Detection kit for identifying muscovy duck gosling plague virus and duck short beak and dwarf syndrome virus

Abstract

The invention discloses a detection kit for identifying muscovy duck gosling plague virus and duck short beak and dwarf syndrome virus, and belongs to the technical field of virus identification. The invention aims to identify the muscovy duck gosling plague virus and the duck short beak and dwarf syndrome virus. The invention provides a kit for identifying muscovy duck gosling plague virus and duck short beak and dwarf syndrome virus. The detection kit comprises an RPA (recombinase polymerase amplification) isothermal amplification system and a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas12a detection system, the RPA isothermal amplification system comprises an RPA primer pair, and the CRISPR / Cas12a detection system comprises crRNA (Complementary Ribonucleic Acid) and a probe. The invention establishes a detection technology for rapidly distinguishing the muscovy duck gosling plague virus and the duck short beak and dwarf syndrome virus, and provides technical support for taking corresponding prevention and control measures in a targeted manner.

Description

Technical Field

[0001] The invention belongs to the technical field of virus identification, and in particular relates to a detection kit for identifying Muscovy duck gosling plague virus and duck short-beak dwarf syndrome virus. Background Art

[0002] Waterfowl parvoviruses have caused huge economic losses to the global waterfowl industry. These viruses are members of the genus Dependoparvovirus in the subfamily Parvovirinae of the family Parvoviridae. Based on the host range, the characteristics of the whole viral genome, and the results of antigenic cross-neutralization tests, these viruses can be divided into two major categories: Muscovy duck parvovirus (MDPV) and goose parvovirus (GPV). GPV and MDPV have approximately 77% homology in the VP1 nucleotide sequence and 85% homology at the protein level, and are antigenically related to each other. However, the two parvoviruses infect different hosts: MDPV only infects Muscovy ducks, especially ducklings less than 3 weeks old; while GPV can infect geese and ducks and is the pathogen of goose plague. Muscovy duck-origin GPV (MDGPV) is a natural recombinant virus of MDPV and classical GPV. It has diagnostic features of intestinal embolism similar to classical gosling plague, with an incidence of 50% to 70% and a case fatality rate of 40% to 65%. Short beak and dwarfism syndrome virus (SBDSV) is a new GPV with a nucleotide homology of 90.8% to 94.6% with classical GPV. It is the pathogen causing duck short beak and dwarfism syndrome (SBDS). SBDSV mainly infects Muscovy ducks and Cherry Valley ducks. Clinical features of infected ducks include soft feet, short beaks, exposed tongue (long tongue), easy fractures, growth disorders (stiff ducks), and poor feather growth. The morbidity of SBDS is 10% to 100%, the mortality rate is 2% to 10%, the elimination rate of mutilated or dead ducks is 20% to 80%, and the average weight of ducks that are not eliminated after the disease is about 1kg lower than that of healthy ducks. In addition, during the slaughter process, the neck, wings and leg bones are easily broken, resulting in a high rate of defective products. MDGPV and SBDSV have caused huge economic losses to the duck industry.

[0003] At present, the methods for detecting GPV include virus isolation and culture, serological diagnosis methods (such as ELISA, latex agglutination test and indirect immunofluorescence test) and methods based on PCR technology (such as conventional PCR and fluorescent quantitative PCR). However, due to the high similarity of the nucleotide sequences of MDGPV and SBDSV, coupled with the limitations of the existing technology itself, these methods cannot accurately distinguish between the two viruses. On the other hand, both MDGPV and SBDSV can infect Muscovy ducks, and clinically infected ducks often do not show typical clinical symptoms and cannot be directly diagnosed based on clinical symptoms. Therefore, it is necessary to establish a detection technology that can quickly distinguish between MDGPV and SBDSV so that corresponding prevention and control measures can be taken in a targeted manner. Summary of the invention

[0004] The purpose of the present invention is to identify Muscovy duck gosling plague virus and duck short beak dwarf syndrome virus.

