Application of a porcine body length-related single nucleotide polymorphism marker

By detecting single nucleotide polymorphism sites in the PTCH1 gene of pigs, individuals with excellent body length were screened, which solved the shortcomings of existing technologies in evaluating the body length trait of pigs and enabled rapid breeding and improved economic benefits.

CN119193859BActive Publication Date: 2026-05-26AGRI GENOMICS INST CHINESE ACADEMY OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
AGRI GENOMICS INST CHINESE ACADEMY OF AGRI SCI
Filing Date
2024-11-07
Publication Date
2026-05-26

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

This invention discloses the application of a single nucleotide polymorphism (SNP) marker associated with pig body length. The SNP marker is located at a C / T polymorphism site at 26,447,347 bp on chromosome 10 of the pig reference genome Sscrofa11.1 version. Individuals with the CC genotype at this site exhibit significantly larger body length phenotype values. The molecular marker significantly associated with pig body length provided by this invention can be used for early selection of larger pigs, thereby accelerating the breeding of superior pig breeds and improving the economic benefits of pig production enterprises.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and livestock breeding technology, and relates to a method for assessing pig body length. PTCH1 Gene single nucleotide polymorphism markers and their detection methods. Background Technology

[0002] Pig body size directly affects meat production performance and is also closely related to reproductive performance, making it an important trait in domestic pig breeding. Body length is a complex quantitative trait influenced by both environmental and genetic factors, but currently, information on the major genes controlling body length and causal mutations in pigs is still very limited.

[0003] Single nucleotide polymorphisms (SNPs) are polymorphisms arising from mutations in a single base in the genomic DNA sequence. These mutations include transversions, transitions, insertions, and deletions. Discovering SNP markers associated with pig body length is of great significance for improving pig body length traits and breeding superior pig breeds. For example, Xu Pan et al. reported... NR6A1 Gene g.299084751 C>T site and VRTN The merged genotype at the InDel locus of the gene has a significant effect on the body length trait of Sujiang pigs (see reference: Sujiang pigs). NR6A1 and VRTN Gene polymorphism and its association with productive traits. Animal husbandry and veterinary medicine, 2022, 54(04):10-16.

[0004] Genome-wide association analysis (GWAS) is one of the main methods for identifying genetic relationships between phenotypes and genotypes. For example, Wang et al. reported 13 candidate genes (…). ATP5O , GHRHR , TRIM55 , EIF2AK1 , PLEKHA1, BRAP , COL11A2 , HMGA1 , NHLRC1 , SGSM1, NFATC2 , MAML1 , PSD3 The association between ) and growth traits in pigs (see reference: Genome-Wide Association Study of Growth Traits in a Four-Way Crossbred Pig Population. Genes, 2022, 13(11).). Currently, no information on pigs has been found. PTCH1 Reports of a correlation between gene variation and body size. Humans PTCH1The gene contains 24 exons (23 of which are coding exons), located between 9q22.3 and 31, and encodes a 1447-amino acid, twelve-times transmembrane protein, which is the membrane receptor for the Hedgehog protein in the Hedgehog signaling pathway. The Hedgehog signaling pathway plays an important role in early embryonic development, but it cannot be used to determine… PTCH1 The major genes that determine growth traits such as body length in pigs. Summary of the Invention

[0005] The purpose of this invention is to provide an application of porcine body length-related single nucleotide polymorphism markers.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A sort of PTCH1 The method for detecting single nucleotide polymorphisms (SNPs) includes the following steps:

[0008] Genomic DNA was extracted from the pig individuals to be tested, and the genotype of the single nucleotide polymorphism site located at 26447347 bp on chromosome 10 of the pig reference genome Sscrofa11.1 version sequence was identified.

[0009] Preferably, the identification specifically includes the following steps: using the genomic DNA as a template, amplifying the DNA containing the single nucleotide polymorphism site by PCR. PTCH1 Gene fragments are amplified, and the genotype of the single nucleotide polymorphism site is determined based on the sequencing results.

