Factor VIII compositions and methods of making and using same

Abstract

The present invention relates to compositions comprising a Factor VIII coagulation factor linked to an extended recombinant polypeptide (XTEN), isolated nucleic acids encoding the compositions and vectors and host cells containing the isolated nucleic acids, and methods of making and using the compositions in the treatment of Factor VIII related diseases, disorders and conditions.

Description

[0001] This application is a re-divisional application of a divisional application with an application date of July 11, 2012, Chinese application number 201911274326.2, and invention name “Factor VIII composition and preparation and use method thereof” (the original application number of the parent case is 201280072346.1).

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims priority to U.S. Provisional Application Serial No. 61 / 599,400, filed February 15, 2012, which is incorporated herein by reference.

[0004] Sequence Listing

[0005] This application contains a sequence listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. The ASCII copy created on July 11, 2012 is named 32887346.txt and is 13,344,768 bytes in size. Background Art

[0006] Factor VIII is an important component of the intrinsic coagulation cascade pathway. In the circulation, factor VIII is mainly complexed with von Willebrand factor. After activation by thrombin (factor IIa), it dissociates from the complex to interact with factor IXa in the intrinsic coagulation cascade, which in turn activates factor X. Once removed from the von Willebrand factor complex, activated factor VIII is proteolytically inactivated by activated protein C (APC), factor Xa, and factor IXa, and is rapidly cleared from the bloodstream. When complexed with normal von Willebrand factor protein, the half-life of factor VIII is about 12 hours, while in the absence of von Willebrand factor, the half-life of factor VIII is reduced to 2 hours (Tuddenham EG et al., Br J Haematol. (1982) 52 (2): 259-267).

[0007] In hemophilia, blood clotting is disturbed by the lack of certain plasma coagulation factors. Hemophilia A is a factor VIII deficiency and a recessive sex-linked X-chromosome disorder that accounts for 80% of hemophilia cases. The standard of care for managing hemophilia A is supplementation therapy with recombinant factor VIII concentrates. Subjects with severe hemophilia A have circulating procoagulant factor VIII levels that are 1-2% lower than normal, and typically adopt preventive therapy that aims to keep factor VIII above 1% between doses, which can usually be achieved by giving factor VIII two to three times a week. People with moderately severe hemophilia (factor VIII levels are 2-5% of normal) account for 25-30% of hemophilia events and develop bleeding after minor trauma. People with mild hemophilia A (factor VIII levels are 5-40% of normal) account for 15-20% of all hemophilia events and develop bleeding only after major trauma or surgery.

[0008] The in vivo activity of exogenously supplied Factor VIII is limited by both the short half-life of the protein and inhibitors that bind to Factor VIII and diminish or destroy hemostatic function.

[0009] Up to 30% of hemophilia A patients who receive exogenous supply of factor VIII mount an IgG immune response to factor VIII (Towfighi, F. et al. Comparative measurement of anti-factor VIII antibody by Bethesda assay and ELISA reveals restricted isotype profile and epitopespecificity. Acta Haematol (2005) 114: 84-90), which may lead to complete inhibition of its procoagulant activity and / or promote more rapid clearance of factor VIII ( E et al. High titer inhibitors in severe haemophilia A. Ameta-analysis based on eight long-term follow-up studies conceming inhibitors associated with crude or intermediate purity factor VIII products. Throm. Haemost. (1994) 72: 162-164). IgG antibodies known as FVIII inhibitors are mainly directed against A2, A3 and C2 domains (Scandella D et al. Localization of epitopes for human factor VIII inhibitor antibodies by immunoblotting and antibody neutralization. Blood (1989) 74: 1618-1626), but can also be produced against A1, B and C1 domains. Therefore, the treatment options for patients with FVIII inhibitors are limited.

[0010] Large proteins such as Factor VIII are usually administered intravenously to make the agent directly available in the bloodstream. It has previously been demonstrated that unmodified Factor VIII injected intramuscularly produces a maximum circulating level of only 1.4% of normal plasma levels (Pool et al., Ineffectiveness of Intramuscularly Injected Factor VIII Concentrate in Two Hemophilic Patients. New England J. Medicine (1966) 275 (10): 547-548). Formulations that can be administered other than by the intravenous route would greatly simplify their use, increase safety, and result in substantial cost savings.

[0011] Chemical modification of therapeutic proteins can improve its in vivo clearance rate and subsequent serum half-life. An example of common modification is the addition of polyethylene glycol (PEG) moieties, which are usually coupled to proteins by reacting aldehydes or N-hydroxysuccinimide (NHS) groups on PEG with amine groups (e.g., lysine side chains or N-terminals). However, the conjugation step can result in the formation of a heterogeneous product mixture that requires extraction, purification, and / or other further processes, all of which inevitably affect product yield and quality control. In addition, if the amino acid side chains near the binding site of the coagulation factor become modified by the pegylation process, the pharmacological function of the coagulation factor may be hindered. Other methods include fusing the Fc domain gene to a therapeutic protein, which can increase the size of the therapeutic protein, thereby reducing the rate of clearance by the kidney. In some cases, the Fc domain confers the ability to bind to the FcRn receptor and recycle through the FcRn receptor autolysosome, thereby increasing the pharmacokinetic half-life. Unfortunately, Fc domains do not fold efficiently during recombinant expression and tend to form insoluble precipitates called inclusion bodies. These inclusion bodies must be solubilized and functional protein must be renatured from the misfolded aggregates, a time-consuming, inefficient and expensive process. Summary of the invention

[0012] The present invention relates to novel blood coagulation factor VIII fusion protein compositions and uses thereof. Specifically, compositions provided herein are particularly useful for treating or improving the symptom associated with hemophilia A, factor VIII deficiency, bleeding disorders and coagulopathy. On the one hand, the present invention provides compositions comprising the fusion protein of the separation of factor VIII (FVIII) and one or more extended recombinant polypeptides (XTEN), wherein the fusion protein exhibits procoagulant activity. The subject XTEN suitable for constructing the fusion protein is generally a polypeptide with non-repetitive sequences and non-structured conformation. In one embodiment, one or more XTEN are connected to a blood coagulation factor FVIII ("CF") selected from natural human factor VIII, factor VIII B domain deletion sequence ("FVIII BDD") and sequence variants thereof (all the aforementioned are collectively referred to as "FVIII" or "CF"), thereby producing a recombinant factor VIII-XTEN fusion protein ("CFXTEN"). The factor VIII polypeptide component of CFXTEN comprises A1 domain, A2 domain, C1 domain, C2 domain and optionally B domain or a portion thereof. In some embodiments, the above-mentioned domains are further characterized to include acidic a1, a2 and a3 spacers. In another embodiment, the disclosure relates to pharmaceutical compositions comprising fusion proteins and their use in methods and regimens for treating factor VIII-related conditions. The CFXTEN compositions have enhanced pharmacokinetic and pharmacological properties compared to FVIII not connected to XTEN, which can allow for more convenient administration and improved efficacy.

[0013] In a first aspect, the invention relates to a recombinant Factor VIII fusion protein comprising a Factor VIII polypeptide and one or more extended recombinant polypeptides (XTEN) linked to the Factor VIII. In some embodiments, the invention provides a recombinant Factor VIII fusion protein comprising a Factor VIII polypeptide and at least one extended recombinant polypeptide (XTEN), wherein the Factor VIII polypeptide comprises an A1 domain comprising an a1 acidic spacer region, an A2 domain comprising an a2 acidic spacer region, an A3 domain comprising an a3 acidic spacer region, a C1 domain, a C2 domain, and optionally all or a portion of a B domain, and wherein the at least one XTEN is linked to the Factor VIII polypeptide at: (i) the C-terminus of the Factor VIII polypeptide; (ii) within the B domain of the Factor VIII polypeptide, if all or a portion of the B domain is present; (iii) within the A1 domain of the Factor VIII polypeptide ; (iv) within the A2 domain of the factor VIII polypeptide; (v) within the A3 domain of the factor VIII polypeptide; (vi) within the C1 domain of the factor VIII polypeptide; (vii) within the C2 domain of the factor VIII polypeptide; (viii) at the N-terminus of the factor VIII polypeptide, or (ix) between two domains of the factor VIII polypeptide, wherein the fusion protein retains at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, or 500% of the procoagulant activity as measured by an in vitro coagulation assay compared to the corresponding factor VIII not linked to the XTEN. In one embodiment, in the aforementioned recombinant factor VIII fusion protein, at least one XTEN is linked to the factor VIII polypeptide at a site within or 1 to 6 amino acids of a site selected from Table 5, Table 6, Table 7, Table 8, and Table 9.In other embodiments, the invention provides a recombinant Factor VIII fusion protein comprising a Factor VIII polypeptide and at least a first extended recombinant polypeptide (XTEN), wherein the Factor VIII polypeptide comprises an A1 domain comprising an a1 acidic spacer region, an A2 domain comprising an a2 acidic spacer region, an A3 domain comprising an a3 acidic spacer region, a C1 domain, a C2 domain, and optionally all or a portion of a B domain, and wherein the first XTEN is attached to the Factor VIII polypeptide at: (i) the C-terminus of the Factor VIII polypeptide; (ii) within the B domain of the Factor VIII polypeptide, if all or a portion of the B domain is present; (iii) within the A1 domain of the Factor VIII polypeptide; (iv) within the C-terminus of the Factor VIII polypeptide; or (vii) within the C2 domain of the Factor VIII polypeptide; and the fusion protein (a) retains at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, or 500% procoagulant activity in an in vitro coagulation assay described herein or other such assays known in the art, and / or (b) exhibits reduced binding to an anti-Factor VIII antibody in an in vitro binding assay described herein or other such assays known in the art, when compared to a corresponding Factor VIII protein not linked to the XTEN. In one embodiment, in the aforementioned recombinant Factor VIII fusion proteins, at least one XTEN is linked to the Factor VIII polypeptide at a site at or within 1 to 6 amino acids of a site selected from Table 5, Table 6, Table 7, Table 8, and Table 9. In other embodiments, the invention provides a recombinant Factor VIII fusion protein comprising a Factor VIII polypeptide and at least a first extended recombinant polypeptide (XTEN), wherein the Factor VIII polypeptide comprises an A1 domain containing an a1 acidic spacer region, an A2 domain containing an a2 acidic spacer region, an A3 domain containing an a3 acidic spacer region, a C1 domain, a C2 domain, and optionally all or a portion of a B domain, and wherein the first XTEN is linked to the Factor VIII polypeptide at an insertion site selected from Tables 6 and 7 and wherein the fusion protein retains at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, or 500% of the procoagulant activity compared to a corresponding Factor VIII protein not linked to the XTEN when measured by an in vitro coagulation assay described herein, or other such assays known in the art.Non-limiting examples of Factor VIII proteins not linked to XTEN include native FVIII, BDD FVIII, pBC100, and the sequences from Table 1. In another embodiment of the recombinant Factor VIII fusion protein, the Factor VIII polypeptide has at least about 80% sequence identity, or about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% to about 100% sequence identity with a sequence selected from the group consisting of the sequences of Table 1, when optimally aligned. Figure 3 The sequence depicted in Figure 4 In another embodiment, the fusion protein comprises at least one other XTEN linked to the Factor VIII polypeptide at the C-terminus of the Factor VIII polypeptide or within the B domain of the Factor VIII polypeptide or optionally replacing the B domain of the Factor VIII polypeptide. In a specific embodiment, the fusion protein comprises at least one XTEN sequence located within the B domain of the Factor VIII polypeptide or optionally replacing the B domain of the Factor VIII polypeptide. In another specific embodiment, the fusion protein comprises at least one XTEN sequence linked to the Factor VIII polypeptide at the C-terminus of the Factor VIII polypeptide. In one embodiment, the recombinant Factor VIII fusion protein comprises a variant of a human Factor VIII with a B domain deletion, wherein with respect to Figure 3 The full-length human factor VIII sequence set forth in , wherein the B domain deletion begins at a first position at about amino acid residue number 741 to about 750 and ends at a second position at about amino acid residue number 1635 to about 1648. In another embodiment, the recombinant factor VIII fusion protein comprises a first XTEN sequence linked to the factor VIII polypeptide at the C-terminus of the factor VIII polypeptide, and at least a second XTEN within the B domain of the factor VIII polypeptide or replacing the B domain of the factor VIII polypeptide, wherein with respect to Figure 3In one embodiment, the second XTEN is connected to the full-length human factor VIII sequence set forth in , wherein the second XTEN is connected to the C-terminus of about amino acid residue numbering 741 to about 750 and the N-terminus of amino acid residue numbering 1635 to about 1648, wherein the cumulative length of the XTEN is at least about 100 amino acid residues. In one embodiment, in the aforementioned fusion protein, the second XTEN connects the factor VIII amino acids between N745 and P1640, or between S743 and Q1638, or between P747 and V1642, or between N745 and Q1656, or between N745 and S1657, or between N745 and T1667, or between N745 and Q1686, or between R747 and V1642, or between T751 and T1667. In one embodiment, the recombinant Factor VIII fusion protein comprises a sequence having at least about 80% sequence identity, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% to about 100% sequence identity compared to a sequence of similar length selected from Table 21 when optimally aligned. In another embodiment, the recombinant factor VIII fusion protein comprises at least a second XTEN, optionally a third XTEN, optionally a fourth XTEN, optionally a fifth XTEN, and optionally a sixth XTEN, wherein the second, third, fourth, fifth, or sixth XTEN is each linked to the factor VIII polypeptide at a second, third, fourth, fifth, or sixth site selected from the group consisting of: an insertion site from Table 5, Table 6, Table 7, Table 8, and Table 9; at amino acid residues 32, 220, 224, 336, 339, 390, 399, 416, 603, 1656, 1711, 1721, 1730, 1743, 1757, 1760, 1771, 1781, 1791, 1803, 1811, 1821, 1830, 1843, 1861, 1871, 1881, 1891, 1903, 1914, 1923, 1930, 1943, 1950, 1961, 1971, 1981, 1991, 2013 a position within 6 amino acids of 725, 1905, and 1910 of the Factor VIII polypeptide; a position between any two adjacent domains of the Factor VIII polypeptide, wherein the two adjacent domains are selected from the group consisting of the A1 and A2 domains, the A2 and B domains, the B and A3 domains, the A3 and C1 domains, and the C1 and C2 domains; a position within the B domain of the Factor VIII polypeptide, wherein the second XTEN is linked to the C-terminus at about amino acid residue number 741 to about 750 and the N-terminus at amino acid residue number 1635 to about 1648 of the native Factor VIII sequence; and the C-terminus of the Factor VIII polypeptide. In one embodiment, the first XTEN is separated from the second XTEN by at least 10 amino acids, at least 50 amino acids, at least 100 amino acids, at least 200 amino acids, at least 300 amino acids, or at least 400 amino acids.In one embodiment of the recombinant factor VIII fusion protein comprising at least a second XTEN, optionally a third XTEN, optionally a fourth XTEN, optionally a fifth XTEN, and optionally a sixth XTEN, each XTEN has at least about 80% sequence identity, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or about 100% sequence identity compared to an XTEN of similar length selected from the group consisting of the sequences in Table 4, Table 13, Table 14, Table 15, Table 16, and Table 17 when optimally aligned. In another embodiment of the recombinant factor VIII fusion protein, the recombinant factor VIII fusion protein comprises at least a second XTEN, optionally a third XTEN, optionally a fourth XTEN, optionally a fifth XTEN, and optionally a sixth XTEN. In preferred embodiments, the recombinant Factor VIII fusion protein exhibits a terminal half-life of at least about 3 hours, or 4 hours, or 6 hours, or 12 hours, or 13 hours, or 14 hours, or 16 hours, or 24 hours, or 48 hours, or 72 hours, or 96 hours, or 120 hours, or 144 hours, or 7 days, or 14 days, or 21 days when administered to a subject, wherein the subject is selected from humans and Factor VIII / von Willebrand Factor double knockout mice. Additionally, in the embodiments of this paragraph, the fusion protein exhibits reduced binding to an anti-Factor VIII antibody or retained greater procoagulant activity, or both, compared to the corresponding Factor VIII not linked to the XTEN. In one embodiment, the procoagulant activity of the recombinant Factor VIII fusion protein in the presence of an anti-FVIII antibody is at least 30%, or 40%, 50%, 80%, 100%, 200%, 300%, 400%, or 500% greater than that of the corresponding Factor VIII not linked to XTEN when each is determined by an in vitro coagulation assay. In one embodiment, the reduced binding of the fusion protein to the anti-Factor VIII antibody is determined using the Bethesda assay using an anti-Factor VIII antibody selected from the group consisting of the antibodies of Table 10 and polyclonal antibodies from hemophilia A patients with Factor VIII inhibitors, wherein the reduced binding and retained procoagulant activity of the fusion protein is demonstrated by a reduction in the Bethesda titer of the fusion protein by at least about 2, 4, 6, 8, 10, 12, 15, 20, 30, 40, 50, 60, 70, 80, 100, or 200 Bethesda units compared to the Bethesda titer of Factor VIII not linked to XTEN.

[0014] In one embodiment, the recombinant Factor VIII fusion protein can, for example, comprise one or more XTEN wherein the XTEN has at least about 80% sequence identity, or about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% to about 100% sequence identity compared to one or more XTEN of similar length selected from Table 4, Table 13, Table 14, Table 15, Table 16, and Table 17 when optimally aligned.

[0015] In another aspect, the invention relates to a recombinant factor VIII fusion protein comprising FVIII and one or more XTEN in a specific N-terminal to C-terminal configuration. In one embodiment of the CFXTEN composition, the invention provides a recombinant factor VIII fusion protein of formula I:

[0016] (XTEN) x -CF-(XTEN) y I

[0017] Wherein independently for each occurrence, CF is a factor VIII as defined herein, including sequences with at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% or 100% sequence identity with the sequences from Table 1; x is 0 or 1 and y is 0 or 1, wherein x+y≥1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences with at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% or 100% sequence identity with the sequences set forth in Table 4. Thus, the CFXTEN fusion compositions can have XTEN-CF, XTEN-CF-XTEN or CF-XTEN configurations.

[0018] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula II:

[0019] (XTEN) x -(S) x -(CF)-(XTEN) x II

[0020] wherein independently for each occurrence, CF is a Factor VIII as defined herein, including sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity with the sequences set forth in Table 1; S is a spacer sequence having between 1 and about 50 amino acid residues that may optionally include a cleavage sequence or amino acids compatible with a restriction site; x is 0 or 1 and y is 0 or 1, wherein x+y≥1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity with the sequences set forth in Table 4.

[0021] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein, wherein the fusion protein has Formula III:

[0022] (XTEN) x -(S) x -(CF)-(S) y -(XTEN) y III

[0023] wherein independently for each occurrence, CF is a Factor VIII as defined herein, including sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity with the sequences set forth in Table 1; S is a spacer sequence having between 1 and about 50 amino acid residues that may optionally include a cleavage sequence or amino acids compatible with a restriction site; x is 0 or 1 and y is 0 or 1, wherein x+y≥1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity with the sequences set forth in Table 4.

[0024] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula IV:

[0025] (A1)-(XTEN) u -(A2)-(XTEN) v -(B)-(XTEN) w -(A3)-(XTEN) x -(C1)-(XTEN) y-(C2)-(XTEN) z

[0026] IV

[0027] wherein, independently for each occurrence, A1 is the A1 domain of FVIII; A2 is the A2 domain of FVIII; A3 is the A3 domain of FVIII; B is the B domain of FVIII, which may be a fragment or splice variant of the B domain; C1 is the C1 domain of FVIII; C2 is the C2 domain of FVIII; v is 0 or 1; w is 0 or 1; x is 0 or 1; y is 0 or 1; y is 0 or 1, provided that u+v+x+y+z≥1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity with the sequences set forth in Table 4.

[0028] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula V:

[0029] (XTEN) 1 -(S) a -(A1)-(S) b -(XTEN) o -(S) b -(A2)-(S) c -(XTEN) v -(S) c -(B)-(S) d -(XTEN) w -(S) d -(A3)-(S) e -(XTEN) x -(S) e -(C1)-(S) f -(XTEN) y -(S) f -(C2)-(S) g -(XTEN) 2 V

[0030] wherein, independently for each occurrence, A1 is the A1 domain of FVIII; A2 is the A2 domain of FVIII; A3 is the A3 domain of FVIII; B is the B domain of FVIII, which may be a fragment or splice variant of the B domain; C1 is the C1 domain of FVIII; C2 is the C2 domain of FVIII; S is a spacer sequence having between 1 and about 50 amino acid residues, which may optionally include a cleavage sequence or amino acids compatible with a restriction site; a is 0 or 1; b is 0 or 1; c is 0 or 1; d is 0 or 1; e is 0 or 1; f is 0 or 1; g is 0 or 1; t is 0 or 1; u is 0 or 1; v is 0 or 1; w is 0 or 1, x is 0 or 1; y is 0 or 1; z is 0 or 1, provided that t+u+v+w+x+y+z≥1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% or 100% sequence identity with the sequences set forth in Table 4. In another embodiment of Formula V, the spacer sequence is glycine or a sequence selected from Tables 11 and 12.

[0031] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula VI:

[0032] (XTEN) u -(S) a -(A1)-(S) b -(XTEN) v -(S) b -(A2)-(S) c -(XTEN) w -(S) c -(A3)-(S) d -(XTEN) c -(S) d -(C1)-(S) c -(XTEN) y -(S) c -(C2)-(S) f -(XTEN) z VI

[0033] wherein, independently for each occurrence, A1 is the A1 domain of FVIII; A2 is the A2 domain of FVIII; A3 is the A3 domain of FVIII; C1 is the C1 domain of FVIII; C2 is the C2 domain of FVIII; S is a spacer sequence having between 1 and about 50 amino acid residues that may optionally include a cleavage sequence or amino acids compatible with a restriction site; a is 0 or 1; b is 0 or 1; c is 0 or 1; d is 0 or 1; e is 0 or 1; f is 0 or 1; u is 0 or 1; v is 0 or 1; w is 0 or 1, x is 0 or 1; y is 0 or 1; z is 0 or 1, provided that u+v+w+x+y+z≥1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% or 100% sequence identity with the sequences set forth in Table 4. In another embodiment of Formula V, the spacer sequence is glycine or a sequence selected from Tables 11 and 12.

[0034] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula VII:

[0035] (SP)-(XTEN) x -(CS) x -(S) x -(FVIII_1-745)-(S) y -(XTEN) y -(S)y-(FVIII_1640-2332)-(S) z -(CS)z-(XTEN) z VII

[0036] wherein, independently for each occurrence, SP is a signal peptide, preferably having the sequence MQIELSTCFFLCLLRFCFS (SEQ ID NO: 1611), CS is a cleavage sequence listed in Table 12, S is a spacer sequence of between 1 and about 50 amino acid residues that may optionally include an amino acid compatible with a restriction site, "FVIII 1-745" are residues 1-745 of factor FVIII and "FVIII_1640-2332" are residues 1640-2332 of FVIII, x is 0 or 1, y is 0 or 1, and z is 0 or 1, wherein x+y+z>2; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity to the sequences set forth in Table 4. In one embodiment of Formula VII, the spacer sequence is GPEGPS (SEQ ID NO: 1612). In another embodiment of Formula V, the spacer sequence is glycine or a sequence selected from Tables 11 and 12.

[0037] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula VIII:

[0038] (A1)-(S) a -(XTEN) v -(S) a -(A2)-(B1)-(S) b -(XTEN) w -(S) b -(B2)-(A3)-(S) c -(XTEN) x -(S) c -(C1)-(S) d -(XTEN) y -(S) d -(C2)-(S) e -(XTEN) 2 VIII

[0039] wherein independently for each occurrence, A1 is the A1 domain of FVIII; A2 is the A2 domain of FVIII; B1 is a fragment of the B domain that may have residues 741 to 743-750 of FVIII or about residue 741 to about residue 745 of FVIII; B2 is a fragment of the B domain that may have residues 1635-1686 to 1689 of FVIII or about residue 1640 to about residue 1689 of FVIII; A3 is the A3 domain of FVIII; C1 is the C1 domain of FVIII; C2 is the C2 domain of FVIII; S is a fragment having between 1 and about 50 amino acid residues A spacer sequence of a cleavage sequence or amino acid that is compatible with a restriction site may be optionally included; a is 0 or 1; b is 0 or 1; c is 0 or 1; d is 0 or 1; e is 0 or 1; f is 0 or 1; u is 0 or 1; v is 0 or 1; w is 0 or 1, x is 0 or 1; y is 0 or 1; z is 0 or 1, provided that u+v+w+x+y+z≥1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% or 100% sequence identity with the sequences set forth in Table 4. In one embodiment of Formula VIII, the spacer sequence is GPEGPS (SEQ ID NO: 1612). In another embodiment of Formula V, the spacer sequence is glycine or a sequence selected from Tables 11 and 12.

[0040] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula IX:

[0041] (A1 N )-(S) a -(XTEN) t -(S) b -(A1 C )-(A2 N )-(S) c -(XTEN) u -(S) d -(A2 C )-(B N )-(S) e -(XTEN) v -(S) t -(B C )-(A3 N )-(S) g -(XTEN) w -(S) h -(A3 C )-(C1 N )-(S)i -(XTEN) x -(S) j -(C1 C )-(C2 N )-(S) k -(XTEN) y -(S)-(C2 C )-(S) m -(XTEN) x

[0042] IX

[0043] In which, for each occurrence independently, A1 N is a fragment of the A1 domain from at least residue number 1 (numbered relative to native mature FVIII) to at most residue number 371, A1 c is a fragment of the A1 domain from at least residue number 2 to at most residue number 372, provided that the A1 N The sequence of the fragment is in the A1 c No repetition in the segment; A2 N is a fragment of the A2 domain from at least residue number 373 to at most residue number 739, A2 c is a fragment of the A2 domain from at least residue number 374 to at most residue number 740, provided that the A2 N The sequence of the fragment is in the A2 c No repetition in the segment; B N is a fragment of the B domain from at least residue number 741 to at most residue number 1647, B c is a fragment of the B domain from at least residue number 742 to at most residue number 1648, provided that the B N The sequence of the fragment is in the B c No repetition in the segment; A3 N is a fragment of the A3 domain from at least residue number 1649 to at most residue number 2019, A3 c is a fragment of the A3 domain from at least residue number 1650 to at most residue number 2019, provided that the A3 N The sequence of the fragment is in the A3 c No repetition in the segment; C1 N is a fragment of the C1 domain from at least residue number 2020 to at most residue number 2171, C1 c is a fragment of the C1 domain from at least residue number 2021 to at most residue number 2172, provided that the C1 N The sequence of the fragment is in the C1 c No repetition in the segment; C2 Nis a fragment of the C2 domain from at least residue number 2173 to at most residue number 2331, C2 c is a fragment of the C2 domain from at least residue number 2174 to at most residue number 2332, provided that the C2 N The sequence of the fragment is in the C2 c is not repeated in the fragment; S is a spacer sequence having between 1 and about 50 amino acid residues, which may optionally include a cleavage sequence or amino acids compatible with a restriction site; a is 0 or 1; b is 0 or 1; c is 0 or 1; d is 0 or 1; e is 0 or 1; f is 0 or 1; g is 0 or 1; h is 0 or 1; i is 0 or 1; j is 0 or 1; k is 0 or 1; 1 is 0 or 1; m is 0 or 1; t is 0 or 1; u is 0 or 1; v is 0 or 1; w is 0 or 1, x is 0 or 1; y is 0 or 1; z is 0 or 1, provided that t+u+v+w+x+y+z≥1; and the XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80% sequence identity, or about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98% or about 99% to about 100% sequence identity compared to one or more XTEN of similar length selected from Table 4. In one embodiment of Formula IX, the spacer sequence is GPEGPS (SEQ ID NO: 1612). In another embodiment of Formula V, the spacer sequence is glycine or a sequence selected from Tables 11 and 12. In another embodiment of Formula IX, Z is 1. In another embodiment of the fusion protein of Formula IX, V is 1 and with respect to Figure 3In another embodiment of the fusion protein of Formula IX, the XTEN is linked to the C-terminus at about amino acid residue number 741 to about 750 and the N-terminus at about amino acid residue number 1635 to about 1648. In another embodiment of the fusion protein of Formula IX, the sum of t, u, v, w, x, y and z is equal to 2, 3, 4, 5 or 6. In another embodiment of Formula IX, the sum of t, u, v, w, x, y and z is equal to 2, and v is 1 and z is 1. In another embodiment of the fusion protein of Formula IX, the sum of t, u, v, w, x, y and z is equal to 3, v and z are each equal to 1, and any one of t, u, w, x or y is 1. In another embodiment of the fusion protein of Formula IX, the sum of t, u, v, w, x, y and z is equal to 4, v and w and z are each equal to 1, and both of t, u, x or y are 1. In another embodiment of the fusion protein of Formula IX, the cumulative length of the XTEN is between about 84 to about 3000 amino acid residues. In another embodiment of Formula IX, at least one XTEN is inserted immediately downstream of the amino acid corresponding to the amino acid in mature native human Factor VIII selected from the group consisting of amino acid residue numbers 32, 220, 224, 336, 339, 399, 416, 603, 1656, 1711, 1725, 1905, and 1910. In another embodiment of the fusion protein of Formula IX, each XTEN is linked to the fusion protein at a site selected from Table 5, Table 6, Table 7, Table 8, and Table 9. In another embodiment of the fusion protein of Formula IX, each XTEN has at least about 80%, or about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or about 100% sequence identity compared to an XTEN of similar length selected from the group consisting of the sequences in Table 4, Table 13, Table 14, Table 15, Table 16, and Table 17 when optimally aligned.

[0044] In another embodiment of the CFXTEN composition, the invention provides a first recombinant Factor VIII polypeptide of Formula X:

[0045] (A1)-a1-(A2)-a2-[B] X

[0046] and a second polypeptide comprising Formula XI:

[0047] a3-(A3)-(C1)-(C2) XI

[0048] wherein the first polypeptide and the second polypeptide are fused or exist as heterodimers; wherein A1 is the A1 domain of factor VIII; A2 is the A2 domain of factor VIII; [B] is the B domain of factor VIII, a fragment thereof or is deleted; A3 is the A3 domain of factor VIII; C1 is the C1 domain of factor VIII; C2 is the C2 domain of factor VIII; a1, a2 and a3 are acidic spacer regions; wherein the A1 domain comprises the XTEN permissive loop-1 (A1-1) region and the X wherein the A2 domain comprises an XTEN permissive loop-1 (A2-1) region and an XTEN permissive loop-2 (A2-2) region; wherein the A3 domain comprises an XTEN permissive loop-1 (A3-1) region and an XTEN permissive loop-2 (A3-2) region; wherein the XTEN sequence is inserted into at least one of regions A1-1, A1-2, A2-1, A2-2, A3-1, or A3-2; ​​and wherein the recombinant Factor VIII protein exhibits procoagulant activity. In one embodiment of the heterodimer, the first polypeptide and the second polypeptide form a single polypeptide chain comprising the formula (A1)-a1-(A2)-a2-[B]-[a3]-(A3)-(C1)-(C2). In one of the foregoing embodiments, "fusion" refers to a peptide bond.

