Application of OSK8 gene in promoting plant growth

Abstract

The present disclosure provides an application of the OSK8 gene in promoting plant growth, belonging to the field of molecular breeding. The application includes: using the OSK8 gene to promote plant growth. The present disclosure provides an application of the OSK8 gene in promoting plant growth, and the OSK8 gene promotes the plant height and underground growth of seedlings. In addition, the plant height of OE varies greatly under treatments with different concentrations of nitrate nitrogen, and is sensitive to changes in nitrate nitrogen concentration, that is, the OSK8 gene affects nitrogen absorption. It can be seen that the OSK8 gene positively regulates the growth of rice through nitrogen absorption, which enables the overexpression transgenic material of the OSK8 gene to improve the nitrogen fertilizer utilization efficiency.

Description

Technical Field

[0001] The present disclosure relates to the field of molecular breeding, and in particular to an application of an OSK8 gene in promoting plant growth. Background Art

[0002] Rice (Oryza sativa) is the largest staple food crop in my country, with more than half of the population relying on rice as their staple food. Rice dwarfing breeding promoted the first "green revolution" and greatly increased rice production. In order to increase rice production, many producers would over-fertilize.

[0003] At present, there is also the phenomenon of over-fertilization in the rice production process, which will cause a large amount of nitrogen fertilizer to be absorbed by the rice instead of being absorbed by the soil or washed away with the water flow, forming pollution. Moreover, excessive application of nitrogen fertilizer will also reduce the nitrogen fertilizer utilization efficiency of rice, which is not conducive to rice cultivation.

[0004] In order to reduce the environmental pollution caused by excessive nitrogen fertilizer, further exploration and utilization of rice nitrogen fertilizer absorption-related genes will play an important role in the development of green agriculture.

[0005] Public Content

[0006] In order to solve the problems of the prior art, the present disclosure provides an application of the OSK8 gene in promoting plant growth. The technical solution is as follows:

[0007] The present disclosure provides an application of an OSK8 gene in promoting plant growth, and the application includes: using the OSK8 gene to promote plant growth.

[0008] Specifically, the application includes: the OSK8 gene positively regulates plant growth by promoting nitrogen fertilizer absorption.

[0009] Specifically, the application includes: over-expressing the OSK8 gene to positively regulate plant growth by promoting nitrogen fertilizer absorption.

[0010] Specifically, the plant includes rice.

[0011] Specifically, the applications include:

[0012] Using the cDNA of the sample as a template, PCR amplification was performed using forward primers and reverse primers to obtain the amplified product;

[0013] Obtaining a target fragment by subjecting the amplified product to agarose electrophoresis;

[0014] Connecting the double-enzyme-cut vector to the target fragment to obtain a connection product;

[0015] The ligation product is transformed into a receptor material and positive plants are selected to obtain overexpression transgenic materials.

[0016] Specifically, the receptor material is rice ZH11.

[0017] Specifically, the amplified product fragment is 372 bp

[0018] Specifically, the sequence of the forward primer is shown in SEQ ID NO: 1 in the sequence listing, and the sequence of the reverse primer is shown in SEQ ID NO: 2 in the sequence listing.

[0019] The technical solution provided by the embodiment of the present disclosure has the following beneficial effects: the present disclosure provides an application of the OSK8 gene in promoting plant growth, and the OSK8 gene promotes the plant height and underground growth of seedlings. In addition, the plant height of OE varies greatly under different concentrations of nitrate nitrogen treatment, and is sensitive to changes in nitrate nitrogen concentration, that is, the OSK8 gene affects nitrogen absorption. It can be seen that the OSK8 gene positively regulates the growth of rice through nitrogen absorption, which enables the overexpression transgenic material of the OSK8 gene to improve the nitrogen fertilizer utilization efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present disclosure, the drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present disclosure. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0021] Figure 1 This is a schematic diagram of the construction of the overexpression vector of OSK8 provided in Example 1 of the present disclosure;

[0022] Figure 2 This is a comparison diagram of the difference in expression levels of WT and OSK8 overexpressing transgenic plants OE-1 and OE-2 analyzed by qPCR provided in Example 1 of the present disclosure;