[0010] Preferably, the amplification primers used in the PCR are:

[0011] Upstream primer F1: 5`-TGGACCATTGGGTCAAGTT-3`

[0012] Downstream primer R1: 5`-GACTAGCTGTTGAGCCAGAT-3`.

[0013] A sort of PTCH1 A single nucleotide polymorphism (SNP) detection kit, comprising a method for amplifying genes containing the aforementioned SNP sites. PTCH1 Primers for partial gene fragments, such as the upstream primer F1 and downstream primer R1 mentioned above.

[0014] A sort of PTCH1 Application of single nucleotide polymorphism (SNP) sites in marker-assisted selection breeding of pigs, wherein the SNP sites are located at 26447347 bp on chromosome 10 of the pig reference genome Sscrofa11.1 version sequence.

[0015] The above PTCH1 Application of single nucleotide polymorphism sites in assessing pig body length.

[0016] The above PTCH1 Application of single nucleotide polymorphism sites in assessing pig growth rate.

[0017] The above PTCH1 Application of single nucleotide polymorphism detection methods in marker-assisted selection breeding of pigs.

[0018] Preferably, the single nucleotide polymorphism site has a C / T polymorphism, with two alleles, C and T, where C is the reference base.

[0019] Preferably, individuals with the genotype CC have a larger body length phenotype value compared to individuals with the genotypes CT or TT.

[0020] Preferably, the pigs to be tested are Sujiang pigs or Yunan black pigs, among which individuals with the CC genotype have better body length. For example, in the Sujiang pig population, individuals with the CC genotype have significantly better body length than individuals with the TT genotype.

[0021] The beneficial effects of this invention are reflected in:

[0022] This invention detects pigs at the molecular level PTCH1 By identifying SNP loci in genes, pig individuals with high body length phenotypic values ​​can be selected early on based on the corresponding SNP markers. This allows for the rapid establishment of genetically superior pig populations, accelerating the selection of superior pig breeds and shortening the time required for molecular breeding. The SNP markers related to pig body length provided by this invention not only enrich the molecular markers used in marker-assisted selection and breeding but can also be used to screen for fast-growing pig populations, thereby increasing the economic value of pig herds, saving breeding costs, and improving the economic benefits of pig production enterprises. Attached Figure Description

[0023] Figure 1 Box plot of the CC and CT genotype effects of the SNP locus at 26447347bp on chromosome 10 of the Yuzhou Black Pig.

[0024] Figure 2 Box plots showing the genotypic effects of CC, CT, and TT at the SNP locus at 26447347bp on chromosome 10 of the Sujiang pig. Detailed Implementation

[0025] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. The embodiments described are for illustrative purposes only and are not intended to limit the scope of protection of the present invention.

[0026] (a) Obtaining SNP loci

[0027] 1. Experimental pig population and sampling

[0028] Thirty Yuhai black pigs from the Yuhai Black Pig Breeding Farm in Gushi County, Xinyang City, Henan Province were used as the experimental pig group. Ear tissues were collected from individuals in the experimental pig group (sampled in July 2022) and brought back to the laboratory for cryopreservation.

[0029] Using 164 Sujiang pigs from Sujiang Breeding Pig Co., Ltd. in Taixing City, Taizhou City, Jiangsu Province as the experimental pig group, ear tissue was collected from individuals in the experimental pig group (sampled in February 2021) and brought back to the laboratory for cryopreservation.

[0030] 2. DNA extraction and SNP detection

[0031] Genomic DNA was extracted from ear tissues collected from the experimental pig population using a kit (Genome DNA Extraction Kit, Tiangen Biotech Co., Ltd.).

[0032] Genomic DNA for SNP chip assays should meet the following conditions: OD values ​​should be measured using a NanoDrop2000 UV spectrophotometer, with A260 / A280 between 1.8 and 2.1; and 1% agarose gel electrophoresis should be performed to ensure clear bands.

