LF-RPA primer and probe for detecting streptococcus mutans, kit and detection method thereof

Abstract

The invention relates to the technical field of medicine and biology, and discloses an LF-RPA primer, a probe, a kit and a detection method for detecting streptococcus mutans, the LF-RPA primer and the probe are SM GTFB gene specific primers and the probe, the GTFB gene specific primers comprise a forward primer and a reverse primer labeled by biotin, and the reverse primer is an SM GTFB gene specific primer. The forward primer is selected from one or more of a forward primer 1, a forward primer 2 and a forward primer 3; the reverse primer labeled by biotin is selected from one or more of a reverse primer 1, a reverse primer 2 and a reverse primer 3. According to the invention, RPA (recombinase polymerase amplification) isothermal amplification is introduced, and a laser flow rapid detection technology is combined. Compared with the conventional nucleic acid amplification technology, the kit disclosed by the invention is simple and convenient to operate, visual in result and relatively high in specificity and accuracy.

Description

Technical Field

[0001] The invention relates to the fields of medicine and biotechnology, and in particular to a LF-RPA primer and probe, a kit and a detection method thereof for detecting mutans streptococci. Background Art

[0002] Dental caries is the most common oral disease. It is a chronic destructive disease of dental hard tissue caused by multiple factors, mainly bacteria. Streptococcus mutans (abbreviated as SM) is one of the main pathogens of dental caries. It can adhere to the surface of dental tissue to aggregate, proliferate, and metabolize to form bacterial biofilms, thereby colonizing the oral cavity and causing dental caries. Streptococcus mutans metabolizes sugar to produce glucan. Under the mediation of glucan, Streptococcus mutans adheres and aggregates on the acquired film on the tooth surface to form a plaque biofilm. In the biofilm environment, bacteria produce acid to demineralize and destroy the tooth surface, causing dental caries.

[0003] As an important cariogenic factor of Streptococcus mutans, glucosyltransferase plays an important role in bacterial attachment and plaque formation. Inactivation of the gtf gene of Streptococcus mutans will significantly reduce its sucrose-dependent adhesion, change the biofilm structure, and reduce cariogenicity to varying degrees. There are at least three types of glucosyltransferase in Streptococcus mutans, including gtf-1 encoded by gtfB, gtf-SI encoded by gtfC, and gtf-S encoded by gtfD. Among them, gtfB and gtfC, which have the ability to synthesize water-insoluble glucans, are essential for the adhesion of Streptococcus mutans.

[0004] The traditional method of detecting and identifying Streptococcus mutans is to separate and culture bacteria, which has obvious defects. Not only are the culture conditions and operations complicated, the detection cycle is long, and the specific sensitivity is greatly limited; with the development of molecular diagnostic technology, a variety of specific, sensitive and rapid microbial detection methods are provided for people, such as ELISA and WestBlot. This method has a certain improvement over the traditional method, but there is a high risk of false positive rate and poor clinical effect; with the progress and maturity of PCR diagnostic technology in recent years, PCR is applied to the field of qualitative and quantitative detection of microorganisms and has received more and more attention from clinical research. For example: in patent CN1737161A, mutans streptococci and trichomoniasis streptococci in saliva are identified by multiple rounds of conventional PCR; patent CN115927684A uses common RT-PCR to rapidly detect and screen pathogens that cause dental caries for Streptococcus mutans, Streptococcus sobrinus, and Lactobacillus casei; patent CN105256048B detects oral pathogens by multiple PCR. However, this type of PCR is not only complicated to operate, but also requires a special laboratory and expensive PCR instrument, and takes a long time. Summary of the invention

[0005] The main purpose of the present invention is to solve the technical problems of the prior art that the PCR operation is complicated and the specificity and accuracy are not high. A LF-RPA primer and probe for detecting Streptococcus mutans, comprising:

[0006] The LF-RPA primers and probe are SM GTFB gene-specific primers and probes, the GTFB gene-specific primers include a forward primer and a reverse primer labeled with biotin, and the forward primer is selected from one or more of forward primer 1, forward primer 2, and forward primer 6;

