IL-6 AND / OR IL-1beta INHIBITORS

Abstract

The present invention addresses the problem of providing a drug for the treatment of circulatory organ diseases associated with cardiovascular system inflammation associated with IL-6 and / or IL-1 [beta]. The present invention relates to an IL-6 and / or IL-1 [beta] inhibitor comprising a compound represented by formula (I) (in the formula, each symbol is as defined in the description). ) the compound or a pharmaceutically acceptable salt thereof. Furthermore, the present invention relates to a drug for treating circulatory organ diseases accompanied by cardiovascular system inflammation associated with IL-6 and / or IL-1beta, which contains the compound or a pharmaceutically acceptable salt thereof as an active ingredient. # imgabs0 #

Description

Technical Field

[0001] The present invention relates to a prostaglandin derivative which inhibits excessive gene expression and production of IL-6 and / or IL-1β and is useful for treating circulatory organ diseases accompanied by cardiovascular inflammation associated with IL-6 and / or IL-1β. Background Art

[0002] Interleukin-6 (IL-6) and interleukin-1β (IL-1β) are cytokines with various physiological effects and play an important role in regulating immune response and inflammatory response. However, if the genes are overexpressed and continuously produced, various pathological conditions may occur.

[0003] For example, the involvement of immune cells and cytokines produced by them in the onset of heart failure has been pointed out. It is known that IL-6 increases in the blood of patients with heart failure and myocarditis and is also associated with prognosis (Non-Patent Documents 1 and 2).

[0004] It is reported that in the blood of patients with pulmonary hypertension, inflammatory cytokines such as IL-6 increase, becoming a poor prognostic factor (Non-patent Document 3). It is also reported that in patients with pulmonary hypertension, cell membrane-bound IL-6 receptors are expressed in large quantities in pulmonary artery vascular smooth muscle cells, and IL-6 signals bring anti-apoptosis resistance to vascular smooth muscle cells, thereby contributing to the reconstruction of the pulmonary artery (Non-patent Document 4).

[0005] In systemic sclerosis patients, IL-6 is confirmed to be overexpressed and IL-6 strongly affects fibrosis. In addition, IL-6 inhibitors have shown therapeutic effects on interstitial lung disease associated with systemic sclerosis (Non-Patent Document 5).

[0006] Regarding pulmonary arterial pulmonary hypertension, high blood IL-6 concentrations have been confirmed, particularly in patients with pulmonary arterial pulmonary hypertension accompanied by connective tissue disease and portal hypertension, and it has been reported that patients with higher blood IL-6 concentrations have worse prognoses (Non-Patent Document 6).

[0007] In patients with Takayasu's arteritis, it was reported that serum IL-6 concentration increased in correlation with disease activity, and IL-6 inhibitors were subsequently shown to be effective and are used clinically (Non-Patent Documents 7, 8, and 9).

[0008] On the other hand, IL-1β is closely related to inflammatory response and plays an important role in the control of metabolic cardiac hypertrophy. Clinical trials targeting IL-1β have shown good results in the treatment of cardiovascular events and heart failure. Therefore, the control of chronic inflammation using IL-1β inhibitors has attracted attention in recent years as a new treatment for heart failure (Non-patent Documents 10, 11).

[0009] As described above, drugs that inhibit excessive gene expression and production of IL-6 and / or IL-1β (hereinafter sometimes referred to as "IL-6 and / or IL-1β inhibitors") are expected to be therapeutic agents for circulatory organ diseases accompanied by cardiovascular inflammation.

[0010] Cardiac hypertrophy refers to a state in which the heart muscle is enlarged and the myocardial weight increases. Specifically, in a phenomenon seen when the load applied to the heart increases for some reason, cardiac hypertrophy occurs as a compensatory mechanism. Hypertrophy caused by thickening of the heart wall is mostly caused by hypertension, valvular disease, cardiomyopathy, etc., and sometimes by myocardial abnormalities accompanied by hyperthyroidism or hypothyroidism, muscular dystrophy, etc. Cardiac hypertrophy is a risk factor for heart failure and coronary artery disease, and treatment to inhibit / reduced cardiac hypertrophy is important.

[0011] Heart failure is defined as the following clinical syndrome: a certain cardiac dysfunction occurs, i.e., the heart produces organic and / or functional abnormalities, and the compensatory mechanism of the cardiac pump function fails, resulting in dyspnea / fatigue, edema, and a decrease in exercise tolerance. For example, acute myocarditis causes cardiac hypertrophy due to inflammatory cell infiltration and myocardial edema, leading to heart failure. It is known that in heart failure, ventricular hypertrophy, dilation, systolic failure, diastolic failure, etc. will develop, which is called myocardial remodeling. In this process, it is accompanied by hypertrophy of the myocardial wall, hypertrophy and degeneration of myocardial cells, and interstitial fibrosis. The improvement of myocardial remodeling is considered to be one of the important goals in the treatment of heart failure, and therapeutic drugs with new mechanisms of action are expected.

[0012] Right heart failure refers to a state in which the function of the right heart system is impaired during the process of venous blood returning to the heart from the whole body to the lungs through the right heart system. It is a disease that threatens life if left untreated. Right ventricular hypertrophy is one of the main changes in right heart failure. The main cause of right heart failure is pulmonary circulation disorder, especially when the pulmonary circulation is affected by pulmonary embolism or pulmonary hypertension.

[0013] Pulmonary embolism is usually accompanied by characteristic clinical signs, acute shortness of breath, collapse-like symptoms and chest pain. Pulmonary embolism is mostly caused by blood clots in the veins of the lower limbs due to some reasons, which enter the pulmonary artery through the blood vessels and block the pulmonary artery.

[0014] Pulmonary hypertension is an intractable disease characterized by increased pulmonary artery pressure and a background of pulmonary vascular remodeling caused by pulmonary artery endothelial disorders, smooth muscle proliferation, inflammation, and immune abnormalities.

[0015] Pulmonary vascular remodeling is mainly caused by the proliferation of arterial endothelial cells and smooth muscle cells of patients. As symptoms progress, muscularization of pulmonary arterioles, hypertrophy of the tunica media, hypertrophy of the tunica intima, stenosis of the vascular lumen caused by the proliferation of endothelial cells, plexiform lesions, etc. are observed. As described above, it is clear that IL-6 is increased in the serum and lungs of patients, indicating the involvement of inflammatory mechanisms in pulmonary vascular remodeling.

[0016] The current clinical classification of pulmonary hypertension includes five groups based on the 2013 Nice classification (Non-Patent Document 12).

[0017] Group 1: PAH;

[0018] 1 Idiopathic PAH

[0019] 2 Hereditary PAH

[0020] 3. Drug / Toxic-Induced PAH

[0021] 4 PAH associated with various diseases

[0022] 4.1 Connective tissue diseases

[0023] 4.2 HIV infection

[0024] 4.3 Portal Hypertension

[0025] 4.4 Congenital heart disease

[0026] 4.5 Schistosomiasis

[0027] Group 1': pulmonary veno-occlusive disease (PVOD) and / or pulmonary capillary hemangiomatosis (PCH);

[0028] Group 1: Persistent pulmonary hypertension of the newborn (PPHN)

[0029] Group 2: pulmonary hypertension due to left heart disease;

[0030] Group 3: pulmonary hypertension due to lung disease and / or hypoxia;

[0031] Group 4: chronic thromboembolic pulmonary hypertension (CTEPH);

[0032] Group 5: Pulmonary hypertension with unknown multifactorial mechanisms.