[0049] In another embodiment of the CFXTEN composition, the invention provides a first recombinant Factor VIII polypeptide of Formula X:

[0050] (A1)-a1-(A2)-a2-[B] X

[0051] and a second polypeptide comprising Formula XI:

[0052] 33-(A3)-(C1)-(C2) XI

[0053] wherein the first polypeptide and the second polypeptide are fused or exist as a heterodimer; wherein A1 is the A1 domain of factor VIII; A2 is the A2 domain of factor VIII; [B] is the B domain of factor VIII, a fragment thereof or is deleted; A3 is the A3 domain of factor VIII; C1 is the C1 domain of factor VIII; C2 is the C2 domain of factor VIII; a1, a2 and a3 are acidic spacer regions; wherein the XTEN sequence is inserted into a3; and wherein the recombinant factor VIII protein exhibits procoagulant activity. In one embodiment of the heterodimer, the first polypeptide and the second polypeptide form a single polypeptide chain comprising the formula (A1)-a1-(A2)-a2-[B]-[a3]-(A3)-(C1)-(C2). In one of the foregoing embodiments, "fusion" refers to a peptide bond.

[0054] In embodiments of the foregoing polypeptides of Formulas X and XI, the XTEN permissive loop is contained within a surface-exposed flexible loop structure, and wherein according to the secondary structure of mature factor VIII deposited as Accession No. 2R7E in the DSSP database, A1-1 is located between beta strand 1 and beta strand 2, A1-2 is located between beta strand 11 and beta strand 12, A2-1 is located between beta strand 22 and beta strand 23, A2-2 is located between beta strand 32 and beta strand 33, A3-1 is located between beta strand 38 and beta strand 39, and A3-2 is located between beta strand 45 and beta strand 46. In other embodiments of the foregoing polypeptides of Formulas X and XI, the surface-exposed flexible loop structure comprising A1-1 corresponds to a region from about amino acid 15 to about amino acid 45 in native mature human factor VIII. In other embodiments of the foregoing polypeptides of Formulas X and XI, A1-1 corresponds to a region from about amino acid 18 to about amino acid 41 in native mature human factor VIII. In other embodiments of the foregoing polypeptides of Formula X and XI, the surface-exposed flexible loop structure comprising A1-2 corresponds to a region from about amino acid 201 to about amino acid 232 in native mature human Factor VIII. In other embodiments of the foregoing polypeptides of Formula X and XI, A1-2 corresponds to a region from about amino acid 218 to about amino acid 229 in native mature human Factor VIII. In other embodiments of the foregoing polypeptides of Formula X and XI, the surface-exposed flexible loop structure comprising A2-1 corresponds to a region from about amino acid 395 to about amino acid 421 in native mature human Factor VIII. In other embodiments of the foregoing polypeptides of Formula X and XI, A2-1 corresponds to a region from about amino acid 397 to about amino acid 418 in native mature human Factor VIII. In other embodiments of the foregoing polypeptides of Formula X and XI, the surface-exposed flexible loop structure comprising A2-2 corresponds to a region from about amino acid 577 to about amino acid 635 in native mature human Factor VIII. In other embodiments of the foregoing polypeptides of Formula X and XI, A2-2 corresponds to a region from about amino acid 595 to about amino acid 607 in native mature human Factor VIII. In other embodiments of the foregoing polypeptides of Formulas X and XI, the surface-exposed flexible loop structure comprising A3-1 corresponds to a region of native mature human Factor VIII from about amino acid 1705 to about amino acid 1732. In other embodiments of the foregoing polypeptides of Formulas X and XI, A3-1 corresponds to a region of native mature human Factor VIII from about amino acid 1711 to about amino acid 1725. In other embodiments of the foregoing polypeptides of Formulas X and XI, the surface-exposed flexible loop structure comprising A3-2 corresponds to a region of native mature human Factor VIII from about amino acid 1884 to about amino acid 1917. In other embodiments of the foregoing polypeptides of Formulas X and XI, A3-2 corresponds to a region of native mature human Factor VIII from about amino acid 1899 to about amino acid 1911.In other embodiments of the aforementioned formula X and XI polypeptides, the XTEN sequence is inserted into at least two of regions A1-1, A1-2, A2-1, A2-2, A3-1 or A3-2. In other embodiments of the aforementioned formula X and XI polypeptides, the XTEN sequence is inserted immediately downstream of the amino acid corresponding to the amino acid selected from the group consisting of amino acids in mature natural human factor VIII: amino acid residue numbers 32, 220, 224, 336, 339, 399, 416, 603, 1656, 1711, 1725, 1905 and 1910. In other embodiments of the aforementioned formula X and XI polypeptides, another XTEN sequence is inserted in the a3 acidic spacer region. In other embodiments of the aforementioned formula X and XI polypeptides, another XTEN sequence is inserted in the a3 acidic spacer immediately downstream of the amino acid corresponding to amino acid 1656. In other embodiments of the foregoing polypeptides of Formulas X and XI, the A1 domain comprises an XTEN permissive loop-1 (A1-1) region and an XTEN permissive loop-2 (A1-2) region, wherein the A2 domain comprises an XTEN permissive loop-1 (A2-1) region and an XTEN permissive loop-2 (A2-2) region, and wherein the A3 domain comprises an XTEN permissive loop-1 (A3-1) region and an XTEN permissive loop-2 (A3-2) region, and wherein another XTEN sequence is inserted into at least one of regions A1-1, A1-2, A2-1, A2-2, A3-1, or A3-2. In other embodiments of the foregoing polypeptides of Formulas X and XI, another XTEN sequence is inserted immediately downstream of the amino acid corresponding to the amino acid in mature native human Factor VIII selected from the group consisting of amino acid residue numbers 32, 220, 224, 336, 339, 390, 399, 416, 603, 1656, 1711, 1725, 1905, and 1910. In the foregoing embodiments of the polypeptides of Formulas X and XI, the fusion protein exhibits at least about 30%, 40%, 50%, 60%, 70%, or 80% or 90% of the procoagulant activity of the corresponding Factor VIII not linked to the XTEN, wherein the procoagulant activity is determined by an in vitro coagulation assay.

[0055] In all embodiments, the polypeptide may, for example, exhibit in vitro procoagulant activity greater than 0.5 IU / ml or 1.0 or 1.5 or 2.0 IU / ml when expressed in cell culture medium and assayed by an in vitro coagulation assay. Procoagulant activity may be measured by a chromogenic assay, a single-stage clotting assay (e.g., aPTT), or both.

[0056] In some embodiments, wherein the recombinant Factor VIII fusion protein comprises Factor VIII and at least a first and a second XTEN, the at least first XTEN is separated from the at least second XTEN by at least 10 amino acids, at least 50 amino acids, at least 100 amino acids, at least 200 amino acids, at least 300 amino acids, or at least 400 amino acids.

[0057] In preferred embodiments, the recombinant factor VIII fusion protein comprises factor VIII and at least a first XTEN and optionally at least a second, or optionally at least a third, or optionally at least a fourth XTEN, the fusion protein exhibiting reduced binding to an anti-factor VIII antibody compared to the corresponding factor VIII not linked to the XTEN. The reduced binding can be assessed in vivo or by an in vitro assay. In one embodiment, the in vitro assay is an ELISA assay, wherein the binding of the anti-FVIII antibody to the fusion protein is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, or at least about 40% or more compared to FVIII not linked to the XTEN. In another embodiment, the in vitro assay is a Bethesda assay, wherein the reduced binding of the fusion protein is demonstrated by a reduction in the Bethesda titer of the fusion protein by at least about 2, 4, 6, 8, 10, 12, 15, 20, 30, 40, 50, 60, 70, 80, 100, or 200 Bethesda units compared to the Bethesda titer of Factor VIII not linked to the XTEN. In the in vitro assay, the anti-Factor VIII antibody is selected from the antibodies of Table 10 and a polyclonal antibody from a hemophilia A patient with a Factor VIII inhibitor. In a specific embodiment of a recombinant Factor VIII fusion protein comprising Factor VIII and at least a first and a second XTEN that exhibits reduced binding to a Factor VIII inhibitor antibody, the first XTEN is linked to the Factor VIII polypeptide within the C2 domain of the Factor VIII polypeptide, and the second XTEN is linked to the Factor VIII polypeptide within the A1 or A2 domain of the Factor VIII polypeptide, wherein the fusion protein exhibits reduced binding to the Factor VIII inhibitor antibody compared to the corresponding Factor VIII not linked to the XTEN, wherein the Factor VIII inhibitor antibody is capable of binding to an epitope located within the A1, A2 or C2 domain, and further, wherein the fusion protein exhibits procoagulant activity. In one embodiment of the foregoing fusion protein, the second XTEN is linked to the Factor VIII polypeptide within the A2 domain of the Factor VIII polypeptide and the Factor VIII inhibitor antibody binds to the A2 domain of the Factor VIII polypeptide. In another embodiment of the foregoing fusion protein, the second XTEN is linked to the Factor VIII polypeptide within the C2 domain of the Factor VIII polypeptide and the Factor VIII inhibitor antibody binds to the C2 domain of the Factor VIII polypeptide. Binding of the anti-Factor VIII antibody to the fusion protein is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, or 40% compared to the corresponding Factor VIII not linked to the XTEN when measured by an ELISA assay, wherein the anti-Factor VIII antibody is selected from the group consisting of the antibodies in Table 10 and a polyclonal antibody from a hemophilia A subject with a Factor VIII inhibitor.The foregoing fusion proteins can further comprise at least three XTEN, wherein at least the third XTEN is linked to Factor VIII at a site selected from the group consisting of: within the B domain or replacing the B domain, at the C-terminus, and at or within 1, 2, 3, 4, 5, or 6 amino acids of an insertion site selected from Table 7 or Table 9. In embodiments in which binding to an anti-Factor VIII antibody is reduced, the fusion protein has at least 10%, 20%, 30%, 40%, 50%, 80%, 100%, 200%, 300%, 400%, or 500% greater procoagulant activity in the presence of an anti-FVIII antibody as measured by an in vitro coagulation assay (e.g., a chromogenic or single-stage clotting assay) compared to the corresponding Factor VIII not linked to the XTEN.

[0058] In all embodiments, the XTEN of the fusion protein can be characterized, for example, in that the XTEN comprises at least 36, or at least 42, or at least 72, or at least 96, or at least 144, or at least 288, or at least 400, or at least 500, or at least 576, or at least 600, or at least 700, or at least 800, or at least 864, or at least 900, or at least 1000, or at least 2000 to about 3000 amino acid residues or even more residues; glycine (G), alanine (A), serine (S), threonine (TH), threonine (P), threonine (D), threonine (TH ... The sum of amino acid (T), glutamate (E), and proline (P) residues constitutes at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% of the total amino acid residues of the XTEN; the XTEN is substantially non-repetitive such that (i) the XTEN does not contain three identical consecutive amino acids unless the amino acid is serine; (ii) at least about 80% of the XTEN sequence consists of non-overlapping sequence motifs, each of which comprises about 9 to about 14, or about 1 2 amino acid residues consisting of four to six amino acids selected from glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), and proline (P), wherein in each non-overlapping sequence motif, no two consecutive amino acid residues occur more than twice; or (iii) the subsequence score of the XTEN sequence is less than 10; the XTEN has a random coil formation rate greater than 90%, or greater than 95%, or greater than 99% (as determined by the GOR algorithm); the XTEN has less than 2% alpha helices and 2% beta helices. when analyzed by the TEPITOPE algorithm, the XTEN lacks a predicted T-cell epitope, wherein the threshold for the TEPITOPE threshold score for the prediction by the algorithm is -9, and wherein the fusion protein exhibits a terminal half-life longer than at least about 12 hours, or at least about 24 hours, or at least about 48 hours, or at least about 72 hours, or at least about 96 hours, or at least about 120 hours, or at least about 144 hours, or at least about 21 days or longer. In one embodiment, the recombinant factor VIII fusion protein comprises at least a second, or at least a third, or at least a fourth XTEN, which may be the same or different from another XTEN. According to a different approach, when optimally aligned, at least one, at least the second, or at least the third, or at least the fourth XTEN of the CFXTEN fusion protein each has at least about 80% sequence identity, or about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% to about 100% sequence identity compared to one or more XTEN with similar length selected from Table 4, Table 13, Table 14, Table 15, Table 16, and Table 17.In another different approach, at least one, at least the second, or at least the third, or at least the fourth XTEN of the CFXTEN fusion protein each has at least 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% to about 100% sequence identity compared to a sequence selected from: AE42_1, AE42_2, AE42_3, AG42_1, AG42_2, AG42_3, AG42_4 , AE144_1A, AE144_2A, AE144_2B, AE144_3A, AE144_3B, AE144_4A, AE144_4B, AE144_5A, AE144_6B, AG144_1 , AG144_2, AG144_A, AG144_B, AG144_C, AG144_F, AG144_3, AG144_4, AE288_1, AE288_2, AG288_1 and AG288_2.

[0059] In one embodiment, the factor VIII component of the CFXTEN recombinant factor VIII fusion protein comprises one, two or three amino acid replacements selected from residue R1648, Y1680 and R1689 numbered relative to mature human factor VIII, wherein the replacement is selected from alanine, glycine and phenylalanine. The non-limiting examples of the replacement include R1648A, Y1680F and R1689A.

[0060] In another embodiment, the CFXTEN fusion protein exhibits an apparent molecular weight factor of at least about 1.3, or at least about 2, or at least about 3, or at least about 4, or at least about 5, or at least about 6, or at least about 7, or at least about 8, or at least about 9, or at least about 10 when measured by size exclusion chromatography or a similar method.

[0061] In some embodiments of CFXTEN fusion rotein, one or more XTEN will be connected to FVIII by one or two cleavage sequences of the mammalian protease cracking of the group consisting of being selected from free factor XIa, factor XIIa, kallikrein (kallikrein), factor VIIa, factor IXa, factor Xa, factor IIa (thrombin), elastase-2 (Elastase-2), MMP-12, MMP13, MMP-17 and MMP-20 respectively, wherein the cleavage carried out at the cleavage sequence place by the mammalian protease makes the factor VIII sequence release from the XTEN sequence, and the factor VIII sequence wherein released shows an increase in procoagulant activity compared to uncleaved fusion rotein. In one embodiment, the cleavage sequence can be cracked by factor XIa.

[0062] According to a different approach, the CFXTEN fusion protein comprises at least three XTEN located at different positions of a Factor VIII polypeptide, wherein the different positions are selected from: an insertion position 1 to 6 amino acids from a site selected from Table 5, Table 6, Table 7, Table 8, and Table 9; a position 1 to 6 amino acids from or within amino acids 32, 220, 224, 336, 339, 390, 399, 416, 603, 1656, 1711, 1725, 1905, and 1910 of mature Factor VIII; a position between any two adjacent domains in the Factor VIII sequence, wherein the two adjacent domains are selected from the group consisting of A1 and A2, A2 and B, B and A3, A3 and C1, and C1 and C2; Figure 3 the full-length human Factor VIII sequence set forth in , at a position within the internal B domain deletion starting at a first position at about amino acid residue numbering 741 to about 750 and ending at a second position at amino acid residue numbering 1635 to about 1648; and the C-terminus of the Factor VIII sequence, wherein the cumulative length of the multiple XTEN is at least about 100 to about 3000 amino acid residues and wherein the fusion protein retains at least about 30%, or about 40%, or about 50%, or about 60%, or about 70%, or about 80%, or about 90% of the procoagulant activity compared to the corresponding Factor VIII not linked to the XTEN, wherein the procoagulant activity is determined by an in vitro coagulation assay. In one of the foregoing embodiments, when administered to a subject, the fusion protein exhibits an increased terminal half-life compared to a corresponding Factor VIII polypeptide lacking the XTEN, wherein when administered to a subject, the fusion protein exhibits a terminal half-life of at least about 3 hours, or 4 hours, or 6 hours, or 12 hours, or 13 hours, or 14 hours, or 16 hours, or 24 hours, or 48 hours, or 72 hours, or 96 hours, or 120 hours, or 144 hours, or 7 days, or 14 days, or 21 days. In one embodiment, the subject is selected from the group consisting of humans and Factor VIII / von Willebrand Factor double knockout mice. In one of the foregoing embodiments, the fusion protein does not comprise a polypeptide selected from GTPGSGTASSSP (SEQ ID NO: 31), GSSTPSGATGSP (SEQ ID NO: 32), GSSPSASTGTGP (SEQ ID NO: 33), GASPGTSSTGSP (SEQ ID NO: 34), and

[0063] The sequence of GSEPATSGSETPGTSESATPESGPGSEPATSGSETPGSPAGSPTSTEEGTSTEPSEGSAPGSEPATSGSETPGSEPATSGSETPGSEPATSGSETPGTSTEPSEGSAPGTSESATPESGPGSEPATSGSETPGTSTEPSEGSAP (SEQ ID NO: 59). In another foregoing embodiment, the fusion protein does not contain the XTEN sequence composed of

[0064] GSEPATSGSETPGTSESATPESGPGSEPATSGSETPGSPAGSPTSTEEGTSTEPSEGSAPGSEPATSGSETPGSEPATSGSETPGSEPATSGSETPGTSTEPSEGSAPGTSESATPESGPGSEPATSGSETPGTSTEPSEGSAP (SEQ ID NO: 59),

[0065] PGSSPSASTGTGPGSSPSASTGTGPGTPGSGTASSSPGSSTPSGATGSPGSSPSASTGTGPGASPGTSSTGSPGTPGSGTASSSPGSSTPSGATGSPGTPGSGTASSSPGASPGTSSTGSPGASPGTSSTGSPGTPGSGTASSS (SEQ ID NO: 71) or

[0066] PGASPGTSSTGSPGASPGTSSTGSPGTPGSGTASSSPGSSTPSGATGSPGTPGSGTASSSPGSSTPSGATGSPGTPGSGTASSSPGSSTPSGATGSPGSSTPSGArGSPGSSPSASTGTGPGSSPSASTGTGPGASPGTSSTGSPGTPGSGTASSSPGSSTPSGATGSPGSSPSASTGTGPGSSPSASTGTGPGASPGTSSTGSPGASPGTSSTGSPGSSTPSGATGSPGSSPSASTGTGPGASPGTSSTGSPGSSPSASTGTGPGTPGSGTASSSPGSSTPSGATGS (SEQ ID NO: 80).

[0067] On the other hand, the present invention relates to the pharmacokinetic properties with enhancement compared to the FVIII that is not connected to XTEN, comprise the CFXTEN fusion rotein of the parameter of raising, wherein said enhanced property includes but not limited to compared to the FVIII that is not connected to XTEN, terminal half-life lengthens, area under the curve becomes larger, blood concentration remains on the time increase in the treatment window, causes blood concentration to increase between the continuous dose in the treatment window and the dosage that can be used in IU to reduce over time, but still causes blood concentration to be higher than the threshold concentration required for the procoagulant effect.In some embodiments, when using to the experimenter, the CFXTEN fusion rotein shows the terminal half-life extension compared to the corresponding factor VIII polypeptide lacking the described XTEN.The experimenter can be people or mouse, as factor VIII / von Willebrand factor double knockout mouse.In a foregoing embodiment, when using to the experimenter, compared to the corresponding factor VIII that is not connected to XTEN, CFXTEN shows the terminal half-life length at least about 2 times or about 3 times or about 4 times or about 5 times or about 10 times or about 20 times. In one embodiment, when administered to a subject, the CFXTEN fusion protein exhibits a terminal half-life of at least about 3 hours, or 4 hours, or 6 hours, or 12 hours, or 13 hours, or 14 hours, or 16 hours, or 24 hours, or 48 hours, or 72 hours, or 96 hours, or 120 hours, or 144 hours, or 7 days, or 14 days, or 21 days. In other embodiments, the enhanced pharmacokinetic properties of the fusion protein of the embodiment are properties that the circulating blood concentration of the procoagulant fusion protein in the subject in need is maintained higher than the threshold concentration of 0.01IU / ml, or 0.05IU / ml, or 0.1IU / ml, or 0.2IU / ml, or 0.3IU / ml, or 0.4IU / ml or 0.5IU / ml for a period of at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 6 times, or at least about 8 times, or at least about 10 times, or at least about 20 times, or at least about 40 times, or at least about 60 times, compared to the corresponding FVIII not being connected to XTEN and being used to the subject at a similar dosage. The increase in the half-life and the time spent above the threshold concentration allows the amount of the fusion protein (in molar equivalent) used to the subject to be reduced compared to the corresponding FVIII not being connected to XTEN. In one embodiment, administration of a subject fusion protein to a subject using a therapeutically effective dose regimen results in an increase in the time between at least two consecutive Cmax peaks and / or Cmin troughs of blood levels of the fusion protein by at least 2-fold, or at least 3-fold, or at least 4-fold, or at least 5-fold, or at least 6-fold, or at least 8-fold, or at least 10-fold, or at least about 20-fold, or at least about 40-fold, or at least about 60-fold or more, compared to a corresponding FVIII not linked to the XTEN and administered to the subject using a similar dose regimen.

[0068] In preferred embodiments, the CFXTEN fusion protein retains at least about 30%, or about 40%, or about 50%, or about 60%, or about 70%, or about 80%, or about 90% of the procoagulant activity compared to the corresponding Factor VIII not linked to the XTEN, wherein the procoagulant activity is determined by an in vitro coagulation assay, such as, but not limited to, a chromogenic assay or a single or two-stage clotting assay.

[0069] According to a different approach, the invention provides a recombinant Factor VIII fusion protein comprising a Factor VIII polypeptide and at least one extended recombinant polypeptide (XTEN), wherein the Factor VIII polypeptide comprises all or a portion of an A1 domain, an A2 domain, an A3 domain, a C1 domain, a C2 domain, and optionally a B domain, and wherein the at least one XTEN is linked to the Factor VIII polypeptide at an insertion site selected from residue numberings 18-32, or 40, or 211-224, or 336-403, or 599, or 745-1640, or 1656-1728, or 1796-1804, or 1900-1912, or 2171-2332; and wherein the fusion protein retains at least about 30%, or about 40%, or about 50%, or about 60%, or about 70%, or about 80%, or about 90% of the procoagulant activity compared to the corresponding Factor VIII not linked to the XTEN. In one of the foregoing embodiments, the fusion protein comprises at least a second XTEN, or at least a third, or at least a fourth XTEN, wherein the XTEN is linked to Factor VIII at a site at or within 1 to 6 amino acids of a site selected from Table 5, Table 6, Table 7, Table 8, and Table 9. In another embodiment, the invention provides a recombinant Factor VIII fusion protein further comprising at an insertion site selected from Table 5, Table 6, Table 7, Table 8, Table 9, at a site from Figure 8 at or within 6 amino acids on the N-terminal or C-terminal side of the insertion position at one or more insertion positions of Fig. 9 The at least one XTEN is linked to the FVIII polypeptide within the insertion range of at least one XTEN, or at least a third, or at least a fourth XTEN, wherein at least two XTEN are separated by an amino acid sequence of at least 100 to about 400 amino acids.

[0070] The present invention provides CFXTEN, wherein the XTEN radius ratio of XTEN is at least 2.3 or at least 2.5, and is separated by the amino acid sequence with at least about 20 amino acid residues or at least about 50 or at least about 100 or at least about 200 or at least about 300 or at least about 400 amino acid residues.In other embodiments, CFXTEN comprises at least four XTEN, the XTEN radius ratio of wherein said XTEN is at least 2.3 or at least 2.5 or at least 2.8, and wherein at least three that are connected to fusion rotein in four XTEN are separated by the amino acid sequence with at least about 20 amino acid residues or at least about 50 or at least about 100 or at least about 200 or at least about 300 or at least about 400 amino acid residues, and the 4th XTEN is connected in the B domain (or its fragment) or in the C domain (or its end).

[0071] In some embodiments, the subject composition is constructed to have a reduced binding affinity to the clearing receptor in the subject compared to the corresponding FVIII not connected to XTEN. In one embodiment, the CFXTEN fusion protein shows the binding affinity of the clearing receptor of FVIII in the range of about 0.01%-30% or about 0.1% to about 20% or about 1% to about 15% or about 2% to about 10% of the binding affinity of the corresponding FVIII not connected to XTEN. In another embodiment, compared to the corresponding FVIII not connected to XTEN, the active clearance of the fusion protein with reduced affinity for clearing receptors is reduced and the corresponding increase in half-life is at least about 2 times, or 3 times, or at least 4 times, or at least about 5 times, or at least about 6 times, or at least about 7 times, or at least about 8 times, or at least about 9 times, or at least about 10 times, or at least about 12 times, or at least about 15 times, or at least about 17 times, or at least about 20 times.

[0072] In one embodiment, the invention provides a recombinant Factor VIII fusion protein comprising FVIII and one or more XTEN, wherein the fusion protein exhibits at least a 3-fold, or at least about 4-fold, or at least about 5-fold, or at least about 6-fold, or at least about 7-fold, or at least about 8-fold, or at least about 9-fold, or at least about 10-fold, or at least about 15-fold, or at least 20-fold, or at least 40-fold, or at least 60-fold increase in solubility under physiological conditions compared to FVIII not linked to the XTEN.

[0073] In another aspect, the present invention provides a pharmaceutical composition comprising the fusion protein of any embodiment described herein and a pharmaceutically acceptable carrier.

[0074] In another embodiment, the present invention provides a method for treating a coagulopathy in a subject, comprising administering to the subject a composition comprising a coagulation effective amount of a pharmaceutical composition. In one embodiment of the method, after the administration, the blood concentration of procoagulant factor VIII is maintained at about 0.05, or 1, or 1.5 IU / ml or higher for at least 48 hours after the administration. In another embodiment, the present invention provides a method for clotting the blood of a subject, comprising contacting a coagulation effective amount of a pharmaceutical composition with the blood.

[0075] In another embodiment, the invention provides a method for treating a coagulopathy of an experimenter with a circulating inhibitor of factor VIII, comprising administering to the experimenter a composition of a pharmaceutical composition comprising a therapeutically effective amount of CFXTEN, wherein the composition exhibits greater procoagulant activity in the experimenter than a composition comprising a corresponding factor VIII not connected to XTEN and administered using a similar amount. In one embodiment of the method, the coagulopathy is hemophilia A. In another embodiment, the coagulopathy is the result of trauma or surgery or infection.

[0076] The present invention provides a method for treating a bleeding episode in a subject, comprising administering to the subject a composition comprising a clotting effective amount of a CFXTEN pharmaceutical composition, wherein the fusion protein of the clotting effective amount is at least 3 times, or at least 4 times, or at least 5 times longer than a corresponding factor VIII not connected to XTEN and administered to the subject using a similar amount to stop a bleeding episode. Non-limiting examples of corresponding factor VIII not connected to XTEN include natural FVIII, the sequence of Table 1, BDD-FVIII, and pCB0114 FVIII.

[0077] In another embodiment, the invention provides a CFXTEN recombinant factor VIII fusion protein for the treatment of a hemophilia A patient's medical regimen, the regimen comprising a pharmaceutical composition comprising the CFXTEN fusion protein. In one embodiment of the medical regimen, the regimen further comprises a step of determining the amount of the pharmaceutical composition comprising the CFXTEN required for achieving hemostasis in the hemophilia A patient. In another embodiment, the medical regimen for the treatment of a hemophilia A subject comprises administering a pharmaceutical composition to the subject with two or more doses in a continuous effective amount, wherein compared to the factor VIII not being connected to XTEN and administered with similar dosages, the administration results in at least one, two or three parameters associated with hemophilia A being improved by at least 10%, or 20%, or 30%, or 40%, or 50%, or 60%, or 70%, or 80%, or 90%. Non-limiting examples of improved parameters include blood concentration of procoagulant FVIII, decreased activated partial prothrombin (aPTT) assay time, decreased single or two-stage clotting assay time, delayed onset of bleeding episodes, decreased chromogenic assay time, decreased bleeding assay time, resolution of bleeding episodes, or decreased Bethesda titer relative to native FVIII.

[0078] On the other hand, the invention provides the nucleic acid sequence of separation of the fusion protein of any embodiment of coding CFXTEN fusion protein.In one embodiment, the nucleic acid of separation is the complementary sequence of the sequence of the CFXTEN fusion protein of coding embodiment.In one embodiment, the nucleic acid of separation further comprises the sequence of encoding signal peptide, wherein said sequence is

[0079] ATGCAAATAGAGCTCTCCACCTGCTTCTTTCTGTGCCTTTTGCGATTCTGCTTTAGT (SEQ ID NO: 1613) or its complementary sequence. In another embodiment, the present invention provides an expression vector comprising a nucleic acid encoding a fusion protein or its complementary sequence. In another embodiment, the present invention provides an isolated host cell comprising the aforementioned expression vector. In another embodiment, the present invention provides a method for producing the fusion protein of any embodiment, comprising providing a host cell comprising an expression vector; culturing the host cell to achieve production of the fusion protein; and recovering the fusion protein.

[0080] In one embodiment, the present invention provides an isolated fusion protein comprising a polypeptide having at least about 80% sequence identity, or about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98% or about 99% to about 100% sequence identity compared to a sequence of similar length selected from Table 21 when optimally aligned.

[0081] In another embodiment, the present invention provides an isolated nucleic acid comprising a polynucleotide sequence selected from the group consisting of: (a) a sequence having at least about 80% sequence identity, or about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98% or about 99% to about 100% sequence identity when optimally aligned compared to a sequence of similar length selected from Table 21, or (b) the complement of the polynucleotide of (a). In another embodiment, the isolated nucleic acid comprises the sequence ATGCAAATAGAGCTCTCCACCTGCTTCTTTCTGTGCCTTTTGCGATTCTGCTTTAGT (SEQ ID NO: 1613) linked to the 5' end of the nucleic acid of (a) or the complement of said sequence linked to the 3' end of (b).

[0082] It is expressly contemplated that the recombinant Factor VIII fusion proteins may exhibit one or more or any combination of the properties disclosed herein.

[0083] Incorporated by Reference

[0084] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF THE DRAWINGS

[0085] The features and advantages of the present invention may be further described by reference to the following detailed description and accompanying drawings which illustrate illustrative embodiments.

[0086] Figure 1 A diagram showing the spatial arrangement of the domains and the FVIII architecture during processing and coagulation is shown and is intended to represent both native FVIII and variants with B domain deletions. The A1 domain ranges from residues 1 to 372 (numbering is relative to the mature form of the FVIII sequence NCBI protein RefSeq NP_000123 and encompasses the a1 residues), the A2 domain ranges from residues 373 to 740, the B domain ranges from residues 741 to 1648, the A3 domain ranges from residues 1649 to 2019 (encompassing the a3 acidic region), the C1 domain ranges from 2020 to 2172, and the C2 domain ranges from residues 2173 to 2332. BDD variants include deletions between the range 741 to 1648, leaving some or no remaining residues, wherein a non-limiting BDD remaining sequence is SFSQNPPVLKRHQR (SEQ ID NO: 1614). Figure 1A shows the domain organization of single-chain FVIII before processing. Arrows indicate the sites at residues R372, R740, R1648 and R1689 that are cleaved during processing and conversion of FVIII to FVIIIa. Figure 1 B shows a FVIII molecule that has been processed into a heterodimer by cleavage at residue R1648, wherein the a3 acidic region of the A3 domain is indicated on the N-terminus of A3. Figure 1 C shows the FVIII molecule processed into the FVIIIa heterotrimer by cleavage at residues R372, R740 and R1689.

