 μg / mL chloramphenicol resistance. The plate was inverted and cultured at 37°C for 12 hours to obtain a plate colony library of random saturated mutants. The single clones on the plate colonies were transferred to another new plate with a number. 5 mL of fresh LB medium containing 50 μg / mL chloramphenicol was added to each well of the 24-well plate, and all transformants on the plate were picked and inoculated into each well in the order of number. After overnight culture at 37°C and 220 rpm, 1 mL of seed solution was taken from each well and transferred to another 24-well plate containing 5 ml of fresh LB medium with 5 ml of chloramphenicol. After about 3 hours of culture, when OD600 reached 0.6-0.8, a final concentration of 0.4 mM IPTG was added, and the culture was induced at 37°C and 220 rpm for 5 hours. After induction, the bacteria were collected by centrifugation, and 1 mL of buffer (pH 8.0) containing 1 mg / mL lysozyme and 100 mM Tris-HCl was added to each well to fully resuspend the bacteria. After incubation at 37°C for 30 minutes, the supernatant was centrifuged and added to a 96-well plate. The enzyme solution in each well was added to the corresponding prepared reaction solution using a spray gun to start the reaction, and the saturated mutant library was subjected to high-throughput screening.

[0063] Example 3 Establishment of a spectroscopic method for screening ferulic acid decarboxylase for efficient decarboxylation of 4-acetoxycinnamic acid

[0064] The substrate 4-acetoxycinnamic acid and the product 4-acetoxystyrene of the decarboxylation reaction were scanned at full wavelength to determine their respective maximum absorption wavelengths. Before measuring the sample, the other mixed components in the decarboxylation reaction system except the substrate 4-acetoxycinnamic acid, including PBS buffer and crude enzyme supernatant, were scanned at full wavelength to remove the influence of the reaction system background. The UV spectrophotometer was used to scan the wavelength of 200-450nm, and the measurement was performed every 5nm. The results showed that the maximum absorption wavelength of the substrate 4-acetoxycinnamic acid was λ max The λ of the product 4-acetoxystyrene is 280 nm. max At 301 nm, the substrate 4-acetoxycinnamic acid has a large absorption and is almost not interfered by the product 4-acetoxystyrene and the background of the reaction system. Therefore, 301 nm is selected as the detection wavelength of 4-acetoxycinnamic acid in the decarboxylation reaction. Figure 3 .

[0065] The enzymatic reaction was carried out in a 200 μL reaction system, including 0.5 mM 4-acetoxycinnamic acid, 50 mM PBS buffer (pH 6.0), and reacted at 30°C for 20 minutes. By detecting the change in absorbance at 301 nm, the absolute value of the change in absorbance of the wild type before and after the reaction was used as a control, and the ratio was greater than 1.2 times that of the wild type. The mutant with improved enzyme activity was screened and verified by high-performance liquid chromatography, and finally the mutant with improved enzyme activity was selected for sequencing. In the high-performance liquid chromatography, 3 times the volume of acetonitrile in the reaction system was added to terminate the reaction, and the supernatant was centrifuged to detect the sample. The specific detection conditions are: chromatographic column: Ecllpse XDB-C18 (250*4.6mm*5μm); mobile phase is 0.1% trifluoroacetic acid in acetonitrile aqueous solution (v / v=1:1); detection wavelength: 254nm; injection volume: 5μL; column temperature: 25°C; flow rate: 1.0mL / min, isocratic elution for 20 minutes. The enzyme activity was evaluated by the amount of product 4-acetoxystyrene produced. The relationship between the peak area and concentration of the product 4-acetoxystyrene was y = 1253.3x + 18.967, R 2 =0.9994, where y represents the peak area (mAU) and x represents the concentration of the product 4-acetoxystyrene (mM).

[0066] Among the 1248 mutant libraries planned to be constructed, 5 mutants of ferulic acid decarboxylase Fdc1 with improved enzyme activity were screened out. Gene sequencing showed that they were distributed at 4 sites, among which there were two mutants at the P441 site, and their mutation sites were: F397V, I398L, T438P, P441S and P441V, and their amino acid sequences were SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8, respectively.

[0067] Example 4 Combination of active center saturation mutations

[0068] Using a construction method similar to that of single point mutants, single point mutants with improved activity were cumulatively combined, multiple mutation sites were selected in the amino acid sequence shown in SEQ ID NO.3 for combination, and 2 to 4 mutation sites were selected from the 5 mutation sites in Example 3 for combination to obtain different ferulic acid decarboxylase combination mutants:

[0069] Two mutation sites were selected for combination, and 8 ferulic acid decarboxylase mutants with improved decarboxylation activity for 4-acetoxycinnamic acid were constructed. The combined mutation sites were F397V / I398L, F397V / T438P, F397V / P441S, F397V / P441V, I398L / T438P, I398L / P441S, I398L / P441V and T438P / P441S. The amino acid sequences of the 8 ferulic acid decarboxylase combined mutants with improved catalytic activity were SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15 and SEQ ID NO.16, respectively.

[0070] Three mutation sites were selected for combination to construct two combined mutants of ferulic acid decarboxylase with improved catalytic activity. The combined mutation sites were F397V / T438P / P441S and I398L / T438P / P441V, respectively. The amino acid sequences of the two combined mutants of ferulic acid decarboxylase with improved catalytic activity were SEQ ID NO.17 and SEQ ID NO.18, respectively.

[0071] Four mutation sites were selected for combination to construct two combined mutants of ferulic acid decarboxylase with improved catalytic activity. The combined mutation sites were F397V / I398L / T438P / P441S and F397V / I398L / T438P / P441V, respectively. The amino acid sequences of the two combined mutants of ferulic acid decarboxylase with improved catalytic activity were SEQ ID NO.19 and SEQ ID NO.20, respectively.

[0072] The relative enzyme activities of the above combined mutants compared with the wild-type Fdc1 are as follows Figure 5 As shown, with 4-acetoxycinnamic acid as the substrate, the activities of the above single-site mutants and combined site mutants were significantly improved, among which the activity of the F397V / I398L / T438P / P441V mutant was increased by more than 11 times compared with the wild type. Therefore, the Fdc1 high-activity combined mutant proposed in the present invention has important application value in the biosynthesis of 4-acetoxystyrene.

[0073] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A ferulic acid decarboxylase mutant, characterized in that The amino acid sequence of the ferulic acid decarboxylase mutant is SEQ ID NO.7, SEQ ID NO.14 or SEQ ID NO.

16.

2. A recombinant plasmid carrying the gene encoding the mutant according to claim 1.

3. A recombinant engineering strain carrying and expressing the recombinant plasmid described in claim 2.

4. The recombinant engineering strain according to claim 3, characterized in that The engineered strain is Escherichia coli.

5. Use of the mutant according to claim 1, the recombinant plasmid according to claim 2 or the recombinant engineering strain according to claim 3 or 4 in the preparation of 4-acetoxystyrene.

6. The use according to claim 5, characterized in that: Taking 4-acetoxycinnamic acid as a substrate, the ferulic acid decarboxylase mutant, the recombinant plasmid or the recombinant engineering strain is added into a reaction system containing the 4-acetoxycinnamic acid substrate to generate 4-acetoxystyrene.

Images