[0023] Figure 3 This is a graph of protein levels of WT and OSK8 overexpressing transgenic plants OE-1 and OE-2 analyzed by Western-blotting provided in Example 1 of the present disclosure;

[0024] Figure 4 This is a comparison diagram of plant height differences between WT and OSK8 overexpressing transgenic plants OE-1 and OE-2 provided in Example 1 of the present disclosure;

[0025] Figure 5 It is a plant height statistical diagram of the WT and OSK8 overexpressing transgenic plants OE-1 and OE-2 provided in Example 1 of the present disclosure;

[0026] Figure 6a is a phenotypic comparison diagram of WT and OE seedlings under water culture conditions provided in Example 2 of the present disclosure;

[0027] Figure 6b is a comparison diagram of root development of WT and OE seedlings under water culture conditions provided in Example 2 of the present disclosure;

[0028] Figure 7a is a phenotypic comparison diagram of WT and OE seedlings under low nitrogen culture conditions provided in Example 2 of the present disclosure;

[0029] Figure 7b is a comparison diagram of root development of WT and OE seedlings under low nitrogen culture conditions provided in Example 2 of the present disclosure;

[0030] Figure 8a is a phenotypic comparison diagram of WT and OE seedlings under medium nitrogen culture conditions provided in Example 2 of the present disclosure;

[0031] Figure 8b is a comparative diagram of root development of WT and OE seedlings under medium nitrogen culture conditions provided in Example 2 of the present disclosure;

[0032] Figure 9a is a phenotypic comparison diagram of WT and OE seedlings under high nitrogen culture conditions provided in Example 2 of the present disclosure;

[0033] Figure 9b is a comparative diagram of root development of WT and OE seedlings under high nitrogen culture conditions provided in Example 2 of the present disclosure;

[0034] Fig.10 is a statistical graph of plant height of WT and OE seedlings under different culture conditions provided in Example 2 of the present disclosure;

[0035] Fig.11 is a statistical graph of the total root length of WT and OE seedlings under different culture conditions provided in Example 2 of the present disclosure;

[0036] Fig.12 It is a statistical graph of root projection areas of WT and OE seedlings under different culture conditions provided in Example 2 of the present disclosure. DETAILED DESCRIPTION

[0037] In order to make the objectives, technical solutions and advantages of the present disclosure more clear, the embodiments of the present disclosure will be further described in detail below with reference to the accompanying drawings.

[0038] Embodiment 1

[0039] An embodiment of the present disclosure provides an application of an OSK8 gene in promoting plant growth, and the application includes: using the OSK8 gene to promote plant growth. In this embodiment, the coding sequence of the OSK8 gene (LOC_Os11g48030) is shown in SEQ ID NO: 3 in the sequence listing, specifically: ATGCTGCGGAAGGGAGAGGCGCCGGGGCACCAAACCCCACCCCACCTGCACAAGGACGACGGCGACGACGACGCACCGTCCGGCTTCGTCAAGCTCATCAGCGCCGAGGGCTTCGAGTTCGTCGTCGACAAGAAGGCCGCCATGGTCTCCAACACGCTCCGCAACATGCTCACCTCCCCCGGCGGCTTCTCCGAGACGCGCGAGGGCGAGGTTAGGTTCCCCGAGATCAGCACCCCCATCCTCGAGAAGATCTGCCAGTACTTCTACTGGTCGCTCCACTACTCCAGTGGGAAGGAGACATCTGAGTTTCAAATTGAACCGGAGATAACTCTGGAGCTGATGATGGCTGCAAACTATCTGGACACCTGA.

[0040] Specifically, the plants include rice.

[0041] Specifically, the application includes: driving the overexpression of OSK8 gene through a promoter to obtain an overexpression vector;

[0042] The overexpression vector was transformed into the receptor material to obtain the overexpression transgenic materials OE-1 and OE-2.

[0043] Specifically, the receptor material is rice ZH11.

[0044] Specifically, the promoter is the Ubiquitin promoter.

[0045] Specifically, the cDNA of rice ZH11 was obtained. In this embodiment, the total RNA in the rice material was first extracted; the total RNA was reverse transcribed to obtain cDNA. Specifically, the total RNA of the rice material was extracted using the RNAiso Plus kit (TaKaRa Code: D9108A). For the specific operation process, please refer to the instructions of the RNAiso Plus kit. Then use TAKARA's PrimeScript TMRT reagent Kit with gDNAEraser (Lot#AK4901) kit. Follow the steps in the instructions of the kit, and finally store the cDNA at 4°C. Rice ZH11 in this embodiment is a commercially available rice variety.