[0087] Figure 2 is a schematic diagram of the coagulation cascade showing the intrinsic and extrinsic arms leading to a common pathway.

[0088] Figure 3 The amino acid sequence of mature human Factor VIII is depicted (SEQ ID NO: 1592).

[0089] Figure 4 Depicted is a Factor VIII sequence lacking a portion of the B domain (SEQ ID NO: 1593).

[0090] Figure 5 Several examples of CFXTEN configurations illustrating FVIII linked to XTEN (XTEN shown as a thick wavy line). In all cases, the FVIII can be a native or BDD form of FVIII, or a single chain form with the entire B domain (including the native cleavage site) removed. Figure 5 A shows three variations of single-chain Factor VIII from left to right, namely, XTEN linked to the N-terminus, the C-terminus, and two XTEN linked to the N-terminus and the C-terminus. Figure 5 B shows six variations of mature heterodimeric FVIII from left to right, i.e., XTEN linked to the N-terminus of the A1 domain; XTEN linked to the C-terminus of the C2 domain; XTEN linked to the N-terminus of the A1 domain and the C-terminus of the C2 domain; XTEN linked to the N-terminus of the A1 domain and the N-terminus of the A3 domain; XTEN linked to the C-terminus of the C2 domain and to the N-terminus of the A3 domain through residual B domain amino acids; and XTEN linked to the N-terminus of the A1 domain, to the C-terminus of the A2 domain through residual B domain amino acids, and to the C-terminus of the C2 domain. Figure 5C shows, from left to right, three variations of single-chain Factor VIII: XTEN linked to the N-terminus of the A1 domain, XTEN linked within a surface loop of the A1 domain, and XTEN linked within a surface loop of the A3 domain; XTEN linked within a surface loop of the A2 domain, XTEN linked within a surface loop of the C2 domain, and XTEN linked to the C-terminus of the C2 domain; XTEN linked to the N-terminus of the A1 domain and within a surface loop of the C1 domain and linked to the C-terminus of the C domain. Figure 5 D shows six variations of mature heterodimeric FVIII from left to right, i.e., XTEN linked to the N-terminus of the A1 domain, XTEN linked within a surface loop of the A1 domain, and XTEN linked within a surface loop of the A3 domain; XTEN linked within a surface loop of the A2 domain, and XTEN linked within a surface loop of the C1 domain, and XTEN linked to the C-terminus of the C2 domain; XTEN linked to the N-terminus of the A1 domain, XTEN linked within a surface loop of the A1 domain, XTEN linked within a surface loop of the A3 domain, and XTEN linked to the C-terminus of the C2 domain; XTEN linked to the N-terminus of the A1 domain, XTEN linked within a surface loop of the A1 domain, XTEN linked within a surface loop of the A3 domain, and XTEN linked to the C-terminus of the C2 domain; XTEN linked to the N-terminus of the A1 domain, XTEN linked The XTEN is linked to the N-terminus of the A3 domain through the residual amino acids of the B domain and the XTEN is linked within the surface loop of the C2 domain; the XTEN is linked within the surface loop of the A2 domain, the XTEN is linked to the N-terminus of the A3 domain through the residual amino acids of the B domain, the XTEN is linked within the surface loop of the C1 domain and the XTEN is linked to the C-terminus of the C2 domain; and the XTEN is linked within the B domain or between the residual B domain residues of the BDD variant (and the invention also encompasses variations in which the XTEN replaces the entire B domain connecting the A2 and A3 domains (including all native cleavage sites), thereby generating a single-chain form of Factor VIII). This figure also includes all variations in which one or more XTEN sequences are inserted within the B domain and the resulting fusion is cleaved at one or more sites (e.g., at the R1648 site) during intracellular processing.

[0091] Figure 6 It is a graphical depiction of the CFXTEN construct with XTEN inserted in the B domain and connected to the C-terminal of the C2 domain, which illustrates the unstructured characteristics of XTEN that result in the formation of a random coil that can cover the portion of Factor VIII adjacent to the XTEN. In the figure below, the graphical depiction shows that when XTEN is a random coil, it can adopt a conformation that produces a sterically hindered combination that blocks Factor VIII inhibitor antibodies, which would otherwise have affinity for an epitope adjacent to the XTEN insertion site.

[0092] Figure 7It is a graphical depiction of various analyses performed on the FVIII B domain deletion sequence to identify the insertion site of XTEN within the FVIII sequence. Each of the AH rows is on an arbitrary scale across the Y-axis values ​​of the FVIII BDD sequence so that low values ​​represent regions with higher predicted tolerance to the XTEN insert, with the residue numbering on the X-axis. The A row shows domain boundaries; all interruptions in this row represent boundaries that may accept XTEN. The B row shows exon boundaries; that is, each step in the row represents a new exon. The C row shows regions that are not visible in the X-ray structure due to lack of order in the crystal. The marked D row represents multiple order prediction results calculated using the corresponding programs FoldIndex and RONN, which are found on the World Wide Web site bip.weizmann.ac.il / fldbin / findex (last visited on February 23, 2011) (see Jaime Prilusky, Clifford E. Felder, Tzviya Zeev-Ben-Mordehai, Edwin Rydberg, Orna Man, Jacques S. Beckmann, Israel Silman and Joel L. Sussman, 2005, Bioinformatics based on the Kyte & Doolitlle algorithm), and RONN, which are found on the World Wide Web site strubi.ox.ac.uk / RONN (last visited on February 23, 2011) (see Yang, ZR, Thomson, R., McMeil, P. and Esnouf, RM (2005) RONN: the bio-basis function neural The E and F rows are calculated based on multiple sequence alignments of FVIII genes from 11 mammals available in GenBank. Row E represents the conservation of individual residues. Row F represents the conservation of segments containing 3 amino acids of FVIII. Rows G and H represent gaps and insertions observed in multiple sequence alignments of 11 mammalian FVIII genes. Row J lists the XTEN insertion points obtained based on combining the above multiple measurements by amino acid number.

[0093] Figure 8 Describe the use Figure 8Based on the information depicted in and as confirmed in the assays of Example 34, a site was identified in the FVIII B domain deletion sequence (SEQ ID NO: 1594) as the active insertion point for XTEN.

[0094] Fig. 9 Describe the use Figure 8 The range of sites identified for insertion of XTEN in the FVIII B domain deletion sequence (SEQ ID NO: 1595) was determined using the information depicted in Example 34 plus a span of amino acids surrounding each insertion point deemed suitable for insertion of XTEN.

[0095] Fig.10 is through Figure 7 Described identification insertion point, uses molecular biology technique to insert the schematic diagram of the assembling of the CFXTEN library that single XTEN (black stick) produces at each insertion point subsequently.Express and reclaim construct, then assess FVIII activity and pharmacokinetic properties to identify those CFXTEN configurations that cause property enhancement.

[0096] Fig.11 Schematic representation of the assembly of a library of CFXTEN components, in which segments of the FVIII BDD domain, either alone or linked to XTEN of various lengths (black bars), are assembled in a combinatorial manner into a library of genes encoding CFXTEN, which can then be evaluated for FVIII activity and pharmacokinetic properties to identify those CFXTEN configurations that result in enhanced properties.

[0097] Fig.12 Several examples of CFXTEN configurations with XTEN (shown as bold wavy lines) are illustrated, some of which can be released by the insertion of a cleavage sequence (indicated by a black triangle) that can be cleaved by a procoagulant protease. Fig.12 A illustrates scFVIII with two terminally releasable XTEN. Fig.12 B Description and Fig.12 Same configuration as A, but with an additional non-releasable XTEN connecting the A3 and C1 domains. Fig.12 C illustrates mature heterodimeric FVIII with two terminal releasable XTEN. Fig.12 D illustrates the same configuration as 10C, but with an additional non-releasable XTEN linking the A3 and C1 domains.

[0098] Fig.13 is a schematic flow chart of representative steps in assembling, generating, and evaluating XTEN.

[0099] Fig.14It is the schematic flow chart of the representative steps in the CFXTEN polynucleotide construct of assembling encoding fusion protein.Individual oligonucleotide 501 anneals into sequence motif 502 (as containing 12 amino acid whose motif (" 12-mer ")), it is connected to other sequence motifs from library to produce the set of containing XTEN 504 of desired length, and is connected to the oligomer 503 that contains BbsI and KpnI restriction site of less concentration.The gained set of connecting product is carried out gel-purified and cuts the band of XTEN with desired length, thereby produces the XTEN gene with separation of blocking sequence (stopper sequence) 505.The XTEN gene is cloned in the filling carrier.In this case, carrier encoding optional CBD sequence 506 and GFP gene 508.Then digest with BbsI / HindIII to remove 507 and 508 and place stop codon. The resulting product is then cloned into a BsaI / HindIII digested vector containing a gene encoding FVIII, thereby generating gene 500 encoding a FVIII-XTEN fusion protein.

[0100] Fig.15 is a schematic flow chart of representative steps in assembling a gene encoding a fusion protein comprising CF and XTEN, expressing and recovering the gene as a fusion protein, and evaluating the fusion protein as a candidate CFXTEN product.

[0101] FIG. 16 illustrates the use of donor XTEN sequences to generate truncated XTEN. Fig.16A The sequence of AG864 is provided (SEQ ID NO: 1596), where the underlined sequence was used to generate a sequence length of 576 (SEQ ID NO: 1597). Fig. 16B The sequence of AG864 is provided (SEQ ID NO: 1598), where the underlined sequence was used to generate a sequence length of 288 (SEQ ID NO: 1599). Fig. 16C The sequence of AG864 is provided (SEQ ID NO: 1600), where the underlined sequence was used to generate a sequence length of 144 (SEQ ID NO: 1601). Fig.16D The sequence of AE864 is provided (SEQ ID NO: 1602), where the underlined sequence was used to generate a sequence length of 576 (SEQ ID NO: 1603). Fig.16E The sequence of AE864 is provided (SEQ ID NO: 1604), where the underlined sequence was used to generate a sequence length of 288 (SEQ ID NO: 1605). Fig.16FThe sequence of AE864 (SEQ ID NO: 1606) used to generate four 144 length sequences (SEQ ID NOs 1607-1610, respectively, in order of appearance) is provided (double underline indicates the first amino acid in the 144 sequence, with single underline indicating the remainder of that sequence).

[0102] Fig.17 is a schematic representation of the design of Factor VIII-XTEN expression vectors with different strategies for introducing XTEN elements into the FVIII coding sequence. Fig.17 A shows an expression vector encoding XTEN fused to the 3' end of the sequence encoding FVIII. Fig.17 B depicts an expression vector encoding an XTEN element inserted into the middle of a coding sequence encoding a single FVIII. Fig.17 C depicts an expression vector encoding two XTEN elements: one inserted inside the FVIII coding sequence and the other fused to the 3' end of the FVIII coding sequence.

[0103] Fig.18 The process of combinatorial gene assembly of the gene encoding XTEN is illustrated. In this case, the gene is assembled from 6 base fragments and each fragment can be obtained in 4 different codon forms (A, B, C and D). This allows to achieve a theoretical diversity of 4096 when assembling the motif containing 12 amino acids.

[0104] Fig.19 Pharmacokinetic profiles (plasma concentrations) of GFP different compositions connected to non-structured polypeptides of different lengths of a single dose of subcutaneous or intravenous administration in cynomolgus monkeys, as described in Example 41. Compositions are GFP-L288, GFP-L576, GFP-XTEN_AF576, GFP-Y576 and XTEN_AD836-GFP. Blood samples were analyzed at various times after injection and the concentration of the GFP in the plasma was measured by ELISA using a polyclonal antibody for GFP captured and a biotinylated preparation for detection of the same polyclonal antibody. The results are presented as plasma concentrations relative to time (hours) after administration, and particularly show that the half-life of XTEN AD836-GFP (i.e., the composition with the longest XTEN sequence length) is considerable. The construct GFP-L288 with the shortest sequence length has the shortest half-life.

[0105] Fig. 20SDS-PAGE gel showing samples from stability studies of fusion proteins of XTEN AE864 fused to the N-terminus of GFP (see Example 42). GFP-XTEN was incubated in cynomolgus monkey plasma and rat kidney lysate for up to 7 days at 37°C. In addition, GFP-XTEN administered to cynomolgus monkeys was also evaluated. Samples were taken at 0, 1, and 7 days and analyzed by SDS PAGE, then detected using Western blot analysis with antibodies to GFP.

[0106] Fig.21 The results of size exclusion chromatography analysis of glucagon-XTEN construct samples measured relative to protein standards of known molecular weight are shown, with the graph output as absorbance versus retention volume, as described in Example 40. The glucagon-XTEN constructs are 1) glucagon-Y288; 2) glucagon Y-144; 3) glucagon-Y72; and 4) glucagon-Y36. The results indicate that the apparent molecular weight increases with increasing length of the XTEN portion (see Example 40 for data).

[0107] Fig. 22 The results of western blotting of proteins expressed by cell culture of cells transformed with the specified constructs are shown (embodiment 25). The samples in lanes 1-12 are respectively: MW standards, FVIII (42.5ng), pBC0100B, pBC0114A, pBC0100, pBC0114, pBC0135, pBC0136, pBC0137, pBC0145, pBC0149 and pBC0146. Lanes 8, 9 and 12 show bands consistent with the FVIII with C-terminal XTEN288 of 95kDa estimated MW. Lanes 7 and 11 show bands consistent with the FVIII with C-terminal XTEN42 of 175kDa estimated MW. Lanes 2-6 show bands consistent with FVIII and heavy chain. Lanes 10 and 23 show bands consistent with heavy chain. Lane 7 shows bands consistent with heavy chain and connected XTEN42.

[0108] Fig.23 Shown are the results of the FVIII assay on samples obtained from FVIII and von Willebrand Factor double knockout mice hydrodynamically injected with plasmid DNA, as detailed in Example 36.

[0109] Fig.24are graphical and tabular depictions of the pharmacokinetic properties of rBDD-FVIII and purified CFXTEN fusion proteins pBC0145 and pBC0146 (with C-terminal XTEN) administered to HemA or FVIII / VWF double knockout mice as described in Example 30, showing that the half-life of CFXTEN was enhanced in both mouse strains.

[0110] Fig.25 A cell culture PK assay was performed in HemA mice to Fig.25 A) or FVIII / VWF double knockout mice ( Fig.25 B) Graphical and tabular depictions of the pharmacokinetic properties of rBDD-FVIII and CFXTEN fusion proteins pSD0050 and pSD0062 (with internally inserted XTEN) administered. As described in Example 32, dose, 5-minute recovery, and half-life (T1 / 2) are shown to emphasize that in both mouse strains, the recovery and half-life of CFXTEN are enhanced compared to the positive control FVIII.

[0111] Fig.26 Is a graphical depiction of titration of the GMA8021 FVIII inhibitor using pBC0114 BDD-FVIII and the CFXTEN construct LSD0049.002 containing three XTEN insertions of 144 amino acids at residues 18, 745, and 2332. The data indicate that the amount of antibody in μg / ml required to inhibit the CFXTEN at 50% is right-shifted by approximately 0.7 orders of magnitude compared to the FVIII positive control.

[0112] Fig. 27 is a schematic diagram of the logic flow diagram of the algorithm SegScore. In the figure, the following legend applies: i, j - counters used in the control loop that goes through the entire sequence; HitCount - this variable is a counter that records how many times a subsequence encounters the same subsequence in a block; SubSeqX - this variable holds the subsequence that is checked for redundancy; SubSeqY - this variable holds the subsequence that SubSeqX is checked against; BlockLen - this variable holds the block length determined by the user; SegLen - this variable holds the segment length. The program is hard-coded to generate scores for subsequences of length 3, 4, 5, 6, 7, 8, 9, and 10; Block - this variable holds a string of length BlockLen. The string consists primarily of letters from the input XTEN sequence and is determined by the position of the i counter; SubSeqList - this is a list that holds all the generated subsequence scores.

[0113] Fig.28Depicts the application of the algorithm SegScore to a hypothetical XTEN of 11 amino acids (SEQ ID NO: 1591) to determine repetitiveness. The XTEN sequence consisting of N amino acids is divided into N-S+1 subsequences of length S (S=3 in this case). All subsequences are compared pairwise and the average number of identical subsequences is calculated to generate a subsequence score of 1.89.

[0114] Fig.29 Be after being exposed to the GMA8021 antibody for FVIII, the figure of the individual construct ratio value of the FVIII activity of the FVIII active in the CFXTEN of mensuration and the pBC114 FVIII positive control, grouping is according to the number (referring to embodiment 28) of the XTEN in the construction fusion protein.Result shows that the ability of CFXTEN retaining FVIII activity increases substantially linearly with the number of the XTEN incorporated into.

[0115] Figure 30 depicts the primary sequence and domain structure of the (BDD) human FVIII construct with mature B domain deletion (Example 46). The positions of the introduced NheI and ClaI restriction sites are shown. It should be noted that the amino acid numbering corresponds to the amino acid position in the primary sequence of mature FVIII (Figure 30). Individual domains are defined by gray lines / frames, wherein the domains are identified with gray text. The acidic regions (a1, a2, a3) are indicated by dotted lines. The solid wedge / triangle indicates the thrombin cleavage site when FVIII is activated into FVIIIa. The hollow wedge / triangle indicates the site of intracellular proteolytic processing into a double-stranded form of FVIII. The hexagon indicates the site of N-linked glycosylation. The circle indicates the site of Tyr sulfation. The unique non-natural restriction sites (NheI, GCTAG; ClaI, ATCGAT) introduced into the cDNA to facilitate XTEN insertion / recombination are highlighted with double underlines in gray.

[0116] Fig.31 A schematic representation of the FVIII construct depicted in Figure 30 is provided, indicating the domain organization and the locations of native and non-native restriction sites.

[0117] Fig.32Graphical ASAView output showing structural data sets 2R7E, 3CDZ, and PM0076106. The solvent accessible areas (ASAs) of the amino acids in domains A1, A2, A3, C1, and C2 are shown. X-ray crystallographic coordinates of 3CDZ (Ngo et al., Structure 16:597-606 (2008)) and 2R7E (Shen et al., Bioood 111:1240-1247 (2008)) deposited in the Protein Data Bank maintained by the Research Collaboratory for Structural Bioinformatics (RCSB; http: / / www.rcsb.org / pdb), and of 2R7E (Shen et al., Bioood 111:1240-1247 (2008)) deposited in the Protein Data Bank maintained by the Consorzio Interuniversitario per le Applicazioni di Supercalcoloper Universitáe Riserca (CASPUR) and the Department of Biochemical Sciences of the University of Rome were retrieved. The atomic coordinates of the predicted refined FVIII structure PM0076106 (Venkateswarlu, BMC Struct. Biol. 10:7 (2010)) obtained from molecular dynamics simulation studies and stored in the Protein Model Database maintained by the Institute of Molecular Biology (Icelandic Institute) (http: / / mi.caspur.it / PMDB / main.php) were analyzed.

[0118] Fig.33 Structural representation showing the position of the XTEN insertion site. The central pattern corresponding to the crystal structure of FVIII (PDB: 2R7E) is surrounded by detailed views of domains A1, A2, A3, C1 and C2. β strands and α helices are shown as ribbon representations. Rings are shown as α carbon tubes. The amino acids at the XTEN insertion site are shown as CPK spherical representations. The numbering in each figure indicates the position of the XTEN insertion site according to the numbering in Figure 30.

[0119] Fig.34 show Fig.33 Schematic diagram of the structure of the location of the XTEN insertion site shown in , where the resulting recombinant FVIII protein exhibits FVIII activity.

[0120] Fig.35 show Fig.34Schematic diagram of the structure of the location of the XTEN insertion site shown in , where the resulting recombinant FVIII protein exhibits FVIII activity.

[0121] Fig.36 show Fig.35 Schematic diagram of the structure of the location of the XTEN insertion site shown in , where the resulting recombinant FVIII protein exhibits FVIII activity.

[0122] Fig.37 A ClustalW multiple sequence alignment of domains A1, A2, A3, C1, and C2 of FVIII is shown, showing the positions of XTEN insertions that result in recombinant FVIII proteins that either exhibit FVIII activity (black boxes, white text) or do not exhibit FVIII activity (grey boxes, bold text).

[0123] Fig.38 A DSSP graphical representation of the secondary structure of the two polypeptide chains in the native active human FVIII crystal structure deposited at the Protein Data Bank with the identifier 2R7E is shown (see Example 47). The amino acid sequence numbering is the same as the protein sequence in Figure 30. The beta-pleated regions are shown as solid arrows and are designated as β1 to β66. The positions of the XTEN-permitted loops are indicated by cross-hatched boxes. The domain A1 XTEN-permitted loops are designated as loop A1-1 and loop A1-2. The domain A2 XTEN-permitted loops are designated as loop A2-1 and loop A2-2. The domain A3 XTEN-permitted loops are designated as loop A3-1 and loop A3-2.

[0124] Fig.39 A DSSP graphical representation of the secondary structure of the two polypeptide chains in the native active human FVIII crystal structure deposited at the Protein Data Bank with the identifier 2R7E is shown (see Example 47). The amino acid sequence numbering is the same as the protein sequence in Figure 30. The beta-pleated regions are shown as solid arrows and are designated as β1 to β66. The positions of the XTEN-permitted loops are indicated by cross-hatched boxes. The domain A1 XTEN-permitted loops are designated as loop A1-1 and loop A1-2. The domain A2 XTEN-permitted loops are designated as loop A2-1 and loop A2-2. The domain A3 XTEN-permitted loops are designated as loop A3-1 and loop A3-2.

[0125] Fig.40 ClustalW multiple sequence alignments showing domains A1, A2, A3, C1 and C2 of FVIII are shown, which show XTEN insertion positions that result in recombinant FVIII proteins showing FVIII activity (black boxes, white text) or not showing FVIII activity (grey boxes, bold text). The positions of XTEN permissive loops are indicated by dashed rectangles (see Example 47).

[0126] Fig.41 . Fig.41 A presents a schematic front view structure of human FVIII (PDB: 2R7E) showing the locations of domains A1, A2, A3, C1, and C2 (circled with dashed lines) and the locations of XTEN-permitting loops A1-1, A1-2, A2-1, A2-2, A3-1, and A3-2 highlighted with CPK spherical representations. Fig.41 B presents a schematic side view of the structure of human FVIII (PDB: 2R7E) showing the locations of domains A1, A2, A3, C1, and C2 (circled with dashed lines) and the locations of XTEN-permitting loops A1-1, A1-2, A2-1, A2-2, A3-1, and A3-2 highlighted with CPK spherical representations.

[0127] Fig.42 A schematic top view of the structure of the isolated human FVIII (PDB: 2R7E) A domain is shown showing the positions of the XTEN-permitting loops highlighted with CPK spherical representations. Fig.42 B, 42D, and 42F show schematic side-view structures of isolated human FVIII (PDB: 2R7E) A domain showing the positions of XTEN-permitting loops highlighted with CPK spherical representations.

[0128] Fig.43 The sequences of various factor VIII B domain deletions and individual mutations are shown. Rows 4-10 show various B domain deletions with indicated XTEN linkages flanking B domain residual residues or A3 domain residues. The R1648A mutation is indicated by arrows in rows 5 and 8, while the Y1680F mutation is indicated by arrows in rows 8-10.

[0129] Fig.44 is a bar graph of chromogenic and aPTT assay activities of various CFXTEN with a single XTEN insert (Example 49).

[0130] Fig.45 is a bar graph of chromogenic and aPTT assay activities of various CFXTEN with 2 XTEN inserts (Example 49).

[0131] Fig.46 is a bar graph of chromogenic and aPTT assay activities of various CFXTENs with 3 XTEN inserts (Example 49).

[0132] Fig.47 is a graph of plasma levels of various administered CFXTEN with single XTEN inserts in DKO mice compared to BDD-FVIII control, showing 10- to 20-fold longer half-lives achieved by inserting XTEN at various positions (Example 50).

[0133] Fig.48 is a graph of plasma levels in DKO mice of various CFXTEN administered with one, two, and three XTEN inserts compared to BDD-FVIII control, showing the increase in half-life achieved by including additional XTEN inserts compared to single or two inserts (Example 51).

[0134] Fig.49 The three hemophiliac sera described in Example 52 ( Fig.49 AC) or sheep anti-FVII ( Fig.49 D) Graph plotting inhibition curves of the remaining Factor VIII procoagulant activity in the assayed samples, showing a clear left shift in the inhibition curves for the two CFXTEN molecules compared to FVIII not linked to XTEN. DETAILED DESCRIPTION

[0135] Before describing the embodiments of the present invention, it should be understood that the embodiments are provided by way of example only, and various alternatives to the embodiments of the present invention described herein can be used to implement the present invention. Numerous changes, modifications and substitutions will now occur to those skilled in the art without departing from the present invention.

[0136] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art to which the present invention belongs. Although methods and materials similar or equivalent to those described herein can be used when implementing or testing the present invention, suitable methods and materials are described below. In the event of a conflict, the patent specification including the definition shall prevail. In addition, materials, methods and examples are only illustrative and not intended to be restrictive. Numerous changes, modifications and substitutions will now be thought of by those skilled in the art without departing from the present invention.

[0137] definition

[0138] In the context of the present application, the following terms have the meanings ascribed to them unless otherwise specified:

[0139] As used in the specification and claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a cell" includes a plurality of cells, including mixtures thereof.

[0140] The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to amino acid polymers of any length. The polymer may be linear or branched, it may contain modified amino acids, and it may be interrupted by non-amino acids. The terms also encompass amino acid polymers that have been modified, for example, by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component.

[0141] As used herein, the term "amino acid" refers to natural and / or unnatural or synthetic amino acids, including but not limited to both D or L optical isomers, as well as amino acid analogs and peptidomimetics. Standard single-letter codes or three-letter codes are used to designate amino acids.

[0142] The term "domain" when used in reference to a Factor VIII polypeptide refers to a full-length domain or a functional fragment thereof, e.g., a full-length or functional fragment of the A1 domain, A2 domain, A3 domain, B domain, C1 domain and / or C2 domain of Factor VIII.

[0143] The term "natural L-amino acids" refers to the L optical isomer forms of glycine (G), proline (P), alanine (A), valine (V), leucine (L), isoleucine (I), methionine (M), cysteine ​​(C), phenylalanine (F), tyrosine (Y), tryptophan (W), histidine (H), lysine (K), arginine (R), glutamine (Q), asparagine (N), glutamic acid (E), aspartic acid (D), serine (S), and threonine (T).

[0144] The term "non-naturally occurring" as applied to sequences and as used herein refers to a polypeptide or polynucleotide sequence that does not have a counterpart in a wild-type or naturally occurring sequence found in a mammal, is not complementary to a wild-type or naturally occurring sequence found in a mammal, or does not have a high degree of homology with a wild-type or naturally occurring sequence found in a mammal. For example, when suitably aligned, a non-naturally occurring polypeptide or fragment may share up to 99%, 98%, 95%, 90%, 80%, 70%, 60%, 50% or even less amino acid sequence identity compared to a native sequence.

[0145] The terms "hydrophilicity" and "hydrophobicity" refer to the degree of affinity a substance has for water. Hydrophilic substances have a strong affinity for water and tend to dissolve in water, mix with water, or be wetted by water, while hydrophobic substances generally lack affinity for water, tend to repel rather than absorb water and tend not to dissolve in water or mix with water or be wetted by water. Amino acids can be characterized based on their hydrophobicity. Many scales have been developed. One example is the scale developed by Levitt, M ​​et al., J Mol Biol (1976) 104:59, which is listed in Hopp, TP et al., Proc Natl Acad Sci U SA (1981) 78:3824. Examples of "hydrophilic amino acids" are arginine, lysine, threonine, alanine, asparagine and glutamine. Of particular interest are the hydrophilic amino acids aspartic acid, glutamic acid, and serine and glycine. Examples of "hydrophobic amino acids" are tryptophan, tyrosine, phenylalanine, methionine, leucine, isoleucine and valine.

[0146] "Fragments" when applied to proteins are truncated forms of native biologically active proteins that retain at least a portion of the therapeutic and / or biological activity. "Variants" when applied to proteins are proteins that retain at least a portion of the therapeutic and / or biological activity of biologically active proteins with sequence homology to native biologically active proteins. For example, variant proteins may have at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid sequence identity compared to a reference biologically active protein. As used herein, the term "biologically active protein portion" includes proteins that are intentionally modified, such as by site-directed mutagenesis, synthetic encoding genes, insertions, or proteins that are accidentally modified by mutations.

[0147] The term "sequence variant" refers to a polypeptide that has been modified by insertion, deletion or substitution of one or more amino acids compared to their native or original sequence. The insertion may be located at either end or both ends of the protein, and / or may be located within the internal region of the amino acid sequence. A non-limiting example is the insertion of an XTEN sequence within the sequence of a biologically active payload protein. In a deletion variant, one or more amino acid residues in a polypeptide as described herein are removed. Thus, a deletion variant includes all fragments of a payload polypeptide sequence. In a substitution variant, one or more amino acid residues of a polypeptide are removed and replaced with an alternative residue. On the one hand, substitutions are conservative in nature and conservative substitutions of this type are well known in the art.

[0148] As used herein, "internal XTEN" refers to an XTEN sequence that has been inserted into the sequence of a coagulation factor. An internal XTEN can be constructed by inserting an XTEN sequence into the sequence of a coagulation factor such as FVIII, wherein the insertion is achieved by inserting between two adjacent amino acids in a domain of the coagulation factor ("intradomain") or between two domains ("interdomain") or wherein the XTEN replaces a partial internal sequence of the coagulation factor.

[0149] As used herein, "terminal XTEN" refers to an XTEN sequence that has been fused to the N-terminus or C-terminus of a coagulation factor or fused in the N-terminus or C-terminus of a coagulation factor or fused to the proteolytic cleavage sequence or joint of the N-terminus or C-terminus of a coagulation factor. The terminal XTEN can be fused to the natural end of the coagulation factor. Alternatively, the terminal XTEN can replace a portion of the terminal sequence of the coagulation factor.

[0150] The term "XTEN release site" refers to the CFXTEN fusion rotein that can be recognized and cracked by mammalian protease, thereby realizes the cleavage sequence that a part of XTEN or XTEN is released from the CFXTEN fusion rotein. As used herein, "mammalian protease" refers to the protease that is usually present in mammalian body fluid, cell or tissue. The XTEN release site can be engineered to be cracked by various mammalian proteases (also referred to as "XTEN release protease"), such as FXIa, FXIIa, kallikrein, FVIIIa, FVIIIa, FXa, FIIa (thrombin), elastase-2, MMP-12, MMP13, MMP-17, MMP-20 or any protease that exists during the coagulation event. Other equivalent proteases (endogenous or exogenous) that can identify and determine the cleavage site can be utilized. The cleavage site can be adjusted and customized for protease used.

[0151] When referring to a first polypeptide being linked to a second polypeptide, the term "within" encompasses linkage such that the N-terminus of the first or second polypeptide is linked to the C-terminus of the second or first polypeptide, respectively, as well as insertion of the first polypeptide into the sequence of the second polypeptide. For example, when an XTEN is linked "within a domain of a Factor VIII polypeptide," the XTEN can be linked to the N-terminus, the C-terminus, or can be inserted into the domain.