[0033] Pulmonary arterial pulmonary hypertension (PAH), which is the first group of pulmonary hypertension, is characterized by significant vasoconstriction and abnormal proliferation of cells in the pulmonary artery wall. This abnormal proliferation leads to severe constriction of the pulmonary blood vessels, a significant increase in pulmonary vascular resistance (PVR) and a continuous increase in pulmonary artery pressure (PAP), resulting in right heart failure and a poor prognosis for patients. Pulmonary hypertension accompanied by right heart failure is highly severe, and if untreated, the average remaining life expectancy of PAH is thought to be 2.8 years from the time of diagnosis.

[0034] Among PAH associated with connective tissue diseases, immunosuppressive therapy using steroids and cyclophosphamide is effective for some PAH associated with connective tissue diseases, but the prognosis of PAH associated with mixed connective tissue disease and systemic sclerosis is poor, and the prognosis of PAH associated with systemic sclerosis is particularly poor.

[0035] There is no clinically proven treatment for PAH associated with portal hypertension.

[0036] The second group of pulmonary hypertension is caused by various left heart diseases such as left ventricular systolic failure, diastolic failure, and valvular disease, resulting in post-capillary pulmonary hypertension. It is also partly related to the remodeling of the pulmonary artery, and the prognosis is worse than that of PAH, which also becomes a factor that worsens the prognosis of heart failure. As a treatment for the second group of pulmonary hypertension, clinical trials of vasodilators have been conducted, but no effect of improving the prognosis has been obtained.

[0037] Group 3 pulmonary hypertension is associated with chronic lung diseases such as chronic obstructive pulmonary disease (COPD) and interstitial lung disease, and hypoxia. It is difficult to administer vasodilators to patients without worsening gas exchange function, and there is currently no approved therapeutic drug for patients with group 3 pulmonary hypertension.

[0038] The fourth group of pulmonary hypertension, chronic thromboembolic pulmonary hypertension (CTEPH), is a disease caused by organic thrombosis in the pulmonary artery. As a treatment for CTEPH, surgery and balloon pulmonary angioplasty are performed, but specific vasodilators are also used. As therapeutic drugs for pulmonary hypertension, three systems of vasodilators are known, including prostacyclin derivatives belonging to the prostacyclin pathway (epoprostenol, beraprost, treprostinil, selexipag, etc.), endothelin receptor antagonists belonging to the endothelin pathway (bosentan, ambrisentan, etc.), and NO-based preparations. Phosphodiesterase 5 inhibitors (sildenafil, tadalafil, etc.) and guanylate cyclase stimulators (riociguat, etc.). These vasodilators are used for group 1 PAH, and some are also used for group 4 CTEPH. The prognosis of PAH has been improved by the combination therapy of these vasodilators, but it cannot be said to be sufficient, and it is still a disease with a poor prognosis. In particular, in PAH with connective tissue diseases, including PAH with systemic sclerosis, not only pulmonary artery but also pulmonary vein remodeling is complicated, and there are also many patient groups where the effects of conventional vasodilators are not sufficient, and there are also patient groups with fatal complications such as pulmonary edema caused by pulmonary vein stenosis.

[0039] Prostacyclin derivatives bind to prostacyclin receptors (IP receptors) to exert vasodilatory effects, but the existence of non-responders with insufficient effects has become a problem. In patients with pulmonary hypertension, reduced expression of IP receptors is also considered to be one of the causes (Non-Patent Documents 13 and 14). In addition, the use of prostacyclin derivatives is restricted due to various side effects such as shock, flushing, hypotension, headache, jaw pain, nausea / vomiting, diarrhea, and bleeding.

[0040] As described above, administration of vasodilators is the main treatment method for current pulmonary hypertension, but in order to avoid fatal complications such as pulmonary edema, therapeutic drugs that do not cause acute vasodilation are also needed. In order to effectively treat serious diseases such as pulmonary hypertension that are accompanied by pulmonary vascular remodeling, it is urgently desired to develop new therapeutic drugs based on a different mechanism of action from conventional treatments using vasodilators.

[0041] Large vessel inflammation includes Takayasu's arteritis and giant cell arteritis, which lead to serious complications such as aortic stenosis, aortic aneurysm, aortic dissection, pulmonary artery stenosis, heart failure, renal failure, pulmonary hypertension, and ophthalmic artery lesions due to inflammation of blood vessels. Takayasu's arteritis is characterized by necrosis of smooth muscle cells in the media, destruction of elastic fibers, fibrosis, and inflammatory hypertrophy of the adventitia, and giant cell arteritis can be seen in vascular lesions such as the appearance of giant cells on the media and intima, and blockage of the lumen accompanied by intimal hypertrophy. For these vascular lesions, IL-6 inhibitors have shown a remodeling improvement effect and are used as therapeutic drugs (Non-Patent Literature 15).

[0042] The present inventors have found that the compound represented by the following formula (1) or a pharmaceutically acceptable salt thereof exhibits a therapeutic effect on ulcerative colitis and the like (Patent Documents 1 and 2 and Non-Patent Documents 16 and 17).

[0043]

[0044] (Where R 1 and R 2 Each independently represents a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms, and R 3 Represents a hydrogen atom, an alkyl group having 1 to 4 carbon atoms, an alkoxyalkyl group, an aryl group, a halogen atom, or a halogenated alkyl group. ). In addition, the pharmacological effect of the compound on osteoarthritis of the knee has also been reported (Non-patent Document 18). However, it is not known that the compound represented by the above formula (1) shows an inhibitory effect on excessive gene expression and production of IL-6 and / or IL-1β, and therefore, there are no reports on the therapeutic effect on circulatory organ diseases accompanied by cardiovascular inflammation associated with IL-6 and / or IL-1β.

[0045] Prior art literature

[0046] Patent Literature

[0047] Patent Document 1: International Publication No. 2010 / 029925

[0048] Patent Document 2: International Publication No. 2011 / 111714

[0049] Non-patent literature

[0050] Non-patent document 1: J. Am. Coll. Cardiol., 1998, 31, 391-398

[0051] Non-patent literature 2: J. Cardiology, 2021, 78, 157-165

[0052] Non-patent document 3: Circulation, 2010, 122, 920-927

[0053] Non-patent literature 4: J. Clin. Invest., 2018, 128, 1956-1970

[0054] Non-patent literature 5: Arthritis Rheumatol., 2022, 74, 13-27

[0055] Non-patent document 6: Eur. Resp. J., 2020, 55, 1901761

[0056] Non-patent document 7: Circulation, 1999, 100, 55-60

[0057] Non-patent document 8: Reumatology, 2006, 45, 545-548

[0058] Non-patent document 9: Ann.Reum.Dis.,2018,77,348-354

[0059] Non-patent document 10: N. Engl. J. Med., 2017, 377, 1119-1131

[0060] Non-patent document 11: Circ. Heart Fail., 2018, 11, e005036

[0061] Non-patent literature 12: Clinical guidelines for pulmonary hypertension (2017 revised edition), p.8-11

[0062] Non-patent document 13: Am. J. Respir. Crit. Care Med., 2010, 182, 1161-1170

[0063] Non-patent document 14: Am. J. Respir. Crit. Care Med., 2001, 164, 314-318

[0064] Non-patent literature 15: Diagnosis and treatment guidelines for vasculitis syndrome (2017 revised edition), p.9-39

[0065] Non-patent literature 16: Eur. J. Pharmacol., 2015, 754, 179-189

[0066] Non-patent literature 17: J. Gastroenterol., 2019, 54, 608-620

[0067] Non-patent literature 18: Sci. Rep., 2019, 20329-20341 Summary of the invention

[0068] Problem that the invention aims to solve

[0069] The present invention aims to provide a drug for treating circulatory organ diseases accompanied by cardiovascular inflammation associated with IL-6 and / or IL-1β by inhibiting excessive gene expression and production of IL-6 and / or IL-1β.