[0007] The reverse primer labeled with biotin is selected from one or more of reverse primer 1, reverse primer 2, and reverse primer 6;

[0008] The base sequence of the forward primer 1 is: SEQ ID NO: 1;

[0009] The base sequence of the forward primer 2 is: SEQ ID NO: 2;

[0010] The base sequence of the forward primer 6 is: SEQ ID NO: 3;

[0011] The base sequence of the reverse primer 1 is: SEQ ID NO: 4;

[0012] The base sequence of the reverse primer 2 is: SEQ ID NO: 5;

[0013] The base sequence of the reverse primer 6 is: SEQ ID NO: 6;

[0014] The base sequence of the probe is: SEQ ID NO:7.

[0015] The probe consists of an oligonucleotide homologous to a target sequence, wherein the 5' end is labeled with digoxigenin, the 3' end is modified with a group that blocks polymerase amplification, and the probe is modified with a tetrahydrofuran abasic site.

[0016] The present invention relates to a kit for detecting mutans streptococci. The kit comprises a kit A and a kit B. The kit A comprises an RPA reaction mixture and an RPA freeze-dried powder, and the kit B comprises a sample lysate, a diluent, a heating device, a sampler, a detection card, and a desiccant. The RPA reaction mixture comprises the primer and probe according to claim 1 or 2, an RPA dissolving solution, and an activator.

[0017] The sample lysis solution is phosphate buffer and 6M guanidine hydrochloride.

[0018] The sample diluent is phosphate buffered saline.

[0019] The test card comprises a PVC base plate, a sample pad, a reagent pad, an NC film and absorbent paper. The sample pad, the reagent pad, the NC film and the absorbent paper are overlapped in sequence and then pasted on the PVC base plate to form a large test paper plate, which is cut into reagent strips with a width of 3 to 4 mm, and the shell is installed to obtain the test card.

[0020] The sample pad is made of NaH 2 PO4、Na 2 HPO 4 After being treated with solutions of NaCl, PVP, Tween-20, and ProClin300, the cells were dried at 37°C overnight.

[0021] The reagent pad is a digoxin antibody and mouse IgG labeled with nanocarbon, which is diluted 10 times with a diluent and then spread on the conjugate pad and dried at 37° C. overnight.

[0022] The NC membrane is coated with a detection line T line and a quality control line C line which are parallel to each other and are spaced apart by 5 mm. After coating, the membrane is dried at 37° C. overnight.

[0023] The present invention also relates to a LF-RPA detection method for Streptococcus mutans, comprising the following steps:

[0024] Use the sampler in the kit to collect gum, dental plaque and tartar samples from the oral cavity to ensure comprehensive sample collection, and place the collected samples in a sample lysis solution and mix them for later use;

[0025] Take 3ul of the oral sample collected above, add it to the RPA reaction mixture in the kit, mix well, add it to the RPA freeze-dried powder, dissolve and mix well, and incubate at 45℃ for 25min;

[0026] After the reaction is finished, take 10ul of the amplified product and add it to the sample diluent, mix well, and then use a large dropper to add 3 to 4 drops to the sample well of the test card, and wait for 5 to 10 minutes to observe the results;

[0027] Observe the color development directly with the naked eye. If both the quality control line and the test line appear on the test paper at the same time, it indicates that the sample contains Streptococcus mutans. If only the quality control line appears, it is negative. The content of Streptococcus mutans can be determined by the intensity of the color development of the nanocarbon on the test line. Regardless of the color intensity of the test line, the quality control line should appear black. The absence of a color signal on the quality control line means that the test is invalid and the sample must be retested.

[0028] The present invention has the following beneficial effects:

[0029] 1. This patent selects the cariogenic factor glucosyltransferase GTFB gene of Streptococcus mutans to design primers. The primers and probes are specific and have no cross-reactivity with common cariogenic bacteria in the oral cavity, such as Streptococcus sobrinus and Lactobacillus casei.

