SNP (Single Nucleotide Polymorphism) marker for evaluating genetic multiple osteochondroma onset risk and application of SNP marker

Abstract

The invention provides an SNP (Single Nucleotide Polymorphism) marker related to evaluation of genetic multiple osteochondroma onset risk, the marker is rs557364026, and the mutation form is Agt; and C. The invention also provides a kit for evaluating the genetic multiple osteochondroma onset risk, a method for evaluating the genetic multiple osteochondroma onset risk, a nucleic acid molecule, a specific primer for detecting the SNP marker and application of the SNP marker. According to the method, the onset risk of the genetic multiple osteochondroma can be accurately evaluated.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and specifically relates to a SNP marker related to evaluating the risk of hereditary multiple osteochondroma and an application thereof. Technical Background

[0002] Hereditary Multiple Exostoses (HME), also known as Hereditary Multiple Osteochondromas (HMO), is a type of autosomal dominant genetic disease. It is characterized by multiple benign bone tumors covered by cartilage caps. Because the disease can interfere with the growth of normal epiphyses and lead to bone deformities, most patients have short stature, abnormal limb alignment and functional impairment. The incidence of multiple osteochondromas shows obvious regional and familial characteristics. In the Caucasus, the incidence of osteochondroma is about 0.9-2.0 people per 100,000 people; in the Indian community in the Pauingassi region of Canada, the incidence is as high as 1,310 people per 100,000 people; in my country, more than 1,000 cases have been reported in the past 23 years. Since multiple osteochondromas are hereditary and have the possibility of malignant transformation into chondrosarcoma, the development of molecular markers for disease risk assessment will help identify individuals at high risk of hereditary multiple osteochondromas and provide a genetic reference for their early preventive intervention.

[0003] Genetic polymorphism refers to the phenomenon that two or more types of variation or genotypes coexist in the same biological population. Among them, single nucleotide polymorphism (SNP) is the most important and most common heritable variation, which is widely distributed in the human genome. At present, many studies have confirmed that specific SNPs can cause different individuals to have different susceptibility to diseases. In addition, the incidence of hereditary multiple osteochondroma is mainly affected by genetic factors. In summary, obtaining SNP detection for people with a high incidence of hereditary multiple osteochondroma is a technical problem that needs to be solved urgently in this field. Summary of the invention

[0004] The purpose of the present invention is to provide a SNP marker for evaluating the risk of hereditary multiple osteochondroma and its application, wherein the marker is specifically targeted at a high-risk population for hereditary multiple osteochondroma.

[0005] To achieve the above objectives, the present invention provides a SNP marker for evaluating the risk of hereditary multiple osteochondroma, wherein the SNP marker is rs557364026, and the mutation form is A>C (Chr9:139925298-A>C, FUT7c.893T>G, p.Phe298Cys).

[0006] On the other hand, the present invention also provides a kit for evaluating the risk of hereditary multiple osteochondroma, wherein the kit comprises specific primers for detecting the amplified SNP sites according to claim 1. Preferably, the nucleotide sequences of the primers are shown in SEQ ID NOs: 1 to 4.

[0007] The primers are used to amplify the above SNP sites, and their nucleotide sequences (5'→3') are as follows:

[0008] The first pair of PCR primers: FUT7F1: CCCATAATCCCAGCTACTTG; FUT7R1: GCAAAGGCCCAGAAGTCA, the amplified product length was 3.4 kb;

[0009] The second pair of nested primers: FUT7F2: AGAATCACTTGAACCCGGAAGGTGGAG; FUT7R2: CCCACGAGGCACTGCTCAGATGTTTAT, the length of the amplified product was 3.2kb.

[0010] Using the kit of the present invention, a single band of the obtained PCR product is subjected to Sanger sequencing by PCR amplification to obtain the sequence information of the fragment. Then, the corresponding genotype of the subject to be tested is obtained according to the sequence information comparison, and heterozygous carriers can be distinguished. Finally, the risk of multiple osteochondroma of an individual is evaluated according to the locus genotype information.

[0011] On the other hand, the present invention also provides a method for evaluating the risk of hereditary multiple osteochondroma, wherein the gene type of the SNP marker amplification product is identified by detecting the SNP marker according to claim 1, and when the rs557364026 gene type in the test result is C, the person is determined to be a high-risk population.