[0070] Solutions for solving problems

[0071] The present inventors conducted intensive studies to solve the above-mentioned problems and found that the compound represented by the following formula (I) (hereinafter sometimes also referred to as "the compound of the present invention") or a pharmaceutically acceptable salt thereof is an excellent IL-6 and / or IL-1β inhibitor, and that a drug containing the IL-6 and / or IL-1β inhibitor as an active ingredient is useful for the treatment of circulatory organ diseases accompanied by cardiovascular inflammation associated with IL-6 and / or IL-1β, thereby completing the present invention.

[0072]

[0073] (Where R 1 and R 2 Each independently represents a hydrogen atom or a methyl group. )

[0074] That is, the present invention is as follows.

[0075] [1] An IL-6 and / or IL-1β inhibitor, comprising a compound represented by formula (I) or a pharmaceutically acceptable salt thereof.

[0076]

[0077] (Where R 1 and R 2 Each independently represents a hydrogen atom or a methyl group. )

[0078] [2] The inhibitor according to the above [1], wherein the compound represented by the above formula (I) is 4-[(Z)-(1S,5R,6R,7R)-6-[(1E,3R,4R)-3-hydroxy-4-(m-tolyl)-1-pentenyl]-7-hydroxy-2-oxa-4,4-difluoro-bicyclo[3.3.0]octan-3-ylidene]-1-(tetrazol-5-yl)butane.

[0079] [3] The inhibitor according to [1] or [2] above, which is an IL-6 and IL-1β inhibitor.

[0080] [4] A drug for preventing and / or treating a circulatory organ disease (hereinafter sometimes referred to as "the drug of the present invention"), comprising the inhibitor described in any one of [1] to [3] above as an active ingredient, wherein the circulatory organ disease is accompanied by cardiovascular inflammation associated with IL-6 and / or IL-1β.

[0081] [5] The drug according to [4] above, wherein the cardiovascular system is the pulmonary vascular system.

[0082] [6] The drug according to [4] above, wherein the cardiovascular system is the myocardium.

[0083] [7] The medicament according to any one of [4] to [6] above, wherein the circulatory organ disease is selected from the group consisting of cardiac hypertrophy, heart failure, myocarditis and cardiomyopathy.

[0084] [8] The drug according to [4] above, wherein the circulatory organ disease is cardiac hypertrophy.

[0085] [9] The drug according to [4] above, wherein the circulatory organ disease is heart failure.

[0086]

[10] The drug according to the above [9], wherein the heart failure is right heart failure.

[0087]

[11] The drug according to [4] above, wherein the circulatory organ disease is pulmonary hypertension associated with right heart failure.

[0088]

[12] The drug according to [4] above, wherein the circulatory organ disease is pulmonary hypertension associated with left heart disease.

[0089]

[13] The drug according to [4] above, wherein the circulatory organ disease is pulmonary hypertension accompanied by lung disease and / or hypoxemia.

[0090]

[14] The drug according to [4] above, wherein the circulatory organ disease is chronic thromboembolic pulmonary hypertension.

[0091]

[15] The medicament according to [4] above, wherein the circulatory organ disease is pulmonary arterial hypertension associated with connective tissue disease.

[0092]

[16] The drug according to

[15] above, wherein the connective tissue disease is mixed connective tissue disease or systemic sclerosis.

[0093]

[17] The medicine according to [4] above, wherein the circulatory organ disease is pulmonary arterial pulmonary hypertension accompanied by portal hypertension.

[0094]

[18] The drug according to the above [4], wherein the circulatory organ disease is selected from the group consisting of large vessel inflammation, aortic aneurysm and aortic dissection.

[0095]

[19] The medicament according to any one of [4] to

[18] above, which is for oral administration.

[0096]

[20] The drug according to the above-mentioned

[19] , characterized in that it is orally administered twice or more per day.

[0097]

[21] The drug according to any one of [4] to

[20] above, characterized in that it is administered in combination with one or more other drugs.

[0098]

[22] The drug according to the above-mentioned

[21] is characterized in that it contains the drug described in the above-mentioned [4] and one or more other drugs as active ingredients in different preparations, which are administered simultaneously or at different times.

[0099]

[23] The medicine according to

[21] above, characterized in that it contains the drug according to [4] above and one or more other drugs in a single preparation.

[0100]

[24] The drug according to any one of

[21] to

[23] above, wherein the other drug is a vasodilator.

[0101]

[25] A pharmaceutical composition (hereinafter sometimes referred to as "the pharmaceutical composition of the present invention") comprising the inhibitor according to any one of [1] to [3] above and a pharmaceutically acceptable carrier.

[0102]

[26] A cardiovascular remodeling inhibitor comprising the inhibitor according to any one of [1] to [3] above as an active ingredient.

[0103]

[27] A pulmonary artery muscularization inhibitor comprising the inhibitor according to any one of [1] to [3] above as an active ingredient.

[0104]

[28] A compound represented by formula (I) or a pharmaceutically acceptable salt thereof, for use in preventing and / or treating circulatory organ diseases accompanied by cardiovascular system inflammation associated with IL-6 and / or IL-1β.

[0105]

[0106] (Where R 1 and R 2 Each independently represents a hydrogen atom or a methyl group. )

[0107]

[29] The compound or pharmaceutically acceptable salt thereof according to

[28] , wherein the circulatory organ disease accompanied by cardiovascular inflammation related to IL-6 and / or IL-1β is a disease selected from the group consisting of the following diseases: cardiac hypertrophy, heart failure, myocarditis, cardiomyopathy, pulmonary hypertension accompanied by right heart failure, pulmonary hypertension accompanied by left heart disease, pulmonary hypertension accompanied by lung disease and / or hypoxemia, chronic thromboembolic pulmonary hypertension, pulmonary arterial pulmonary hypertension accompanied by connective tissue disease, pulmonary arterial pulmonary hypertension accompanied by portal hypertension, large vessel inflammation, aortic aneurysm and aortic dissection.

[0108]

[30] Use of a compound represented by formula (I) or a pharmaceutically acceptable salt thereof in the manufacture of a preventive and / or therapeutic agent for circulatory organ diseases accompanied by cardiovascular system inflammation associated with IL-6 and / or IL-1β.

[0109]

[0110] (Where R 1 and R 2 Each independently represents a hydrogen atom or a methyl group. )

[0111]

[31] The use as described in

[30] above, wherein the circulatory organ disease accompanied by cardiovascular inflammation related to IL-6 and / or IL-1β is a disease selected from the group consisting of the following diseases: cardiac hypertrophy, heart failure, myocarditis, cardiomyopathy, pulmonary hypertension accompanied by right heart failure, pulmonary hypertension accompanied by left heart disease, pulmonary hypertension accompanied by lung disease and / or hypoxemia, chronic thromboembolic pulmonary hypertension, pulmonary arterial pulmonary hypertension accompanied by connective tissue disease, pulmonary arterial pulmonary hypertension accompanied by portal hypertension, large vessel inflammation, aortic aneurysm and aortic dissection.

[0112]

[32] A method for preventing and / or treating a circulatory organ disease in a mammal, wherein the circulatory organ disease is accompanied by cardiovascular inflammation associated with IL-6 and / or IL-1β of the mammal, the method comprising administering to the mammal a pharmaceutically effective amount of a compound represented by formula (I) or a pharmaceutically acceptable salt thereof.

[0113]

[0114] (Where R 1 and R 2 Each independently represents a hydrogen atom or a methyl group. )

[0115]

[33] The method described in

[32] above, wherein the circulatory organ disease accompanied by cardiovascular inflammation related to IL-6 and / or IL-1β is a disease selected from the group consisting of the following diseases: cardiac hypertrophy, heart failure, myocarditis, cardiomyopathy, pulmonary hypertension accompanied by right heart failure, pulmonary hypertension accompanied by left heart disease, pulmonary hypertension accompanied by lung disease and / or hypoxemia, chronic thromboembolic pulmonary hypertension, pulmonary arterial pulmonary hypertension accompanied by connective tissue disease, pulmonary arterial pulmonary hypertension accompanied by portal hypertension, large vessel inflammation, aortic aneurysm and aortic dissection.