[0005] The present invention provides a kit for identifying Muscovy duck gosling plague virus and duck short-beak dwarf syndrome virus, wherein the detection kit comprises an RPA isothermal amplification system and a CRISPR / Cas12a detection system;

[0006] The RPA isothermal amplification system includes an RPA primer pair, wherein the RPA primer pair includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2;

[0007] The CRISPR / Cas12a detection system includes crRNA and a probe, and the nucleotide sequence of the crRNA is shown in SEQID NO.3.

[0008] It is further defined that the sequence of the probe is FAM-TTATT-BHQ.

[0009] It is further defined that the RPA isothermal amplification system also includes an RPA reaction system of 50 μL, including 29.5 μL buffer, 2.4 μL upstream primer, 2.4 μL downstream primer, 2.5 μL magnesium acetate, 1 μL recombinant plasmid and 12.2 μL nuclease-free water.

[0010] It is further defined and characterized in that the CRISPR / Cas12a detection system also includes Cas12a.

[0011] It is further defined that the template sequence for designing the RPA primer pair and crRNA is as shown in SEQ ID NO.7.

[0012] It is further defined that the concentration of crRNA is 200nM, the concentration of probe is 300nM and the concentration of Cas12a is 100nM.

[0013] The present invention provides an application of the above-mentioned kit in preparing a kit for identifying Muscovy duck gosling plague virus and duck short-beak dwarf syndrome virus.

[0014] The present invention provides a method for identifying Muscovy duck gosling plague virus and duck short beak dwarf syndrome virus for non-diagnosis and treatment purposes, and the specific steps of the method are as follows:

[0015] S1: adding the sample DNA to be tested into the RPA system for isothermal amplification to obtain the RPA amplification product;

[0016] S2: adding the RPA amplification product obtained in S1 to the detection system of the kit containing crRNA to react and obtain a reactant;

[0017] S3: Detect the reactants obtained in S2 using a multifunctional microplate reader or a fluorescence quantification instrument.

[0018] The present invention provides the use of the gene shown in SEQ ID NO.7 as a marker for identifying Muscovy duck gosling plague virus and duck short-beak dwarf syndrome virus.

[0019] The present invention provides application of VP3 gene as a marker for distinguishing Muscovy duck gosling plague virus and duck short beak dwarf syndrome virus.

[0020] Beneficial effects: The CRISPR / Cas system, especially Cas12a, has been developed for in vitro nucleic acid detection, single nucleotide polymorphism typing, tumor gene mutation detection, etc., because of its targeted recognition and trans-acting "accessory cleavage" activity and extremely high base resolution. The CRISPR / Cas12a system can be used to identify MDGPV and SBDSV with an accuracy of 100%. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The results of the optimization of the experimental conditions of the RPA-CRISPR / Cas12a method; (A) Optimization of Cas12a concentration; (B) Optimization of crRNA concentration; (C) Optimization of probe concentration; (D) Effects of different buffers on the trans-cleavage efficiency of CRISPR / Cas12a; Note: S / B, signal-to-noise ratio, is the ratio of the fluorescence intensity of the sample to the negative control;

[0022] Figure 2 The results of the detection performance evaluation of the RPA-CRISPR / Cas12a method are shown in Figure 2; (A) Sensitivity evaluation results; (B) Specificity evaluation results;

[0023] Figure 3 This is a graph showing the reproducibility assessment results of the RPA-CRISPR / Cas12a method;

[0024] Figure 4 This is a diagram showing the stability assessment results of the RPA-CRISPR / Cas12a method;

[0025] Figure 5 This is a heat map of the fluorescence intensity of clinical samples detected by the RPA-CRISPR / Cas12a method; Note: red represents that the sample is SBDSV positive, while blue represents that the sample is SBDSV negative. DETAILED DESCRIPTION

[0026] Example 1.