[0012] On the other hand, the present invention also provides a nucleic acid molecule for evaluating the risk of developing hereditary multiple osteochondroma, wherein the nucleic acid molecule comprises a nucleotide sequence as shown in SEQ ID NO: 5 (TACCAACGCTGCTTTGCCTGG).

[0013] On the other hand, the present invention also provides the use of the nucleic acid molecule detection reagent for preparing a kit for evaluating the risk of developing hereditary multiple osteochondroma.

[0014] On the other hand, the present invention also provides the use of a reagent for detecting the SNP marker in the preparation of a kit for evaluating the risk of developing hereditary multiple osteochondroma.

[0015] On the other hand, the present invention also provides the use of a reagent for regulating the expression of the gene FUT7 where the SNP marker is located in the preparation of a drug for treating hereditary multiple osteochondroma.

[0016] On the other hand, the present invention also provides a set of specific primers for detecting the SNP markers, wherein the nucleotide sequences of the primers are shown in SEQ ID NOs: 1 to 4.

[0017] The present invention is easy to obtain materials, only requires the peripheral blood of the tester, and is easy to operate. SNPs are detected by specific amplification primers, and the individual's risk of disease is evaluated by the SNP results. The molecular diagnostic method of the present invention can accurately identify the high-risk population of hereditary multiple osteochondroma and guide them to take preventive intervention measures. The present invention also reveals a new potential therapeutic target FUT7 for hereditary multiple osteochondroma, which can be used to guide the treatment measures for patients with hereditary multiple osteochondroma, so as to be applied to scientific research and clinical work. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The figure shows that the gene FUT7 regulates the expression of the hereditary multiple osteochondroma pathogenic gene EXT1. (A) After knocking down the expression of FUT7 or Fut7 in COS7 or ATDC5 cell lines using siRNA, the expression changes of EXT1 or Ext1 mRNA were detected by qPCR. (B) FUT7WT or FUT7p.phe298Cys was overexpressed in COS7 or ATDC5 cell lines, and the expression changes of EXT1 or Ext1 mRNA were detected by qPCR. (C) FUT7WT or FUT7p.phe298Cys was overexpressed in COS7 or ATDC5 cell lines, and the expression changes of EXT1 protein were detected by western blot. *, p<0.05; ***, p<0.001; ****, p<0.0001.

[0019] Figure 2 The Sanger sequencing signal peak diagram of the rs557364026 (Chr9: 139925298-A>C) T / G heterozygous (HME risk type) site is shown, and the arrows in the figure point to double peaks.

[0020] Figure 3 This is a sequence alignment information diagram obtained by Sanger sequencing of PCR products. The red font G is the mutation site, and the black bold font T is the base corresponding to the mutation site in the genome. DETAILED DESCRIPTION

[0021] In order to more concisely and clearly demonstrate the technical solutions, objectives and advantages of the present invention, the present invention is further described in detail below in conjunction with specific embodiments.

[0022] Whole-exome sequencing (WES) can efficiently screen out susceptible SNPs for the disease. First, the inventors used the whole-exome sequencing method to obtain a risk site for hereditary multiple osteochondroma: rs557364026 (Chr9: 139925298-A>C, FUT7c.893T>G, p.Phe298Cys). The sequence information of the 10bp before and after the above SNP site is as follows: TACCAACGCT[T / G]CTTTGCCTGG. The nucleic acid molecule containing this sequence (SEQ ID NO: 5 (TACCAACGCTGCTTTGCCTGG)) can be used to evaluate the risk of hereditary multiple osteochondroma. Then, the function of the gene FUT7 where the SNP site is located is analyzed to determine the relationship between FUT7 and hereditary multiple osteochondroma and clarify its mechanism of action, and evaluate its potential as a new therapeutic target.

[0023] The present invention further clarifies that the gene where the SNP is located - FUT7 has an important regulatory effect on hereditary multiple osteochondroma. FUT7 can regulate the expression of hereditary multiple osteochondroma pathogenic gene EXT1, revealing a new potential therapeutic target for hereditary multiple osteochondroma.