[0116] Effects of the Invention

[0117] The compound of the present invention or a pharmaceutically acceptable salt thereof is useful as an IL-6 and / or IL-1β inhibitor. In addition, according to the present invention, a drug can be provided, characterized in that it contains an IL-6 and / or IL-1β inhibitor as an active ingredient, the inhibitor comprises a compound of the present invention or a pharmaceutically acceptable salt thereof, and the drug is used to prevent and / or treat circulatory organ diseases accompanied by cardiovascular inflammation associated with IL-6 and / or IL-1β, especially diseases selected from the following diseases: cardiac hypertrophy (e.g., right heart hypertrophy), heart failure (e.g., right heart failure), myocarditis, cardiomyopathy, pulmonary hypertension accompanied by right heart failure, pulmonary hypertension accompanied by left heart disease, pulmonary hypertension accompanied by lung disease and / or hypoxemia, chronic thromboembolic pulmonary hypertension, pulmonary artery pulmonary hypertension accompanied by connective tissue disease (e.g., mixed connective tissue disease, systemic sclerosis), pulmonary artery pulmonary hypertension accompanied by portal hypertension, large vessel inflammation (e.g., Takayasu's arteritis, giant cell arteritis), aortic aneurysm and aortic dissection. BRIEF DESCRIPTION OF THE DRAWINGS

[0118] Figure 1 The dosing method of each group is shown.

[0119] Figure 2 The effect of KAG-308 (2 mg / kg / day) on rats with monocrotaline-induced pulmonary hypertension after 3 weeks of administration is shown. The left graph shows the effect on right ventricular systolic pressure, and the right graph shows the effect on right ventricular hypertrophy.

[0120] Figure 3 The effect of KAG-308 (2 mg / kg / day) on rats with monocrotaline-induced pulmonary hypertension after 3 weeks of administration is shown. The left graph shows the effect on left ventricular systolic pressure, and the right graph shows the effect on heart rate.

[0121] Figure 4The inhibitory effect of KAG-308 (2 mg / kg / day) on the tunica media thickness of the pulmonary artery was shown by lung pathological tissue analysis after 3 weeks of administration of KAG-308 to rats with monocrotaline-induced pulmonary hypertension.

[0122] Figure 5 The inhibitory effect of KAG-308 (2 mg / kg / day) on muscularization of pulmonary arterioles was shown by lung pathological tissue analysis after 3 weeks of administration of KAG-308 to rats with monocrotaline-induced pulmonary hypertension.

[0123] Figure 6 The results show the inhibitory effect of KAG-308 (2 mg / kg / day) on the infiltration of inflammatory macrophages in rats with monocrotaline-induced pulmonary hypertension after 3 weeks of administration of KAG-308 (2 mg / kg / day).

[0124] Figure 7 The results of quantitative RT-PCR analysis are shown in rats with monocrotaline-induced pulmonary hypertension induced by KAG-308 (2 mg / kg / day) for 3 weeks. The left graph shows the mRNA expression level of IL-6, and the right graph shows the mRNA expression level of IL-1β. DETAILED DESCRIPTION

[0125] The following are definitions of terms and symbols used in this specification. Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art in the art to which the present invention belongs.

[0126] In this specification, "pharmaceutically acceptable salt" refers to a salt containing the tetrazolyl moiety of the compound of the present invention and a non-toxic base such as an inorganic base or an organic base that is acceptable as a pharmaceutical agent, and is a compound in which the hydrogen atom of the tetrazolyl group is replaced by a cation. Examples of the cation include Na + , K + Alkali metal cations, 1 / 2Ca 2+ 、1 / 2Mg 2+ 、1 / 2Zn 2+ 、1 / 3Al 3+ Metal cations other than alkali metals, NH4 + , and organic amines such as triethanolamine, diethanolamine, ethanolamine, tromethamine, lysine, arginine, and the ammonium cation of amino acids, etc. Preferred cations are sodium ions and potassium ions.

[0127] Specific examples of salts derived from pharmaceutically acceptable non-toxic inorganic bases include, in addition to the above-mentioned sodium salts, potassium salts, calcium salts, magnesium salts, zinc salts, aluminum salts, ammonium salts, etc., lithium salts, copper salts, iron salts, ferrous salts, manganic salts, manganous salts, etc. Among them, sodium salts, potassium salts, calcium salts, magnesium salts and ammonium salts are preferred, and sodium salts and potassium salts are particularly preferred.

[0128] Specific examples of salts from pharmaceutically acceptable non-toxic organic bases include salts of primary amines, secondary amines and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins. Organic bases other than the specific examples of the organic amines and amino acids include, for example, isopropylamine, diethylamine, triethylamine, trimethylamine, tripropylamine, ethylenediamine, N,N'-dibenzylethylenediamine, 2-diethylaminoethanol, 2-dimethylaminoethanol, morpholine, N-ethyl-morpholine, piperazine, piperidine, N-ethylpiperidine, betaine, caffeine, choline, glucosamine, glucosamine, histidine, hydrabamine, methylglucamine, polyamine resins, procaine, purine, theobromine, and the like.

[0129] In this specification, "pharmaceutically acceptable carriers" include various organic or inorganic carrier substances commonly used as preparation materials, such as excipients, disintegrants, binders, fluidizers, lubricants, etc. in solid preparations, solvents, solubilizers, suspending agents, isotonic agents, buffers, pain-relieving agents, etc. in liquid preparations, and bases, emulsifiers, wetting agents, stabilizers, stabilizers, dispersants, plasticizers, pH regulators, absorption promoters, gelling agents, preservatives, fillers, solubilizers, solubilizers, suspending agents, etc. in semi-solid preparations. In addition, as needed, additives such as preservatives, antioxidants, colorants, sweeteners, etc. are also included.

[0130] In this specification, "IL-6 and / or IL-1β inhibitor" refers to an agent that inhibits excessive gene expression and production of IL-6 and / or IL-1β, a cytokine that plays an important role in regulating immune response and inflammatory response. As the "IL-6 and / or IL-1β inhibitor", any agent that inhibits the gene expression and production of either IL-6 or IL-1β is sufficient, and an agent that inhibits the gene expression and production of both IL-6 and IL-1β (dual inhibitor) is more preferred.

[0131] In the present specification, "circulatory organ diseases accompanied by cardiovascular system inflammation associated with IL-6 and / or IL-1β" refers to circulatory organ diseases accompanied by cardiovascular system (specifically, pulmonary blood vessels or myocardium) inflammation caused by excessive gene expression and production of IL-6 and / or IL-1β. Specific examples of such circulatory organ diseases include, for example, cardiac hypertrophy (e.g., right heart hypertrophy), heart failure (e.g., right heart failure), myocarditis, cardiomyopathy, pulmonary hypertension accompanied by right heart failure, pulmonary hypertension accompanied by left heart disease, pulmonary hypertension accompanied by lung disease and / or hypoxemia, chronic thromboembolic pulmonary hypertension, pulmonary artery pulmonary hypertension accompanied by connective tissue disease (e.g., mixed connective tissue disease, systemic sclerosis), pulmonary artery pulmonary hypertension accompanied by portal hypertension, large vessel inflammation (e.g., Takayasu's arteritis, giant cell arteritis), aortic aneurysm, aortic dissection, and the like.

[0132] In this specification, "cardiovascular remodeling" refers to the remodeling of the structure of the ventricles and blood vessels due to various loads under physiological or pathological conditions, which are respectively referred to as ventricular remodeling and vascular remodeling. It is known that these remodelings are adaptive responses that are in line with the purpose of the organism at a certain point in time, but they become important factors that cause the disease to progress in the long term.