[0027] 1.RPA and crRNA primer design

[0028] The nucleotide sequences of the VP3 genes of all GPVs were obtained, and a pair of RPA primers and a crRNA sequence were designed near the mutation site (Table 1). Both the RPA primers and crRNA sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0029] Table 1 RPA primers and crRNA sequences used to identify SBDSV

[0030] : The spacer sequence of crRNA used for recognition and complementary to the target sequence is underlined. FAM: carboxyfluorescein; BHQ: Black Hole Design the sequence of RPA primers and crRNA: (SEQ ID NO.7)

[0031] AGTCTCTTAAATTCAAGATCTTCAATGTTCAAGTCAAGGAAGTCACAACGCAGGATCAG

[0032] ACAAAGACCATTGCAAACAATCTCACCTCAACAATCCAAGTTTTTACGGATGATGAGCA

[0033] CCAACTCCCGTATGTCCTGGGCTCGGCTACGGAAGGGACCATGCCCGCGTTCCCGTCG

[0034] GATGTCTATGCCCTGCCGCAGTACGGGTACTGCACAATGCACACCAACCAGAATGGAGCACGGTTCAATGACCGTAGCGCATTCTACTGCTTAGAGTACTTCCCTAGTC.

[0035] 2. Construction of SBDSV-M15 recombinant plasmid

[0036] DNA of SBDSV-M15 was extracted using a DNA extraction kit as a PCR template, and the target fragment VP3 gene was amplified. The PCR product was identified by 2% agarose gel electrophoresis, and the target fragment was recovered and purified. The purified target fragment was cloned into the vector pUC57, and 8 single colonies were randomly selected and cultured in LB medium containing ampicillin resistance for 14 hours. The recombinant plasmid was extracted for PCR identification, and the positive recombinant plasmid was sent for sequencing. The recombinant plasmid with positive identification results after sequencing was measured for DNA concentration using NanoDrop2000 ultra-micro spectrophotometer, and the copy number was calculated. The recombinant plasmid was diluted 10 times and stored at -20°C for use.

[0037] VP3 gene (SEQ ID NO.4):

[0038]

[0039] Example 2.

[0040] 1. RPA trials

[0041] The RPA reaction system is 50 μL, including 29.5 μL buffer, 2.4 μL upstream and downstream primers, 2.5 μL magnesium acetate, 1 μL recombinant plasmid and 12.2 μL nuclease-free water. Add the other components in the reaction solution except magnesium acetate to TwistAmp TM In the basicKit reaction tube, shake and mix to fully dissolve the reaction enzyme, and finally add 2.5μL of magnesium acetate, shake and mix to start the amplification reaction, and set up a negative control at the same time. Place the reaction tube in a 39℃ constant temperature water bath for 20 minutes.

[0042] 2. RPA-CRISPR / Cas12a diagnostic platform for detection of SBDSV

[0043] CRISPR / Cas12a detection system (30 μL): 100 nM Cas12a and 200 nM crRNA were added to 10× reaction buffer and pre-incubated at 37°C for 5 min to form a ribonucleoprotein complex. Subsequently, 200 nM fluorescent reporter molecules and 1 μL RPA amplification product were added to the above solution, mixed, and the fluorescence intensity was immediately collected using a multifunctional microplate reader (Synergy H1, BioTek, USA). The reaction was carried out at 37°C for 30 min, and the fluorescence signal was collected every 1 min (λex 485 nm, λem 525 nm).

[0044] 3. Optimization of RPA-CRISPR / Cas12a reaction conditions

[0045] In order to construct a highly sensitive RPA-CRISPR / Cas12a reaction system, several important experimental conditions were optimized, including Cas12a concentration (50nM, 100nM, 150nM, 200nM), crRNA concentration (50nM, 100nM, 200nM, 300nM), ssDNA probe concentration (50nM, 100nM, 200nM, 300nM, 400nM) and reaction buffer (Magigen buffer, NEBuffer r2.1 buffer, NEBuffer r3.1 buffer and CutSmart buffer).