[0152] As used herein, the term "site," when used to refer to the site of insertion of an XTEN in or into a biological polypeptide such as Factor VIII, refers to the amino acid position at which the XTEN is attached. When describing numbered sites, such as the first, second, third, fourth, fifth, or sixth site of insertion of an XTEN in or into Factor VIII, each site will be understood to refer to a different site in Factor VIII; e.g., the second site is a different Factor VIII position than the first site, the third site is different than the second and first sites, etc.

[0153] "Activity" or "procoagulant activity" as applied to one or more forms of CFXTEN polypeptides provided herein refers to the ability to bind target coagulation protein substrates or cofactors and promote coagulation events, no matter measured by external, in vitro or in vivo assays. Described assays include but are not limited to single-stage coagulation assays, two-stage coagulation assays, colorimetric assays and ELISA assays. "Biological activity" refers to biological function or effect in vitro or in vivo, including but not limited to receptor or ligand binding or FVIII coagulation factor to the effect of coagulation commonly known in the art or cells, physiology or clinical responses, including stopping bleeding events.

[0154] As used herein, the term "ELISA" refers to an enzyme-linked immunosorbent assay as described herein or as otherwise known in the art.

[0155] "Host cell" includes an individual cell or cell culture that can be or has been a recipient of a subject vector. Host cells include the progeny of a single host cell. Progeny may not necessarily be completely identical (in morphology or in genome of total DNA complement sequence) to the original parent cell due to natural, accidental, or deliberate mutation. Host cells include cells transfected in vivo with a vector of the invention.

[0156] "Isolated" refers to a polypeptide that has been identified and separated from the components of its natural environment and / or recovered from the components of the natural environment when used to describe the various polypeptides disclosed herein. The pollutant components of its natural environment are substances that will generally interfere with the diagnostic or therapeutic use of the polypeptide, and may include enzymes, hormones, and other proteins or non-protein solutes. As will be apparent to those skilled in the art, non-naturally occurring polynucleotides, peptides, polypeptides, proteins, antibodies, or fragments thereof do not need to be "separated" to distinguish them from their naturally occurring counterparts. In addition, "concentrated", "separated" or "diluted" polynucleotides, peptides, polypeptides, proteins, antibodies, or fragments thereof can be distinguished from their naturally occurring counterparts because the concentration or number of molecules per volume is generally greater than the concentration or number of its naturally occurring counterparts. In general, polypeptides prepared by recombinant means and expressed in host cells are considered to be "isolated".

[0157] An "isolated" polynucleotide or polypeptide encoding nucleic acid or other polypeptide encoding nucleic acid is a nucleic acid molecule that is identified and separated from at least one contaminant nucleic acid molecule with which it is normally associated in the natural source of the polypeptide encoding nucleic acid. An isolated polypeptide encoding nucleic acid molecule is different from the form or configuration in which it is found in nature. Thus, an isolated polypeptide encoding nucleic acid molecule is different from a specific polypeptide encoding nucleic acid molecule when it is present in a natural cell. However, an isolated polypeptide encoding nucleic acid molecule includes a polypeptide encoding nucleic acid molecule contained in a cell that normally expresses a polypeptide, in which cell, for example, the nucleic acid molecule is in a chromosomal or extrachromosomal position that is different from the position of the natural cell.

[0158] A "chimeric" protein contains at least one fusion polypeptide that includes at least one region in a position in the sequence that is different from that in which it occurs in nature. The regions may normally exist as separate proteins and are brought together in the fusion polypeptide; or they may normally exist as the same protein but are placed in a novel arrangement in the fusion polypeptide. Chimeric proteins can be produced, for example, by chemical synthesis, or by creating and translating a polynucleotide in which the peptide regions are encoded in the desired relationship.

[0159] "Conjugated," "connected," "fused," and "fusion" are used interchangeably herein. These terms refer to joining two or more chemical elements, sequences, or components together by whatever means, including chemical conjugation or recombinant means. For example, if a promoter or enhancer affects the transcription of a sequence, it is operably linked to a coding sequence. Typically, "operably linked" means that the DNA sequences being linked are continuous and in reading phase or frame. "In-frame fusion" refers to joining two or more open reading frames (ORFs) to form a continuous longer ORF in a manner that maintains the correct reading frame of the original ORF. Therefore, the resulting recombinant fusion protein is a single protein containing two or more segments corresponding to the polypeptides encoded by the original ORFs (the segments are not usually joined in this way in nature).

[0160] In the context of polypeptides, a "linear sequence" or "sequence" is a certain order of amino acids in a polypeptide in the direction from amino terminus to carboxyl terminus, wherein the residues that are adjacent to each other in the sequence are continuous in the primary structure of the polypeptide. A "partial sequence" is a linear sequence of a portion of a polypeptide that is known to contain other residues in one or two directions.

[0161] "Heterologous" refers to an entity that is genotypically different from the rest of the entity to which it is compared. For example, a glycine-rich sequence removed from its native coding sequence and operably linked to a coding sequence other than the native sequence is a heterologous glycine-rich sequence. The term "heterologous" as applied to polynucleotides, polypeptides, refers to a polynucleotide or polypeptide that is genotypically different from the rest of the entity to which it is compared.

[0162] The terms "polynucleotide", "nucleic acid", "nucleotide" and "oligonucleotide" are used interchangeably. They refer to a polymeric form of nucleotides of any length, which are deoxyribonucleotides or ribonucleotides or their analogs. Polynucleotides can have any three-dimensional structure and can perform any function known or unknown. The following are non-limiting examples of polynucleotides: coding or non-coding regions of genes or gene fragments, loci determined by linkage analysis (locus), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA with any sequence, isolated RNA with any sequence, nucleic acid probes and primers. Polynucleotides may contain modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after polymer assembly. The sequence of nucleotides may be interrupted by non-nucleotide components. Polynucleotides may be further modified after polymerization, such as by conjugation with a labeling component.

[0163] The term "complement of a polynucleotide" refers to a polynucleotide molecule having a complementary base sequence and in the reverse orientation compared to a reference sequence such that it can hybridize with full fidelity to the reference sequence.

[0164] "Recombinant" as applied to a polynucleotide means that the polynucleotide is the product of various combinations of in vitro cloning, restriction and / or ligation steps, and other procedures that result in a construct that can potentially be expressed as a recombinant protein in a host cell.

[0165] The terms "gene" and "gene fragment" are used interchangeably herein. They refer to polynucleotides containing at least one open reading frame that can encode a specific protein after transcription and translation. The gene or gene fragment can be genomic or cDNA, as long as the polynucleotide contains at least one open reading frame that can cover the entire coding region or a segment thereof. A "fusion gene" is a gene composed of at least two heterologous polynucleotides linked together.

[0166] "Homology" or "homologous" or "sequence identity" refers to the sequence similarity or interchangeability between two or more polynucleotide sequences or between two or more polypeptide sequences. When using a program such as BestFit to determine the sequence identity, similarity or homology between two different amino acid sequences, the default settings can be used, or an appropriate scoring matrix such as blosum45 or blosum80 can be selected to optimize the consistency, similarity or homology scores. Preferably, homologous polynucleotides are those polynucleotides that hybridize under stringent conditions as defined herein and have at least 70%, preferably at least 80%, more preferably at least 90%, more preferably 95%, more preferably 97%, more preferably 98%, and even more preferably 99% sequence identity compared to those sequences. Homologous polypeptides preferably have at least 70%, preferably at least 80%, even more preferably at least 90%, even more preferably at least 95-99%, and most preferably 100% identical sequence identity.

[0167] "Connection" refers to the process of forming a phosphodiester bond between two nucleic acid fragments or genes that connects them together. To connect DNA fragments or genes together, the ends of the DNA must be compatible with each other. In some cases, after endonuclease digestion, the ends will be directly compatible. However, it may be necessary to first convert the staggered ends that are usually produced after endonuclease digestion into blunt ends so that they are compatible for connection.

[0168] The term "stringent conditions" or "stringent hybridization conditions" includes conditions under which a polynucleotide will hybridize to its target sequence to a greater detectable degree than to other sequences (e.g., at least 2-fold over background). Typically, the stringency of hybridization is expressed in part with respect to the temperature and salt concentration at which the wash steps are performed. Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ions, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short polynucleotides (e.g., 10 to 50 nucleotides) and at least about 60° C. for long polynucleotides (e.g., greater than 50 nucleotides)—for example, "stringent conditions" may include hybridization at 37° C. in 50% formamide, 1 M NaCl, 1% SDS, and washing 3 times for 15 minutes each in 0.1×SSC / 1% SDS at 60° C. to 65° C. Alternatively, a temperature of about 65°C, 60°C, 55°C or 42°C may be used. The SSC concentration may vary from about 0.1 to 2×SSC, with SDS being present at about 0.1%. The washing temperature is typically selected to be about 5°C to 20°C below the thermal melting point of the specific sequence at a defined ionic strength and pH. Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. The equation for calculating Tm and the conditions for nucleic acid hybridization are well known and can be found in Sambrook, J. et al., “Molecular Cloning: A Laboratory Manual,” 3rd edition, Cold Spring Harbor Laboratory Press, 2001. Typically, a blocking agent is used to block nonspecific hybridization. The blocking agent includes, for example, about 100-200 μg / ml of sheared and denatured salmon sperm DNA. Organic solvents (such as formamide at a concentration of about 35-50% v / v) may also be used in certain circumstances (such as RNA:DNA hybridization). Applicable variations on these wash conditions will be readily apparent to those of ordinary skill in the art.

[0169] The terms "percent identity", "percent sequence identity" and "% identity" as applied to polynucleotide sequences refer to the percentage of residues that match between at least two polynucleotide sequences aligned using a standardized algorithm. The algorithm can insert gaps in the compared sequences in a standardized and reproducible manner to optimize the alignment between the two sequences, and thus achieve a more meaningful comparison of the two sequences. The percent identity can be measured over the length of the entire defined polynucleotide sequence, or can be measured over a shorter length, such as a fragment taken from a larger defined polynucleotide sequence (e.g., a fragment having at least 45, at least 60, at least 90, at least 120, at least 150, at least 210, or at least 450 consecutive residues). The lengths are exemplary only, and it should be understood that any fragment length supported by the sequences shown in the tables, figures or sequence listings herein can be used to describe the length over which the percent identity is measured. The percent sequence identity is calculated by comparing the two optimally aligned sequences over a comparison window, determining the number of matching positions (positions where the same residue is present in both polypeptide sequences), dividing the number of matching positions by the total number of positions in the comparison window (i.e., the window size), and multiplying the result by 100 to produce the percent sequence identity. When sequences of different lengths are to be compared, the shortest sequence defines the length of the comparison window. Conservative substitutions are not considered when calculating sequence identity.

[0170] "Percentage (%) of sequence identity" with respect to the polypeptide sequences identified herein is defined as the percentage of amino acid residues in the query sequence that are identical to the amino acid residues of the second reference polypeptide sequence or a portion thereof, after the sequences are aligned and gaps are introduced, if necessary, to achieve the maximum percentage of sequence identity, and any conservative substitutions are not considered as part of the sequence identity. Alignment for the purpose of determining the percentage of amino acid sequence identity can be achieved in various ways that are within the skill of the art, such as using publicly available computer software, such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine the parameters suitable for measuring the alignment, including any algorithm required for achieving maximum alignment over the full length of the compared sequences. The percentage of identity can be measured over the length of the entire determined polypeptide sequence, or can be measured over a shorter length, such as a fragment (e.g., a fragment having at least 15, at least 20, at least 30, at least 40, at least 50, at least 70, or at least 150 consecutive residues) taken from a larger determined polypeptide sequence. The lengths are exemplary only, and it will be appreciated that any fragment length supported by the sequences shown herein in the tables, figures or sequence listing can be used to describe the length over which percent identity is measured.

[0171] As used herein in the context of polypeptides, the term "non-repetitiveness" refers to the lack of internal homology or limited internal homology in a peptide or polypeptide sequence. The term "substantially non-repetitive" may refer to, for example, the presence or absence of the following situations: four consecutive amino acids in the sequence are the same amino acid type; or to the polypeptide having a subsequence score of 10 or less (defined below) or to the absence of a pattern of sequence motifs constituting the polypeptide sequence in the order from the N-terminus to the C-terminus. As used herein in the context of polypeptides, the term "repetitiveness" refers to the degree of internal homology in a peptide or polypeptide sequence. In contrast, a "repetitive" sequence may contain multiple identical copies of a short amino acid sequence. For example, a target polypeptide sequence can be divided into n-mer sequences and the number of identical sequences can be counted. Highly repetitive sequences contain most of the same sequence, while non-repetitive sequences contain a few identical sequences. In the case of a polypeptide, a sequence may contain multiple copies of a shorter sequence or motif of a determined or variable length, wherein the motif itself has a non-repetitive sequence, thereby rendering the full-length polypeptide substantially non-repetitive. The length of the polypeptide at which non-repetitiveness is measured can vary from 3 amino acids to about 200 amino acids, from about 6 amino acids to about 50 amino acids, or from about 9 amino acids to about 14 amino acids. "Repetitiveness" as used in the context of polynucleotide sequences refers to the degree of internal homology in a sequence, such as, for example, the frequency of identical nucleotide sequences of a given length. Repetitiveness can be measured, for example, by analyzing the frequency of identical sequences.

[0172] "Vector" is a nucleic acid molecule that transfers an inserted nucleic acid molecule into a host cell and / or between host cells, preferably self-replicating in an appropriate host. The term includes vectors that primarily function to insert DNA or RNA into a cell, replication vectors that primarily function to replicate DNA or RNA, and expression vectors that function to transcribe and / or translate DNA or RNA. Vectors that provide more than one of the above functions are also included. "Expression vector" is a polynucleotide that can be transcribed and translated into a polypeptide when introduced into an appropriate host cell. "Expression system" generally implies a suitable host cell containing an expression vector that can function to produce a desired expression product.

[0173] "Resistance to serum degradation" as applied to polypeptides refers to the ability of a polypeptide to resist degradation in blood or its components, which typically involves proteases in serum or plasma. Resistance to serum degradation can be measured by combining a protein with human (or mouse, rat, monkey, as appropriate) serum or plasma, typically at about 37°C, typically for a range of days (e.g., 0.25, 0.5, 1, 2, 4, 8, 16 days). Samples at these time points can be subjected to a Western blot assay and the protein detected with an antibody. The antibody can be directed against a tag in the protein. If the protein shows a single band on the Western blot (where the size of the protein is consistent with the size of the injected protein), then no degradation has occurred. In this exemplary method, the time point at which 50% of the protein is degraded, as judged by Western blot or an equivalent technique, is the serum degradation half-life or "serum half-life" of the protein.

[0174] As used herein, the term " 1 / 2 ” refers to the calculation of ln(2) / K e1 The terminal half-life of K e1 The terminal elimination rate constant is calculated by linear regression of the terminal linear portion of the log concentration versus time curve. Half-life is generally defined as the time required for half the amount of an administered substance deposited in a living organism to be metabolized or eliminated by normal biological processes. The term "t 1 / 2 ,” “terminal half-life,” “elimination half-life,” and “circulatory half-life” are used interchangeably herein.

[0175] "Active clearance" refers to mechanisms by which proteins are removed from the circulation other than by filtration or aggregation, and includes removal of proteins from the circulation mediated by cells, receptors, metabolism, or degradation.

[0176] "Apparent molecular weight factor" and "apparent molecular weight" are related terms regarding the measure of the relative increase or decrease in apparent molecular weight exhibited by a particular amino acid sequence. Apparent molecular weight is determined by comparison with globular protein standards using size exclusion chromatography (SEC) or similar methods, and is measured in "apparent kD" units. The apparent molecular weight factor is the ratio between the apparent molecular weight and the actual molecular weight; the latter is predicted by adding the calculated molecular weight of each type of amino acid in the composition based on the amino acid composition or by estimating from comparison with molecular weight standards in an SDS electrophoresis gel.

[0177] The term "hydrodynamic radius" or "Stokes radius" is the effective radius (R h, in nm), which is measured by assuming that an object passes through a solution and is resisted by the viscosity of the solution. In embodiments of the present invention, the hydrodynamic radius measurement of the XTEN fusion protein is related to the 'apparent molecular weight factor' as a more intuitive measure. The "hydrodynamic radius" of a protein affects its diffusion rate in an aqueous solution and its ability to migrate in a gel of a macromolecular mass. The hydrodynamic radius of a protein is measured by its molecular weight and by its structure (including shape and compactness). The method for measuring the hydrodynamic radius is well known in the art, such as by using size exclusion chromatography (SEC) as described in U.S. Patent Nos. 6,406,632 and 7,294,513. Most proteins have a globular structure, which is the tightest three-dimensional structure that a protein can have with a minimum hydrodynamic radius. Some proteins adopt a random and open unstructured or 'linear' conformation and therefore have a much larger hydrodynamic radius than typical globular proteins with similar molecular weights.

[0178] "Physiological conditions" refers to a set of conditions in a living host as well as in vitro conditions, including temperature, salt concentration, pH that simulate those conditions of a living subject. Hosts for in vitro assays have been established with physiologically relevant conditions. Typically, physiological buffers contain physiological concentrations of salt and are adjusted to a neutral pH in the range of about 6.5 to about 7.8, and preferably about 7.0 to about 7.5. A variety of physiological buffers are listed in Sambrook et al. (2001). Physiologically relevant temperatures are in the range of about 25°C to about 38°C, and preferably about 35°C to about 37°C.

[0179] A "reactive group" is a chemical structure that can be coupled to a second reactive group. Examples of reactive groups are amino, carboxyl, sulfhydryl, hydroxyl, aldehyde, azido. Some reactive groups can be activated to promote coupling with a second reactive group. Non-limiting examples of activation are the reaction of a carboxyl with a carbodiimide, the conversion of a carboxyl to an activated ester, or the conversion of a carboxyl to an azide functional group.

[0180] "Controlled release agent", "slow release agent", "depot formulation" and "sustained release agent" are used interchangeably to refer to agents that can extend the release duration of the polypeptide of the present invention relative to the release duration when the polypeptide is administered in the absence of the agent. Different embodiments of the present invention can have different release rates, thereby producing different therapeutic amounts.

[0181] The terms "antigen," "target antigen," and "immunogen" are used interchangeably herein to refer to a structure or binding determinant to which an antibody fragment or antibody fragment-based therapeutic binds or has specificity for.

[0182] As used herein, the term "payload" refers to a protein or peptide sequence with biological or therapeutic activity; that is, the counterpart of the pharmacophore of a small molecule. Examples of payloads include, but are not limited to, coagulation factors, cytokines, enzymes, hormones, and blood and growth factors.

[0183] The term "antagonist" as used herein includes any molecule that partially or completely blocks, inhibits or neutralizes the biological activity of a native polypeptide disclosed herein. Methods for identifying antagonists of a polypeptide may include contacting a native polypeptide with a candidate antagonist molecule and measuring detectable changes in one or more biological activities typically associated with the native polypeptide. In the context of the present invention, antagonists may include proteins, nucleic acids, carbohydrates, antibodies, or any other molecules that reduce the effects of a biologically active protein.

[0184] The term "agonist" is used in a broad sense and includes any molecule that mimics the biological activity of a natural polypeptide disclosed herein. Suitable agonist molecules specifically include agonist antibodies or antibody fragments, fragments or amino acid sequence variants of natural polypeptides, peptides, small organic molecules, etc. Methods for identifying agonists of natural polypeptides may include contacting the natural polypeptide with a candidate agonist molecule and measuring detectable changes in one or more biological activities typically associated with the natural polypeptide.

[0185] As used herein, "treat" or "alleviate" or "ameliorate" are used interchangeably and refer to the administration of a drug or biologic to achieve a therapeutic benefit, cure an existing condition or lessen the severity of an existing condition, or to achieve a prophylactic benefit, prevent or reduce the likelihood of onset of a condition or the severity of the occurrence of a condition. By therapeutic benefit, it is meant eradication or amelioration of the underlying condition being treated or one or more physiological symptoms associated with the underlying condition such that an improvement is observed in the subject, even though the subject may still be afflicted with the underlying condition.

[0186] As used herein, "therapeutic effect" or "therapeutic benefit" refers to the physiological effect produced by the administration of the fusion protein of the present invention, including but not limited to alleviating, improving or preventing a disease in a human or other animal, or otherwise enhancing the physical or mental well-being of a human or animal, rather than being able to induce the production of antibodies against antigenic epitopes possessed by biologically active proteins. For preventive and therapeutic benefits, the composition may be administered to a subject at risk of developing a particular disease, a condition or symptom of the disease (e.g., bleeding in a subject diagnosed with hemophilia A), or to a subject who reports one or more physiological symptoms of the disease, although a diagnosis of the disease may not have been made.

[0187] As used herein, the terms "therapeutically effective amount" and "therapeutically effective dose" refer to an amount of a drug or biologically active protein, alone or as part of a fusion protein composition, that is capable of having any detectable beneficial effect on any symptom, aspect, measured parameter or characteristic of a disease condition or pathology when administered to a subject in one or repeated doses. The effect need not be absolutely beneficial. Determining a therapeutically effective amount is well within the capabilities of those skilled in the art, especially in light of the detailed disclosure provided herein.

[0188] The term "therapeutically effective dosage regimen" as used herein refers to a schedule for the sequential administration of multiple doses (i.e., at least two or more) of a biologically active protein, either alone or as part of a fusion protein composition, wherein the doses are given in therapeutically effective amounts to produce a sustained beneficial effect on any symptom, aspect, measured parameter, or characteristic of a disease state or condition.

[0189] I). General Technology

[0190] The practice of the present invention employs, unless otherwise indicated, conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA, which are within the skill of the art. See Sambrook, J. et al., "Molecular Cloning: A Laboratory Manual," 3rd edition, Cold Spring Harbor Laboratory Press, 2001; "Current protocols in molecular biology," FM Ausubel et al., 1987; the book "Methods in Enzymology," Academic Press, San Diego, CA.; "PCR 2: a practical approach," MJ MacPherson, BD Hames and GR Taylor, 1995; "Antibodies, a laboratory manual," Harlow, E. and Lane, D., 1988; "Goodman & Gilman's The Pharmacological Basis of Therapeutics," 11th edition, McGraw-Hill, 2005; and Freshney, RI, "Culture of Animal Cells: A Manual of Basic Technique," 4th edition, John Wiley & Sons, Somerset, NJ, 2000, the contents of which are incorporated herein by reference in their entirety.

[0191] II). Coagulation Factor VIII

[0192] The present invention relates in part to compositions comprising the factor VIII thrombin (CF) that is connected to one or more extended recombinant proteins (XTEN), thereby producing the CFXTEN fusion protein compositions.As used herein, " CF " refers to analogies, sequence variants and truncated forms of factor VIII (FVIII) or FVIII, as described below.

[0193] "Factor VIII" or "FVIII" or "FVIII protein" refers to a coagulation factor protein and its species (including human, porcine, canine, rat or murine FVIII protein) and sequence variants, including but not limited to a single-chain precursor protein containing 2351 amino acids (with a hydrophobic signal peptide of 19 amino acids); a mature factor VIII cofactor protein of approximately 270-330 kDa containing 2332 amino acids, which has a domain structure A1-A2-B-A3-C1-C2; and the non-enzymatically "active" or cofactor form of FVIII (FVIIIa), which is a circulating heterodimer with two chains formed as a result of proteolytic cleavage after R1648, with a heavy chain form consisting primarily of A1-A2-B (ranging from 90-220 kD) containing amino acids 1-1648 (numbered relative to the mature FVIII form) and an 80 kDa light chain A3-C1-C2 containing amino acids 1649-2232, each of which is schematically depicted in Figure 1 In. In addition and as used herein, A1, A2 and A3 domains each encompass an acidic spacer region; respectively a1, a2 and a3 acidic regions. Therefore, it should be understood that the CFXTEN constructs described as having A1, A2, A3, B, C1 and C2 domains include a1, a2 and a3 acidic regions. As used herein, "factor VIII" or "FVIII" or "FVIII polypeptides" also include variant forms, including proteins with substitutions, additions and / or deletions, as long as the variant retains the desired biological activity such as procoagulant activity. Tens of thousands of functional FVIII variants have been constructed and can be used as recombinant FVIII proteins as described herein. See PCT Publication Nos. WO 2011 / 069164A2, WO 2012 / 006623A2, WO 2012 / 006635A2 or WO 2012 / 006633A2, all of which are incorporated herein by reference in their entirety. Many functional FVIII variants are known. In addition, hundreds of non-functional mutations in FVIII have been identified in hemophiliacs. See, e.g., Cutler et al., Hum. Mutat. 19: 274-8 (2002), which is incorporated herein by reference in its entirety. In addition, comparisons between FVIII from humans and FVIII from other species have identified conserved residues that may be required for function. See, e.g., Cameron et al., Thromb. Haemost. 79: 317-22 (1998) and US 6,251,632, which are incorporated herein by reference in their entirety.

[0194] In one embodiment, the human Factor VIII domain is defined by the following amino acid residues: A1, residues Ala1-Arg372; A2, residues Ser373-Arg740; B, residues Ser741-Arg1648; A3, residues Ser1649-Asn2019; C1, residues Lys2020-Asn2172; C2, residues Ser2173-Tyr2332. The A3-C1-C2 sequence includes residues Ser1649-Tyr2332. In another embodiment, residues Arg336-Arg372 are generally referred to as the a1 region, and Arg372 is cleaved by thrombin. In certain embodiments, the a2 region is part of the A1 domain. In another embodiment, residues Glu1649-Arg1689 are referred to as the a3 acidic region. In certain embodiments, the a3 acidic region is part of the A3 domain. In another embodiment, the native FVIII protein has the formula: A1-a1-A2-a2-B-a3-A3-C1-C2, wherein A1, A2 and A3 are structurally related "A domains", B is a "B domain", C1 and C2 are structurally related "C domains", and a1, a2 and a3 are acidic spacer regions. In the preceding formula and with reference to the primary amino acid sequence positions in Figure 30, the A1 domain of human FVIII extends from Ala1 to about Arg336, the a1 spacer region extends from about Met337 to about Arg372, the A2 domain extends from about Ser373 to about Tyr719, the a2 spacer region extends from about Glu720 to about Arg740, the B domain extends from about Ser741 to about Arg1648, the a3 spacer region extends from about Glu1649 to about Arg1689, the A3 domain extends from about Ser1690 to about Asn2019, the C1 domain extends from about Lys2020 to about Asn2172, and the C2 domain extends from about Ser2173 to Tyr2332 (Saenko et al., 2005, J Thromb Hemostasis, 1, 922-930). Apart from specific proteolytic cleavage sites, the designation of the positions of boundaries between domains and regions of FVIII may vary in different references.Thus, the boundaries indicated herein are designated as approximate boundaries by using the term "about".

[0195] The Factor VIII includes truncated sequences, such as a B domain-deleted "BDD" sequence in which a portion or a majority of the B domain sequence is deleted (such as the BDD sequences disclosed or referenced in U.S. Pat. Nos. 6,818,439 and 7,632,921). An example of a BDD Factor VIII is or (recombinant BDD FVIII) comprising a first polypeptide corresponding to amino acids 1 to 743 of Figure 30 fused to a second polypeptide corresponding to amino acids 1638 to 2332 of Figure 30. Exemplary BDD FVIII constructs that can be used to produce recombinant proteins of the invention include, but are not limited to, FVIII lacking amino acids corresponding to amino acids 747-1638 (Figure 30) of mature human FVIII (Hoeben RC et al. J. Biol. Chem. 265(13):7318-7323 (1990), which is incorporated herein by reference in its entirety), and FVIII lacking amino acids corresponding to amino acids 771-1666 or amino acids 868-1562 (Figure 30) of mature human FVIII (Meulien P. et al. Protein Eng. 2(4):301-6 (1988), which is incorporated herein by reference in its entirety).

[0196] In addition, sequences including heterologous amino acid insertions or substitutions (such as aspartic acid replacing valine at position 75) or single-chain FVIII (scFVIII) where the heavy and light chains are covalently linked by a linker are contemplated. As used herein, "FVIII" will be any functional form of a factor VIII molecule having typical characteristics of coagulation factor VIII that can correct human factor VIII deficiency when administered to a subject, such as a subject with hemophilia A. FVIII or sequence variants have been isolated, characterized, and cloned as described in U.S. Patents or Application Nos. 4,757,006; 4,965,199; 5,004,804; 5,198,349, 5,250,421; 5,919,766; 6,228,620; 6,818,439; 7,138,505; 7,632,921; and 20100081615.

[0197] Human factor VIII is encoded by a single copy gene present at the tip of the long arm of chromosome X (q28). It contains nearly 186,000 base pairs (bp) and occupies approximately 0.1% of chromosome X (White, GC. and Shoemaker, CB, Blood (1989) 73: 1-12). The human FVIII amino acid sequence was deduced from the cDNA as shown in U.S. Pat. No. 4,965,199, which is incorporated herein by reference in its entirety. The native mature human FVIII obtained from the cDNA sequence (i.e., without the secretory signal peptide but before other post-translational processing) appears as Figure 3 .

[0198] The DNA encoding mature factor VIII mRNA is found in 26 individual exons ranging in size from 69 to 3,106 bp. The 25 intervening intronic regions separating the exons range in size from 207 to 32,400 bp. The complete gene consists of approximately 9 kb exons and 177 kb introns. The three repeated A domains have approximately 30% sequence homology. The B domain contains 19 of approximately 25 predicted glycosylation sites, and the A3 domain is believed to contain a binding site for von Willebrand factor. The tandem C domains follow the A3 domains and have approximately 37% homology to each other (White, GC. and Shoemaker, CB, Blood (1989) 73: 1-12).