[0024] The above risk susceptibility loci were obtained by the following method:

[0025] 1. Sample collection: Peripheral blood specimens and clinical data were collected from patients with hereditary multiple osteochondroma and healthy controls in a HME family.

[0026] 2. Genomic DNA extraction, WES library construction and sequencing: Genomic DNA from peripheral blood was extracted using the DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA). The Human All Exon Kit (Agilent Technologies, USA) was used for exon enrichment and amplification to construct the library, and finally the library was sequenced.

[0027] 3. Statistical analysis: For WES analysis, the process includes data quality control, variant calling, and candidate candidate list. First, the raw data was quality controlled using fastQC, and the adapter sequences were removed using cutadapt. Then, the sequencing sequences were aligned with the human reference genome (GRCh37 / hg19) using BWA, and the bam files were classified and PCR duplicates were removed using picard. Next, the Genome analysis tool kit (GATK) was used to perform local indel alignment, base call recalibration, and haplotype calling according to the GATK process. Further, in order to determine the candidate mutations, the known common SNPs and indexes were first compared with the 1000Genome Project and dbSNP138 to screen out the candidate mutations. Subsequently, the remaining SNPs were further shortlisted if they were defined as deleterious mutations by the Protein Variant Effect Analyzer (PROVEAN). Finally, the candidate genes for deleterious mutations shared by affected family members were screened using the data of the ExomeAggregation Consortium. In addition, Sanger sequencing was further used for verification.

[0028] Example 1

[0029] 1. Extract DNA from samples:

[0030] Use DNeasy Blood and Tissue Kit to extract genomic DNA from peripheral blood. According to the product instructions, the specific steps are as follows:

[0031] (1) Draw 3 mL of peripheral blood from patients with hereditary multiple osteochondroma or controls and place it in an EDTA anticoagulant tube.

[0032] (2) Add 1 mL of anticoagulated blood to a 15 mL centrifuge tube, add 20 μL of proteinase K and 2.4 mL of Buffer AL, vortex to mix, and incubate in a 70°C water bath for 30 min (shake occasionally until the solution becomes clear).

[0033] (3) Add 2 mL of anhydrous ethanol and vortex to mix again; add the above mixture to the filter column twice, centrifuge at 3000 rpm for 3 minutes, and discard the filtrate.

[0034] (4) Add 2 mL of Buffer AW1 to the column, centrifuge at 5000 rpm for 1 min, and discard the filtrate.

[0035] (5) Add 2 mL of Buffer AW2 to the column, centrifuge at 5000 rpm for 1 min, and discard the filtrate.

[0036] (6) Dry the column by centrifugation at 5000 rpm for 3 minutes and transfer to a sterile 1.5 mL centrifuge tube.

[0037] (7) Add 150 μL Buffer AE, incubate at room temperature for 5 minutes, and centrifuge at 5000 rpm for 5 minutes.

[0038] (8) DNA quality test: use The DNA concentration was tested by 2.0, and the DNA integrity was tested by 0.7% agarose gel electrophoresis.

[0039] 2. Whole-exome sequencing library construction and sequencing

[0040] (1) Genomic DNA fragmentation and recovery: First, 3 μg of DNA was taken and ultrasonically sheared using a sonicator (Covaris M220); then, the fragments were recovered using the Agencourt AMPure XP kit (Beckman Coulter, USA) at a ratio of DNA solution: beads = 1:1.5 according to the product instructions. Finally, the Agilent DNA 1000 kit and Agilent Bioanalyzer 2100 were used to detect whether the sheared fragment size met the requirements (the average size should be about 250 bp).

[0041] (2) Exon library construction: according to The method was carried out according to the instructions of the Human All Exon Kit (Agilent Technologies, USA), which generally included the following steps: DNA fragment end repair and linker addition, hybridization, exon capture and fragment size selection, and the fragment length was selected to be 300-500bp.

[0042] (3) Library sequencing: Use Agilent DNA 1000 kit to detect sample concentration and fragment size, then dilute the sample to 10 nM and submit for sequencing. Use Illumina sequencing platform and perform sequencing strictly according to the manufacturer's recommended parameters to obtain raw sequencing data.

[0043] 3. Bioinformatics Analysis

[0044] The analysis process of WES analysis includes quality control, finding variant sites, and candidate gene screening.