[0046] Results: In order to construct a highly sensitive biosensor, some key experimental parameters were optimized. The optimal experimental conditions were screened by calculating the signal-to-noise ratio (S / B). The concentration of the Cas12a and crRNA complex is a key factor in determining the rate of Cas12a cleavage reaction, which directly affects the intensity of the fluorescence signal of the CRISPR / Cas12a system. In this study, we systematically optimized different concentrations of Cas12a (concentration range 50-200nM) and crRNA (concentration range 50-300nM). Figure 1 As shown in A in 1, B in 1, and C in 1, when the concentration of standard plasmid is the same, when the concentration of Cas12a is 100nM, the concentration of crRNA is 200nM, and the concentration of ssDNA probe is 300nM, the S / B value of the CRISPR / Cas12a system reaches the maximum. Based on these results, a combination of 100nM Cas12a, 200nM crRNA, and 300nM ssDNA probe concentration was selected for subsequent experiments. In addition, the reaction buffer is also an important factor affecting the cleavage efficiency of Cas12a protein. Figure 1 As shown in D, under the optimal experimental conditions, the S / B value is the largest when using Magigen buffer, which indicates that Cas12a protein has the best trans-cleavage efficiency in Magigen buffer. Therefore, we chose Magigen buffer as the reaction buffer for the experiment.

[0047] Example 3.

[0048] 1. Sensitivity test

[0049] The standard plasmid was diluted 10-fold and 1 μL (10 3 ~10 0 After the RPA reaction, 1 μL of the amplified product was taken as the substrate for CRISPR / Cas12a cleavage and tested under the optimized reaction conditions. At the same time, ddH2O was set as a negative control. Each group was repeated 3 times to evaluate the sensitivity of the established RPA-CRISPR / Cas12a method.

[0050] 2. Specificity test

[0051] According to the reaction system established above and the optimized reaction conditions, SBDSV (duck short-beak dwarf syndrome virus), GPV (goose parvovirus), MDGPV (Muscovy duck gosling plague virus), MDPV (Muscovy duck parvovirus), MDRV (Muscovy duck reovirus), NDRV (novel duck reovirus), DHV (duck hepatitis virus), DPV (duck plague virus) and DAdV-3 (duck adenovirus type 3) were detected, and a negative control was set up to evaluate the specificity of the detection method.

[0052] Results: We used the RPA-CRISPR / Cas12a method to detect different concentration gradients of standard plasmids (10 3 ~10 0 copies / μL) and ddH2O as negative control, and sensitivity evaluation was performed. Figure 2 As shown in A, the lowest concentration detected by the RPA-CRISPR / Cas12a method was 10 1 The fluorescence intensity of the standard plasmid was significantly different from that of the negative control group (P<0.01). Therefore, the sensitivity of the established method was 10 1 copies / μL of standard plasmid.

[0053] The constructed RPA-CRISPR / Cas12a method was used to detect SBDSV, GPV, MDGPV, MDPV, MDRV, NDRV, DHV, DPV and DAdV-3. Figure 2 As shown in Figure B, this method can produce a strong fluorescence signal only when SBDSV nucleic acid is present, and the end-point fluorescence value of SBDSV is significantly higher than that of GPV, MDGPV, and the other five waterfowl viruses and the negative control group, indicating that the RPA-CRISPR / Cas12a method established in this study has a high degree of specificity and can accurately detect SBDSV nucleic acid without cross-reaction with GPV, MDGPV and other viral nucleic acids. This confirms that this method can effectively distinguish between classic GPV, MDGPV and SBDSV.

[0054] 3. Repeatability test

[0055] Take 10 4 The standard plasmid with a concentration of 10 copies / μL was used as a template, and the constructed RPA-CRISPR / Cas12a method was used to perform 5 consecutive tests under the optimal reaction conditions.

[0056] Results: To determine the reproducibility of the method, 10 4 The standard plasmid with copies / μL was used as a template and the optimized reaction conditions were used. Five experiments were performed independently by different experimenters. Figure 3 As shown, the fluorescence intensity of the five tests was almost the same. The relative standard deviation (RSD) of the fluorescence intensity was only 2.92%, which was much lower than 5%, indicating that the method had good reproducibility and was reliable for detecting SBDSV.

[0057] 4. Stability test

[0058] The reagents used for RPA and CRISPR / Cas12a reactions were placed in a 4°C refrigerator for 30 days. 4 The standard plasmid with a concentration of copies / μL was used as a template and measured every 5 days using the constructed RPA-CRISPR / Cas12a method.