[0199] In the newly synthesized single-chain precursor molecule, the B domain separates the A2 domain and the A3 domain of native factor FVIII. The exact boundaries of the B domain have been variously reported as extending from amino acid 712 to 1648 of the precursor sequence (Wood et al., Nature (1984) 312: 330-337) or as amino acids 741-1648 (Pipe, SW, Haemophilia (2009) 15: 1187-1196 and U.S. Patent No. 7,560,107) or amino acids 740-1689 (Toole, JJ. Proc. Natl. Acad. Sci. USA (1986) 83: 5939-5942). As used herein, "B domain" refers to amino acids 741-1648 of mature factor VIII. As used herein, "FVIII B domain deletion" or "FVIII BDD" refers to a FVIII sequence in which any, a fragment or all of amino acids 741 to 1648 are deleted. In one embodiment, the FVIII BDD variant retains the remaining amino acids of the B domain from the N-terminus (as "B1" as used herein) and the C-terminus (as "B2" as used herein). In one FVIII BDD variant, the B domain remaining amino acids are SFSQNPPVLKRHQR (SEQ ID NO: 1614). In one FVIII BDD variant, the B1 remainder is SFS and the B2 remainder is QNPPVLKRHQR (SEQ ID NO: 1615). In another FVIII BDD variant, the B1 remainder is SFSQN (SEQ ID NO: 1616) and the B2 remainder is PPVLKRHQR (SEQ ID NO: 1617). "B domain deleted factor VIII," "FVIII BDD," or "BDD FVIII" may have complete or partial deletions as disclosed in U.S. Pat. Nos. 6,316,226; 6,346,513; 7,041,635; 5,789,203; 6,060,447; 5,595,886; 6,228,620; 5,972,885; 6,048,720; 5,543,502; 5,610,278; 5,171,844; 5,112,950; 4,868,112; and 6,458,563, each of which is herein incorporated by reference in its entirety. In some embodiments, the B-domain deleted Factor VIII sequence of the invention comprises any of the deletions disclosed at column 4, line 4 to column 5, line 28 and Examples 1-5 of U.S. Pat. No. 6,316,226 (also in US 6,346,513).In another embodiment, the B-domain deleted factor VIII is a S743 / Q1638 B-domain deleted factor VIII (SQ form factor VIII) (e.g., a factor VIII deleted from amino acid 744 to amino acid 1637, e.g., a factor VIII having amino acids 1-743 and amino acids 1638-2332 of full-length factor VIII). In some embodiments, the B-domain deleted factor VIII of the invention has a deletion disclosed at column 2, lines 26-51 and Examples 5-8 of U.S. Pat. No. 5,789,203 (as well as US 6,060,447, US 5,595,886, and US 6,228,620). In some embodiments, the B domain-deleted Factor VIII has a deletion as described in: U.S. Pat. No. 5,972,885, column 1, line 25 to column 2, line 40; U.S. Pat. No. 6,048,720, column 6, lines 1-22, and Example 1; U.S. Pat. No. 5,543,502, column 2, lines 17-46; U.S. Pat. No. 5,171,844, column 4, line 22 to column 5, line 36; U.S. Pat. No. 5,112,950, column 2, lines 55-68. Figure 2and Example 1; U.S. Pat. No. 4,868,112, column 2, line 2 to column 19, line 21, and Table 2; U.S. Pat. No. 7,041,635, column 2, line 1 to column 3, line 19, column 3, line 40 to column 4, line 67, column 7, line 43 to column 8, line 26, and column 11, line 5 to column 13, line 39; or U.S. Pat. No. 6,458,563, column 4, lines 25-53. In some embodiments, the B-domain-deleted Factor VIII lacks most of the B domain, but still contains the amino-terminal sequence of the B domain necessary for proteolytic processing of the primary translation product into two polypeptide chains in vivo, as disclosed in WO 91 / 09122, which is incorporated herein by reference in its entirety. In some embodiments, a B-domain-deleted Factor VIII is constructed that lacks amino acids 747-1638, i.e., substantially completely lacks the B domain. Hoeben RC et al. J. Biol. Chem. 265(13):7318-7323 (1990), which is incorporated herein by reference in its entirety. The B domain deleted factor VIII may also contain a deletion of amino acids 771-1666 or amino acids 868-1562 of factor VIII. Meulien P. et al. Protein Eng. 2(4):301-6 (1988), which is incorporated herein by reference in its entirety. Other B domain deletions that are part of the present invention include: deletion of amino acids 982 to 1562 or 760 to 1639 (Toole et al., Proc. Natl. Acad. Sci. USA (1986) 83, 5939-5942)), 797 to 1562 (Eaton et al., Biochemistry (1986) 25:8343-8347)), 741 to 1646 (Kaufman (PCT Published Application No. WO 87 / 04187)), 747-1560 (Sarver et al., DNA (1987) 6:553-564), 741 to 1648 (Pasek (PCT Application No. 88 / 00831)), or 816 to 1598 or 741 to 1648 (Lagner (Behring Inst. Mitt. (1988) 82:16-25; EP 537654)). 295597)), each of which is incorporated herein by reference in its entirety. Each of the foregoing deletions may be made in any Factor VIII sequence utilized in embodiments of the present invention.

[0200] The proteins involved in coagulation include Factor I, Factor II, Factor III, Factor IV, Factor V, Factor VI, Factor VII, Factor VIII, Factor IX, Factor X, Factor XI, Factor XII, Factor XIII, Protein C, and Tissue Factor (collectively or individually "coagulation proteins"). The interactions of the major coagulation proteins in the intrinsic and extrinsic coagulation pathways are shown in Figure 2 In. Most coagulation proteins exist in zymogen form, but exhibit procoagulant protease activity when activated, wherein they activate another coagulation protein, thereby contributing to endogenous or exogenous coagulation path and clot formation. In the endogenous coagulation cascade pathway, FVIII associates with the complex of activated factor IX, factor X, calcium and phospholipid. Factor VIII heterodimers do not have enzymatic activity, but after proteolytic activation by thrombin or factor Xa, heterodimers become active as cofactors of enzyme factor IXa, wherein the activity of factor VIIIa is characterized in that it can form factors IXa and X in a membrane binding site suitable for the conformation of factor X activated by factor IXa. After being cleaved by thrombin, activated FVIII (FVIIIa) dissociates from von Willebrand factor and combines negatively charged phospholipids PL, and the resulting complex participates in factor X activation (factor X enzyme (tenase)) complex as the cofactor of factor IXa. Within the C2 domain and within amino acid residues 1649 to 1689 in the A3 domain is a von Willebrand factor (vWF) binding site that is used to complex with von Willebrand factor, and the resulting circulating complex protects FVIII from rapid degradation in the blood (Weiss HJ et al. Stabilization of factor VIII in plasma by the von Willebrand factor. Studies on posttransfusion and dissociated factorVIII and in patients with von Willebrand's disease. J Clin Invest (1977) 60: 390).

[0201] Activated factor VIII is a heterotrimer comprising the A1 domain and the A2 domain and a light chain comprising the domains A3-C1-C2. The activation of factor IX is achieved by removing the activation peptide (Ala 146-Arg 180) from the molecule in two steps (Bajaj et al., Human factor IX and factor IXa, METHODS IN ENZYMOLOGY.1993). The first cleavage is performed by factor XIa or factor VIIa / tissue factor at the Arg 145-Ala 146 site. The second and rate-limiting cleavage is performed at Arg180-Val181. Activation removes 35 residues. Activated human factor IX exists as a heterodimer of the C-terminal heavy chain (28 kDa) and the N-terminal light chain (18 kDa) held together by a disulfide bridge that connects the enzyme to the Gla domain. Factor IXa and activated factor VIII work together to activate factor X. Alternatively, factors IX and X can both be activated by factor VIIa produced by the extrinsic pathway in complex with lipidated tissue factor. Factor Xa then participates in the final common pathway by which prothrombin is converted to thrombin, and thrombin in turn converts fibrinogen to fibrin to form a clot.

[0202] Defects in the coagulation process can lead to bleeding disorders (coagulopathy) in which the time spent on clot formation is prolonged. The defect can be congenital or acquired. For example, hemophilia A and hemophilia B are hereditary diseases characterized by lack of FVIII and FIX, respectively. In other words, bioactive factor VIII corrects the coagulation defects in the plasma of individuals suffering from hemophilia A. Recombinant FVIII has been shown to be effective and approved for the treatment of hemophilia A in adult patients and pediatric patients, and is also used to prevent bleeding episodes or prevent bleeding associated with trauma and / or surgery. The current therapeutic use of factor VIII may have problems in treating individuals who exhibit factor VIII deficiency and those individuals suffering from von Willebrand's disease. In addition, individuals who receive factor VIII with supplementary therapy often produce antibodies against these proteins that often reduce or eliminate the procoagulant activity of the combined FVIII. Due to the presence of these antibodies that reduce or eliminate the therapeutic efficacy, continuous treatment is extremely difficult.

[0203] On the one hand, the present invention encompasses FVIII sequences consistent with human FVIII, sequences with homology to the FVIII sequences, native sequences (such as from humans, non-human primates, mammals (including domestic animals)), or truncated forms of FVIII in CFXTEN fusion protein compositions; all of which retain at least a portion of the procoagulant activity of native FVIII and are suitable for preventing, treating, mediating or improving hemophilia A or bleeding events associated with trauma, surgery or lack of coagulation factor VIII. Sequences with homology to FVIII can be obtained by standard homology search techniques (such as NCBI BLAST) or in public databases, such as Chemical Abstracts Services Database (CAS registration), GenBank, Universal Protein Resource (UniProt) and subscription-provided databases, such as GenSeq (such as Derwent).

[0204] In one embodiment, the FVIII incorporated into the subject CFXTEN compositions is a recombinant polypeptide whose sequence corresponds to the FVIII protein found in nature. In another embodiment, FVIII is a non-natural FVIII sequence variant, fragment, homologue or analogue of at least a portion of the procoagulant activity of the corresponding natural FVIII of the native sequence retention. In another embodiment, FVIII is a truncated variant ("FVIII BDD") of all or a portion of the B domain deletion, which can be in a heterodimeric form or can remain as a single chain ("scFVIII"), which is described in Meulien et al., Protein Eng. (1988) 2 (4): 301-306. Non-limiting examples of FVIII BDDs are Factor VIII sequences with amino acids deleted between residue number 741 and residue number 1640 (numbered relative to native mature FVIII), or between residue number 745 and residue number 1640, or between residue number 745 and residue number 1640, or between residue number 741 and residue number 1690, or between residue number 745 and residue number 1667, or between residue number 745 and residue number 1657, or between residue number 747 and residue number 1642, or between residue number 751 and residue number 1667.

[0205] In another embodiment, a heterologous sequence is incorporated into the FVIII, which may include an XTEN as described more fully below. Table 1 provides a non-limiting list of the amino acid sequence of the FVIII encompassed by the CFXTEN fusion protein of the present invention. In some embodiments, the FVIII incorporated into the CFXTEN fusion protein comprises a protein having at least about 70% sequence identity, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity compared to an amino acid sequence with similar length selected from Table 1.

[0206] Table 1: FVIII amino acid sequence

[0207]

[0208]

[0209]

[0210]

[0211]

[0212]

[0213]

[0214]

[0215]

[0216]

[0217]

[0218] The present invention also encompasses the CFXTEN comprising the FVIII of the retention procoagulant activity of various amino acid deletions, insertions and substitutions carried out in the FVIII sequence of Table 1. The example of the conservative substitution of amino acids in the polypeptide sequence is shown in Table 2. In the embodiment of the CFXTEN with a sequence identity of FVIII less than 100% compared to the specific sequence disclosed herein, the present invention encompasses the substitution of any of other 19 kinds of natural L-amino acids for a given FVIII, including adjacent amino acid residues, at any position in the FVIII sequence. If any substitution causes an undesirable change in procoagulant activity, then a kind of alternative amino acid can be adopted and by the method described herein (e.g., the determination of Table 49), or using any technique and guidelines for conservative and non-conservative mutations set forth in, for example, U.S. Patent number 5,364,934 (its contents are incorporated herein by reference in their entirety); or using methods generally known in the art to assess construct proteins. In a preferred replacement, the FVIII component of the CFXTEN embodiment is to modify to prevent the proteolytic processing of heterodimer form by replacing the R1648 residue (numbering relative to the FVIII of natural mature form) with glycine or alanine. In another replacement, the FVIII component of the CFXTEN embodiment is to modify by replacing the Y1680 residue (numbering relative to the FVIII of natural mature form) with phenylalanine. In another embodiment, the FVIII component of the CFXTEN embodiment is to modify by replacing the Y1680 residue (numbering relative to the FVIII of natural mature form) with phenylalanine and replacing the R1648 residue (numbering relative to the FVIII of natural mature form) with glycine or alanine.

[0219] In one embodiment, the FVIII of the fusion protein composition has one or more amino acid substitutions designed to reduce the binding of FVIII inhibitors at an epitope recognized by the antibodies of Table 9, including but not limited to substitutions at: Lys (377), Lys (466), Lys (380), Ser (488), Arg (489), Arg (490), Leu (491), Lys (493), Lys (496), His (497), Lys (499), Lys (512), Lys (523), Lys (556), Met (2199), Phe (2200), Leu (2252), Val (2223), and Lys (2227). In addition, variants may include, for example, polypeptides in which one or more amino acid residues are added or deleted at the N-terminus or C-terminus of or near the full-length native amino acid sequence or domain of FVIII, as long as the variant retains some (if not all) of the procoagulant activity of the native peptide. The resulting FVIII sequence that retains at least a portion (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or at least 95% or more) of the procoagulant activity compared to native circulating FVIII is considered suitable for use in the fusion protein compositions of the present invention. Examples of FVIII variants are known in the art, including those described in U.S. Patents and Application Nos. 6,316,226; 6,818,439; 7,632,921; 20080227691, which are incorporated herein by reference. In one embodiment, the FVIII sequence variant has an aspartic acid substituted for valine at amino acid position 75 (numbered relative to the native mature form of FVIII).

[0220] Table 2: Exemplary conservative amino acid substitutions

[0221] Original residue Exemplary substitutions Ala(A) val;leu;ile Arg(R) lys;gln;asn Asn(N) gin;his;lys;arg Asp(D) Glu Cys(C) Ser Gln(Q) Asn Glu(E) Asp Gly(G) Pro His(H) asn:gin:lys:arg Ile(I) leu; val; met; ala; phe: norleucine Leu(L) Norleucine:ile:val;met;ala:phe Lys(K) arg:gin:asn Met(M) leu; phe; ile Phe(F) leu:val:ile;ala Pro(P) Gly Ser(S) Thr Thr(T) Ser Trp(W) Tyr Tyr(,Y,) Trp:phe:thr:ser Val(V) Ile; leu; met; phe; ala; norleucine

[0222] III). Extending the recombinant polypeptide

[0223] On the one hand, the present invention provides applicable effects to be connected to FVIII polypeptide and / or be incorporated into FVIII polypeptide, thereby produce the XTEN polypeptide composition of the fusion protein partner (partner) of CFXTEN fusion rotein.XTEN is normally the polypeptide of non-naturally occurring substantially non-repetitive sequence, and the sequence has low degree or does not have secondary or tertiary structure under physiological conditions.XTEN usually has about 36 to about 3000 amino acids, wherein most or all are small hydrophilic amino acids.As used herein, "XTEN" clearly excludes complete antibodies or antibody fragments (such as single-chain antibodies and Fc fragments).XTEN polypeptides have the effectiveness as fusion protein partner, because they play various effects when being connected to FVIII albumen to produce CFXTEN fusion rotein, thereby give some desirable pharmacokinetics, physicochemistry, pharmacology and pharmaceutical properties.Described CFXTEN fusion protein composition has the property of enhancing compared to the corresponding FVIII that is not connected to XTEN, thereby makes them applicable to treat certain symptom relevant to FVIII deficiency or hemorrhagic disease as described more fully below.

[0224] The selection criteria for XTEN to be fused to the FVIII protein for producing the fusion protein composition of the present invention generally involve the attributes and conformational structures of the physical / chemical properties of XTEN, which in turn are used to confer enhanced pharmaceutical, pharmacological and pharmacokinetic properties to the FVIII fusion protein composition. The unstructured characteristics and physical / chemical properties of XTEN are partly due to the overall amino acid composition that is disproportionately limited to 4-6 hydrophilic amino acids, the connection of amino acids in a quantitative non-repetitive design, and the length of the XTEN polypeptide. In an advantageous feature shared by XTEN but not shared by polypeptides, the properties of XTEN disclosed herein do not depend on the absolute primary amino acid sequence, as demonstrated by the diversity of the exemplary sequences of Table 4, with similar properties in different length ranges, many of which are recorded in the Examples. The XTEN of the present invention can exhibit one or more or all of the following advantageous properties: unstructured conformation, conformational flexibility, enhanced water solubility, high protease resistance, low immunogenicity, lower binding to mammalian receptors, determined charge and increased hydrodynamic (or Stokes) radius; properties that can make them particularly suitable as fusion protein partners. Compared to the FVIII that is not connected to XTEN, the limiting examples of the enhanced properties of the fusion protein that XTEN gives the FVIII that comprises fusion to XTEN include that overall solubility and / or metabolic stability increase, the sensitivity to proteolysis is reduced, immunogenicity is reduced, absorption rate is reduced when subcutaneous or intramuscular administration, the combination of FVIII removal receptor is reduced, the reactivity with anti-payload antibody is reduced, the interaction with substrate is enhanced, and / or pharmacokinetic properties are enhanced when being used to a subject.Compared to the FVIII that is not connected to XTEN, the enhanced pharmacokinetic properties of CFXTEN compositions include that terminal half-life is longer (for example, 2 times, 3 times, 4 times or longer), area under the curve (AUC) increases (for example, 25%, 50%, 100% or larger), distribution volume is lower and absorption is enhanced after subcutaneous or intramuscular injection (this is an advantage compared to the commercially available FVIII form that must be administered intravenously). In addition, it is believed that the CFXTEN compositions comprising cleavage sequences (described more fully below) allow sustained release of bioactive FVIII, so that the CFXTEN used serves as a depot. Clearly encompassed is that the CFXTEN fusion protein of the present invention can show one or more or any combination of improved properties disclosed herein. Because these properties enhance, it is believed that when using under similar dosage, the CFXTEN compositions allow less frequent administration compared to the FVIII not being connected to XTEN. The CFXTEN fusion protein compositions have the effectiveness of treating some Factor VIII related symptom as described herein.

[0225] The multiple methods and the determination of the physical / chemical properties of proteins of the CFXTEN compositions known in the art as comprising XTEN. Said properties include but are not limited to secondary or tertiary structure, solubility, protein aggregation, stability, absolute and apparent molecular weight, purity and homogeneity, melting properties, pollution and water content. The method for measuring these properties comprises analytical centrifugation, EPR, HPLC-ion exchange, HPLC-size exclusion, reversed-phase HPLC, light scattering, capillary electrophoresis, circular dichroism, differential scanning calorimetry, fluorescence, HPLC-ion exchange, HPLC-size exclusion, IR, NMR, Raman (Raman) spectroscopy, refractometry and UV / visible spectroscopy. Other methods are disclosed in Arnau etc., Prot Expr and Purif (2006) 48, among 1-13.

[0226] The XTEN components of CFXTEN are designed to act as denatured peptide sequences under physiological conditions, regardless of the extended length of the polymer. "Denaturation" describes a state in which the conformational freedom of the peptide backbone is large in a peptide in solution. Most peptides and proteins adopt a denatured conformation in the presence of a high concentration of a denaturant or at high temperatures. Peptides in a denatured conformation have, for example, characteristic circular dichroism (CD) spectra and are characterized by a lack of long-range interactions, as determined by NMR. "Denatured conformation" and "unstructured conformation" are used synonymously herein. In some embodiments, the invention provides an XTEN sequence that mainly lacks a secondary structure under physiological conditions. In other cases, the XTEN sequence generally lacks a secondary structure under physiological conditions so that the XTEN can adopt a random coil conformation. "Mainly lacking" as used in this context refers to that at least 50% of the XTEN amino acid residues of the XTEN sequence do not contribute to a secondary structure, as measured or determined by means described herein. "Substantially lacking," as used in this context, means that at least about 60%, or about 70%, or about 80%, or about 90%, or about 95%, or at least about 99% of the XTEN amino acid residues of the XTEN sequence do not contribute to secondary structure as measured or determined by the methods described herein.

[0227] A variety of methods have been established in the art to discern the presence or absence of secondary and tertiary structure in a given polypeptide. Specifically, secondary structure can be measured spectrophotometrically, for example, by circular dichroism spectroscopy in the "far ultraviolet" spectral region (190-250 nm). Secondary structural elements such as alpha helices and beta sheets each produce a characteristic shape and amplitude of the CD spectrum, as does the absence of these structural elements. The secondary structure of a polypeptide sequence can also be predicted by certain computer programs or algorithms, such as the well-known Chou-Fasman algorithm (Chou, PY et al. (1974) Biochemistry, 13: 222-45) and Gamier-Osguthorpe-Robson ("GOR") algorithm (Garnier J, Gibrat JF, Robson B. (1996), GOR method for predicting protein secondary structure from amino acid sequence. Methods Enzymol 266: 540-553), as described in U.S. Patent Application Publication No. 20030228309A1. For a given sequence, the algorithm can predict whether there is some or no secondary structure, expressed as the total number of residues and / or the percentage of residues in the sequence that form, for example, alpha helices or beta sheets, or the percentage of residues in the sequence that are predicted to result in the formation of random coils (which lack secondary structure).

[0228] In one embodiment, the alpha helix percentage of the XTEN sequence used in the subject fusion protein composition is in the range of 0% to less than about 5%, as determined by the Chou-Fasman algorithm. In another embodiment, the beta fold percentage of the XTEN sequence of the fusion protein composition is in the range of 0% to less than about 5%, as determined by the Chou-Fasman algorithm. In some embodiments, the alpha helix percentage of the XTEN sequence of the fusion protein composition is in the range of 0% to less than about 5% and the beta fold percentage is in the range of 0% to less than about 5%, as determined by the Chou-Fasman algorithm. In some embodiments, the alpha helix percentage of the XTEN sequence of the fusion protein composition is less than about 2% and the beta fold percentage is less than about 2%. The XTEN sequence of the fusion protein composition has a high random coil percentage, as determined by the GOR algorithm. In some embodiments, the XTEN sequence has at least about 80%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, and most preferably at least about 99% random coil, as determined by the GOR algorithm. In some embodiments, the XTEN sequence of the fusion protein composition has an alpha helix percentage in the range of 0% to less than about 5% and a beta fold percentage in the range of 0% to less than about 5%, as determined by the Chou-Fasman algorithm; and has at least about 90% random coil, as determined by the GOR algorithm. In other embodiments, the XTEN sequence of the fusion protein composition has an alpha helix percentage of less than about 2% and a beta fold percentage of less than about 2%, at least about 90% random coil, as determined by the GOR algorithm.

[0229] 1. Non-repetitive sequences

[0230] The XTEN sequence of the intention CFXTEN embodiment is roughly non-repetitive.In general, the repetitive amino acid sequence has the tendency of gathering or forming higher structure, as illustrated by natural repetitive sequence (such as collagen and leucine zipper).These repetitive amino acids also can tend to form contacts, thereby produce crystallization or pseudo-crystalline structure.On the contrary, the gathering tendency of non-repetitive sequence is lower and makes it possible to design the relatively low long sequence XTEN of the frequency of charged amino acids, if sequence is repetitive, so described long sequence XTEN will possibly gather in addition.The non-repetitiveness of theme XTEN can be observed by assessing one or more following characteristics. In one embodiment, a "substantially non-repetitive" XTEN sequence has about 36, or at least 72, or at least 96, or at least 144, or at least 288, or at least 400, or at least 500, or at least 600, or at least 700, or at least 800, or at least 864, or at least 900, or at least 1000, or at least 2000 to about 3000 or more amino acid residues, or has a length ranging from about 36 to about 3000, about 100 to about 500, about 500 to about 1000, about 1000 to about 3000 amino acids and residues, wherein no three consecutive amino acids in the sequence are the same amino acid type, unless the amino acid is serine, in which case no more than three consecutive amino acids are serine residues. In another embodiment, as described more fully below, a "substantially non-repetitive" XTEN sequence comprises a motif of 9 to 14 amino acid residues, wherein the motif consists of 4 to 6 types of amino acids selected from glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), and proline (P), and wherein the sequence of any two consecutive amino acid residues in any motif is not repeated more than twice in the sequence motif.

[0231] The degree of repetition of a polypeptide or gene can be measured by a computer program or algorithm or by other means known in the art. According to the present invention, an algorithm for calculating the degree of repetition of a particular polypeptide such as XTEN is disclosed herein, and examples of sequences analyzed by the algorithm are provided (see the following examples). On the one hand, the repetitiveness of a polypeptide of a predetermined length can be calculated according to the formula given by Equation 1 (hereinafter referred to as "subsequence scoring"):

[0232] Subsequence Scoring

[0233] Where: m = (amino acid length of polypeptide) - (amino acid length of subsequence) + 1; and count i = cumulative number of occurrences of each unique subsequence in sequence i

[0234] An algorithm called "SegScore" was developed to quantify the repetitiveness of polypeptides such as XTEN using the aforementioned equation, thereby providing a subsequence score, wherein the repetitiveness of a sequence of a predetermined amino acid length "n" is analyzed by determining the number of times a unique subsequence of length "s" occurs in the set length (the "count"), divided by the absolute number of subsequences within the predetermined length of the sequence. Fig. 27 Describes the logical flow chart of the SegScore algorithm, and Fig.28 Schematic diagram depicting how to obtain a subsequence score for a hypothetical XTEN with 11 amino acids and a subsequence length of 3 amino acid residues. For example, a predetermined polypeptide length of 200 amino acid residues has 192 overlapping 9 amino acid subsequences and 198 3-mer subsequences, but the subsequence score for any given polypeptide will depend on the absolute number of unique subsequences and the frequency with which each unique subsequence (referring to a different amino acid sequence) occurs in the predetermined length of the sequence.

[0235] In the context of the present invention, "subsequence score" refers to the sum of the number of occurrences of 200 continuous amino acids of each unique 3-mer frame across cumulative XTEN polypeptides divided by the absolute number of unique 3-mer subsequences in the sequence containing 200 amino acids. Examples of the subsequence scores obtained by 200 continuous amino acids of repeated and non-repeated polypeptides are presented in Example 45. In one embodiment, the invention provides a CFXTEN comprising an XTEN, wherein the subsequence score of the XTEN is less than 12, more preferably less than 10, more preferably less than 9, more preferably less than 8, more preferably less than 7, more preferably less than 6 and most preferably less than 5. In another embodiment, the invention provides a CFXTEN comprising at least two to about six XTEN, wherein the subsequence score of 200 amino acids of XTEN is less than 10, more preferably less than 9, more preferably less than 8, more preferably less than 7, more preferably less than 6 and most preferably less than 5. In the embodiment of the CFXTEN fusion protein compositions as herein described, the XTEN components with a subsequence score of 10 or lower (i.e., 9, 8, 7, etc.) of the fusion protein are also generally non-repetitive.

[0236] It is believed that the non-repetitive characteristics of XTEN of the present invention together with the amino acid of the particular type that prevails in XTEN rather than absolute primary sequence give many enhanced physicochemical and biological properties of CFXTEN fusion rotein.The properties of these enhancements comprise that gained CFXTEN is compared to the fusion rotein that comprises the polypeptide with tumor-necrosis factor glycoproteins, and the genetic stability of the gene of the expression level of fusion rotein in host cell is higher, encoding XTEN is larger, solubility is larger, aggregation tendency is smaller and pharmacokinetics is enhanced.The properties of these enhancements allow more efficient manufacturing, reduce commodity cost, and contribute to the preparation of the pharmaceutical preparation that contains the extremely high protein concentration (surpassing 100mg / ml in some cases) that comprises XTEN.In addition, the XTEN peptide sequence of each embodiment is designed to have the internal repeatability of low degree to reduce or eliminate the immunogenicity when using to mammals roughly.When using to mammals, the peptide sequence that is mainly limited to only three amino acid (as glycine, serine and glutamic acid) short repeat motif composition can produce relatively high antibody titer, although in these sequences, there is no prediction t cell epitope. This may be caused by the repetitive nature of the polypeptide, as immunogens with repetitive epitopes (including protein aggregates, cross-linked immunogens and repetitive carbohydrates) have been shown to be highly immunogenic and can, for example, lead to cross-linking of B cell receptors, thereby leading to B cell activation. (Johansson, J. et al. (2007) Vaccine, 25: 1676-82; Yankai, Z. et al. (2006) Biochem Biophys Res Commun, 345: 1365-71; Hsu, CT et al. (2000) Cancer Res, 60: 3701-5); Bachmann MF et al. Eur J Immunol. (1995) 25 (12): 3445-3451).

[0237] 2. Exemplary sequence motifs

[0238] The present invention encompasses XTEN that comprises a plurality of shorter sequence units or motifs used as fusion partners, wherein the amino acid sequence of the motif is non-repetitive. Although the library utilizing the multimerization sequence motif is used to carry out the "building block" method to produce the XTEN sequence, the non-repetitive property is satisfied. Therefore, although the XTEN sequence can be made up of a plurality of units as few as four different types of sequence motifs, because the motif itself is usually made up of non-repetitive amino acid sequence, the overall XTEN sequence is designed to cause the sequence to be non-repetitive roughly.

[0239] In one embodiment, the XTEN has a substantially non-repetitive sequence containing greater than about 36 to about 3000, or about 100 to about 2000, or about 144 to about 1000 amino acid residues, or even longer, wherein at least about 80%, or at least about 85%, or at least about 90%, or at least about 95%, or at least about 97%, or about 100% of the XTEN sequence consists of non-overlapping sequence motifs, and wherein each of the motifs has about 9 to 36 amino acid residues. In other embodiments, at least about 80%, or at least about 85%, or at least about 90%, or at least about 95%, or at least about 97%, or about 100% of the XTEN sequence consists of non-overlapping sequence motifs, wherein each of the motifs has 9 to 14 amino acid residues. In other embodiments, at least about 80% or at least about 85% or at least about 90% or at least about 95% or at least about 97% or about 100% of the XTEN sequence is composed of non-overlapping sequence motifs, wherein the motifs have 12 amino acid residues respectively. In these embodiments, it is preferred that the sequence motifs are composed of roughly (for example, 90% or more than 90%) or only small hydrophilic amino acids so that the overall sequence has unstructured flexibility characteristics. The amino acid whose example included in the XTEN is for example arginine, lysine, threonine, alanine, asparagine, glutamine, aspartic acid, glutamic acid, serine and glycine. Due to testing variables such as codon optimization, assembly of polynucleotide coding sequence motifs, expression of proteins, charge distribution and solubility of expressed proteins, and secondary and tertiary structure, it was found that the XTEN compositions with enhanced characteristics disclosed herein include mainly or only glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), and proline (P) residues, wherein the sequence is designed to be substantially non-repetitive. In one embodiment, the XTEN sequence has mainly four to six types of amino acids selected from glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), or proline (P), and the amino acids are arranged in a substantially non-repetitive sequence of greater than about 36 to about 3000, or about 100 to about 2000, or about 144 to about 1000 amino acid residues in length. In some embodiments, the XTEN sequence is composed of 4, 5, or 6 types of amino acids selected from the group consisting of glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), or proline (P).In some embodiments, the XTEN has a sequence of greater than about 36 to about 1000, or about 100 to about 2000, or about 400 to about 3000 amino acid residues, wherein at least about 80% of the sequence consists of non-overlapping sequence motifs, wherein each of the motifs has 9 to 36 amino acid residues and wherein at least 90%, or at least 91%, or at least 92%, or at least 93%, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or 100% of each of the motifs consists of 4 to 6 types of amino acids selected from glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), and proline (P), and wherein the content of any one amino acid type in the full-length XTEN does not exceed 30%. In other embodiments, at least about 90% of the XTEN sequences consist of non-overlapping sequence motifs, wherein each of the motifs has 9 to 36 amino acid residues, wherein the motifs consist of 4 to 6 types of amino acids selected from glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), and proline (P), and wherein the content of any one amino acid type in the full-length XTEN does not exceed 40%, or about 30%, or 25%, or about 17%. In other embodiments, at least about 90% of the XTEN sequences consist of non-overlapping sequence motifs, wherein each of the motifs has 12 amino acid residues consisting of 4 to 6 types of amino acids selected from glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), and proline (P), and wherein the content of any one amino acid type in the full-length XTEN does not exceed 40%, or 30%, or about 25%. In other embodiments, at least about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% to about 100% of the XTEN sequence consists of non-overlapping sequence motifs, wherein each of the motifs has 12 amino acid residues consisting of glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), and proline (P).