[0030] 2. This patent adopts RPA isothermal amplification technology, which is a new type of nucleic acid amplification method. Compared with conventional PCR, it has the advantages of rapidity, sensitivity, simplicity, etc., and it gets rid of the limitations of expensive precision instruments and professional technicians. At the same time, it greatly shortens the time of nucleic acid amplification, which helps to improve the detection rate and accuracy of oral mutans streptococci.

[0031] 3. This patented kit uses a combination of RPA isothermal amplification and immunochromatography to achieve visualization of nucleic acid test results. Compared with conventional nucleic acid agarose gel electrophoresis, it has the same effect and can obtain results within 5 to 10 minutes, greatly shortening the detection time. At the same time, it avoids nucleic acid contamination, complex operations and limitations of gel imagers, solving the problem that conventional nucleic acid detection and analysis is not suitable for promotion and application in ordinary laboratories and home self-testing. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 This is the electrophoresis result of GTF B gene primer screening;

[0033] Figure 2 This is the LF-RPA test result;

[0034] Figure 3 This is the LF-RPA test result of the real oral sample;

[0035] Figure 4 This is the BLAST analysis diagram of Chen Yeqing's sequence. DETAILED DESCRIPTION

[0036] For ease of understanding, the specific process of the embodiment of the present invention is described below:

[0037] The kit provided by this patent consists of kit A and kit B. Kit A consists of RPA reaction mixture and RPA lyophilized powder. Kit B consists of sample lysate, diluent, heating device, sampler, detection plate and desiccant.

[0038] The RPA reaction mixture contains SM GTFB gene-specific primers and probes, RPA dissolving solution, activator, etc.;

[0039] RPA lyophilized powder is the basic amplification reagent provided by Suzhou Xinda Gene Technology Co., Ltd.;

[0040] The sample lysis buffer was phosphate buffered saline (PBS) + 6 M guanidine hydrochloride;

[0041] The sample diluent was phosphate-buffered saline (PBS);

[0042] The test card includes a PVC base plate, a sample pad, a reagent pad, an NC film and a water-absorbing paper. The sample pad, the reagent pad, the NC film and the water-absorbing paper are overlapped in sequence and pasted on the PVC base plate to form a large test paper plate, which is cut into reagent strips with a width of 3 to 4 mm, and the shell is installed to obtain the test card.

[0043] The specific primer of the GTFB gene is as follows: the 5' end of the reverse primer is labeled with biotin.

[0044] Forward Primer 1: 5'-TAATATTAGTAAACAAACAACCGAAGCTGATA-3'

[0045] Reverse Primer 1: 5'-Biotin-AGATTACTTCTTGTTGTGACGATATCTTTATT-3'

[0046] Forward Primer 2: 5'-TTCTAATACTAGTGTTGTTACTGCTAATGAAG-3'

[0047] Reverse Primer 2: 5'-Biotin-ATACTTACCATCAATTTCTTTTACATTGGGAA-3'

[0048] Forward Primer 6: 5'-TAGTAGTCAAACTAATCATACAGTAACGACAA-3'

[0049] Reverse Primer 6: 5'-Biotin-GTAAAATTTTGCCATCAGCAATTAATGTAAAA-3'

[0050] The probe is composed of an oligonucleotide homologous to the target sequence, wherein the 5' end is labeled with digoxigenin (Dig), the 3' end is modified with a group that blocks polymerase amplification (C3 Spacer), and the probe is modified with a tetrahydrofuran abasic site (THF). Probe: 5'-Dig-TAATATTAGTAAACAAACAACCGAAGCTGATA(THF)CAGATGTTATTGATG-C3Spacer-3'

[0051] The sample pad is treated with a solution containing NaH2PO4, Na2HPO4, NaCl, PVP, Tween-20, and ProClin300, and then dried at 37°C overnight;

[0052] The reagent pad is a DIG antibody and mouse IgG labeled with nanocarbon, which are diluted 10 times with a diluent and then spread on the binding pad and dried at 37°C overnight;

[0053] The NC membrane is coated with parallel detection lines T and quality control lines C, with a spacing of 5 mm, and dried at 37°C overnight after coating;

[0054] The processed sample pad and reagent pad are sequentially pasted on the coated NC film to form a large plate, which is then cut into 3-4 mm wide test strips, mounted on a plastic part, and sealed and stored at room temperature with a desiccant to obtain the test card.