[0059] Results: The stability of the established RPA-CRISPR / Cas12a detection method was evaluated within 30 days. Figure 4 As shown, after 30 days of storage, the RPA-CRISPR / Cas12a detection method was effective for the same concentration (10 4 The response of the recombinant plasmid containing 100 copies / μL) was very small, and compared with the initial fluorescence intensity, it only decreased by 8.43% after 30 days, indicating that the established method has good stability and has the potential to be developed into a diagnostic kit.

[0060] 5. Clinical sample testing

[0061] Thirty-six duck tissue samples suspected of being infected with GPV were collected from multiple farms in Fujian Province.

[0062] First, take an appropriate amount of tissue sample and add sterile PBS solution in proportion for grinding. After centrifugation, take the supernatant for nucleic acid extraction.

[0063] The high temperature heating method was used to quickly obtain the viral nucleic acid in the supernatant. Next, the RT-qPCR method for detecting GPV previously established by our research group was used for preliminary screening. The primer sequences used were F: 5'-GAGGTAGACAGCAACAGAAA-3', SEQ ID NO.5, R: 5'-GCTCGTCCGTGACCATA-3', SEQ ID NO.6. Reaction system: Green qPCR SuperMix 10μL, 10μmol / L specific upstream and downstream primers 0.5μL each, template 1μL, supplemented with sterile deionized water to a final volume of 20μL. Reaction conditions: 95℃5min; 95℃15s, 60℃10s, 72℃15s, 40 cycles. After preliminary screening, the samples were further verified using the indirect immunofluorescence method previously established by our research group. Finally, for samples with positive verification results, we used the RPA-CRISPR / Cas12a method established in this patent for final identification.

[0064] Results: The qPCR method established by our research group was used to test 36 duck tissue samples suspected of being infected with GPV. The results showed that 16 of them were GPV positive. The established RPA-CRISPR / Cas12a method was then used to test these 16 samples. The results showed that Figure 5 As shown, 2 samples were SBDSV positive (shown in red in the heat map), while the remaining 14 samples were MDGPV positive (shown in blue in the heat map).

Claims

1. A kit for identifying Muscovy duck gosling plague virus and duck short beak syndrome virus, characterized in that: The detection kit includes an RPA isothermal amplification system and a CRISPR / Cas12a detection system; The RPA isothermal amplification system includes an RPA primer pair, the RPA primer pair includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2; The CRISPR / Cas12a detection system includes crRNA and a probe, and the nucleotide sequence of the crRNA is shown in SEQ ID NO.

3.

2. The kit according to claim 1, characterized in that The sequence of the probe is FAM-TTATT-BHQ.

3. The kit according to claim 1, characterized in that The RPA isothermal amplification system also includes an RPA reaction system of 50 μL, including 29.5 μL buffer, 2.4 μL upstream primer, 2.4 μL downstream primer, 2.5 μL magnesium acetate, 1 μL recombinant plasmid and 12.2 μL nuclease-free water.

4. The kit according to claim 1, characterized in that The CRISPR / Cas12a detection system also includes Cas12a.

5. The kit according to claim 1, characterized in that The template sequence for designing the RPA primer pair and crRNA is shown in SEQ ID NO.

7.

6. The kit according to claim 1, characterized in that The concentration of crRNA was 200nM, the probe concentration was 300nM, and the concentration of Cas12a was 100nM.

7. Use of the kit according to any one of claims 1 to 6 in the preparation of a kit for identifying Muscovy duck gosling plague virus and duck short-beak dwarf syndrome virus.

8. A method for distinguishing Muscovy duck gosling plague virus and duck short beak syndrome virus for non-diagnostic and non-therapeutic purposes, characterized in that: The specific steps of the method are as follows: S1: adding the sample DNA to be tested into the RPA system for isothermal amplification to obtain the RPA amplification product; S2: adding the RPA amplification product obtained in S1 to the detection system of the kit containing crRNA to react and obtain a reactant; S3: Detect the reactants obtained in S2 using a multifunctional microplate reader or a fluorescence quantification instrument.

9. Use of the gene shown in SEQ ID NO.7 as a marker for identifying Muscovy duck gosling plague virus and duck short-beak syndrome virus.

10. Application of VP3 gene as a marker for identifying Muscovy duck gosling plague virus and duck short-beak syndrome virus.

Images