[0133] In the present specification, the "cardiovascular remodeling inhibitor" is an agent for improving cardiovascular remodeling by delaying the progression of cardiovascular remodeling or preventing the progression to irreversible pathological remodeling.

[0134] In the present specification, the term "pulmonary artery muscularization inhibitor" refers to an agent for inhibiting the thickening of the pulmonary artery media and adventitia and the muscularization of pulmonary microvessels caused by the proliferation of vascular smooth muscle cells promoted by shear stress, hypoxic environment, inflammation, etc.

[0135] In the present specification, "pharmaceutically effective amount" refers to the amount of the compound (I) of the present invention or a pharmaceutically acceptable salt thereof administered orally or parenterally (topically, rectally, intravenously, intramuscularly, subcutaneously, etc.) to a mammal.

[0136] In the present specification, the "mammal" is not particularly limited, and examples thereof include humans and mammals other than humans (for example, mice, rats, hamsters, guinea pigs, rabbits, cats, dogs, pigs, cows, horses, sheep, monkeys, etc.).

[0137] In this specification, "prevention" means to inhibit, suppress, control, slow down or stop the onset of clinical symptoms of a disease etc. in a patient (or subject) who may develop a disease etc. but has not yet developed the disease, or who is concerned about the recurrence of the disease etc. after treatment of the disease etc.

[0138] In the present specification, "treatment" means alleviation, alleviation or delay of the clinical symptoms of a disease, illness, disorder or the like (hereinafter referred to as "disease or the like") in a patient (or subject) suffering from the disease or the like.

[0139] (Compound of the present invention)

[0140] The compound of the present invention is a compound represented by the following formula (I).

[0141]

[0142] (Where R 1 and R 2 Each independently represents a hydrogen atom or a methyl group. )

[0143] Preferred R in the compound of the present invention represented by formula (I) 1 and R 2 The combination is as follows.

[0144] R 1 is a hydrogen atom, R 2 A hydrogen atom.

[0145] R 1 is methyl, R 2 A hydrogen atom.

[0146] R 1 is a hydrogen atom, R 2 It is methyl.

[0147] R 1 is methyl, R 2 It is methyl.

[0148] In addition, from the viewpoint of a high effect of suppressing excessive gene expression and production of IL-6 and / or IL-1β, preferred combinations among the above are as follows.

[0149] R 1 is methyl, R 2 A hydrogen atom.

[0150] R 1 is a hydrogen atom, R 2 It is methyl.

[0151] Furthermore, a particularly preferred compound of the present invention is 4-[(Z)-(1S,5R,6R,7R)-6-[(1E,3R,4R)-3-hydroxy-4-(m-tolyl)-1-pentenyl]-7-hydroxy-2-oxa-4,4-difluoro-bicyclo[3.3.0]octan-3-ylidene]-1-(tetrazol-5-yl)butane (sometimes referred to as "KAG-308" in this specification).

[0152] Since the compound of the present invention has an asymmetric carbon in its structure, it has various stereoisomers and optical isomers. The present invention includes all these stereoisomers, optical isomers, and mixtures thereof.

[0153] Furthermore, the compounds of the present invention or pharmaceutically acceptable salts thereof also include solvates thereof (eg, hydrates, ethanolates, etc.).

[0154] (Method for producing the compound of the present invention)

[0155] The compound of the present invention or a pharmaceutically acceptable salt thereof can be produced by a known method, for example, the method described in Patent Document 1 (International Publication No. 2010 / 029925) or Patent Document 2 (International Publication No. 2011 / 111714) related to the invention of the present inventors.

[0156] (Characteristics of the Compounds of the Present Invention)

[0157] The compound of the present invention or a pharmaceutically acceptable salt thereof is a prostaglandin (PG) derivative that is not easily metabolized in vivo and has improved stability. Since the carboxyl group of the PG skeleton is converted into a tetrazolyl group, it is difficult to be metabolized by β oxidation, which is known as a common metabolic pathway of fatty acids such as PG. Therefore, compared with compounds having a carboxyl group in the PG skeleton, the half-life in the blood is long and the effective blood concentration can be maintained for a long time. In addition, by improving metabolic stability in this way, the bioavailability of the drug can be improved.

[0158] The compound of the present invention or a pharmaceutically acceptable salt thereof exhibits an effect as an IL-6 and / or IL-1β inhibitor. Examples of preferred compounds exhibiting this effect are the same as the preferred embodiments of the compound of the present invention described above.

[0159] (Medicaments containing the compound of the present invention or a pharmaceutically acceptable salt thereof (or an IL-6 and / or IL-1β inhibitor comprising the compound of the present invention or a pharmaceutically acceptable salt thereof) as an active ingredient)

[0160] The drug of the present invention may be a drug containing only the compound of the present invention or a pharmaceutically acceptable salt thereof, or may be a pharmaceutical composition further containing a pharmaceutically acceptable carrier and other therapeutic ingredients (preferably one or more vasodilators) as required.

[0161] The dosage of the drug (or pharmaceutical composition) of the present invention when administered to mammals (patients or subjects) including humans varies depending on the subject of administration, disease, symptoms, dosage form, route of administration, etc. For example, in the case of humans, when administered to adult patients (weighing about 60 kg), the daily dosage varies depending on the patient's age, weight, condition and severity, etc. When converted to the compound of the present invention as an active ingredient, it is usually preferred to administer 0.0001 to 10 mg, preferably 0.01 to 1 mg, once or several times. For example, when administered orally, 0.001 to 3 mg is preferred, and 0.02 to 0.5 mg is particularly preferred. 0.0001 to 1 mg is preferred for intravenous administration, and 0.001 to 0.2 mg is particularly preferred. The dosage can be appropriately increased or decreased depending on the disease and morbidity. In addition, the administration method is sometimes ideal for continuous administration by drip in the case of injections.

[0162] When used as a medicine (or pharmaceutical composition), it can be administered to the body by oral administration, parenteral administration (for example, intravascular (venous, arterial) administration, subcutaneous administration, rectal administration, etc.). As a mode of administration, for example, oral administration modes such as tablets, capsules, syrups, liquid injections such as solutions, emulsions, suspensions, drips, suppositories, nasal drops, patches, inhalants, etc. can be exemplified. Among them, oral administration is preferred, and oral administration is particularly preferred more than 2 times a day.

[0163] The pharmaceutical composition of the present invention (hereinafter sometimes referred to as "the preparation of the present invention") is prepared by appropriately mixing the compound of the present invention or its pharmaceutically acceptable salt with at least one or more pharmaceutically acceptable carriers, etc., according to a method known in the technical field of pharmaceutical preparations. For example, in the case where the preparation is a powder, granules, tablets, etc., any pharmaceutically acceptable carrier (e.g., excipient, lubricant, disintegrant, binder, etc.) suitable for making a solid preparation can be used to make it. The content of the compound of the present invention or its pharmaceutically acceptable salt in the preparation or medicine varies according to the dosage form, dosage, etc., for example, 0.1% to 100% by weight of the preparation or medicine as a whole.