[0046] Then, cDNA was used as a template, PU2301F was used as a forward primer, and PU2301R was used as a reverse primer to perform PCR (Polymerase Chain Reaction) amplification to obtain an amplified product (coding region of OSK8 gene OX-OSK8), and the fragment of the amplified product was 372 bp. Among them, the sequence of the forward primer is: ccatttacgaacgatagccggtaccatgctgcggaagggagaggc, as shown in SEQ ID NO: 1 in the sequence table, and the sequence of the reverse primer is: gatctttgtaatcggatccggatccggtgtccagatagttt gcag, as shown in SEQ ID NO: 2 in the sequence table.

[0047] In this embodiment, the PCR amplification system is: DNA 3 μL, 2×KOD Fx (1 U / μL) PCR buffer 25 μL, 2 mM dNTPs 10 μL, forward primer 1.5 μL, reverse primer 1.5 μL, KOD Fx (1 U / μL) 1 μL, ddH2O 8 μL. The PCR amplification program is shown in Table 1.

[0048] Table 1 shows the PCR amplification program

[0049]

[0050]

[0051] After the amplified product was detected by agarose electrophoresis to confirm that the size of the amplified product was correct, a DNA recovery kit (TIANGEN DNA purification and recovery kit, catalog number DP241-03) was used to dig out the gel to recover the amplified product to obtain the target fragment OX-OSK8.

[0052] The commercially available vector pU2301 was double-digested with KpnⅠ and BamHI, and after the digestion was complete as detected by agarose electrophoresis, it was recovered and purified to obtain the double-digested vector pU2301 (KpnⅠ / BamHI).

[0053] The target fragment OX-OSK8 and the double-enzyme vector pU2301 (KpnⅠ / BamHⅠ) were subjected to a one-step ligation reaction (Gibson Assembly). The ligation system was: 2μL of the target fragment OX-OSK8, 0.5μL of the double-enzyme vector pU2301 KpnⅠ / BamHⅠ and 7.5μL of one-step ligase Mixture. After mixing evenly, react at 50℃ for 50min to obtain a ligation product. The ligation product was transformed into the competent Escherichia coli Trans5α, and a single clone was picked for shaking to obtain a bacterial solution. After the bacterial solution was stored, the positive single clone was preliminarily determined by the bacterial solution PCR reaction, and then the plasmid was extracted and sequenced. After comparison, the positive single clone without mutation was used as the constructed Figure 1 The overexpression vector of OSK8 shown in the figure. The overexpression vector of OSK8 was transferred into rice ZH11 by Agrobacterium-mediated genetic transformation to obtain transgenic T0 generation overexpression plants. The transgenic T0 generation overexpression plants were positively identified by Hyg primers, and positive seedlings were screened. The positive seedlings were further propagated, and the expression level and protein level were detected to screen out transgenic plants with overexpression of OSK8.

[0054] In this example, qPCR (quantitative polymerase chain reaction) was used to detect the OSK8 gene in the OSK8 overexpressed transgenic plants, and wild-type rice ZH11 was used as the control group WT. Figure 2 As shown by Figure 2 It can be seen that the expression level of OSK8 gene in OSK8 overexpressing transgenic plants OE-1 and OE-2 was significantly increased compared with WT. Figure 3 As shown, OE-1 and OE-2 were detected by Western-blotting with Flag as the antibody and Actin as the internal reference protein. The results showed that OSK8-flag protein could be detected in the OSK8-overexpressing transgenic plants, but not in the WT. It can be seen that the overexpression family overexpressed at both the transcriptional level and the protein level. The results showed that the plant height of the overexpression material was significantly increased compared with the WT.