[0055] This patent provides a LF-RPA detection method for Streptococcus mutans for preventive screening and diagnosis of oral caries, the method comprising the following steps:

[0056] 1. Oral sample collection: Use the sampler provided by the kit to collect gum, dental plaque and tartar samples from the oral cavity to ensure comprehensive sample collection. Place the collected samples in the sample lysis solution and mix well for later use;

[0057] 2. RPA isothermal amplification: Take 3ul (one drop) of the oral sample collected above, add it to the RPA reaction mixture and mix well, add it to the RPA freeze-dried powder, dissolve and mix well, and incubate at 45°C for 25min.

[0058] 3. LF-RPA detection: After the reaction is completed, take 10ul (3 drops) of the amplified product and add it to the sample diluent, mix well, and then use a large dropper to add 3 to 4 drops to the sample well of the detection card, and wait for 5 to 10 minutes to observe the results.

[0059] 4. Result judgment: Observe the color development directly with the naked eye. If both the quality control line and the test line appear on the test paper, it indicates that the sample contains Streptococcus mutans. If only the quality control line appears, it is negative. The content of Streptococcus mutans can be judged by the color development intensity of the nanocarbon on the test line. Regardless of the color development intensity of the test line, the quality control line should be black. No color development signal on the quality control line means that the test is invalid and the sample must be retested.

[0060] Detection principle

[0061] This kit uses RPA isothermal amplification combined with nanocarbon immunochromatography technology and double antibody sandwich method to detect the GTFB gene of Streptococcus mutans.

[0062] LF-RPA detection technology combines RPA technology with lateral flow immunochromatography test strips to achieve rapid visualization of nucleic acid detection. The key point is the probes and primers labeled with digoxigenin and biotin. The lateral flow immunochromatography reagent strip uses nitrocellulose (NC) membrane as the matrix, and streptavidin (SA) conjugate (test line T) and goat anti-mouse IgG antibody (quality control line C) are fixed on the NC membrane. The conjugate pad is labeled with digoxigenin antibody (DIG antibody) and mouse IgG nanocarbon. When testing, the nucleic acid product of the oral sample after RPA isothermal amplification is dripped on the sample addition area of ​​the test strip. The sample will be chromatographed forward under capillary action. Since the two ends of the isothermal amplified Streptococcus mutans DNA fragment contain digoxigenin and biotin labels, they will bind to the nanocarbon-labeled digoxigenin antibody on the conjugate pad and then move forward together. After the sample reaches the detection area, the amplification product and the nanocarbon-labeled digoxin antibody complex and the streptavidin conjugate coated on the detection line re-form a complex, which is manifested as a gray or black detection line. The DNA content of mutans streptococcus glucosyltransferase in the sample is positively correlated with the color intensity of the detection line. After 5 to 10 minutes of room temperature reaction, the color development is directly observed with the naked eye. If the quality control line and the detection line appear on the test paper at the same time, it indicates that the sample contains mutans streptococci. The content of mutans streptococci can be judged by the color intensity of the nanocarbon on the detection line. Regardless of the color intensity of the detection line, the quality control line should be black. The absence of a color signal on the quality control line means that the test is invalid and the sample must be retested. Specific embodiment:

[0064] The test reagent card operation steps are as follows:

[0065] Preparation of sample pad

[0066] Sample pad treatment solution: 10mM PBS, 1% PVP, 1% Tween20, 0.1% ProClin300, pH7.4±0.1. Weigh the reagents according to the above formula, add purified water to dissolve, and adjust the pH. Take 40mL of sample pad treatment solution to evenly treat 254*300mm glass fiber 8964, dry at 37℃ overnight and store.