[0164] When the preparation of the present invention is a solid preparation, the pharmaceutically acceptable carrier that can be used is not particularly limited. Examples of the "excipient" include lactose, sucrose, D-mannitol, D-sorbitol, corn starch, dextrin, microcrystalline cellulose, crystalline cellulose, carboxymethyl cellulose, carboxymethyl cellulose calcium, sodium carboxymethyl starch, low-substituted hydroxypropyl cellulose, calcium carbonate, sodium carbonate, calcium phosphate, sodium phosphate, alginic acid, gum arabic, etc. Examples of the "lubricant" include magnesium stearate, calcium stearate, stearic acid, talc, etc. Examples of the "disintegrant" include carboxymethyl cellulose, carboxymethyl cellulose calcium, carboxymethyl cellulose sodium, sodium carboxymethyl starch, cross-linked sodium carboxymethyl cellulose, cross-linked polyvinylpyrrolidone, low-substituted hydroxypropyl cellulose, hydroxypropyl methyl cellulose, crystalline cellulose, etc. Examples of the "binder" include hydroxypropyl cellulose, hydroxypropyl methyl cellulose, polyvinylpyrrolidone, crystalline cellulose, sucrose, dextrin, starch, gelatin, sodium carboxymethyl cellulose, gum arabic, etc. In addition, the solid preparation may not be coated, or, in order to delay disintegration and absorption in the gastrointestinal tract, thereby giving a sustained effect for a longer time, may be coated by known techniques. For example, a time delay material such as glyceryl monostearate or glyceryl distearate may be used.

[0165] In addition, the preparation of the present invention can be a hard gelatin capsule mixed with an inert solid diluent such as calcium carbonate, calcium phosphate or kaolin, or can be provided in the form of a soft gelatin capsule mixed with a water-miscible solvent (e.g., propylene glycol, polyethylene glycol, ethanol, etc.) or an oil medium (e.g., peanut oil, liquid paraffin, olive oil, etc.).

[0166] In addition, when the preparation of the present invention is syrup, liquid, for example, stabilizer, suspending agent, flavoring agent, aromatic agent etc. can be appropriately selected to manufacture.When the medicine of the present invention is injection, in order to manufacture it, active ingredient can be dissolved in injection distilled water together with pH adjusting agents such as hydrochloric acid, sodium hydroxide, lactose, sodium lactate, acetic acid, sodium dihydrogen phosphate, sodium dihydrogen phosphate, sodium chloride, glucose and the like tonicity agents, aseptically prepared.In addition, inactive non-aqueous diluents such as propylene glycol, polyethylene glycol, olive oil, ethanol, polysorbate 80 can be used to prepare, mannitol, dextrin, cyclodextrin, gelatin etc. can also be further added, vacuum lyophilized, injection is made to dissolve when used.In addition, in order to improve stabilization and focus reachability, liposome preparations and fat emulsions can also be prepared by known methods and used as injection.

[0167] In addition, other aspects of the preparation of the present invention include: rectal preparations using suppository bases such as cocoa butter, triglycerides of fatty acids, diglycerides of fatty acids, monoglycerides of fatty acids, and polyethylene glycol; rectal injection ointments prepared with appropriate viscosity using water-soluble bases such as polyethylene glycol, polypropylene glycol, glycerin, and glycerin gelatin, white vaseline, hard wax, paraffin, liquid paraffin, plastic bases, lanolin, and refined lanolin.

[0168] The compound of the present invention or its pharmaceutically acceptable salt can be locally administered to the skin or mucosa, i.e., percutaneous or transmucosal administration. As the common dosage form for this purpose, gel, hydrogel, lotion, solution, cream, ointment, spray, dressing, foam preparation, film, skin patch, glutinous rice paper, implant, sponge, fiber, bandage, microemulsion etc. can be enumerated. The example of pharmaceutically acceptable carrier that can be used for this purpose includes alcohol, water, mineral oil, liquid paraffin, white vaseline, glycerol, polyethylene glycol and propylene glycol etc.

[0169] In order to use in any of the above-mentioned administration methods, in order to improve its solubility, dissolution rate, bioavailability and stability, the compounds of the present invention can be mixed with soluble macromolecular units such as cyclodextrin and its suitable derivatives or polymers containing polyethylene glycol. For example, it has been confirmed that drug-cyclodextrin complexes are generally useful in most dosage forms and routes of administration. Both inclusion and non-inclusion complexes can be used. As another method of direct complexation with the compounds of the present invention, cyclodextrin can also be used as an auxiliary additive, i.e., a carrier, excipient or solubilizer. For these purposes, α-, β- and γ-cyclodextrins are generally used.

[0170] The compound of the present invention or a pharmaceutically acceptable salt thereof may be used in combination with other drugs (combination drugs) as long as the pharmaceutical efficacy is not impaired.

[0171] There are no particular limitations on other drugs (combination drugs) suitable for use with the compound of the present invention or a pharmaceutically acceptable salt thereof. For example, one or more known drugs conventionally used in the treatment of circulatory organ diseases, autoimmune diseases, and respiratory diseases selected from the group consisting of hypertension, heart failure, pulmonary artery pulmonary hypertension, thrombosis, arrhythmia, ischemic heart disease, cardiomyopathy, aortic disease, myocarditis, and arteriosclerosis can be appropriately used. Specifically, for example, vasodilators such as prostacyclin derivatives (epoprostenol, beraprost, iloprost, treprostinil, selexipag, etc.), endothelin receptor antagonists (bosentan, ambrisentan, macitentan, etc.), phosphodiesterase 5 (PDE5) inhibitors (sildenafil, tadalafil, etc.) and guanylate cyclase stimulators (riociguat, etc.); steroids such as prednisolone, methylprednisolone, dexamethasone, etc.; immunosuppressants such as MTX, azathioprine, cyclophosphamide, mycophenolate mofetil, tacrolimus, cyclosporin, etc.; biological agents such as tocilizumab and TNF inhibitors; antiplatelet drugs such as aspirin, etc. Among them, vasodilators are particularly preferred.

[0172] In addition, the combination drugs that supplement and / or enhance the therapeutic effects of the compounds of the present invention or their pharmaceutically acceptable salts also include substances that have not been discovered so far but will be discovered in the future based on the above-mentioned mechanism (i.e., the mechanism of inhibiting excessive gene expression and production of IL-6 and / or IL-1β).

[0173] When using a combination drug, the administration period is not limited, and they can be administered to the subject at the same time, or they can be administered at a time different from the administration of the drug of the present invention (i.e., separated by a time difference). Based on the administration of the time difference, the drug of the present invention can be administered first, and then the combination drug, or the combination drug can be administered first, and then the drug of the present invention. The respective administration methods may be the same or different. In addition, it is also possible to administer in the form of a single preparation (compounding agent) containing a compound of the present invention or a pharmaceutically acceptable salt thereof and a combination drug. As a pharmaceutically acceptable carrier that can be used in the manufacture of the compounding agent, the same carrier as the carrier used in the aforementioned pharmaceutical composition of the present invention can be cited.

[0174] The dosage of the combination drug can be appropriately selected based on the dosage commonly used clinically. In addition, the compound of the present invention or its pharmaceutically acceptable salt etc. and the compounding ratio of the combination drug can be appropriately selected according to the subject of administration (age, body weight, general health status, sex, degree of illness of the subject etc.), route of administration, kind of disease, kind of combination drug etc.

[0175] The mass ratio of the compound of the present invention or a pharmaceutically acceptable salt thereof to the combined drug is not particularly limited.

[0176] The drug or pharmaceutical composition of the present invention can be provided in the form of a kit together with instructions for administration, etc. The drug contained in the kit is supplied through a container made of a material that allows the activity of the constituent components of the drug or pharmaceutical composition to be effectively sustained for a long time, does not adsorb to the inside of the container, and does not deteriorate the constituent components. For example, a sealed glass ampoule can contain a buffer solution sealed in the presence of a neutral and non-reactive gas such as nitrogen.

[0177] In addition, an instruction manual may be included in the kit. The instruction manual of the kit may be printed on paper or the like, or stored in an electromagnetically readable medium such as a CD-ROM or DVD-ROM and provided to the user.