[0240] In other embodiments, the XTEN comprises a substantially non-repetitive sequence of greater than about 36 to about 3000 amino acid residues, wherein at least about 80%, or at least about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% of the sequence consists of non-overlapping sequence motifs of 9 to 14 amino acid residues, wherein the motifs consist of 4 to 6 types of amino acids selected from glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), and proline (P), and wherein the sequence of any two consecutive amino acid residues in any one motif is not repeated more than twice in the sequence motif. In other embodiments, at least about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% of the XTEN sequence consists of non-overlapping sequence motifs of 12 amino acid residues, wherein the motifs consist of four to six types of amino acids selected from glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), and proline (P), and wherein the sequence of any two consecutive amino acid residues in any one sequence motif is not repeated more than twice in the sequence motif. In other embodiments, at least about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% of the XTEN sequence consists of non-overlapping sequence motifs of 12 amino acid residues, wherein the motifs consist of glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), and proline (P), and wherein the sequence of any two consecutive amino acid residues in any sequence motif is not repeated more than twice in the sequence motif. In other embodiments, the XTEN consists of sequence motifs of 12 amino acids, wherein the amino acids are selected from glycine (G), alanine (A), serine (S), threonine (T), glutamate (E), and proline (P), and wherein the sequence of any two consecutive amino acid residues in any sequence motif is not repeated more than twice in the sequence motif, and wherein the content of any amino acid type in the full-length XTEN does not exceed 30%. The foregoing embodiments are examples of substantially non-repetitive XTEN sequences. Other examples are described in detail below.

[0241] In some embodiments, the invention provides CFXTEN compositions comprising one, or two, or three, or four, five, six or more non-repetitive XTEN sequences having about 36 to about 1000 amino acid residues, or cumulatively having about 100 to about 3000 amino acid residues, wherein at least about 80%, or at least about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% to about 100% of the sequences consist of multiple units of non-overlapping sequence motifs of four or more amino acid sequences selected from Table 3, wherein the overall sequence remains substantially non-repetitive. In some embodiments, the XTEN comprises non-overlapping sequence motifs, wherein about 80%, or at least about 85%, or at least about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99%, or about 100% of the sequences consist of multiple units of non-overlapping sequences selected from a single motif family (thereby generating a family sequence) selected from Table 3. As used herein, "family" means that the XTEN has a motif selected from only a single motif species from Table 3 (i.e., AD, AE, AF, AG, AM, AQ, BC, or BD XTEN), and any other amino acids in the XTEN that are not from the family motif are selected to achieve a desired property, such as allowing incorporation of restriction sites by the encoding nucleotides, incorporation of cleavage sequences, or achieving better linkage with the FVIII coagulation factor component of the CFXTEN. In some embodiments of the XTEN family, the XTEN sequence comprises multiple units of non-overlapping sequence motifs of the AD motif family or the AE motif family or the AF motif family or the AG motif family or the AM motif family or the AQ motif family or the BC family or the BD family, so that the resulting XTEN exhibits the above-mentioned homology range. In other embodiments, the XTEN comprises multiple units of motif sequences from two or more motif families of Table 3. These sequences can be selected to realize the desired physical / chemical characteristics conferred by the amino acid composition of the motif described more fully below, including properties such as net charge, hydrophilicity, lack of secondary structure or lack of repeatability. In the embodiments described above in this paragraph, the motifs incorporated into the XTEN can be selected and assembled using the methods described herein to obtain the XTEN of about 36 to about 3000 amino acid residues.

[0242] Table 3: XTEN sequence motifs and motif families with 12 amino acids

[0243]

[0244]

[0245] *Indicates individual motif sequences that when used together in various permutations produce a "family sequence"

[0246] In some embodiments of the XTEN family, the XTEN sequence comprises a plurality of units of the non-overlapping sequence motifs of AD motif family, AE motif family or AF motif family or AG motif family or AM motif family or AQ motif family or BC family or BD family, thereby the gained XTEN shows the above-mentioned homology scope.In other embodiments, XTEN comprises a plurality of units of the motif sequence from two or more motif families of table 3 that are selected to realize the required physicochemical characteristics that can be given by the amino acid composition of the motif described more fully below, and the feature comprises the property such as net charge, lacks secondary structure or lacks repeatability.In the embodiment described in this paragraph above, the motif or each part of the motif that can be incorporated in the XTEN with method described herein can be selected and assembled to obtain about 36, about 42, about 72, about 144, about 288, about 576, about 864, about 1000, about 2000 to about 3000 amino acid residues or any intermediate length XTEN.The limiting examples that are applicable to the XTEN family sequence that is incorporated in the theme CFXTEN are presented in Table 4. It is intended that a specified sequence mentioned in Table 4 has that sequence set forth in Table 4, while a general reference to, for example, the AE144 sequence is intended to cover any AE sequence having 144 amino acid residues; for example, AE144_1A, AE144_2A, etc., or a general reference to, for example, the AG144 sequence is intended to cover any AG sequence having 144 amino acid residues, for example, AG144_1, AG144_2, AG144_A, AG144_B, AG144_C, etc.

[0247] Table 4: XTEN polypeptides

[0248]

[0249]

[0250]

[0251]

[0252]

[0253]

[0254]

[0255]

[0256]

[0257]

[0258]

[0259]

[0260]

[0261]

[0262]

[0263]

[0264]

[0265]

[0266]

[0267] In other embodiments, the CFXTEN composition comprises one or more non-repetitive XTEN sequences ranging in length from about 36 to about 3000 amino acid residues, wherein at least about 80%, or at least about 90%, or about 91%, or about 92%, or about 93%, or about 94%, or about 95%, or about 96%, or about 97%, or about 98%, or about 99% to about 100% of the sequence consists of non-overlapping 36 amino acid sequence motifs selected from one or more polypeptide sequences of Tables 13-17, in the form of family sequences, or wherein the motifs are selected from two or more motif families.

[0268] In those embodiments where less than 100% of the amino acids of the XTEN component of the CFXTEN fusion protein consist of 4, 5 or 6 types of amino acids selected from glycine (G), alanine (A), serine (S), threonine (T), glutamate (E) and proline (P), or less than 100% of the sequence consists of sequence motifs from Table 3 or the XTEN sequences of Tables 4 and 13-17, the other amino acid residues of the XTEN are selected from any of the other 14 natural L-amino acids, but are preferably selected from hydrophilic amino acids so that the XTEN sequence contains at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about 99% hydrophilic amino acids. The XTEN amino acid that is not glycine (G), alanine (A), serine (S), threonine (T), glutamate (E) and proline (P) is dispersed in the whole XTEN sequence, is located in or between the sequence motif, or concentrates in one or more short segments of the XTEN sequence, for example to produce a joint between the XTEN component and the FVIII component. In the case where the XTEN component of CFXTEN comprises amino acids other than glycine (G), alanine (A), serine (S), threonine (T), glutamate (E) and proline (P), it is preferred that less than about 2% or less than about 1% amino acid is a hydrophobic residue so that the resulting sequence generally lacks a secondary structure, for example, does not have more than 2% alpha spiral or 2% beta folding, as determined by the method disclosed herein. The less hydrophobic residues that are advantageous when constructing XTEN include tryptophan, phenylalanine, tyrosine, leucine, isoleucine, valine and methionine. In addition, the XTEN sequence can be designed to contain less than 5% or less than 4% or less than 3% or less than 2% or less than 1% or do not contain the following amino acid: cysteine ​​(to avoid forming disulfide and oxidation), methionine (to avoid oxidation), asparagine and glutamine (to avoid deamidation). Therefore, in some embodiments, the XTEN components that also comprise other amino acids except glycine (G), alanine (A), serine (S), threonine (T), glutamic acid (E) and proline (P) of the CFXTEN fusion rotein have the residue that contributes to alpha spiral and beta folding less than 5% sequence (as measured by Chou-Fasman algorithm) and have at least 90%, or at least about 95% or more than 95% random coil formation rate (as measured by GOR algorithm).

[0269] 3. The length of the sequence

[0270] On the other hand, the present invention provides the XTEN with different lengths for incorporating into the CFXTEN compsn, wherein based on the property to be realized in the fusion rotein or the length of the function selection XTEN sequence.Determine according to predetermined property or function, the CFXTEN compsn comprises the short length or medium length XTEN that is positioned at FVIII sequence interior or between the FVIII structural domain and / or is positioned at the longer XTEN sequence that can serve as carrier in the fusion rotein as described herein.Although not intended to have restrictiveness, the fragment of XTEN or XTEN comprises the short segment with approximately 6 to approximately 99 amino acid residues, the medium length of approximately 100 to approximately 399 amino acid residues and approximately 400 to approximately 1000 and up to the longer length of approximately 3000 amino acid residues. Thus, the XTEN for incorporation into the subject CFXTEN encompasses XTEN or fragments of XTEN that are about 6, or about 12, or about 36, or about 40, or about 42, or about 72, or about 96, or about 144, or about 288, or about 400, or about 500, or about 576, or about 600, or about 700, or about 800, or about 864, or about 900, or about 1000, or about 1500, or about 2000, or about 2500, or up to about 3000 amino acid residues in length. In some embodiments, the XTEN of the present invention can be used for the preparation of the XTEN of the present invention.Perhaps, the length of the XTEN sequence can be about 6 to about 50, about 50 to about 100, about 100 to 150, about 150 to 250, about 250 to 400, about 400 to about 500, about 500 to about 900, about 900 to 1500, about 1500 to 2000 or about 2000 to about 3000 amino acid residues.The accurate length of the XTEN that is incorporated into the theme CFXTEN can change and not adversely affect the activity of the CFXTEN compsn.In one embodiment, the length of one or more XTEN in the CFXTEN disclosed herein is 36 amino acid, 42 amino acid, 144 amino acid, 288 amino acid, 576 amino acid or 864 amino acid and can be selected from an XTEN family sequence; i.e. AD, AE, AF, AG, AM, AQ, BC or BD. In another embodiment, the length of two or more XTEN used in the CFXTEN disclosed herein is 36 amino acids, 42 amino acids, 144 amino acids, 288 amino acids, 576 amino acids or 864 amino acids and can be selected from two XTEN family sequences; i.e. AD, AE, AF, AG, AM, AQ, BC or BD, wherein the combination of AE and AG family sequences is preferred. In some embodiments, the CFXTEN comprising one or more XTEN used herein contains an XTEN selected from any sequence in Table 4, which can be directly or connected to the FVIII component by a spacer sequence disclosed herein.

[0271] In a specific CFXTEN configuration design where the XTEN acts as a flexible linker, or is inserted into an external loop or disordered region of the FVIII sequence to increase the volume, flexibility, or hydrophilicity of the region, or is designed to interfere with the clearance receptors of FVIII to enhance pharmacokinetic properties, or interferes with the binding of FVIII inhibitors or other anti-FVIII antibodies, or where short or medium length XTEN is used to promote tissue penetration or alter the intensity of the interaction of the CFXTEN fusion protein with its target, or where it is desirable to distribute the cumulative length of the XTEN in segments of short or medium length at multiple positions within the FVIII sequence, the invention encompasses CFXTEN compositions in which one, two, three, four, five or more short or medium XTEN sequences are inserted between or within one or more FVIII domains or within external loops, or at other sites in the FVIII sequence, such as, but not limited to, in or adjacent to Tables 5, 6, 7, 8, and 9 identified or as Figure 8-9 In the position of the insertion site of explanation.In a foregoing embodiment, the CFXTEN fusion rotein contains a plurality of XTEN segments, for example at least two or at least three or at least four or at least five or more XTEN segments, wherein the XTEN segments can be identical or they can be different and wherein when being measured by a kind of mensuration disclosed herein, CFXTEN retains at least 10%, 20%, 30%, 40%, 50%, 60%, 70% or more procoagulant activity of natural FVIII.XTEN serves as carrier to increase the volume of fusion rotein therein, or changes the interactional intensity of CFXTEN fusion rotein and its target, or strengthens in other specific CFXTEN configuration designs of the pharmacokinetic properties of fusion rotein, the present invention encompasses one or more medium length or longer length XTEN sequences to be inserted in the C-terminal, B domain (or the residue of BDD sequence), between one or more FVIII domains or in, in the outer ring or in the FVIII sequence other sites of CFXTEN compositions, described other sites are such as but not limited to identification in table 5, table 6, table 7, table 8 and table 9 or as Figure 8-9 The insertion site of explanation in. However, it is believed that multiple short lengths to medium length XTEN are incorporated into the CFXTEN compositions to give the fusion protein the enhanced properties compared to the CFXTEN fusion protein with the same number of amino acids in fewer but longer length XTEN, but still produce compositions with procoagulant activity and prolonged half-life; Its basic principle is described in detail in this article about the acquisition radius of multiple XTEN.

[0272] In the embodiment that CFXTEN fusion rotein comprises a plurality of XTEN sequences therein, the cumulative length of total residues is greater than approximately 100 to approximately 3000 or approximately 200 to approximately 2000 or approximately 400 to approximately 1000 amino acid residues and XTEN can be identical or they can be different in sequence, net charge or length.In an embodiment of the CFXTEN that comprises a plurality of XTEN, when with the sequence optimal comparison with similar length, individual XTEN sequence shows at least about 80% sequence identity separately compared to the motif or XTEN or its fragment that are selected from table 3,4 and 13-17, perhaps 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity.

[0273] As described more fully below, disclose the following each method: wherein CFXTEN is designed to give the target half-life of CFXTEN fusion rotein, the maintenance of procoagulant activity, the combination reduction or physicochemical property (for example, stability or solubility) of FVIII inhibitor by selecting the length of XTEN and its incorporation site in CFXTEN; Produce and express coding construct; And separate and reclaim recombinant CFXTEN fusion rotein.In general, compared to shorter cumulative length, for example, be shorter than about 280 residues, cumulative length is longer than the XTEN of about 400 residues and is incorporated in the CFXTEN compositions and causes half-life longer.In one embodiment, contain and comprise and have long sequence length at least about 400 or at least about 600 or at least about 800 or at least about 900 or at least about 1000 or more amino acid whose at least single XTEN is as the CFXTEN fusion rotein design of carrier. In another embodiment, a plurality of XTEN are incorporated in the fusion rotein to realize cumulative length at least about 400 or at least about 600 or at least about 800 or at least about 900 or at least about 1000 or more amino acid, wherein XTEN can be identical or they can be different in sequence or length.As used herein, when being incorporated in the CFXTEN fusion rotein more than an XTEN, " cumulative length " is intended to contain the total length in terms of amino acid residue number.Two aforementioned embodiments are designed to give the terminal half-life of bioavailability and / or increase compared to the CFXTEN increase that comprises shorter cumulative XTEN length after using to the experimenter, but still produce procoagulant activity and hemostasis.When subcutaneous or intramuscular administration, compared to the CFXTEN with shorter cumulative length XTEN of similar dosage or the FVIII that is not connected to XTEN, C maxReduce but area under the curve (AUC) increases, thus helping to maintain the effective level of the CFXTEN compositions for a long period of time and allowing the period between administration to increase to 2,4,7,10,14 or 21 days, as more fully described below.Therefore, in addition to other physicochemical properties as described herein, XTEN gives storage tank properties to the CFXTEN used.

[0274] When XTEN is used as a carrier, the present invention utilizes the discovery that the length of increasing non-repetitive non-structured polypeptides can enhance the non-structured properties of XTEN and the corresponding enhancement of the fusion protein comprising the XTEN carrier's physical / chemical and pharmacokinetic properties.As described more fully in the embodiments, the length of XTEN is increased in proportion (even if produced by a single family sequence motif (e.g., four AE motifs of Table 3) of a repeating order) causes the sequence to have a higher random coil formation percentage (e.g., 90% or higher) (as determined by the GOR algorithm) or a reduction in the content of α spiral or β folding (e.g., less than 2%) (as determined by the Chou-Fasman algorithm) compared to a shorter XTEN length.In addition, as described in the embodiments, increasing the length of the non-structured polypeptide fusion partner causes the fusion protein to have a fusion protein with a shorter sequence length compared to the non-structured polypeptide partner, and the terminal half-life is disproportionately increased (e.g., up to 50,100,200 hours or more than 200 hours).The following more fully describes the pharmacokinetic properties of CFXTEN compared to the FVIII enhanced by not being connected to XTEN.

[0275] In another aspect, the invention provides methods for producing short or medium length XTEN from longer "donor" XTEN sequences, wherein the longer donor XTEN sequences are truncated at the N-terminus or C-terminus, or fragments are generated from the interior of the donor sequence, thereby resulting in short or medium length XTEN. In non-limiting examples, such as Fig.16A As schematically depicted in FIG. 8C , the AG sequence of 864 amino acid residues can be truncated to produce an AG sequence of 144 residues, an AG sequence of 288 residues, an AG sequence of 576 residues, or other intermediate lengths, while the AE sequence of 864 residues can be truncated (e.g. Fig.16D, E) to produce a plurality of 144 residues AE sequences, AE sequences with 288 or 576 residues or other shorter or medium lengths. Clearly encompassed is that the method can be used to produce an XTEN of desired length together with any XTEN embodiment described herein or with any sequence listed in Table 4 or 13-17. In a preferred embodiment, the CFXTEN comprising a plurality of XTEN has a clade selected from AE42_1, AE42_2, AE42_3, AG42_1, AG42_2, AG42_3, AG42_4, AE144_1A, AE144_2A, AE144_2B, AE144_3A, AE144_3B, AE144_4A, AE144_4B, AE144_5A, AE144_6B, AG144_1, AG144_2, AG144_3, AG42_4, The sequences of AG144_B, AG144_C, AG144_F, AG144_3, AG144_4, AE288_1, AE288_2, AG288_1, AG288_2, and AG288_DE exhibit at least about 80%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity.

[0276] 4. Net charge

[0277] In other embodiments, the unstructured features of XTEN polypeptides can be enhanced by incorporating amino acid residues with net charge and / or reducing the overall percentage (e.g., less than 5% or 4% or 3% or 2% or 1%) of hydrophobic amino acids in the XTEN sequence. Overall net charge and net charge density are controlled by modifying the content of positively charged or negatively charged amino acids in the XTEN sequence, wherein net charge is generally expressed as the percentage of amino acids that facilitate a charged state in the polypeptide except those residues offset by residues with opposite charges. In some embodiments, the net charge density of the XTEN of compositions can be higher than +0.1 or lower than -0.1 charge / residue. With regard to " net charge density " of this paper protein or peptide, it refers to net charge divided by the total number of amino acids in protein or peptide original. In other embodiments, the net charge of XTEN can be about 0%, about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10% about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, or about 20% or more. Based on the net charge, some XTEN have an isoelectric point (pI) 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0 or even 6.5. In a preferred embodiment, XTEN will have an isoelectric point between 1.5 and 4.5 and carry a net negative charge under physiological conditions.

[0278] Because most tissues and surfaces in humans or animals have a net negative charge, in some embodiments, the XTEN sequence is designed to have a net negative charge so that the non-specific interactions between the compositions containing XTEN and various surfaces such as blood vessels, healthy tissues or various receptors are minimized. Without being bound by a particular theory, due to the electrostatic repulsion between the individual amino acids that individually carry a net negative charge and span the sequence distribution of the XTEN polypeptide, XTEN can adopt an open conformation. In some embodiments, the XTEN sequence that designs at least 90% or 95% charged residues are separated by other residues such as serine, alanine, threonine, proline or glycine, this causes a more uniform distribution of charge, and expression or purification characteristics are better. The described distribution of the net negative charge in the XTEN of extended sequence length can produce an unstructured conformation, which can cause the hydrodynamic radius to effectively increase. In a preferred embodiment, the negative charge of theme XTEN is given by incorporating glutamic acid residues. Usually, glutamic acid residues span the XTEN sequence by uniform spacing. In some cases, every 20kDaXTEN in XTEN can contain about 10-80 or about 15-60 or about 20-50 glutamic acid residues, it can cause XTEN to have charged residues with very similar pKa, this can increase the charge homogeneity of product and make its isoelectric point sharp, strengthen the physicochemical properties of gained CFXTEN fusion rotein, and therefore simplify purification procedure.For example, when needing to have negatively charged XTEN, XTEN can only be selected from AE family sequence with about 17% net charge due to the glutamic acid incorporated into, or can comprise the glutamic acid motif containing of the table 3 of different proportions to provide required net charge degree.The non-limiting examples of AE XTEN include but are not limited to 36,42,144,288,576,624,864 and 912AE family sequences or its fragment of table 4 and 14.In one embodiment, the XTEN sequence of table 4 or 13-17 can be modified to comprise other glutamic acid residues to realize required net negative charge. Thus, in one embodiment, the invention provides XTEN wherein the XTEN sequence contains about 1%, 2%, 4%, 8%, 10%, 15%, 17%, 20%, 25%, or even about 30% glutamic acid. In one embodiment, in addition to glutamic acid, the invention also contemplates incorporating up to 5% aspartic acid residues into the XTEN to achieve a net negative charge.

[0279] In other embodiments where a net charge is not desired, the XTEN can be selected, for example, from AGXTEN components such as the AG motifs of Table 3 or those AM motifs of Table 3 that do not have a net charge. Non-limiting examples of AG XTEN include, but are not limited to, the 36, 42, 144, 288, 576, and 864 AG family sequences of Tables 4 and 16, or fragments thereof. In another embodiment, the XTEN can comprise different ratios of AE and AG motifs to have a net charge deemed optimal for a given use or to maintain a given physicochemical property.

[0280] Without being bound by a particular theory, it is expected that the XTEN with higher net charge of the CFXTEN compositions will have less nonspecific interactions with various negatively charged surfaces such as blood vessels, tissues or various receptors, and this will further contribute to the active removal reduction.On the contrary, it is believed that the XTEN with low net charge (or without net charge) of the CFXTEN compositions will have a higher degree of interaction with the surface, in view of the known effects of cell (for example, platelet) and vascular surface on coagulation process and thrombin activation intensity, this can strengthen the activity of related thrombin (Zhou, R. etc., Biomaterials (2005) 26 (16): 2965-2973; London, F. etc. Biochemistry (2000) 39 (32): 9850-9858).

[0281] The XTEN of the compositions of the present invention does not usually have positively charged amino acids or has low levels of positively charged amino acids. In some embodiments, XTEN may have less than about 10% amino acid residues with positive charge or less than about 7% or less than about 5% or less than about 2% or less than about 1% amino acid residues with positive charge. However, the present invention encompasses the construct of conjugating between the reactive groups on the epsilon amine and peptide of lysine, the joint bridge or the drug to be conjugated to the XTEN skeleton or small molecules and the like. In a previous embodiment, the XTEN of theme CFXTEN has about 1 to about 100 lysine residues or about 1 to about 70 lysine residues or about 1 to about 50 lysine residues or about 1 to about 30 lysine residues or about 1 to about 20 lysine residues or about 1 to about 10 lysine residues or about 1 to about 5 lysine residues or only single lysine residues. Using the aforementioned lysine-containing XTEN, fusion proteins comprising XTEN, FVIII coagulation factor plus chemotherapeutic agents useful for treating coagulopathy conditions or other coagulation factors or cofactors can be constructed, wherein the maximum number of molecules of the agent incorporated into the XTEN component is determined based on the number of lysines or other amino acids with reactive side chains (e.g., cysteine) incorporated into the XTEN.

[0282] Because hydrophobic amino acid gives structure to polypeptide, so the content of the hydrophobic amino acid in the regulation XTEN of the present invention will be usually less than 5% or less than 2% or less than 1% hydrophobic amino acid content.In one embodiment, the amino acid content of the methionine and tryptophan in the XTEN component of CFXTEN fusion rotein is usually less than 5% or less than 2% and most preferably less than 1%.In another embodiment, the XTEN of theme CFXTEN compsn will have following sequence, described sequence has less than 10% amino acid residue with positive charge or less than about 7% or less than about 5% or less than about 2% amino acid residue with positive charge, the summation of methionine and tryptophan residue will be less than 2%, and the summation of asparagine and glutamine residue will be less than 5% of total XTEN sequence.

[0283] 5. Low immunogenicity

[0284] On the other hand, the XTEN sequences provided herein have a low degree of immunogenicity or are roughly non-immunogenic. Several factors can contribute to the low immunogenicity of XTEN, such as non-repetitive sequences, unstructured conformation, high solubility, low degree of self-aggregation or lack of self-aggregation, low degree of proteolytic sites within the sequence or lack of proteolytic sites and low degree epitopes or lack of epitopes in the XTEN sequence.

[0285] Conformational epitopes are formed by regions on the surface of proteins that are mainly composed of multiple discontinuous amino acid sequences of protein antigens. The accurate folding of proteins causes these sequences to be in a clear stable spatial configuration or epitope that can be recognized as "foreign" by the host's humoral immune system, thereby leading to the production of antibodies or activated cell-mediated immune responses against proteins. In the latter case, the immune response to proteins in individuals is deeply affected by T cell epitope recognition that varies with the peptide binding specificity of the HLA-DR allotype of that individual. MHC class II peptide complexes can induce an activated state in T cells by engaging the homologous T cell receptor on the surface of T cells together with the cross-binding of certain other co-receptors such as CD4 molecules. Activation leads to cytokine release, thereby further activating other lymphocytes such as B cells to produce antibodies or activate T killer cells as a complete cellular immune response.

[0286] The ability of peptide binding to present on the surface of APC (antigen presenting cell) depends on many factors; Most significantly depends on its primary sequence. In one embodiment, the immunogenicity of a lower degree is achieved by designing the XTEN sequence of antigen processing in the resistance antigen presenting cell, and / or selecting the sequence that does not fully bind to the MHC receptor. The present invention provides the CFXTEN fusion protein with substantially non-repetitive XTEN polypeptide, and the XTEN polypeptide is designed to reduce the combination with the MHC II receptor, and avoids the epitope that forms T cell receptor or antibody combination, thereby produces the immunogenicity of a lower degree. The avoidance of immunogenicity can be attributed at least in part to the result of the conformational flexibility of the XTEN sequence, i.e., lacking secondary structure due to the selection and order of amino acid residues. For example, it is particularly interesting to adopt the lower sequence of the tendency of the compact folding conformation in aqueous solution or under the physiological conditions that can produce conformational epitopes. The fusion protein that uses the conventional treatment specification and administration to administer the XTEN will not usually result in the formation of neutralizing antibodies for the XTEN sequence, and also reduces the immunogenicity of the FVIII fusion partner in the CFXTEN compositions.

[0287] In one embodiment, the XTEN sequence utilized in the subject fusion protein may be substantially free of epitopes recognized by human T cells. It has been previously disclosed to eliminate the epitopes for the purpose of producing less immunogenic proteins; see, for example, WO98 / 52976, WO 02 / 079232, and WO 00 / 3317, which are incorporated herein by reference. Determination of human T cell epitopes has been described (Stickler, M. et al. (2003) J Immunol Methods, 281: 95-108). Of particular interest are peptide sequences that can be oligomerized without generating T cell epitopes or non-human sequences. This is achieved by testing the presence of T cell epitopes in these sequences repeated in the same direction and the presence of 6 to 15-mers that are not human sequences, and specifically 9-mer sequences, and then changing the design of the XTEN sequence to eliminate or destroy the epitope sequence. In some embodiments, the XTEN sequence is substantially non-immunogenic by limiting the number of epitopes of the XTEN that are predicted to bind to MHC receptors. As the number of epitopes capable of binding to the MHC receptor decreases, there is a concomitant decrease in T cell activation potential and T helper cell function, decreased B cell activation or upregulation, and decreased antibody production. The low degree of a predicted T cell epitope can be determined, for example, by an epitope prediction algorithm such as TEPITOPE (Sturniolo, T. et al. (1999) Nat Biotechnol, 17: 555-61), as shown in Example 46. The TEPITOPE score for a given peptide frame within a protein is the logarithm of the Kd (dissociation constant, affinity, dissociation rate) for that peptide frame binding to multiple most common human MHC alleles, as disclosed in Sturniolo, T. et al. (1999) Nature Biotechnology 17: 555. The score is calculated over at least 20 logs from about 10 to about -10 (corresponding to a binding constraint of 10e 10 K d To 10e -10 K d ), and can be reduced by avoiding the hydrophobic amino acids (such as M, I, L, V, F) that serve as anchor residues during peptide display on MHC. In some embodiments, at a TEPITOPE threshold score of about -5 or -6 or -7 or -8 or -9, or at a TEPITOPE score of -10, the XTEN component incorporated into the CFXTEN does not have a predicted T cell epitope. As used herein, a score of "-9" is a stricter TEPITOPE threshold than a score of -5.

[0288] In another embodiment, by limiting the known proteolytic sites from the sequence of XTEN, thereby reducing the processing of XTEN into small peptides that can bind MHC II receptors to cause XTEN sequences of the present invention (including those incorporated in the theme CFXTEN fusion rotein) to be roughly non-immunogenic.In another embodiment, by using roughly lacking secondary structure, thereby because the entropy of structure is higher and the sequence of resistance to many proteases is given to cause XTEN sequence to be roughly non-immunogenic.Therefore, TEPITOPE score reduction and elimination of known proteolytic sites from XTEN cause the XTEN compositions comprising the XTEN of the CFXTEN fusion protein compositions to be roughly not combined by mammalian receptors (including those receptors of the immune system or the active removal receptors of targeting FVIII).In one embodiment, the K of the XTEN of the CFXTEN fusion rotein in conjunction with mammalian receptors d Can be >100nM, or K d Greater than 500 nM, or K for mammalian cell surface receptors or circulating peptide receptors d Greater than 1μM.

[0289] In addition, the non-repetitive sequence of XTEN and the corresponding lack of epitope limit B cell in conjunction with XTEN or the ability activated by XTEN.Repetitive sequence is recognized and can form multivalent contact with even a few B cells, and due to the crosslinking of multiple T cell-independent receptors, can stimulate B cell proliferation and antibody production.On the contrary, although XTEN can contact with many different B cells on its extended sequence, due to the lack of repeatability of sequence, each individual B cell can only contact with individual XTEN once or a few times.Under being bound by no theory, the tendency of XTEN to stimulate B cell proliferation and thus stimulate immune response is usually much lower.In one embodiment, CFXTEN has the immunogenicity of reduction compared to the corresponding FVIII not fused in XTEN.In one embodiment, the CFXTEN of up to three parenteral doses is used to produce in serum dilution 1: 100 detectable but undetectable anti-CFXTEN IgG under dilution 1: 1000. In another embodiment, administration of up to three parenteral doses of CFXTEN to a mammal produces anti-FVIII IgG detectable at a serum dilution of 1:100 but undetectable at a dilution of 1:1000. In another embodiment, administration of up to three parenteral doses of CFXTEN to a mammal produces anti-XTEN IgG detectable at a serum dilution of 1:100 but undetectable at a dilution of 1:1000. In the foregoing embodiments, the mammal can be a mouse, rat, rabbit, or cynomolgus monkey.