[0067] Preparation of conjugate pad

[0068] Nanocarbon labeling: First, take 300μL of 1mg / ml nanocarbon, add 0.8mg / mL EDC and NHS 50μL each after ultrasonic dispersion, mix well, and activate at 37℃ for 30min; then add 40μg of digoxin antibody and 40ug of mouse IgG, mix well, and couple at 37℃ for 30min. Then add nanocarbon blocking solution (50mM Tris+2%BSA) and 10% Tween, mix well, and block at 37℃ for 30min. Finally, centrifuge at 13000r / min for 15min, wash once with nanocarbon preservation solution (50mM Tris+0.5%BSA), and store in 200μL nanocarbon preservation solution for later use.

[0069] Bedding: dilute the labeled nanocarbon liquid 10 times with nanocarbon diluent (70mM Tris+1% BSA+10% sucrose+5% trehalose+0.4% TritonX-100, PH=8.2) and mix well. Take 12ml of the mixed liquid to treat 280*300mm glass fiber KB50, dry it at 37℃ overnight and store it.

[0070] Preparation of NC membranes

[0071] The NC membrane was pasted on the PVC base plate, and 1.0 mg / mL goat anti-mouse polyclonal antibody (C line) and 0.1 mg / mL streptavidin conjugate (T line) were coated on the NC membrane using a gold spray film scribing instrument. The distance between the T line and the C line was 5 mm, and the coated NC membrane was dried overnight at 37°C and sealed.

[0072] Large card assembly: stick the absorbent paper (17mm wide), reagent pad (4mm wide) and sample pad (20mm wide) on the coating film alternately in sequence.

[0073] The large card is cut into test strips with a width of 3-4 mm, mounted on a plastic piece, and sealed with a desiccant and a dropper to obtain the test card.

[0074] Screening of specific primers for Streptococcus mutans

[0075] Primer screening: Use conventional PCR-agarose gel electrophoresis to screen specific primers.

[0076] According to the mutans streptococcus GTFB gene, https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi, 4 pairs of primers and 1 probe were designed as shown in Table 1. Conventional PCR was used for primer screening, with mutans streptococcus DNA and mutans streptococcus liquid as positive samples and Helicobacter pylori DNA (HPDNA) as negative samples. The reaction procedure was pre-denaturation at 94℃ for 5min; denaturation at 94℃ for 30s, annealing at 57℃ for 30s, extension at 72℃ for 40s, 35 cycles; extension at 72℃ for 10min. The amplified product was subjected to gel electrophoresis to observe the bands.

[0077] Results: All primer combinations did not cross with the DNA of Helicobacter pylori. For positive samples, only the 1F+4R primer pair could not amplify positive bands, and the remaining 15 primer combinations could amplify positive bands. Figure 1 and Table 2. GTF B gene primer screening electrophoresis results are shown in Figure 1 .

[0078] Table 1 GTFB gene primer information

[0079]

[0080] Table 2 GTFB gene primer screening results

[0081]

[0082]

[0083] Note: “-” represents a negative test result, and “+” represents a positive test result.

[0084] LF-RPA Detection Method for Streptococcus mutans

[0085] According to the primer screening results, probes were designed and the probe sequences are shown in Table 1.

[0086] Preparation of RPA reaction mixture

[0087] Take 20ul of RPA solution, add 2.0ul of forward primer, 2.0ul of reverse primer, 0.6ul of probe, and 20.4ul of ddH 2 O and mix well, then add 3ul of sample and 2ul of activator, mix well, add to RPA freeze-dried powder to dissolve and mix well, and place in a thermostat at 37-45℃ to react for 30min.

[0088] LF-RPA detection

[0089] After the reaction is completed, take 10ul of the amplified product and add it to 1ml of the sample diluent, mix well, then take 100ul and add it to the sample well of the test card, wait for 5 to 10 minutes to observe the results.

[0090] The 1FProbe probe was selected and combined with 1F+1R, 2F+2R, 4F+4R, and 6F+6R for LF-RPA test. The results showed that only the probe combined with the 4F+4R primer could not detect positive results. The other three pairs were able to amplify positive samples normally without false positives (see Table 3 and Figure 2 LF-RPA test results). In the LF-RPA test results, T line intensity ≥ C3.5 indicates a positive test, and < C3.5 indicates a negative test.