[0033] DNA samples (genomic DNA from individuals in the Henan Black Pig experimental population) that passed the testing were collected. Whole-genome SNP detection was performed using a porcine 80K functional locus gene chip, and genotyping was performed using GenCall Version 7.0.0 software. During genotyping, sequences of polymorphic sites were extracted using R language, and the genotype and allele frequencies of SNP sites were statistically analyzed. SNP sites with a genotype detection rate of less than 95% were removed; SNP sites with a Hardy-Weinberg equilibrium chi-square test p-value less than 1.0E-6 were removed; and SNP sites on sex chromosomes were removed. The genotyping results of the SNP site located at 26447347 bp on chromosome 10 in the porcine reference genome Sscrofa 11.1 version sequence are shown in Table 1.

[0034] Table 1. Gene frequency statistics of the SNP locus at 26447347 bp in the experimental pig population (Yunan Black Pig).

[0035]

[0036] DNA samples that passed the initial testing (genomic DNA from individuals in the Sujiang pig experimental population) were amplified by PCR, gel electrophoresis, gel recovery, and sequencing to obtain the genotyping results of the SNP locus located at 26447347 bp on chromosome 10 of the pig reference genome Sscrofa11.1 version sequence, as shown in Table 2.

[0037] Table 2. Gene frequency statistics of the SNP locus at 26447347 bp in the experimental pig population (Sujiang pigs).

[0038]

[0039] As can be seen from Tables 1 and 2, for the experimental pig population, the SNP locus at 26447347 bp (this locus is in pigs) PTCH1 The dominant allele (in terms of genes) is C, and CC is the dominant genotype.

[0040] (II) Genome-wide association analysis and large-scale population validation

[0041] 1. Phenotypic value determination of body size

[0042] Body length refers to the distance from the occipital bone ridge to the tail root of a pig, which is the total length of the neck, chest, waist, sacrum and anterior coccyx measured from the midpoint of the line connecting the upper edges of the left and right ear roots.

[0043] According to the methods specified in the "Specifications for Performance Testing of Breeding Pigs" (NY / T 822-2019) and "Technical Specifications for Performance Testing of Lean-type Breeding Pigs" (GBT 8467-1987), the body length of individual pigs (specifically referring to individuals in the experimental groups of Yuzhou Black Pigs and Sujiang Pigs) was measured at approximately 150 days of age, as follows:

[0044] When the pig (live) is relatively still and standing on flat ground, use a soft measuring tape to measure along the midline of its back, close to the surface of its body. The unit is centimeters (cm).

[0045] During the determination of body length phenotypic values, individuals with a corresponding phenotypic value when the number of individuals with a certain genotype is too small (e.g., 1) are removed; individuals whose deviation from the mean is greater than 3 times the standard deviation are removed; and individuals with missing phenotypic values ​​are removed.

[0046] 2. Genome-wide association analysis

[0047] Genome-wide association analysis was performed on all SNP loci identified by SNP microarray assays and their correlation with body length in pigs (including Henan Black Pigs) using GEMMA Version 0.98.3. The Bonferroni method was used to test for significant differences in genotype and phenotypic data using R language. P-value < 0.05 / SNP locus number indicates significant difference. Table 3 shows the association analysis results between different genotypes of the SNP locus located at 26447347 bp on chromosome 10 of the pig reference genome Sscrofa11.1 and the body length of the Yuzhou Black Pig:

[0048] Table 3. Results of phenotypic association analysis of the SNP locus at 26447347 bp in Yuzhou Black Pig.

[0049]

[0050] The analysis results (Table 3) show that different genotypes (specifically CC and CT) at the SNP locus at 26447347 bp are significantly associated with the body length trait of Yuzhou Black Pigs. Individuals with the two genotypes showed significant differences in body length, with the CC genotype individuals being statistically significantly longer than the CT genotype individuals. Further analysis of the genotype effects using the ggplot2, ggpubr, and magrittr functions in R language yielded the following results: Figure 1 As shown. By Figure 1 It can be seen that the body length phenotypic value of the CC genotype Yu Nan Black Pig is 2.7 cm larger than that of the CT genotype Yu Nan Black Pig.