[0045] (1) The raw data were quality checked by fastQC and the adapters were removed using cutadapt.

[0046] (2) Clean reads were aligned to the human reference genome (UCSC hg 19) using BWA, and the bam files were sorted and PCR duplicate sequences were removed using picard.

[0047] (3) According to the Genome Analysis Toolkit (GATK) best practice process, GATK was used to perform indel alignment, base call recalibration, and haplotype calling.

[0048] (4) Filtering SNVs: Remove known SNVs based on dbSNP and 1000 Genomes Project data.

[0049] (5) Selection of candidate functional SNVs: Use SIFT or PolyPhen software to analyze SNVs and predict SNVs that cause functional changes in proteins. In addition, use Exome Aggregation Consortium data to screen candidate genes with deleterious mutations shared by affected family members.

[0050] (6) Verification of candidate SNVs: Peripheral blood genomic DNA was used as a template, and PCR amplification and sequencing were used to determine the correctness of the SNVs. At the same time, the Sanger sequencing method was used to detect other cases for genes enriched with candidate SNVs. It was finally determined that rs557364026 (Chr9: 139925298-A>C, FUT7c.893T>G, p.Phe298Cys) was closely related to the onset of hereditary multiple osteochondroma.

[0051] 4. Gene Function Analysis

[0052] (1) Design siRNAs that specifically knock down human FUT7 and mouse FUT7 based on the FUT7 sequence.

[0053] (2) Construct expression vectors that overexpress FUT7 wild type (FUT7WT) and FUT7 mutant (FUT7c.893T>G, p.Phe298Cys).

[0054] (3) In COS-7 and ATDC5 cell lines, FUT7 was knocked down or overexpressed, respectively, and the expression changes of EXT1, a pathogenic gene of multiple osteochondromas, in the cell lines were detected. The results showed that knocking down FUT7 or Fut7 could reduce the expression of EXT1 or Ext1 mRNA in COS7 or ATDC5 cells ( Figure 1 , A). Conversely, overexpression of FUT7WT can promote the expression of EXT1 or Ext1 mRNA. At the same time, compared with FUT7WT, FUT7mutant (FUT7c.893T>G, p.Phe298Cys) can reduce the expression of EXT1 or Ext1 mRNA ( Figure 1, B). At the same time, overexpression of FUT7WT can promote the expression of EXT1 protein in COS7 or ATDC5 cells. At the same time, compared with FUT7WT, FUT7mutant (FUT7c.893T>G, p.Phe298Cys) can reduce the expression of EXT1 protein ( Figure 1 , C).

[0055] The above results suggest that FUT7 plays an important regulatory role in hereditary multiple osteochondromas, and its mutation (FUT7c.893T>G, p.Phe298Cys) reduces the expression level of EXT1, a key pathogenic gene in hereditary multiple osteochondromas. Therefore, FUT7 can be used as a new potential therapeutic target. For example, using drugs to promote high expression of FUT7 in cartilage can help further increase the expression level of EXT1, thereby reducing the risk of multiple osteochondromas. For patients who have already developed multiple osteochondromas, targeted increase in FUT7 expression may reduce their multiple sites and slow down the disease, which is a potential new treatment mechanism.

[0056] Example 2: Use of prediction kit

[0057] (1) Extract genomic DNA from the peripheral blood of the subject using the above method.

[0058] (2) First, a specific first external primer was used to amplify a fragment containing the rs557364026 (Chr9: 139925298-A>C) site. The primer information is shown in Table 1:

[0059] Table 1: Amplification primers

[0060]

[0061] The first round of PCR reaction system used HS (Premix) (TaKaRa, Code No R040Q). The composition of the PCR reaction solution (50 μL system) is shown in Table 2, and the reaction conditions are shown in Table 3:

[0062] Table 2: First round PCR reaction system

[0063] Reagents Usage Final concentration PrimeSTAR HS(Premix) 25μL 1x FUT7F1 10-15 pmol 0.2-0.3uM FUT7R1 10-15 pmol 0.2-0.3uM Peripheral blood genomic DNA <200ng Sterilized water Up to 50 μL

[0064] Table 3: First outer primer PCR reaction conditions

[0065]

[0066] After the first round of PCR reaction, the PCR product was diluted 10 times for later use.