[0178] (Use of medicines with the compound of the present invention or its pharmaceutically acceptable salt as an active ingredient)

[0179] The drug containing the IL-6 and / or IL-1β inhibitor of the compound of the present invention or a pharmaceutically acceptable salt thereof as an active ingredient can be used to treat circulatory organ diseases accompanied by diseases related to IL-6 and / or IL-1β, especially accompanied by cardiovascular system inflammation induced by excessive gene expression of IL-6 and / or IL-1β. The drug of the present invention is particularly useful for circulatory organ diseases accompanied by inflammation of the pulmonary vascular or myocardium.

[0180] The drug of the present invention exhibits a potent cardiovascular remodeling inhibitory effect, a right ventricular systolic pressure lowering effect, and an anti-inflammatory effect, and is therefore useful as a therapeutic drug for cardiac hypertrophy (particularly right cardiac hypertrophy) among circulatory organ diseases.

[0181] The drug of the present invention has a therapeutic effect not only on cardiac hypertrophy but also on pulmonary hypertension. In addition, since it has a strong inhibitory effect on cardiovascular remodeling, a right ventricular systolic pressure lowering effect, and an anti-inflammatory effect, it is also useful as a therapeutic drug for heart failure (especially right heart failure).

[0182] The drug of the present invention has a strong cardiovascular remodeling inhibitory effect, particularly a pulmonary artery muscularization inhibitory effect, a right ventricular systolic pressure lowering effect, an anti-inflammatory effect and an immunosuppressive effect, and is therefore useful for pulmonary hypertension in circulatory organ diseases. The drug of the present invention is particularly useful as a therapeutic drug for a disease selected from the group consisting of pulmonary hypertension with right heart failure, pulmonary hypertension with left heart disease, pulmonary hypertension with lung disease and / or hypoxemia, chronic thromboembolic pulmonary hypertension, pulmonary artery pulmonary hypertension with connective tissue disease (e.g., mixed connective tissue disease, systemic sclerosis), and pulmonary artery pulmonary hypertension with portal hypertension.

[0183] The drug of the present invention has a strong cardiovascular remodeling inhibitory effect, particularly an arterial muscularization inhibitory effect, an anti-inflammatory effect, and an immunosuppressive effect. Therefore, it is useful as a therapeutic drug for circulatory organ diseases, particularly for diseases selected from the group consisting of large vessel inflammation (e.g., Takayasu's arteritis, giant cell arteritis), aortic aneurysm, and aortic dissection.

[0184] Example

[0185] Hereinafter, the present invention will be specifically described by way of examples, but the present invention is not limited to these examples.

[0186] [Example 1]

[0187] (method)

[0188] According to the method described in Abe K, Circ Res, 94: 385-393, 2004, a rat pulmonary hypertension model induced by monocrotaline (MCT) was prepared. Male Sprague Dawley rats (SD rats) aged 5-6 weeks (weight 150-200g) were subcutaneously injected with monocrotaline (manufactured by Sigma-Aldrich) once at a dose of 60 mg / kg. For KAG-308, a compound of the present invention, from the day of subcutaneous injection of monocrotaline to the day before the measurement, a probe was used to perform oral administration at a dose of 1 mg / kg twice a day (2 mg / kg / day) ( Figure 1 In the KAG-308 non-treated pulmonary hypertension model, the same amount of solvent (injection water) was administered during the same period ( Figure 1 The normal subjects group without monocrotaline and KAG-308 were treated with the same age ( Figure 13 weeks after the injection of monocrotaline, the right ventricular systolic pressure, systemic arterial pressure, heart rate and right ventricular to left ventricular weight ratio (right ventricular hypertrophy) were measured. Under anesthesia with inhalation of isoflurane, the right ventricular systolic pressure was measured by right cardiac catheterization. Systemic arterial pressure and heart rate were measured from the carotid artery using an invasive conductance catheter. After the measurement, the rats were euthanized by intravenous injection of a lethal dose of pentobarbital, the hearts were removed, and the weight of the left ventricle (LV) including the ventricular septum (Sep) relative to the right ventricle (RV) was measured, and the ratio was used as an indicator of right ventricular hypertrophy.

[0189] (result)

[0190] (1) Effects on right ventricular systolic pressure and right ventricular hypertrophy

[0191] like Figure 2 As shown in the left figure, KAG-308 significantly inhibited the increase in right ventricular systolic pressure (RVSP) observed in rats with monocrotaline-induced pulmonary hypertension.

[0192] In addition, if Figure 2 As shown in the right figure, KAG-308 also significantly inhibited the increase in the weight ratio of the left ventricle (LV) including the ventricular septum (Sep) to the right ventricle (RV) (RV / LV+Sep) confirmed in rats with monocrotaline-induced pulmonary hypertension.

[0193] (2) Effects on left ventricular systolic pressure and heart rate

[0194] like Figure 3 As shown, there were no significant differences in left ventricular systolic pressure and heart rate in either group.

[0195] From the above results, it was confirmed that KAG-308 significantly suppressed the increase in right ventricular systolic pressure and right ventricular hypertrophy, and did not affect left ventricular systolic pressure and heart rate.

[0196] [Example 2] (Pathological tissue analysis)

[0197] In order to investigate the effect of 3-week administration of KAG-308 (2 mg / kg / day) in the monocrotaline-induced rat pulmonary hypertension model described in Example 1, pathological tissue analysis was performed.

[0198] (method)

[0199] The lungs collected from the rats used in the experiment of Example 1 were expanded by applying 20 cmH2O pressure and then fixed with 10% formalin overnight. They were then embedded in paraffin and cut into 5 μm sections, and the obtained tissue sections were used for Elastica Van Gieson (EVG) staining and immunohistological staining. For analysis, Graph pad Prism8 was used to calculate the average media wall thickness of the pulmonary arteries and the muscularization of the pulmonary arterioles.

[0200] (result)

[0201] (1) Effect on pulmonary artery media thickness

[0202] Pulmonary arteries with an outer diameter of 50 to 100 μm were analyzed, and the average media thickness was determined in a blinded manner (average media thickness = (outer diameter - inner diameter) / outer diameter). The results are shown in Figure 4 .

[0203] according to Figure 4 The average medial wall thickness increased in the monocrotaline-administered group, but the increase in average medial wall thickness was significantly suppressed by the administration of KAG-308. Based on this result, it was confirmed that KAG-308 has an inhibitory effect on the proliferation and hypertrophy of smooth muscle caused by pulmonary artery remodeling.

[0204] (2) Inhibitory effect on muscularization of pulmonary arterioles

[0205] The muscularization of pulmonary arterioles with an outer diameter of less than 50 μm was analyzed by immunostaining with anti-α-SMA (smooth muscular actin) antibodies. The proportion of smooth muscle in the entire circumference of the pulmonary arteriole was defined as non-muscular (<25%), partially muscular (25-75%), and totally muscular (>75%). At least 70 pulmonary arterioles from each specimen were evaluated by blind testing. The results are shown in Figure 5 .

[0206] according to Figure 5 In the KAG-308-administered group, the non-muscular ratio increased and the totally muscular ratio decreased. These results confirm that KAG-308 administration has a significant inhibitory effect on muscularization of pulmonary arterioles.

[0207] (3) Inhibitory effect on infiltration of inflammatory macrophages

[0208] Macrophages were measured by immunostaining using anti-CD68 antibodies. The device used a laser scanning microscope FV1200 IX83 (OLYMPUS) and observed at a magnification of 400 times, and the number of CD68-positive cells was measured in 15 fields randomly selected around small blood vessels. The results are shown in Figure 6 .

[0209] according to Figure 6 In monocrotaline-induced pulmonary hypertension rats, the infiltration of inflammatory CD68-positive macrophages increased, but the increase was significantly suppressed by the administration of KAG-308. The inhibitory effect on the infiltration of inflammatory macrophages was confirmed.

[0210] [Example 3] Quantitative RT-PCR analysis

[0211] According to the method described in Abe, K. et al. Cardiovasc Res. 2016, 111, 16, in order to investigate the effect of KAG-308 (2 mg / kg / day) in the monocrotaline-induced rat pulmonary hypertension model shown in Example 1, IL-6 and IL-1β mRNA quantitative analysis was performed using PCR.