[0290] Another feature of XTEN with non-repetitive sequences is that non-repetitive XTEN forms weaker contacts with antibodies relative to sequences with high repetitiveness. Antibodies are multivalent molecules. For example, IgG has two identical binding sites and IgM contains 10 identical binding sites. Therefore, antibodies directed against repetitive sequences can form multivalent contacts with the repetitive sequences with high avidity, which can affect the effectiveness and / or elimination of the repetitive sequences. On the contrary, antibodies directed against non-repetitive XTEN can produce monovalent interactions, thereby resulting in less likelihood of immune clearance, so that the period during which the CFXTEN compositions can be maintained in circulation increases. In addition, it is believed that Figure 6 As schematically depicted in , the flexible, unstructured nature of XTEN provides steric shielding of the FVIII region adjacent to the XTEN insertion site and provides steric hindrance to binding by FVIII inhibitors.

[0291] On the other hand, the theme XTEN that is suitable for being used as fusion partner has high hydrodynamic radius; This is a kind of to give apparent molecular weight corresponding increase to the CFXTEN fusion protein that has XTEN in some embodiments, and strengthens the steric hindrance for FVIII inhibitor and anti-FVIII antibody in other embodiments, thereby reduces the property of their ability in conjunction with CFXTEN.As described in detail in embodiment 26, XTEN is connected to therapeutic protein sequence and causes CFXTEN compositions to have the hydrodynamic radius of increase, the apparent molecular weight of increase and the apparent molecular weight factor of increase compared to the therapeutic protein that is not connected to XTEN. For example, in therapeutic applications where half-life extension is desired, compositions in which XTEN with a high hydrodynamic radius is incorporated into a fusion protein comprising a therapeutic protein can effectively increase the hydrodynamic radius of the composition beyond the glomerular pore size of about 3-5 nm (corresponding to an apparent molecular weight of about 70 kDa) (Caliceti. 2003. Pharmacokinetic and biodistribution properties of poly(ethylene glycol)-protein conjugates. Adv Drug Deliv Rev 55: 1261-1277), resulting in reduced renal clearance of circulating protein with a corresponding increase in terminal half-life and other enhanced pharmacokinetic properties. The hydrodynamic radius of a protein is conferred by its molecular weight as well as by its structure, including shape or compactness. Without being bound by a particular theory, XTEN can adopt an open conformation due to electrostatic repulsion between individual charges of the peptide or inherent flexibility conferred by specific amino acids in the sequence that lack the potential to confer secondary structure. Compared to the polypeptide (such as typical globular protein) with secondary and / or tertiary structure with similar sequence length and / or molecular weight, the opening, extension and non-structured conformation of XTEN polypeptide can have larger proportional hydrodynamic radius.The method for measuring hydrodynamic radius is well known in the art, as by using the size exclusion chromatography (SEC) described in U.S. Patent number 6,406,632 and 7,294,513.Embodiment 26 proves that the XTEN length increase can cause hydrodynamic radius, apparent molecular weight and / or apparent molecular weight factor to increase in proportion, and therefore allows to customize CFXTEN with respect to the required cutoff value of apparent molecular weight or hydrodynamic radius.Therefore, in certain embodiments, available XTEN structure CFXTEN fusion rotein can have hydrodynamic radius at least about 5nm or at least about 8nm or at least about 10nm or about 12nm or about 15nm or about 20nm or about 30nm or larger.In the foregoing embodiments, the large hydrodynamic radius conferred by the XTEN in the CFXTEN fusion protein can result in reduced clearance, increased terminal half-life, and increased mean residence time of the resulting fusion protein.

[0292] In some embodiments, the CFXTEN of FVIII and at least one or more XTEN exhibits an apparent molecular weight of at least 400 kD, or at least 500 kD, or at least 700 kD, or at least 1000 kD, or at least 1400 kD, or at least 1600 kD, or at least 1800 kD, or at least 2000 kD. Therefore, the apparent molecular weight that the CFXTEN fusion rotein that comprises one or more XTEN presents is about 1.3 times or about 2 times or about 3 times or about 4 times or about 8 times or about 10 times or about 12 times or about 15 times than the actual molecular weight of fusion rotein.In one embodiment, the CFXTEN fusion rotein of the separation of any embodiment disclosed herein presents an apparent molecular weight factor greater than about 1.3 or about 2 or about 3 or about 4 or about 5 or about 6 or about 7 or about 8 or about 10 or greater than about 15 under physiological conditions.In another embodiment, with respect to the actual molecular weight of fusion rotein, the CFXTEN fusion rotein has an apparent molecular weight factor of about 3 to about 20 or about 5 to about 15 or about 8 to about 12 or about 9 to about 10 under physiological conditions.It is believed that the apparent molecular weight of theme CFXTEN compsn increases and can strengthen the pharmacokinetic properties of fusion rotein due to the combination of each factor, and the factor comprises active removal reduction, reduction by the combination of FVIII inhibitor and capillary and venous bleeding loss reduction.

[0293] IV). CFXTEN compositions

[0294] The present invention provides compositions comprising fusion proteins with factor VIII connected to one or more XTEN sequences, wherein when applied to a subject, the fusion protein acts to replace or increase the amount of FVIII present in an endogenous or contact-activated coagulation pathway. The present invention addresses the long-term immediate need to increase the terminal half-life of factor VIII applied exogenously to a subject in need. A way to increase the circulating half-life of a therapeutic protein is to ensure that the renal clearance or metabolism of the protein is reduced. Another way to increase the terminal half-life is to reduce the active removal of the therapeutic protein, whether mediated by receptors, active metabolism of the protein, or other endogenous mechanisms. Both can be achieved by conjugating the protein to a polymer, which can give the protein an increased molecular size (or hydrodynamic radius) and therefore a reduced renal clearance on the one hand, and interfere with protein binding to remove receptors or other proteins that contribute to metabolism or removal on the other hand. Therefore, certain objects of the present invention include, but are not limited to, providing improved FVIII molecules with longer circulating or terminal half-lives, reducing the number or frequency of necessary administration of FVIII compositions, retaining at least a portion of activity compared to native coagulation Factor VIII, and / or enhancing the ability to treat coagulation deficiencies and uncontrolled bleeding more efficiently, more effectively, more economically, and / or with greater safety compared to currently available Factor VIII preparations.

[0295] Therefore, the present invention provides the FVIII that comprises covalently attached to one or more extended recombinant polypeptides (" XTEN "), thereby produces the recombinant factor VIII fusion protein composition of CFXTEN fusion protein composition.Term " CFXTEN " as used herein is intended to contain the fusion polypeptide comprising at least one effective load region and at least one other region, and the at least one effective load region comprises FVIII or a part of FVIII that can have the procoagulant activity relevant to the FVIII thrombin, and the at least one other region comprises one or more XTEN polypeptides that can be dispersed in the effective load region and / or be connected to terminal.In one embodiment, FVIII is natural FVIII.In another embodiment, FVIII is sequence variant, fragment, homologue or analogies of at least a portion of the procoagulant activity of retention natural FVIII of native sequence, as disclosed herein. Non-limiting examples of FVIII suitable for inclusion in the composition include sequences of Table 1 or sequences having at least 80%, or at least 90%, or at least 91%, or at least 92%, or at least 93%, or at least 94%, or at least 95%, or at least 96%, or at least 97%, or at least 98%, or at least 99% sequence identity to the sequences of Table 1. In a preferred embodiment, the FVIII is a B domain deleted (BDD) FVIII sequence variant, such as those BDD sequences from Table 1 or other such sequences known in the art. In another preferred embodiment, the CFXTEN comprises a B domain deleted (BDD) FVIII sequence variant expressing a native 19 amino acid signal sequence that is cleaved during protein maturation.

[0296] Compositions of the present invention include fusion proteins that are applicable to mediation or prevention or improvement when using to a subject in need of lacking factor VIII or the defect-related condition in the endogenous FVIII produced or lacking or defect-related bleeding disorders with trauma, surgery, factor VIII. Particularly interested is to seek to compare to natural FVIII, its pharmacokinetic parameter increase, solubility increase, stability increase or some other medical properties strengthen, or increase its terminal half-life will improve effect, safety, or cause administration frequency to reduce and / or improve the CFXTEN fusion protein compositions of patient management. The CFXTEN fusion protein of the embodiment disclosed herein presents one or more or any combination of improved properties and / or embodiment as described in detail herein. In some embodiments, the CFXTEN fusion composition when administered to a subject maintains levels above a threshold of at least 0.01-0.05, or 0.05 to 0.1, or 0.1 to 0.4 IU / ml for a longer period of time when compared to FVIII not linked to XTEN and administered at a similar dose to a subject in need thereof (e.g., a subject with hemophilia A, such as a human or mouse or monkey).

[0297] The FVIII of the subject composition (particularly those disclosed in Table 1) together with their corresponding nucleic acid and amino acid sequences are available in public databases, such as Chemical Abstracts Service databases (e.g., CAS registration), GenBank, the Global Protein Resource (UniProt), subscription-provided databases such as GenSeq (e.g., Derwent), and in patents and primary documents. The polynucleotide sequence that can be suitable for expressing the subject CFXTEN sequence can be a wild-type polynucleotide sequence encoding a given FVIII (e.g., full-length or mature), or in some cases, the sequence can be a variant of a wild-type polynucleotide sequence (e.g., a polynucleotide encoding a wild-type biologically active protein, wherein the DNA sequence of the polynucleotide has been optimized, for example, for expression in a particular species; or a polynucleotide encoding a variant of a wild-type protein (e.g., a site-directed mutant or allelic variant). It is entirely within the capabilities of the skilled artisan to use the wild-type or consensus cDNA sequence or codon-optimized variant of FVIII to produce the CFXTEN constructs encompassed by the present invention, using methods known in the art and / or together with the guidance and methods provided herein and more fully described in the Examples.

[0298] In one embodiment, the CFXTEN fusion protein comprises a single FVIII molecule connected to a single XTEN (e.g., XTEN as described above) with a sequence of 42, 144, 288, 576, or 864 amino acids, including, but not limited to, the AE or AG families set forth in Table 4, which exhibits at least about 80% sequence identity, or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about 99%, or 100% sequence identity to the sequence of Table 1. In another embodiment, the CFXTEN comprises a single FVIII connected to two XTEN, wherein the XTEN can be identical or they can be different. In another embodiment, the CFXTEN fusion protein comprises a single FVIII molecule linked to one, two, three, four, five, six or more XTEN sequences, wherein the FVIII is at least about 80% sequence identity, or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 136%, 137%, 138%, 139%, 200%, 201 In some embodiments, the one or more XTENs have at least about 80% sequence identity or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% or 100% sequence identity, and when optimal comparison, compared to one or more sequences of any one that are selected from Table 3, 4 and 13-17, each of the one or more XTENs has at least about 80% sequence identity or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or at least about 99% or 100% sequence identity.In the aforementioned embodiment where the CFXTEN has two or more XTEN, the XTEN can be identical or they can be different sequences.In another embodiment, the CFXTEN fusion protein comprises a single FVIII that exhibits at least about 80% sequence identity, or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about 99%, or 100% sequence identity compared to a sequence of similar length selected from Table 1 when optimally aligned, wherein each portion is identical to three, four, five, six, or more portions of the FVIII. Interspersed and linked by more XTEN sequences, which may be identical or different and wherein each has at least about 80% sequence identity, or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about 99%, or 100% sequence identity when optimally aligned compared to a sequence selected from any one of Tables 3, 4, and 13-17, or a fragment thereof. In another embodiment, the invention provides a CFXTEN fusion protein comprising a sequence having at least about 80% sequence identity, or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least about 99%, or 100% sequence identity to a sequence from Table 21 when optimally aligned.

[0299] 1. CFXTEN fusion protein configuration

[0300] The invention provides CFXTEN fusion protein compositions having CF and XTEN components linked in a specific N-terminus to C-terminus configuration.

[0301] In one embodiment of the CFXTEN composition, the invention provides a fusion protein of Formula I:

[0302] (XTEN) x -CF-(XTEN) y I

[0303] Wherein independently for each occurrence, CF is a factor VIII as defined herein, including sequences with at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% or 100% sequence identity with the sequences from Table 1; x is 0 or 1 and y is 0 or 1, wherein x+y≥1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences with at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% or 100% sequence identity with the sequences set forth in Table 4. Thus, the CFXTEN fusion compositions can have XTEN-CF, XTEN-CF-XTEN or CF-XTEN configurations.

[0304] In another embodiment of the CFXTEN composition, the invention provides a fusion protein of Formula II:

[0305] (XTEN) x -(S) x -(CF)-(XTEN) y II

[0306] wherein independently for each occurrence, CF is a Factor VIII as defined herein, including sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity with the sequences set forth in Table 1; S is a spacer sequence having between 1 and about 50 amino acid residues that may optionally include a cleavage sequence or amino acids compatible with a restriction site; x is 0 or 1 and y is 0 or 1, wherein x+y≥1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity with the sequences set forth in Table 4.

[0307] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein, wherein the fusion protein has Formula III:

[0308] (XTEN) x -(S) x -(CF)-(S) y -(XTEN) y III

[0309] wherein independently for each occurrence, CF is a Factor VIII as defined herein, including sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity with the sequences set forth in Table 1; S is a spacer sequence having between 1 and about 50 amino acid residues that may optionally include a cleavage sequence or amino acids compatible with a restriction site; x is 0 or 1 and y is 0 or 1, wherein x+y≥1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity with the sequences set forth in Table 4.

[0310] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula IV:

[0311] (A1)-(XTEN) u -(A2)-(XTEN) v -(B)-(XTEN) w -(A3)-(XTEN) x -(C1)-(XTEN) y -(C2)-(XTEN) z IV

[0312] wherein, independently for each occurrence, A1 is the A1 domain of FVIII; A2 is the A2 domain of FVIII; A3 is the A3 domain of FVIII; B is the B domain of FVIII, which may be a fragment or splice variant of the B domain; C1 is the C1 domain of FVIII; C2 is the C2 domain of FVIII; v is 0 or 1; w is 0 or 1; x is 0 or 1; y is 0 or 1; y is 0 or 1, provided that u+v+x+y+z≥1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity with the sequences set forth in Table 4.

[0313] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula V:

[0314] (XTEN) 1 -(S) a -(A1)-(S) b -(XTEN) u -(S)b -(A2)-(S) c -(XTEN) v -(S) c -(B)-(S) d -(XTEN) w -(S) d -(A3)-(S) e -(XTEN) x -(S) e -(C1)-(S) f -(XTEN) y -(S) f -(C2)-(S) g -(XTEN) z V

[0315] wherein, independently for each occurrence, A1 is the A1 domain of FVIII; A2 is the A2 domain of FVIII; A3 is the A3 domain of FVIII; B is the B domain of FVIII, which may be a fragment or splice variant of the B domain; C1 is the C1 domain of FVIII; C2 is the C2 domain of FVIII; S is a spacer sequence having between 1 and about 50 amino acid residues, which may optionally include a cleavage sequence or amino acids compatible with a restriction site; a is 0 or 1; b is 0 or 1; c is 0 or 1; d is 0 or 1; e is 0 or 1; f is 0 or 1; g is 0 or 1; t is 0 or 1; u is 0 or 1; v is 0 or 1; w is 0 or 1, x is 0 or 1; y is 0 or 1; z is 0 or 1, provided that t+u+v+w+x+y+z≥1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% or 100% sequence identity with the sequences set forth in Table 4. In another embodiment of Formula V, the spacer sequence is glycine or a sequence selected from Tables 11 and 12.

[0316] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula VI:

[0317] (XTEN) u -(S) a -(A1)-(S) b -(XTEN) y -(S) b -(A2)-(S) c -(XTEN) w -(S) c -(A3)-(S) d-(XTEN) x -(S) d -(C1)-(S) v -(XTEN) y -(S) c -(C2)-(S) f -(XTEN) z VI

[0318] wherein, independently for each occurrence, A1 is the A1 domain of FVIII; A2 is the A2 domain of FVIII; A3 is the A3 domain of FVIII; C1 is the C1 domain of FVIII; C2 is the C2 domain of FVIII; S is a spacer sequence having between 1 and about 50 amino acid residues that may optionally include a cleavage sequence or amino acids compatible with a restriction site; a is 0 or 1; b is 0 or 1; c is 0 or 1; d is 0 or 1; e is 0 or 1; f is 0 or 1; u is 0 or 1; v is 0 or 1; w is 0 or 1, x is 0 or 1; y is 0 or 1; z is 0 or 1, provided that u+v+w+x+y+z≥1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% or 100% sequence identity with the sequences set forth in Table 4. In another embodiment of Formula V, the spacer sequence is glycine or a sequence selected from Tables 11 and 12.

[0319] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula VII:

[0320] (SP)-(XTEN) x -(CS) x -(S) x -(FVIII_1-745)-(S) y -(XTEN) y -(S) y -(FVIII_1635-2332)-(S) z -(CS) x -(XTEN) x VII

[0321] wherein, independently for each occurrence, SP is a signal peptide, preferably having the sequence MQIELSTCFFLCLLRFCFS (SEQ ID NO: 1611), CS is a cleavage sequence listed in Table 12, S is a spacer sequence of between 1 and about 50 amino acid residues that may optionally include an amino acid compatible with a restriction site, "FVIII_1-745" is residues 1-745 of factor FVIII and "FVIII_1635-2332" is residues 1635-2332 of FVIII, x is 0 or 1, y is 0 or 1, and z is 0 or 1, wherein x+y+z>2; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity to the sequences set forth in Table 4. In one embodiment of Formula VII, the spacer sequence is GPEGPS (SEQ ID NO: 1612). In another embodiment of Formula V, the spacer sequence is glycine or a sequence selected from Tables 11 and 12.

[0322] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula VIII:

[0323] (A1)-(S) a -(XTEN) v -(S) 1 -(A2)-(B1)-(S) h -(XTEN) w -(S) b -(B2)-(A3)-(S) e -(XTEN) x -(S) c -(C1)-(S) d -(XTEN) y -(S) d -(C2)-(S) e -(XTEN) z VIII

[0324] wherein independently for each occurrence, A1 is the A1 domain of FVIII; A2 is the A2 domain of FVIII; B1 is a fragment of the B domain that may have residues 741 to 743-750 of FVIII or about residue 741 to about residue 745 of FVIII; B2 is a fragment of the B domain that may have residues 1635-1686 to 1689 of FVIII or about residue 1640 to about residue 1689 of FVIII; A3 is the A3 domain of FVIII; C1 is the C1 domain of FVIII; C2 is the C2 domain of FVIII; S is a fragment having between 1 and about 50 amino acid residues A spacer sequence of a cleavage sequence or amino acid that is compatible with a restriction site may be optionally included; a is 0 or 1; b is 0 or 1; c is 0 or 1; d is 0 or 1; e is 0 or 1; f is 0 or 1; u is 0 or 1; v is 0 or 1; w is 0 or 1, x is 0 or 1; y is 0 or 1; z is 0 or 1, provided that u+v+w+x+y+z≥1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% or 100% sequence identity with the sequences set forth in Table 4. In one embodiment of Formula VIII, the spacer sequence is GPEGPS (SEQ ID NO: 1612). In another embodiment of Formula V, the spacer sequence is glycine or a sequence selected from Tables 11 and 12.

[0325] In another embodiment of the CFXTEN composition, the invention provides a recombinant Factor VIII fusion protein of Formula IX:

[0326] (A1 N )-(S) a -(XTEN) 1 -(S) b -(Al C )-(A2 N )-(S) c -(XTEN) u -(S) d -(A2 C )-(B N )-(S) e -(XTEN) v -(S) f -(B C )-(A3 N )-(S) g -(XTEN) w -(S) h -(A3 C )-(C1 N )-(S)i -(XTEN) x -(S) j -(C1 C )-(C2 N )-(S) k -(XTEN) y -(S)+(C2C)-(S) m -(XTEN) x IX

[0327] In which, for each occurrence independently, A1 N is a fragment of the A1 domain from at least residue number 1 (numbered relative to native mature FVIII) to at most residue number 371, A1 c is a fragment of the A1 domain from at least residue number 2 to at most residue number 372; A2 N is a fragment of the A2 domain from at least residue number 373 to at most residue number 739, A2 c is a fragment of the A2 domain from at least residue number 374 to at most residue number 740; B N is a fragment of the B domain from at least residue number 741 to at most residue number 1647, B c A3 is a fragment of the B domain from at least residue number 742 to at most residue number 1648; N is a fragment of the A3 domain from at least residue number 1649 to at most residue number 2019, A3 c is a fragment of the A3 domain from at least residue number 1650 to at most residue number 2019; C1 N is a fragment of the C1 domain from at least residue number 2020 to at most residue number 2171, C1 c is a fragment of the C1 domain from at least residue number 2021 to at most residue number 2172; C2 N is a fragment of the C2 domain from at least residue number 2173 to at most residue number 2331, C2 cis a fragment of the C2 domain from at least residue number 2174 to at most residue number 2332; S is a spacer sequence having between 1 and about 50 amino acid residues that may optionally include a cleavage sequence or amino acids that are compatible with a restriction site; a is 0 or 1; b is 0 or 1; c is 0 or 1; d is 0 or 1; e is 0 or 1; f is 0 or 1; g is 0 or 1; h is 0 or 1; i is 0 or 1; j is 0 or 1; k is 0 or 1; 1 is 0 or 1; m is 0 or 1; t is 0 or 1; u is 0 or 1; v is 0 or 1; w is 0 or 1, x is 0 or 1; y is 0 or 1; z is 0 or 1, provided that t+u+v+w+x+y+z≥1; and XTEN is an extended recombinant polypeptide as described herein, including but not limited to sequences having at least 90% identity with the sequences set forth in Table 4. In one embodiment of Formula IX, the spacer sequence is GPEGPS (SEQ ID NO: 1612). In another embodiment of Formula IX, the spacer sequence is glycine or a sequence selected from Tables 11 and 12.

[0328] The embodiment of formula IV-VIII encompasses the following CFXTEN configuration: wherein one or more lengths of XTEN in the range of about 6 amino acids to ≥1000 amino acids (e.g., selected from any one of Tables 3, 4 and 13-17, or sequences showing at least about 90-99% or higher sequence identity thereto) are inserted and connected between the adjacent domains of Factor VIII or are connected to the N-terminal or C-terminal of FVIII. In other embodiments of formula V-VIII, the present invention further provides the following configuration: wherein XTEN is connected to the FVIII domain by optionally comprising an amino acid that can be compatible with a restriction site or can include a cleavage sequence (e.g., the sequence of Tables 11 and 12 described more fully below) spacer sequence so that the XTEN encoding sequence (in the case of a restriction site) can be integrated into the CFXTEN construct, and in the case of a cleavage sequence, the XTEN can be released from the fusion protein under the action of a protease suitable for the cleavage sequence.

[0329] The embodiments of Formula VI-VIII differ from those of Formula V in that the FVIII components of Formula VI-VIII are only B-domain deleted forms of Factor VIII that retain short residual sequences of the B domain ("FVIII BDD"), non-limiting examples of sequences of which are provided in Table 1, wherein one or more XTEN or fragments of XTEN ranging from about 6 amino acids to ≥1000 amino acids in length (e.g., sequences selected from any one of Tables 3, 4, and 13-17) are inserted and linked between adjacent domains of Factor VIII and / or between the remainder of the B domain residues (such as those of Table 8). The embodiments of Formula IX generally differ from those of the other formulae in that one or more XTEN are each inserted within a domain of FVIII rather than between domains, and / or have the XTEN linked to the C-terminus of FVIII (or linked to the C-terminus of FVIII through a spacer sequence).

[0330] In some embodiments of CFXTEN, the fusion protein comprises a B domain deleted form of FVIII, wherein with respect to the full-length human factor VIII sequence, the B domain is deleted from the first position at about amino acid residue numbering 745 and ends at the second position at amino acid residue numbering 1635 to about 1690, and the XTEN connects the first and second positions of the B domain deletion. In one aforementioned embodiment, the first and second positions of the B domain deletion are selected from the position of Table 8. In another aforementioned embodiment, at least one XTEN connects the first and second positions, wherein the at least one XTEN connects factor VIII amino acid residue 745 and amino acid residue 1640, or amino acid residue 741 and amino acid residue 1640, or amino acid residue 741 and amino acid residue 1690, or amino acid residue 745 and amino acid residue 1667, or amino acid residue 745 and amino acid residue 1657, or amino acid residue 745 and amino acid residue 1657, or amino acid residue 747 and amino acid residue 1642, or amino acid residue 751 and amino acid residue 1667. In one embodiment of the CFXTEN, wherein the factor VIII comprises an XTEN linked to a first position and a second position of the B domain deletion described in the embodiments of this paragraph, the XTEN is a sequence having at least 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% sequence identity to a sequence of similar length selected from any one of Table 4, Table 13, Table 14, Table 15, Table 16, and Table 17 when optimally aligned, wherein the CFXTEN retains at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% procoagulant activity of native FVIII.

[0331] The present invention contemplates insertion of XTEN between or within the domains of FVIII or adjacent to the insertion points in Table 5, Table 6, Table 7, Table 8, and Table 9 or Figure 8-9 All possible permutations of those insertion points described in , wherein another XTEN is optionally linked to the N-terminus or C-terminus of FVIII, optionally linked through another cleavage sequence selected from Table 12, thereby producing a CFXTEN composition; non-limiting examples of which are depicted in Figure 5 and 12In one embodiment, the CFXTEN comprises the FVIII BDD sequence of Table 1, wherein one or more XTENs having at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% or more sequence identity compared to any one of Tables 3, 4, and 13-17 or its fragments are inserted between any two residual B domain amino acids of the FVIII BDD sequence, thereby producing a single-chain FVIII fusion protein, wherein the CFXTEN retains at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% of the procoagulant activity of native FVIII. In the aforementioned embodiments, the CFXTEN can have another XTEN sequence of any one of Tables 4 and 13-17 that is connected to the N-terminus or C-terminus of the fusion protein. In another embodiment, the CFXTEN comprises at least the first XTEN inserted in the site of setting forth in Table 8, wherein the CFXTEN retains at least about 30% or at least about 40% or at least about 50% or at least about 60% or at least about 70% or at least about 80% or at least about 90% procoagulant activity of native FVIII. In one embodiment of formula VII fusion rotein, the CFXTEN comprises the FVIII BDD sequence of Table 1, wherein compared to sequences or fragments from any one of Tables 3, 4 and 13-17, each having at least about 80% or at least about 90% or at least about 95% or at least about 96% or at least about 97% or at least about 98% or at least about 99% or 100% sequence identity Two or more XTEN are connected to the FVIII-BDD sequence, wherein at least one XTEN is from FVIII The BDD sequence is inserted from about 3 to about 20 amino acid residues from the FVIII cleavage site amino acid R740 to the C-terminal side and from about 3 to about 20 amino acid residues from the FVIII cleavage site amino acid R1689 to the N-terminal side, thereby producing a single-chain FVIII fusion protein, and one or two XTEN are linked to the N-terminus and / or C-terminus of the FVIII-BDD sequence by the cleavage sequence, wherein after the XTEN is released by cleavage of the cleavage sequence, the CFXTEN exhibits at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% of the procoagulant activity of native FVIII.

[0332] In one embodiment, the A3 domain comprises an a3 acidic region or a portion thereof. In another embodiment, at least one XTEN is inserted in an a3 acidic region or a portion thereof, in the N-terminal of an a3 acidic region or a portion thereof, in the C-terminal of an a3 acidic region or a portion thereof, or in a combination thereof. In certain embodiments, at least one XTEN is inserted in a C2 domain, in the N-terminal of a C2 domain, in the C-terminal of a C2 domain, or in a combination thereof. In other embodiments, factor VIII comprises all or a portion of a B domain. In other embodiments, at least one XTEN is inserted in all or a portion of a B domain, in the N-terminal of a B domain, in the C-terminal of a B domain, or in a combination thereof.

[0333] 2. CFXTEN fusion protein configurations with internal XTEN

[0334] On the other hand, the invention provides CFXTEN constructed with one or more XTEN sequences located inside the FVIII sequence. In one embodiment, the invention provides CFXTEN constructed with one or more XTEN sequences located inside the FVIII sequence to confer properties such as but not limited to the following: compared to the FVIII without the XTEN incorporated therein, increased stability, increased resistance to proteases, increased resistance to clearance mechanisms (including but not limited to interactions with clearance receptors or FVIII inhibitors) and increased hydrophilicity.

[0335] The present invention contemplates that different configurations or sequence variants of FVIII can be used as platforms into which one or more XTEN are inserted. These configurations include, but are not limited to, native FVIII, FVIII BDD, and single-chain FVIII (scFVIII), as well as variants of those configurations. In the case of scFVIII, the present invention provides CFXTEN that can be constructed by replacing one or more amino acids of the processing site of FVIII. In one embodiment, the scFVIII used in the CFXTEN is produced by replacing R1648 in the FVIII sequence RHQREITR (SEQ ID NO: 1698) with glycine or alanine to prevent proteolytic processing into a heterodimeric form. It is expressly contemplated that any CFXTEN embodiment disclosed herein having a 1648 FVIII residue may have a glycine or alanine replacing an arginine at position 1648. In some embodiments, the present invention provides CFXTEN comprising scFVIII, wherein a portion of the sequence surrounding the R1648 processing site is replaced with XTEN, such as Fig.10In one embodiment, at least about 60% or about 70% or about 80% or about 90% or about 95% or about 97% or more of the B domain is replaced with an XTEN sequence disclosed herein (comprising one or more of R740, R1648 or R1689 cleavage sites). In another embodiment, the FVIII B domain sequence of CFXTEN between the FXIa cleavage sites at R740 and R1689 (wherein at least 1-5 adjacent B domain amino acids between the cleavage site and the start site of XTEN are also retained to allow protease to enter the cleavage site) is replaced by XTEN. In another embodiment, the FVIII B domain sequence of CFXTEN between the FXIa cleavage sites at N745 and P1640 is replaced by XTEN. In other embodiments, the invention provides CFXTEN FVIIIBDD sequence variants in which portions of the B domain are deleted but only one FXI R740 or R1689 activation site (and 1-5 adjacent amino acids of the B domain) remains in the construct, wherein after cleavage by FXIa, the XTEN remains attached to one end of the light or heavy chain, such as Figure 5 B and 5D. In one of the foregoing embodiments, the CFXTEN comprises a FVIII BDD sequence wherein the amino acids between N745 to P1640 or between S743 to Q1638 or between P747 to V1642 or between N745 and Q1656 or between N745 and S1657 or between N745 and T1667 or between N745 and Q1686 or between R747 and V1642 or between T751 and T1667 are deleted and the XTEN sequence is connected between these amino acids, thereby connecting the heavy and light chains, and may further comprise insertions in external surface loops, between FVIII domains, or at the N-terminus or C-terminus of the FVIII BDD sequence (e.g., one or more insertion sites or Figure 8-9 In another of the foregoing embodiments, the CFXTEN comprises a FVIII BDD sequence wherein the amino acids between K713 to Q1686 or between residues 741 and 1648 are deleted and the XTEN is linked between the two amino acids, and the other XTEN can be inserted in a surface loop, between FVIII domains, or at the N-terminus or C-terminus of the FVIII BDD sequence, including but not limited to one or more insertion sites from Table 5, Table 6, Table 7, Table 8, and Table 9 or Figure 8-9In some embodiments, the CFXTEN sequence can have one or more XTENs that exhibit at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% or 100% sequence identity to an XTEN sequence from any one of Tables 4 and 13-17.