[0051] 3. Validate the association analysis between different SNP genotypes and body length in the population.

[0052] Preliminary analysis results showed that the three genotypes at the SNP locus at 26447347bp did not differ significantly in body length trait in Sujiang pigs (Table 4-1). However, considering that both Yunan Black Pig and Sujiang Pig are hybrid breeds, it is only necessary to determine whether another homozygous genotype (i.e. TT) has the application value as a molecular marker. Further association analysis of body length traits between Sujiang pigs with CC and TT genotypes, between Sujiang pigs with CT and TT genotypes, and between Sujiang pigs with CT and CC genotypes showed that: (1) the body length of Sujiang pigs with CC genotype was statistically significantly greater than that of Sujiang pigs with TT genotype (Table 4-2); (2) the body length of Sujiang pigs with CT genotype was statistically significantly greater than that of Sujiang pigs with TT genotype (Table 4-3); (3) there was no statistically significant difference in body length between Sujiang pigs with CC genotype and CT genotype (P=0.731).

[0053] Table 4-1. Trait association analysis results of SNP locus at 26447347bp in Sujiang pigs.

[0054]

[0055] Table 4-2. Trait association analysis results of SNP locus at 26447347bp in Sujiang pigs.

[0056]

[0057] Table 4-3. Trait association analysis results of SNP locus at 26447347bp in Sujiang pigs.

[0058]

[0059] Further analysis of the effects of the three genotypes was conducted using the ggplot2, ggpubr, and magrittr function packages in R. The results are as follows: Figure 2 As shown. By Figure 2 It can be seen that the body length phenotypic value of Sujiang pigs with CC genotype is 8.68 cm larger than that of Sujiang pigs with TT genotype.

[0060] Therefore, the CC genotype at the SNP site at 26447347bp is a candidate SNP marker associated with pig body length.

[0061] (III) Application of SNP markers in evaluating body length traits in pigs and in trait genetic improvement and breed selection

[0062] Step i: Taking the rapid establishment of a fattening pig population with body length trait advantage at an early stage (e.g., at birth) as an example, extract the genomic DNA of the individual Sujiang pig to be tested;

[0063] Step ii: The genomic DNA of the individual Sujiang pig to be tested was amplified by PCR using primer pairs to obtain the amplification products; the primer pair sequences are as follows:

[0064] F1: 5`-TGGACCATTGGGTCAAGTT-3` (ie SEQ.ID.NO.1)

[0065] R1: 5`-GACTAGCTGTTGAGCCAGAT-3` (ie SEQ.ID.NO.2)

[0066] Step iii: Perform electrophoresis, target fragment recovery, and sequencing on the amplified products to obtain the SNP site (SNP site at position 26447347 bp on chromosome 10 of the porcine reference genome Sscrofa11.1 version sequence). PTCH1 The nucleotide sequence of the partial gene fragment (i.e., the 565bp target fragment) is as follows (i.e., SEQ.ID.NO.3):

[0067] 5`-TGGACCATTGGGTCAAGTTTGACAACGAAGTGGAATTTCTTCCAGAAACCTAAAAAGAAAAAAAAAAAAAGAATAAAATCCTATGCAGTCAGTTTCATTCCTTAACCTTTAAAATGCTCTATCCAGAATAAAATTGACAG CACTTGCCAACTTTTAATGGTGTTCCTCAAGCCAAGCATGAGCAAATTTGGCTTTCTTGTGGTAGCTGGAAGCCAAGAGCAGGTTCGGAGAATGACACACAGGGCTGAAGTCCTCCGGGCAAAAGAGGAAGATCCCAGTTCTAT CCCAGGGAGAAGGTCAGACACCTGACAGGCA[C / T]GCTGGCCCCAAGCGATGCAGCGGAGAATGGCAGGGCCGTGTGCAGATGGTCACAGATGAACCTCCCAGGGAGAAGGGCAGTGGGACTGGGCAGAGATGAGTATCTGAA CAGACTAGTTTATAGCTTGCAGAGGGTTACAAAGTAGCCGTGGCGCTCTGCTCACATACAGAGAGGGGGCCTTCAAATGGAAAAGAACTACCCTATGCAAGAAATCTCCTTTAAGACCCCAAATCTGGCTCAACAGCTAGTC-3`