[0091] Table 3 LF-RPA test results

[0092]

[0093]

[0094] Practical analysis of LF-RPA detection method for oral mutans Streptococcus

[0095] Primers 1F+1R and 1Fprobe were used for RPA reaction.

[0096] Sample collection: Collect gum, dental plaque and tartar samples from the oral cavity to ensure comprehensive sample collection. DNA extracted from standard mutans streptococci and sterile water are used as positive and negative controls, respectively. All samples are placed in sample lysis buffer and mixed for later use.

[0097] Ordinary PCR amplification detection: 10×Taq Buffer 2.5ul, dNTP2ul, Taq enzyme

[0098] 0.125ul, 1ul each of forward and reverse primers, 15.4ul of dd H2O, and 3ul of sample were added to the reaction solution, mixed, and amplified in a PCR instrument. The reaction procedure was 94℃ pre-denaturation for 5min, 94℃

[0099] Denaturation for 30 s, annealing at 56 °C for 30 s, extension at 72 °C for 40 s, amplification for 35 cycles, and then extension at 72 °C

[0100] 10min. Take the amplified product for gel electrophoresis. If a band with obvious brightness appears, the sample is positive, otherwise it is negative.

[0101] LF-RPA detection:

[0102] Take 20ul of RPA solution, add 2.0ul of forward primer, 2.0ul of reverse primer, 0.6ul of probe, and 20.4ul of ddH 2 O and mix well, add 2ul of activator, mix well to obtain RPA reaction mixture, then add 3ul of sample, add to RPA lyophilized powder to dissolve and mix well, and place in a thermostat at 37-45℃ to react for 30min.

[0103] After the reaction is completed, take 10ul (3 drops) of the amplified product and add it to the sample diluent, mix well, and then use a large dropper to add 3 to 4 drops to the sample well of the test card, wait for 5 to 10 minutes to observe the results (see Figure 3 Figure 1 shows the results of LF-RPA test of real oral samples. In the LF-RPA test results, T line intensity ≥ C3.5 indicates a positive test, and < C3.5 indicates a negative test. The comparison table of the results of ordinary PCR and LF-RPA is shown in Table 4.

[0104] Table 4. Comparison of oral sample test results

[0105]

[0106]

[0107] The amplified samples with positive LF-RPA test results were sequenced, and the sequences were compared by BLAST, and the results showed that the similarity with Streptococcus mutans was more than 92% (see Table 5).

[0108] Chen Yeqing sequencing sequence:

[0109] TCGTTCCTTCTTACTTGCAAGATTATTTCATATTTCAGTATAAGCGCCAGTTTCCATCAAAATGT

[0110] AAAATTTTGCCATCAG

[0111] CAATTAATGTAAAATTAGTACGAACTTTGCCGTTATTGTCATAATAATAATACTTACCATCAAT

[0112] TTCTTTTACATTGGGA

[0113] AGTTTTTCCAATATTTGTAGATTGGCTGCATTGCTATCATCAATAACATCTGAATCAGCTTCGG

[0114] TTGTTTGTTTACTAAT

[0115] ATTAACC

[0116] Table 5 Sequencing analysis results of positive samples

[0117] sample serial number LF-ERA Sequencing length Blast comparison results Chen Yeqing SM-2 C6 247bp Streptococcus mutans: 99.52% Chen Liang SM-3 C6 229bp Streptococcus mutans: 100.00% Zhu Kai SM-4 C4 233bp Streptococcus mutans: 99.55% Zhang Yejing SM-5 C3.5 233bp Streptococcus mutans: 92.92%

[0118] From the verification of the detection method in Example 4, the LF-RPA primers and kit for detecting Streptococcus mutans provided by this patent are a simple, accurate and economical on-site rapid detection method, which is suitable for self-testing at home to prevent dental caries.