[0212] (method)

[0213] The lungs collected from the rats used in the experiment of Example 1 were crushed, and Total RNA was extracted from the whole lungs using Qiagen RNeasy Mini Kit. ReverTra Ace qPCR Kit (Toyobo) and SYBR Premix Ex Taq (Takara Bio) were used for reverse transcription and amplification, respectively. TB Green Premix Ex TaqII (Takara Bio) and 7500real-time PCR system (Applied biosystems) were used for analysis. The primers used are as follows.

[0214] Primer sequences

[0215] IL-6F:AGCGATGATGCACTGTCAGAA

[0216] IL-6R: AACGGAACTCCAGAAGACCAG

[0217] IL-1βF: CCCTGAACTCAACTGTGAAATAGCA

[0218] IL-1βR: CCCAAGTCAAGGGCTTGGAA

[0219] (result)

[0220] according to Figure 7 , it was confirmed that in rats given monocrotaline, the mRNA expression of IL-6, an inflammatory cytokine, increased by more than 60 times (left figure), and the mRNA expression of IL-1β increased by more than 2 times (right figure). On the other hand, in rats given KAG-308 (2 mg / kg / day), the increase in the mRNA expression of IL-6 and IL-1β was significantly suppressed. In particular, the increase in mRNA expression of IL-6 was suppressed by 89%.

[0221] From the above results, it can be confirmed that the compound of the present invention does not change the heart rate and left ventricular systolic pressure, and significantly inhibits right ventricular systolic pressure, right ventricular hypertrophy and pulmonary artery muscularization compared with the non-treated monocrotaline-induced pulmonary hypertension group. In addition, as its mechanism, the pulmonary hypertension prevention and treatment effect and the right ventricular hypertrophy inhibitory effect brought about by the inhibition of cardiovascular remodeling brought about by the excessive gene expression and the inhibitory effect produced by IL-6 and / or IL-1β were confirmed, thus showing that the compound of the present invention is useful in the treatment of pulmonary hypertension and cardiac hypertrophy via the inhibition of IL-6 and / or IL-1β.

[0222] Preparation Example 1: Preparation of capsules

[0223]

[0224] 1), 2), 3) and 4) are mixed and filled into gelatin capsules.

[0225] Preparation Example 2: Preparation of Tablets

[0226]

[0227]

[0228] The compound of the present invention (30 mg) and magnesium stearate (3.0 g) were granulated with an aqueous solution of soluble starch (70 mL) (7.0 g in terms of soluble starch), dried, and mixed with lactose (70.0 g) and corn starch (50.0 g) (lactose, corn starch, soluble starch and magnesium stearate were all qualified products of the 14th revised edition of the Japanese Pharmacopoeia). The mixture was compressed to obtain tablets.

[0229] Industrial Applicability

[0230] The compound of the present invention or a pharmaceutically acceptable salt thereof is useful as an IL-6 and / or IL-1β inhibitor. In addition, according to the present invention, a drug can be provided, characterized in that it contains an IL-6 and / or IL-1β inhibitor as an active ingredient, the inhibitor comprises a compound of the present invention or a pharmaceutically acceptable salt thereof, and the drug is used to treat circulatory organ diseases accompanied by cardiovascular inflammation associated with IL-6 and / or IL-1β, in particular, a disease selected from the group consisting of cardiac hypertrophy (e.g., right heart hypertrophy), heart failure (e.g., right heart failure), myocarditis, cardiomyopathy, pulmonary hypertension accompanied by right heart failure, pulmonary hypertension accompanied by left heart disease, pulmonary hypertension accompanied by lung disease and / or hypoxemia, chronic thromboembolic pulmonary hypertension, pulmonary artery pulmonary hypertension accompanied by connective tissue disease (e.g., mixed connective tissue disease, systemic sclerosis), pulmonary artery pulmonary hypertension accompanied by portal hypertension, large vessel inflammation (e.g., Takayasu's arteritis, giant cell arteritis), aortic aneurysm and aortic dissection.

[0231] This application is based on Japanese Patent Application No. 2022-080531 filed on May 16, 2022 in Japan, the contents of which are all included in this specification.

Claims

1. An IL-6 and / or IL-1β inhibitor, It comprises a compound represented by formula (I) or a pharmaceutically acceptable salt thereof, In the formula, R 1 and R 2 Each independently represents a hydrogen atom or a methyl group.

2. The inhibitor according to claim 1, wherein The compound represented by formula (I) is 4-[(Z)-(1S,5R,6R,7R)-6-[(1E,3R,4R)-3-hydroxy-4-(m-tolyl)-1-pentenyl]-7-hydroxy-2-oxa-4,4-difluoro-bicyclo[3.3.0]octane-3-ylidene]-1-(tetrazolyl-5-yl)butane. The inhibitor according to claim 1 or 2, which is an IL-6 and IL-1β inhibitor.

4. A medicament for treating a circulatory organ disease accompanied by cardiovascular system inflammation associated with IL-6 and / or IL-1β, comprising the inhibitor according to any one of claims 1 to 3 as an active ingredient.

5. The drug according to claim 4, wherein The cardiovascular system is the pulmonary vascular system.

6. The drug according to claim 4, wherein The cardiovascular system is the myocardium.

7. The drug according to any one of claims 4 to 6, wherein The circulatory organ disease is selected from the group consisting of cardiac hypertrophy, heart failure, myocarditis and cardiomyopathy.

8. The drug according to claim 7, wherein Circulatory organ disease is cardiac hypertrophy.

9. The drug according to claim 7, wherein The circulatory organ disease is heart failure.

10. The drug according to claim 9, wherein Heart failure is right heart failure.

11. The drug according to claim 4, wherein The circulatory organ disease is pulmonary hypertension with right heart failure.

12. The drug according to claim 4, wherein The circulatory organ disease is pulmonary hypertension associated with left heart disease.

13. The drug according to claim 4, wherein Circulatory organ disease is pulmonary hypertension with accompanying lung disease and / or hypoxemia.

14. The drug according to claim 4, wherein The circulatory organ disease is chronic thromboembolic pulmonary hypertension.

15. The drug according to claim 4, wherein The circulatory organ disease is pulmonary hypertension associated with connective tissue disease.

16. The drug according to claim 15, wherein The connective tissue disease was mixed connective tissue disease or systemic sclerosis.

17. The drug according to claim 4, wherein The circulatory organ disease is pulmonary arterial pulmonary hypertension with portal hypertension.

18. The drug according to claim 4, wherein The circulatory organ disease is selected from the group consisting of large vessel vasculitis, aortic aneurysm and aortic dissection.

19. The medicament according to any one of claims 4 to 18, which is for oral administration.

20. The drug according to claim 19, characterized in that Administer orally 2 or more times a day.

21. The drug according to any one of claims 4 to 20, characterized in that It is administered in combination with one or two or more other pharmaceutical agents.

22. The drug according to claim 21, characterized in that The drug according to claim 4 and one or more other drugs are respectively contained as active ingredients of different preparations, and are administered simultaneously or at different times.

23. The drug according to claim 21, characterized in that A single preparation contains the drug according to claim 4 and one or more other drugs.

24. The medicament according to any one of claims 21 to 23, wherein Other agents are vasodilators.

25. A pharmaceutical composition comprising the inhibitor according to any one of claims 1 to 3 and a pharmaceutically acceptable carrier.

26. A cardiovascular remodeling inhibitor comprising the inhibitor according to any one of claims 1 to 3 as an active ingredient.

27. A pulmonary artery muscularization inhibitor comprising the inhibitor according to any one of claims 1 to 3 as an active ingredient.

Images