[0067] (3) Amplify the fragment containing the rs557364026 (Chr9: 139925298-A>C) site using a specific second pair of inner primers. The composition of the second round of PCR reaction solution (50 μL system) is shown in Table 4, and the PCR reaction conditions are shown in Table 5:

[0068] Table 4: Second round PCR reaction system

[0069] Reagents Usage Final concentration PrimeSTAR HS(Premix) 25μL 1x FUT7F2 10-15 pmol 0.2-0.3uM FUT7R2 10-15 pmol 0.2-0.3uM The first PCR product after dilution 2μL Sterilized water Up to 50 μL

[0070] Table 5: PCR reaction conditions for the second pair of inner primers

[0071]

[0072] (4) Electrophoresis: Perform DNA electrophoresis to check the target band (the fragment size is consistent with expectations and the band is single).

[0073] (5) Sanger sequencing: Perform Sanger sequencing on a single band in the PCR product. Use the primers in the above directions to perform sequencing, thereby obtaining the sequence information of the fragment and combining it with the peak graph file in ab1 format of the sequencing result.

[0074] (6) Analysis of sequencing results: The corresponding genotype of the subject is obtained based on the sequence information comparison, and the peak graph can distinguish heterozygous carriers.

[0075] (7) Risk assessment: The individual's risk of developing multiple osteochondromas is assessed based on the genotype information of the locus and the risk level is divided.

[0076] Example 3: Application Example

[0077] SNP typing was performed on one sample using the above method.

[0078] The specific steps are as follows:

[0079] 1. Preparation of sample DNA: DNA was extracted according to the method of Example 1, with a DNA concentration of 80 ng / μL, about 50 μL, 260 / 280=1.90.

[0080] 2. PCR amplification and Sanger sequencing: After two rounds of nested PCR using the primers in Table 1, the single tape was sent to Sanger sequencing to obtain the sequencing peak graph and genotype information containing the SNP. Figure 2 As shown, the peak graph can clearly identify the signal of the detected SNP, indicating that the corresponding primer sequence is reasonably designed and the PCR product is accurate and reliable.

[0081] 3. Alignment of sequencing sequences with the reference genome: Using the online alignment database (http: / / genome.ucsc.edu / cgi-bin / hgBlat), the sequences obtained by Sanger sequencing were aligned to the human reference genome (GRCh37 / hg19). Figure 3 As shown, the comparison results show that the products obtained by PCR are all located in the pre-designed amplification interval, covering the detected SNP. This site can play a role in predicting the risk of hereditary multiple osteochondroma.

Claims

1. A SNP marker for evaluating the risk of hereditary multiple osteochondroma, characterized in that: The SNP marker is rs557364026, and the mutation form is A>C.

2. A kit for evaluating the risk of hereditary multiple osteochondroma, characterized in that: The kit comprises specific primers for detecting the amplified SNP site according to claim 1.

3. The kit according to claim 2, characterized in that The nucleotide sequences of the primers are shown in SEQ ID NOs: 1 to 4.

4. A method for evaluating the risk of developing hereditary multiple osteochondroma, characterized in that: By detecting the SNP marker according to claim 1, the gene type of the SNP marker amplification product is identified, and when the rs557364026 gene type in the detection result is C, it is determined to be a high-risk population.

5. A nucleic acid molecule for evaluating the risk of hereditary multiple osteochondroma, characterized in that: The nucleic acid molecule comprises the nucleotide sequence shown in SEQ ID NO:

5.

6. Use of the nucleic acid molecule detection reagent according to claim 5 for preparing a kit for evaluating the risk of developing hereditary multiple osteochondroma.

7. Use of a reagent for detecting the SNP marker according to claim 1 in the preparation of a kit for evaluating the risk of developing hereditary multiple osteochondroma.

8. Use of an agent for regulating the expression of the gene FUT7 where the SNP marker according to claim 1 is located in the preparation of a drug for treating hereditary multiple osteochondroma.

9. A set of specific primers for detecting the SNP marker according to claim 1, characterized in that: The nucleotide sequences of the primers are shown in SEQ ID NOs: 1 to 4.

Images