[0055] After soaking and germinating the seeds of OE-1, OE-2 and WT, 50 seeds with normal germination and similar germination speed were selected and sown in seedling trays. When the seedlings were 25 days old, they were transplanted to the field with a plant spacing of 16.7 cm and a row spacing of 26.7 cm. They were planted according to the rule of 10 plants × 5 rows as a plot, and normal field water and fertilizer management was carried out. After the seeds matured, the plant heights of OE-1, OE-2 and WT were examined and photographed. The results of the photographs are shown in the figure. Figure 4 As shown in Figure 2, the plant heights of WT, OE-1 and OE-2 were counted separately, as shown in Figure 2. Figure 5 As shown. Combined Figure 4 and Figure 5 It can be seen that compared with WT, the plant height of OE-1 and OE-2 was significantly increased. This shows that the increase in the expression level of the OSK8 gene can positively regulate the growth of rice.

[0056] Embodiment 2

[0057] The present disclosure provides an application of an OSK8 gene in promoting plant growth, and the application includes: the OSK8 gene positively regulates plant growth by promoting nitrogen fertilizer absorption.

[0058] Specifically, the application includes: over-expressing the OSK8 gene to positively regulate plant growth by promoting nitrogen fertilizer absorption.

[0059] In this example, the OSK8 overexpressing transgenic plant OE and the control group WT were cultured under different culture conditions, and the growth of the seedlings was recorded. The different culture conditions included the application of water, low nitrogen (0.375 mM NO3 - ), medium nitrogen (1.25mM NO3 - ) and high nitrogen (2mM NO3 - ).

[0060] Combination Figure 6a and Figure 6b It can be seen that under water culture conditions, there were no significant changes in the plant height and root development of OE seedlings compared with WT seedlings.

[0061] Combination Figure 7a and Figure 7b It can be seen that under low nitrogen (0.375mM NO3 - ) culture conditions, the plant height of OE seedlings increased significantly compared with WT seedlings, and there was no significant difference in root development of OE.

[0062] Combination Figure 8a and Figure 8b It can be seen that for root development, in the medium nitrogen (1.25mM NO3 -) culture conditions, the plant height and root area of ​​the seedlings of OE increased significantly. In this embodiment, the significance was obtained by t test.

[0063] Combination Figure 9a and Figure 9b It can be seen that in high nitrogen (2mM NO3 - ) culture conditions, there were significant differences in plant height and root development of OE seedlings, specifically, the root system of OE seedlings was larger.

[0064] Combined with Figures 10 to 12 It can be seen that the OSK8 gene promotes the plant height and underground growth of seedlings. In addition, the plant height of OE varies greatly under different concentrations of nitrate nitrogen treatment and is sensitive to changes in nitrate nitrogen concentration, which indicates that the OSK8 gene affects nitrogen absorption. It can be seen that the OSK8 gene positively regulates the growth of rice by affecting nitrogen absorption, which enables the OSK8 gene overexpression transgenic materials to improve nitrogen fertilizer utilization efficiency.

[0065] The above description is only an optional embodiment of the present disclosure and is not intended to limit the present disclosure. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present disclosure shall be included in the protection scope of the present disclosure.

Claims

1. An application of OSK8 gene in promoting plant growth, characterized in that: The application includes: using the OSK8 gene to promote plant growth, the plant is rice, and the nucleotide sequence of the OSK8 gene is shown as SEQ ID NO: 3 in the sequence table.

2. The use according to claim 1, characterized in that: The application includes: the OSK8 gene positively regulates plant growth by promoting nitrogen fertilizer absorption.

3. The use according to claim 1, characterized in that: The application includes: over-expressing the OSK8 gene to positively regulate plant growth by promoting nitrogen fertilizer absorption.

4. The use according to claim 3, characterized in that: The applications include: Using the cDNA of the sample as a template, PCR amplification was performed using forward primers and reverse primers to obtain the amplified product; Obtaining a target fragment by subjecting the amplified product to agarose electrophoresis; Connecting the double-enzyme-cut vector to the target fragment to obtain a connection product; The ligation product is transformed into a receptor material and positive plants are selected to obtain overexpression transgenic materials.

5. The use according to claim 4, characterized in that: The receptor material is rice ZH11.

6. The use according to claim 4, characterized in that: The amplified product fragment is 372 bp.

7. The use according to claim 4, characterized in that: The sequence of the forward primer is shown as SEQ ID NO: 1 in the sequence listing, and the sequence of the reverse primer is shown as SEQ ID NO: 2 in the sequence listing.

Images