[0068] Step iv: Based on the sequencing results, obtain the genotype of the individual Sujiang pig to be tested at the SNP locus;

[0069] Step v: When the genotype of the Sujiang pig to be tested is CC, it indicates that it has a large body length phenotype value; when the genotype is TT, it indicates that it has a relatively small body length phenotype value.

[0070] Step vi: Repeat the above steps and retain individuals with the CC genotype in the tested Sujiang pig population, while culling individuals with the TT genotype (individuals with the detected CT genotype may or may not be retained).

[0071] In summary, the SNP locus located at 26,447,347 bp on chromosome 10 of the pig reference genome Sscrofa11.1 version sequence discovered in this invention has the potential to serve as a molecular marker (specifically, an SNP marker) for assessing pig body length. This marker can be used in molecular breeding to improve pig growth traits. Furthermore, by selecting pig individuals carrying this SNP marker, fast-growing pig populations can be screened out (individuals with larger body length phenotypic values ​​specifically exhibit faster growth in pig production), thereby achieving the goal of improving pig production efficiency.

Claims

1. A kind PTCH1 The application of single nucleotide polymorphism detection methods in marker-assisted selection breeding of Sujiang pigs is characterized by: The PTCH1 The method for detecting a genetic single nucleotide polymorphism comprises the following steps: Genomic DNA of pigs to be tested was extracted, and the genotype of the single nucleotide polymorphism site located at 26447347 bp on chromosome 10 of the pig reference genome Sscrofa11.1 version sequence was identified. The single nucleotide polymorphism site has a C / T polymorphism, with two alleles, C and T, respectively; individuals with genotype CC or CT have a larger body size than individuals with genotype TT.

2. The application according to claim 1, characterized in that: The identifying specifically comprises the following steps: taking the genomic DNA as a template, amplifying a gene fragment containing the single nucleotide polymorphism site by PCR, sequencing the amplified fragment, and determining the genotype of the single nucleotide polymorphism site according to the sequencing result. PTCH1 gene fragment, sequencing the amplified fragment, and determining the genotype of the single nucleotide polymorphism site according to the sequencing result.

3. Use according to claim 2, characterized in that: The amplification primers used in the PCR were: Upstream primer: 5`-TGGACCATTGGGTCAAGTT-3` Downstream primer: 5`-GACTAGCTGTTGAGCCAGAT-3`.

4. A method of detecting PTCH1 The application relates to the application of a reagent for detecting a single nucleotide polymorphism site of a gene in body length marker-assisted selection breeding of Sus scrofa, characterized in that: The single nucleotide polymorphism (SNP) site is located at 26,447,347 bp on chromosome 10 of the pig reference genome Sscrofa 11.1 version sequence; the SNP site has a C / T polymorphism, with two alleles, C and T; individuals with genotype CC or CT have a larger body length than individuals with genotype TT.

5. A detection method PTCH1 The application of reagents for single nucleotide polymorphism sites in assessing body length in Sujiang pigs is characterized by: The single nucleotide polymorphism (SNP) site is located at 26,447,347 bp on chromosome 10 of the pig reference genome Sscrofa 11.1 version sequence; the SNP site has a C / T polymorphism, with two alleles, C and T; individuals with genotype CC or CT have a larger body length than individuals with genotype TT.