[0119] As described above, the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features thereof may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A LF-RPA primer and probe for detecting Streptococcus mutans, characterized in that: include: The LF-RPA primers and probe are SM GTFB gene-specific primers and probes, the GTFB gene-specific primers include a forward primer and a reverse primer labeled with biotin, and the forward primer is selected from one or more of forward primer 1, forward primer 2, and forward primer 6; The reverse primer labeled with biotin is selected from one or more of reverse primer 1, reverse primer 2, and reverse primer 6; The base sequence of the forward primer 1 is: SEQ ID NO: 1; The base sequence of the forward primer 2 is: SEQ ID NO: 2; The base sequence of the forward primer 6 is: SEQ ID NO: 3; The base sequence of the reverse primer 1 is: SEQ ID NO: 4; The base sequence of the reverse primer 2 is: SEQ ID NO: 5; The base sequence of the reverse primer 6 is: SEQ ID NO: 6; The base sequence of the probe is: SEQ ID NO:

7.

2. The LF-RPA primer and probe for detecting Streptococcus mutans according to claim 1, characterized in that: The probe consists of an oligonucleotide homologous to a target sequence, wherein the 5' end is labeled with digoxigenin, the 3' end is modified with a group that blocks polymerase amplification, and the probe is modified with a tetrahydrofuran abasic site.

3. A kit for detecting Streptococcus mutans, characterized in that: The kit consists of a kit A and a kit B, wherein the kit A consists of an RPA reaction mixture and an RPA freeze-dried powder, and the kit B consists of a sample lysate, a diluent, a heating device, a sampler, a test card, and a desiccant; the RPA reaction mixture contains the primers and probes according to claim 1 or 2, an RPA dissolving solution, and an activator.

4. A kit for detecting Streptococcus mutans according to claim 3, characterized in that: The sample lysis solution is phosphate buffer and 6M guanidine hydrochloride.

5. A kit for detecting Streptococcus mutans according to claim 3, characterized in that, The sample diluent is phosphate buffered saline.

6. A kit for detecting Streptococcus mutans according to claim 3, characterized in that: The test card comprises a PVC base plate, a sample pad, a reagent pad, an NC film and absorbent paper. The sample pad, the reagent pad, the NC film and the absorbent paper are overlapped in sequence and then pasted on the PVC base plate to form a large test paper plate, which is cut into reagent strips with a width of 3 to 4 mm, and the shell is installed to obtain the test card.

7. A kit for detecting Streptococcus mutans according to claim 6, characterized in that: The sample pad is treated with a solution containing NaH2PO4, Na2HPO4, NaCl, PVP, Tween-20, and ProClin300, and then dried at 37°C overnight.

8. A kit for detecting Streptococcus mutans according to claim 6, characterized in that: The reagent pad is a digoxin antibody and mouse IgG labeled with nanocarbon, which is diluted 10 times with a diluent and then spread on the conjugate pad and dried at 37° C. overnight.

9. A kit for detecting Streptococcus mutans according to claim 6, characterized in that: The NC membrane is coated with a detection line T line and a quality control line C line which are parallel to each other and are spaced apart by 5 mm. After coating, the membrane is dried at 37° C. overnight.

10. A LF-RPA detection method for Streptococcus mutans, characterized in that: The following steps are involved: The sampler in the kit for detecting mutans streptococci according to claim 3 is used to collect gum, dental plaque and tartar samples from the oral cavity to ensure all-round sample collection, and the collected samples are placed in a sample lysis solution and mixed for later use; Take 3ul of the oral sample collected above, add it to the RPA reaction mixture in the kit, mix well, add it to the RPA freeze-dried powder, dissolve and mix well, and incubate at 45℃ for 25min; After the reaction is finished, take 10ul of the amplified product and add it to the sample diluent, mix well, and then use a large dropper to add 3 to 4 drops to the sample well of the test card, and wait for 5 to 10 minutes to observe the results; Observe the color development directly with the naked eye. If both the quality control line and the test line appear on the test paper at the same time, it indicates that the sample contains Streptococcus mutans. If only the quality control line appears, it is negative. The content of Streptococcus mutans can be determined by the intensity of the color development of the nanocarbon on the test line. Regardless of the color intensity of the test line, the quality control line should appear black. The absence of a color signal on the quality control line means that the test is invalid and the sample must be retested.

Images