[0336] The invention encompasses other CFXTEN with internal XTEN in various configurations; schematic diagrams of exemplary configurations are illustrated in Figure 5 and 10 Regions suitable for XTEN insertion sites include known domain boundaries of FVIII, exon boundaries, known surface (external) loops and solvent accessible surface area sites identified by X-ray crystallographic analysis and structural models obtained by molecular dynamic simulations of FVIII, sites with low order (through Figure 7 In another embodiment, the XTEN insertion site is selected based on the inferred removal receptor binding site of FVIII. In another embodiment, the CFXTEN comprises an XTEN inserted at the following position: not in close proximity to the mutation range listed in the hemophilia A mutation, search, test and resource center (HaemophiliaAMutation, Search, Test and Resource Site, HAMSTeRS) database involved in hemophilia A (Kemball-Cook G et al. The factor VIII Structure and Mutation Resource Site: HAMSTeRS version 4. Nucleic Acids Res. (1998) 26 (1): 216-219). In another embodiment, the potential site of XTEN insertion is included in the FVIII epitope and can be combined by the anti-FVIII antibody present in the sensitized hemophilia patient and does not serve as a residue of the protein interaction site. Regions and / or sites considered for exclusion as XTEN insertion sites include residues / regions of Factor VIII that are important in various interactions, including other coagulation proteins, residues surrounding each of the arginine activation / inactivation cleavage sites acted upon by the proteases thrombin, factor Xa, activated protein C, residues surrounding the signal peptide processing site (residue 1) if the construct contains a signal peptide, regions known to interact with other proteins such as FIXa, FX / FXa, thrombin, activated protein C, protein S cofactor of protein C, von Willebrand factor, sites known to interact with phospholipid cofactors in coagulation, residues involved in domain interactions, Ca-coordinating proteins, and phospholipid cofactors.++ Cu ++ ionic residues, cysteine ​​residues involved in SS intramolecular bonding, documented amino acid insertion and point mutation sites affecting procoagulant activity in FVIII produced in subjects with hemophilia A, and mutation sites affecting procoagulant activity produced in FVIII in research laboratories. Sites considered for insertion (to extend half-life) or for exclusion (required for removal of spent FVIIIa or FXa) include regions known to interact with heparin sulfate proteoglycans (HSPGs) or low-density lipoprotein receptor-related proteins (LPRs).

[0337] By analyzing the foregoing criteria as described in Example 34, different insertion sites or ranges of insertion sites spanning the FVIII BDD sequence have been identified and / or confirmed as candidate sites for insertion of XTEN, non-limiting examples of which are listed in Tables 5, 6, 7, 8, and 9 and schematically shown in Figure 8 and 9In one embodiment, CFXTEN comprises the XTEN inset between the individual domains of FVIII, i.e. between A1 and A2 or between A2 and B or between B and A3 or between A3 and C1 or between C1 and C2 domains. In another embodiment, CFXTEN comprises the XTEN that is inserted in the B domain or between the remaining residues of the BDD sequence. In another embodiment, CFXTEN comprises the XTEN that is inserted in the known exon boundary of the coding FVIII gene, because the exon represents the evolutionary conservative sequence module with high probability of functioning under the situation of other protein sequences. In another embodiment, CFXTEN comprises the XTEN that is inserted in the surface loop identified according to the x-ray structure of FVIII. In another embodiment, CFXTEN comprises the XTEN that is inserted in the low-order region that is identified as having low or not having detection electron density by X-ray structure analysis. In another embodiment, CFXTEN comprises the XTEN that is inserted in the low-order region predicted by structure prediction algorithm (such as but not limited to FoldIndex, RONN and Kyte and Doolitlle algorithm). In another embodiment, the CFXTEN comprises an XTEN inserted in a sequence region with a higher frequency of hydrophilic amino acids. In another embodiment, the CFXTEN comprises an XTEN inserted in an epitope that can be bound by a naturally occurring anti-FVIII antibody in a sensitized hemophiliac. In another embodiment, the CFXTEN comprises an XTEN inserted in a sequence region with low sequence conservation and / or sequence segment length differences between FVIII sequences from different species. In another embodiment, the CFXTEN comprises an XTEN connected to the N-terminus and / or the C-terminus. In another embodiment, the present invention provides a CFXTEN configuration with an insertion XTEN selected from two or more criteria from the embodiments listed above. In another embodiment, the present invention provides a CFXTEN configuration with an XTEN inserted in a factor VIII sequence, wherein the insertion point is at or adjacent to an insertion residue amino acid or amino acids selected from table 5, table 6, table 7, table 8, and table 9. Figure 8-9 at the N-terminal or C-terminal side of at least one, two, three, four, or five, or six or more amino acids of those insertion residue amino acids described in ; or within one, or two, or three, or four, or five, or six amino acids of the insertion residue amino acids from Table 5, Table 6, Table 7, Table 8, and Table 9; or Fig. 9 The inserted residues are schematically depicted at various spacings of amino acids for an exemplary FVIII BDD sequence in FIG.

[0338] As mentioned above, the sequence length of the fragment of the XTEN of one or more internal positionings or XTEN can be 6 to 1000 or more amino-acid residues.In some embodiments where the CFXTEN has one or two or three or four or five or more XTEN sequences inside FVIII, the XTEN sequence can be identical or can be different.In one embodiment, when optimal comparison, compared to similar length or fragment or the motif of any one XTEN selected from table 3,4 and 13-17, the XTEN of each internal positioning has at least about 80% sequence identity or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity. In another embodiment, the invention provides a CFXTEN constructed with one or more XTEN inserted internally in a FVIII BDD sequence having at least about 80% sequence identity, or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity compared to the sequences of Table 1, wherein the insertion is located in Table 5, Table 6, Table 7, Table 8, and Table 9, Figure 8 At the insertion point or range of insertion points indicated in or as Fig. 9 Those skilled in the art will appreciate that the XTEN inserted into the FVIII sequence at the insertion points of Tables 5, 6, 7, 8, and 9 is linked to the flanking FVIII amino acids (or through a linker spacer or cleavage sequence as described above) via its N-terminus and C-terminus, whereas an XTEN linked to the N-terminus or C-terminus of FVIII will only be linked to a single FVIII amino acid (or to a linker spacer or cleavage sequence amino acid as described above). By way of example only, variations of the CFXTEN with three internal XTENs can have: an XTEN incorporated between FVIII BDD residues 741 and 1640, residues 18 and 19, and residues 1656 and 1657 (as described herein); or an XTEN incorporated between FVIII BDD residues 741 and 1640, residues 1900 and 1901, and at the C-terminus at residue 2332; or an XTEN incorporated between FVIII BDD residues 26 and 27, residues 1656 and 1657, and residues 1900 and 1901; or an XTEN incorporated between FVIII BDD residues 741 and 1640, residues 1900 and 1901, and at the C-terminus at residue 2332.

[0339] When evaluating the CFXTEN fusion rotein with the XTEN inserted in the position from Table 5, it was found that the insertion of the FVIII sequence in certain regions produced a CFXTEN with good expression and procoagulant activity maintenance. Therefore, in a preferred embodiment, the invention provides the CFXTEN fusion rotein constructed with one or two or three or four or five or six or more XTEN inserted inside the FVIII BDD sequence or connected to the FVIII BDD sequence, the XTEN having at least about 80% sequence identity or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity compared to any one XTEN selected from Table 4 and 13-17. The BDD sequence has at least about 80% sequence identity, or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity compared to the sequence of Table 1, wherein the insertion is at one or two or three or four or five or six or more insertion points set forth in Table 7. In the foregoing embodiments, the CFXTEN fusion protein with the XTEN insert retains at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% or more procoagulant activity compared to the corresponding FVIII not linked to the XTEN.

[0340] When evaluating CFXTEN fusion proteins with XTEN inserted in one or more positions from Table 5, it was surprisingly found that a high percentage of fusion proteins with XTEN inserts retained procoagulant activity, as described in Example 25. Thus, the invention provides CFXTEN fusion proteins constructed with one, two, three, four, five, six or more XTEN, wherein the resulting fusion proteins exhibit at least about 10%, or 20%, or 30%, or 40%, or 50%, or 60%, or 70%, or 80%, or 90% or more procoagulant activity compared to the corresponding FVIII not linked to XTEN when measured by the coagulation assay described herein. In a preferred embodiment, the invention provides CFXTEN fusion proteins comprising one or two or three or four or five or six or more XTEN linked to a FVIII BDD sequence, each having at least about 80% sequence identity, or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity compared to an XTEN selected from any one of Tables 4 and 13-17, wherein the FVIII The BDD sequence has at least about 80% sequence identity, or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the sequence of Table 1, wherein the insertion is at one or more insertion points selected from Table 5, Table 6, Table 7, Table 8, and Table 9, and wherein the resulting fusion protein exhibits at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70% or more procoagulant activity compared to the corresponding FVIII not linked to XTEN when assayed in vitro by an assay described herein (e.g., a chromogenic assay). Because the subject CFXTEN fusion proteins generally exhibit an increased terminal half-life compared to native FVIII, one skilled in the art will appreciate that a CFXTEN with lower procoagulant activity relative to an equimolar amount of native FVIII would nevertheless be acceptable when administered as a therapeutic composition to a subject in need thereof.In another embodiment; The CFXTEN fusion protein comprises one or two or three or four or five or more XTEN connected to the FVIII BDD sequence; The XTEN each has at least about 80% sequence identity, or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity compared to any one XTEN selected from Tables 4 and 13-17; The FVIII The BDD sequence has at least about 80% sequence identity, or 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the sequence of Table 1, wherein the insertion is at one or more insertion points or a range of insertion points selected from Table 5, Table 6, Table 7, Table 8 and Table 9, wherein when expressed in cell culture medium and in a chromogenic assay The resulting fusion protein exhibits at least about 0.5 IU / ml, or at least about 0.75 IU / ml, or at least about 1.0 IU / ml, or at least about 1.5 IU / ml, or at least about 2.0 IU / ml, or at least about 2.5 IU / ml, or at least about 3 IU / ml, or at least about 4 IU / ml, or at least about 5 IU / ml, or at least about 7 IU / ml, or at least about 10 IU / ml, or at least about 20 IU / ml, or at least about 30 IU / ml FVIII activity when assayed in a fixed-dose manner, wherein culturing and expression are according to the methods described herein; e.g., the methods of Example 25.

[0341] It is believed that finding an insertion site in which FVIII retains at least a portion of its procoagulant activity will also allow insertion of other peptides and polypeptides with unstructured or structured features associated with an extension of half-life when fused to the FVIII protein in one or more of those same sites. Non-limiting examples include albumin, albumin fragments, Fc fragments of immunoglobulins, the β subunit of the C-terminal peptide (CTP) of human chorionic gonadotropin, HAP sequences, transferrin, PAS polypeptides of U.S. Patent Application No. 20100292130, polyglycine linkers, polyserine linkers, peptides and short polypeptides with different degrees of secondary structure, especially from less than 50% to greater than 50%, with 6-40 amino acids selected from two amino acid types of glycine (G), alanine (A), serine (S), threonine (T), glutamic acid (E) and proline (P), which will be suitable for inserting FVIII in the active insertion site identified.

[0342] In fusion rotein embodiment as herein described; The CFXTEN fusion rotein can further comprise one or more cleavage sequences from table 12 or other sequences as known in the art; Said cleavage sequence is between 6 amino-acid residues of the cross point of FVIII and XTEN sequence or in, and said cleavage sequence can comprise two cleavage sequences in given internal XTEN sequence.In one embodiment, the CFXTEN that comprises cleavage sequence has two identical cleavage sequences, is positioned at the corresponding end of one or more internal XTEN separately or near said corresponding end so that when by the protease cleavage of combination and cracking that sequence, XTEN discharges from fusion rotein.Below more fully describe the sequence that can be cleaved and exemplary sequence are provided in table 12.

[0343] Table 5: Insertion positions of XTEN linked to FVIII BDD sequence

[0344]

[0345]

[0346]

[0347]

[0348] Insertion points of XTEN based on the amino acid numbering of mature full-length human FVIII are indicated, where the insertion can be on the N-terminal or C-terminal side of the indicated amino acid

[0349] Downstream sequence in FVIII BDD with 746-1639 deletion

[0350] Table 6. Exemplary insertion positions of XTEN linked to FVIII polypeptides

[0351]

[0352]

[0353] The distance from the insertion residue refers to the relative number of amino acids from the N-terminus (negative numbers) or C-terminus (positive numbers) of the specified insertion residue (residue "0") at which insertion can be made. The symbol "-x" means that the insertion site is x amino acids from the N-terminus of the specified insertion residue. Similarly, the symbol "+x" means that the insertion site is x amino acids from the C-terminus of the specified insertion residue.

[0354] For example, "-1, +2" indicates that the insertion is made at the N-terminus or C-terminus of the amino acid residue indicated as -1, 0, +1 or +2.

[0355] Table 7. Other exemplary insertion positions of XTEN linked to FVIII polypeptides

[0356]

[0357] Indicates the extent of the insertion sites numbered relative to the amino acid numbering of mature human FVIII

[0358] Table 8. Exemplary XTEN insertion locations within B domain deleted variants of FVIII polypeptides

[0359]

[0360]

[0361] The amino acids linked to the B domain deleted variant and adjacent to the A3 domain are indicated, wherein the amino acids are numbered relative to the amino acid numbering of mature human FVIII.

[0362] Indicates the amino acids linked by the XTEN inserted into BDD-FVIII

[0363] Table 9. Exemplary insertion positions of XTEN linked to FVIII polypeptides that produce procoagulant activity

[0364]

[0365]

[0366] Downstream sequence in FVIII BDD with 746-1639 deletion

[0367] On the other hand, the invention provides libraries of components and methods for producing libraries of nucleotides from FVIII segments encoding FVIII segments, XTEN, and genes suitable for preparing the encoding subject CFXTEN that are connected to XTEN. In a first step, generate, express, and insert the coding sequence identified or Figure 8-9 A library of genes for FVIII and XTEN in various single sites at or within 1-6 amino acids of the insertion site described in , and the CFXTEN were recovered and evaluated for activity and pharmacokinetics, such as Fig.15 Those CFXTEN that show enhanced properties are then used to generate genes encoding FVIII segments and insertion sites plus XTEN, where components from each enhanced insertion are represented in the library, such as Fig.11 In one embodiment, standard recombinant techniques are used to Fig.11 The library components can be assembled in a combinatorial manner as described in Table 5, Table 6, Table 7, Table 8, and Table 9, thereby generating each arrangement of CFXTEN with multiple internal and N- and C-terminal XTENs that can include Table 5, Table 6, Table 7, Table 8, and Table 9 or as shown in Table 5. Figure 8-9The insertion site described in or adjacent to those insertion sites.The activity and the enhanced pharmacokinetics of the resulting construct will then be assessed, and further assessment will be made compared to the FVIII not being connected to XTEN, producing those candidate substances of the CFXTEN with enhanced properties, such as the active removal of the reduction, the resistance to proteases, the immunogenicity of the reduction and the enhanced pharmacokinetics.

[0368] 3. XTEN Permissible Cycles

[0369] As described in detail elsewhere herein and as Figure 33-36 As described in, the inventors have recognized that each FVIII "A" domain comprises at least two "XTEN permissive loops" into which the XTEN sequence can be inserted without eliminating the procoagulant activity of the recombinant protein, or the ability of the recombinant protein to be expressed in a host cell in vivo or in vitro. The inventors have identified XTEN permissive loops as regions having, among other attributes, high surface or solvent exposure and high conformational flexibility. The A1 domain comprises an XTEN permissive loop-1 (A1-1) region and an XTEN permissive loop-2 (A1-2) region, the A2 domain comprises an XTEN permissive loop-1 (A2-1) region and an XTEN permissive loop-2 (A2-2) region, and the A3 domain comprises an XTEN permissive loop-1 (A3-1) region and an XTEN permissive loop-2 (A3-2) region.

[0370] In some aspects, the recombinant FVIII protein as described above comprises at least one XTEN sequence inserted into at least one of the XTEN permissive loops A1-1, A1-2, A2-1, A2-2, A3-1 or A3-2, wherein the recombinant FVIII protein has procoagulant activity and can be expressed in vivo or in vitro in a host cell. In some aspects, the recombinant FVIII protein as described above comprises at least two XTEN sequences inserted into FVIII, such as two different XTEN permissive loops A1-1, A1-2, A2-1, A2-2, A3-1 or A3-2, wherein the recombinant FVIII protein has procoagulant activity and can be expressed in vivo or in vitro in a host cell. Alternatively, the recombinant FVIII protein as described above may comprise two or more XTEN sequences inserted into a single XTEN permissive loop, wherein there are or no XTEN sequences inserted into other XTEN permissive loops, wherein the recombinant FVIII protein has procoagulant activity and can be expressed in vivo or in vitro in a host cell. In some aspects, the recombinant FVIII protein as described above may comprise at least one XTEN sequence inserted into at least one XTEN permissive loop as described above, and may further comprise one or more XTEN sequences inserted into a3, wherein the recombinant FVIII protein has procoagulant activity and can be expressed in a host cell in vivo or in vitro. In some aspects, the recombinant FVIII protein of the present invention may comprise three, four, five, six or more XTEN sequences inserted into one or more XTEN permissive loops or inserted into a3, wherein the recombinant FVIII protein has procoagulant activity and can be expressed in a host cell in vivo or in vitro.

[0371] In some aspects, the recombinant FVIII protein as described above comprises at least one XTEN sequence inserted into a3, wherein the recombinant FVIII protein has procoagulant activity and can be expressed in a host cell in vivo or in vitro. In some aspects, the recombinant FVIII protein of the present invention comprises at least one XTEN sequence inserted into a3, and further comprises one or more XTEN sequences inserted into one or more XTEN permissive loops as described above, wherein the recombinant FVIII protein has procoagulant activity and can be expressed in a host cell in vivo or in vitro.

[0372] The inventors have recognized that the recombinant FVIII protein of the present invention contains at least two XTEN permissive loops in each of the FVIII A domain regions, which allows the insertion of XTEN sequences while having procoagulant activity and still being able to be expressed by host cells in vivo or in vitro. Various crystal structures of FVIII with different degrees of resolution have been determined. These structures of FVIII and FVIIIa determined by X-ray crystallography and molecular dynamic simulation are used to generate models of accessible surface area and conformational flexibility of FVIII. For example, the crystal structure of human FVIII has been determined by Shen et al. Blood 111: 1240-1247 (2008) and Ngo et al. Structure 16: 597-606 (2008). The data for these structures can be obtained from the Protein Data Bank (pdb.org) according to accession numbers 2R7E and 3CDZ, respectively.

[0373] The secondary structures of the heavy and light chains of human FVIII predicted from the crystal structure of Shen et al. are reproduced in Fig.38 and 39 According to the crystal structure predictions of Shen et al., various β chains are Fig.38 and 39 In certain embodiments, the XTEN allows loops A1-1, A1-2, A2-1, A2-2, A3-1, and A3-2 to be contained within a surface-exposed flexible loop structure in the A domain of FVIII. According to the accession number 2R7E (PDB: 2R7E) of the mature FVIII stored in the PDB database and as Fig.38 and 39 In the secondary structure shown in , A1-1 is located between β strand 1 and β strand 2, A1-2 is located between β strand 11 and β strand 12, A2-1 is located between β strand 22 and β strand 23, A2-2 is located between β strand 32 and β strand 33, A3-1 is located between β strand 38 and β strand 39, and A3-2 is located between β strand 45 and β strand 46. Fig.38 and 39 The secondary structure of PDB accession number 2R7E shown in corresponds to the standardized secondary structure assignment according to the DSSP program (Kabsch and Sander, Biopolymers, 22: 2577-2637 (1983)). The DSSP secondary structure of mature FVIII stored under PDB accession number 2R7E can be obtained from the DSSP database available at the World Wide Web site swift.cmbi.ru.nl / gv / dssp / (last accessed on February 9, 2012) (Joosten et al., 39 (Suppl 1): D411-D419 (2010)).

[0374] In certain aspects, the surface-exposed flexible loop structure comprising A1-1 corresponds to a region from about amino acid 15 to about amino acid 45 of FIG. 30 in natural mature human FVIII. In certain aspects, A1-1 corresponds to a region from about amino acid 18 to about amino acid 41 of FIG. 30 in natural mature human FVIII. In certain aspects, the surface-exposed flexible loop structure comprising A1-2 corresponds to a region from about amino acid 201 to about amino acid 232 of FIG. 30 in natural mature human FVIII. In certain aspects, A1-2 corresponds to a region from about amino acid 218 to about amino acid 229 of FIG. 30 in natural mature human FVIII. In certain aspects, the surface-exposed flexible loop structure comprising A2-1 corresponds to a region from about amino acid 395 to about amino acid 421 of FIG. 30 in natural mature human FVIII. In certain aspects, A2-1 corresponds to a region from about amino acid 397 to about amino acid 418 of FIG. 30 in natural mature human FVIII. In certain aspects, the surface-exposed flexible loop structure comprising A2-2 corresponds to a region from about amino acid 577 to about amino acid 635 of FIG. 30 in natural mature human FVIII. In certain aspects, A2-2 corresponds to a region from about amino acid 595 to about amino acid 607 of FIG. 30 in natural mature human FVIII. In certain aspects, the surface-exposed flexible loop structure comprising A3-1 corresponds to a region from about amino acid 1705 to about amino acid 1732 of FIG. 30 in natural mature human FVIII. In certain aspects, A3-1 corresponds to a region from about amino acid 1711 to about amino acid 1725 of FIG. 30 in natural mature human FVIII. In certain aspects, the surface-exposed flexible loop structure comprising A3-2 corresponds to a region from about amino acid 1705 to about amino acid 1732 of FIG. 30 in natural mature human FVIII. Figure 3 30 . In certain aspects, A3-2 corresponds to the region from about amino acid 1884 to about amino acid 1917 of native mature human FVIII.

[0375] In certain aspects, the recombinant FVIII protein of the present invention comprises one or more XTEN permissive loops inserted into FVIII, or an XTEN sequence inserted into the a3 region, wherein the recombinant FVIII protein has procoagulant activity and can be expressed in a host cell in vivo or in vitro. The XTEN sequence to be inserted includes those XTEN sequences that increase the in vivo half-life or in vivo or in vitro stability of FVIII.

[0376] In certain aspects, the recombinant FVIII proteins of the invention comprise an XTEN sequence inserted immediately downstream of one or more amino acids corresponding to one or more amino acids in mature native human FVIII, including but not limited to: amino acid 18 of Figure 30, amino acid 26 of Figure 30, amino acid 40 of Figure 30, amino acid 220 of Figure 30, amino acid 224 of Figure 30, amino acid 399 of Figure 30, amino acid 403 of Figure 30, amino acid 599 of Figure 30, amino acid 603 of Figure 30, amino acid 1711 of Figure 30, amino acid 1720 of Figure 30, amino acid 1725 of Figure 30, amino acid 1900 of Figure 30, amino acid 1905 of Figure 30, amino acid 1910 of Figure 30, or any combination thereof; including corresponding insertions in the BDD variants of FVIII described herein.

[0377] In some aspects, the recombinant FVIII protein of the present invention comprises at least one XTEN sequence inserted in the a3 region of FVIII alone or in combination with one or more XTEN permissive loops (e.g., A1-1, A1-2, A2-1, A2-2, A3-1, or A3-2 as described above) inserted into the A domain, wherein the recombinant FVIII protein has procoagulant activity and can be expressed in vivo or in a host cell in vitro. In some aspects, at least one XTEN sequence is inserted into the a3 region immediately downstream of the amino acid corresponding to amino acid 1656 of Figure 30. In certain aspects, the recombinant FVIII protein of the invention comprises an XTEN sequence inserted into the a3 region as described, and further comprises one or more XTEN sequences inserted immediately downstream of one or more amino acids corresponding to one or more amino acids in mature native human FVIII, including but not limited to: amino acid 18 of FIG. 30, amino acid 26 of FIG. 30, amino acid 40 of FIG. 30, amino acid 220 of FIG. 30, amino acid 224 of FIG. 30, amino acid 399 of FIG. 30, amino acid 403 of FIG. 30, amino acid 599 of FIG. 30, amino acid 603 of FIG. 30, amino acid 1711 of FIG. 30, amino acid 1720 of FIG. 30, amino acid 1725 of FIG. 30, amino acid 1900 of FIG. 30, amino acid 1905 of FIG. 30, amino acid 1910 of FIG. 30, or any combination thereof.

[0378] Those skilled in the art will appreciate that the aforementioned aspects of the permissive loops of the native FVIII protein into which the heterologous protein may be inserted may also be applicable to the B-domain deleted FVIII variants described herein; for example, the sequences set forth in Table 1. In practicing the present invention, it will be appreciated that the BDD-FVIII sequences of Table 1 may be substituted for the recombinant FVIII proteins of the various embodiments described above, and it is believed that the resulting constructs will similarly retain procoagulant activity.

[0379] 4. Interference with FVIII binders

[0380] One object of the present invention is to provide the accelerator blood coagulation CFXTEN fusion protein compositions in the human patient suffering from the coagulopathy such as hemophilia A, the patient has the natural or acquired antibody, inhibitor or other protein or molecule of the activity or half-life of the influence CFXTEN fusion protein in conjunction with FVIII, wherein CFXTEN retains a larger amount of accelerator blood coagulation activity than the corresponding FVIII that is not connected to XTEN.As used herein, " FVIII binding agent " refers to any molecule that can be combined with natural FVIII or the recombinant factor VIII fusion protein of the factor VIII or its fragment that comprises natural, derived or recombinant production of the present invention.Clearly encompassed is that the FVIII binding agent comprises anti-FVIII antibody and FVIII inhibitor and can specifically bind other proteins of FVIII.On the one hand, the present invention provides the accelerator blood coagulation CFXTEN fusion protein that reduces with the combination of the anti-FVIII antibody or FVIII inhibitor of the accelerator blood coagulation activity that disturbs FVIII. As used herein, "anti-FVIII antibody" or "anti-factor VIII antibody" refers to an antibody capable of binding to the FVIII component of FVIII or CFXTEN of the present invention, including but not limited to the antibodies of Table 10 or polyclonal antibodies from hemophilia A patients with FVIII inhibitors. The term antibody includes monoclonal antibodies, polyclonal antibodies, antibody fragments, and antibody fragment clones. As used herein, "FVIII inhibitor" or "anti-FVIII inhibitor antibody" refers to an antibody capable of binding to the FVIII component of FVIII or CFXTEN of the present invention and reducing the procoagulant activity of the FVIII component of FVIII or CFXTEN by any means. On the other hand, the present invention provides CFXTEN fusion proteins retaining procoagulant activity in the presence of a FVIII inhibitor. On the other hand, the present invention provides a CFXTEN fusion protein comprising a FVIII that exhibits an increased terminal half-life in the presence of a FVIII binding agent compared to a FVIII that is not connected to XTEN.

[0381] Most inhibitory antibodies against human factor VIII act by binding to epitopes located in the A2 domain or the C2 domain of factor VIII, thereby disrupting specific functions associated with these domains (U.S. Pat. No. 6,770,744; Fulcher et al. Localization of human factor FVIII inhibitor epitopes to two polypeptide fragments. Proc. Natl. Acad. Sci. USA (1985) 82: 7728-7732; Scandella et al. Epitope mapping of human factor VIII inhibitor antibodies by deletion analysis of fVIII fragments expressed in Escherichiacoli. Proc. Natl. Acad. Sci. USA (1988) 85: 6152-6156). Although 68% of inhibitory antibodies are reported to be directed against the A2 and / or C2 domains, 3% act against the A1 domain and 46% act against the a3 acidic region (Lavigne-Lissalde, G et al. Characteristics, mechanisms of action, and epitope mapping of anti-factor VIII antibodies. Clin Rev Allergy Immunol (2009) 37: 67-79). For example, some heavy chain-specific inhibitors react with the 18.3 kD amino-terminal segment of the A2 domain (Scandella D et al. 1988); Lollar P et al. Inhibition of human factor VIIIa by anti-A2 subunit antibodies. J Clin Invest 1994; 93: 2497). FVIII contains a phospholipid binding site between amino acids 2302 and 2332 in the C2 domain, and there is also a von Willebrand factor binding site in the C2 domain that acts together with amino acids 1649-1689 in the A3 domain. The C2 domain also has an epitope that, when bound by an inhibitor, blocks activation of FVIII by thrombin or Factor Xa.Inhibitors that specifically bind to the light chain recognize an epitope in the A3 domain or a major antigenic region in the C2 domain and can lead to a decrease in procoagulant activity by preventing FVIII from binding to phospholipids or reducing the dissociation rate of FVIII from von Willebrand factor (Gilles JG et al. Anti-factor VIII antibodies of hemophiliac patients are frequently directed towards nonfunctional determinants and do not exhibit isotypic restriction. Blood (1993) 82: 2452; Shima M et al. A factor VIII neutralizing monoclonal antibody and a human inhibitor alloantibody recognizing epitopes in the C2 domain inhibitfactor VIII binding to von Willebrand factor and to phosphatidylserine. Thromb Haemost (1993) 69: 240). Non-limiting examples of monoclonal FVIII inhibitors are listed in Table 9. In patients with high titer inhibitors, there is an increased risk of developing recurrent bleeding in specific joints, which can ultimately lead to reduced quality of life, disability, or death from excessive bleeding (U.S. Patent Application No. 20120065077; Zhang et al., Clinic. Rev. Allerg. Immunol., 37: 114-124 (2009); Gouw and van den Berg, Semin. Thromb. Hemost., 35: 723-734 (2009)).

[0382] Without intending to be bound by any particular theory, it is believed that the unstructured features of the XTEN incorporated into the CFXTEN fusion protein allow the XTEN to adopt a conformation that results in steric hindrance to inhibitors that would otherwise bind to the FVIII epitope. Figure 6 As described in , when the incorporated XTEN adopts various random coil conformations, it spatially covers various regions of the FVIII component of the fusion protein and sterically interferes with the ability of the inhibitor to bind to the FVIII epitope.

[0383] In one embodiment, the present invention provides CFXTEN that shows procoagulant activity and combines with reduction in the presence of antibodies in the C2 domain of factor VIII compared to the corresponding factor VIII and / or natural FVIII that are not connected to XTEN.In another embodiment, the present invention provides CFXTEN that shows procoagulant activity and combines with reduction in the presence of antibodies in the A2 domain of factor VIII compared to the corresponding factor VIII or natural FVIII that are not connected to XTEN.In another embodiment, the present invention provides CFXTEN that shows procoagulant activity and combines with reduction in the presence of antibodies in the A2 and C2 domains of factor VIII compared to the corresponding factor VIII or natural FVIII that are not connected to XTEN.In one embodiment, the present invention provides CFXTEN that shows procoagulant activity and combines with reduction in the presence of antibodies in the group consisting of antibodies selected from table 10 compared to the corresponding FVIII that is not connected to XTEN.In one embodiment, the CFXTEN fusion protein shows reduction in combination with antibody GMA8021. In another embodiment, the CFXTEN fusion protein exhibits reduced binding to antibody GMA8008. In another embodiment, the CFXTEN fusion protein exhibits reduced binding to antibody ESH4. In another embodiment, the CFXTEN fusion protein exhibits reduced binding to antibody ESH8. In another embodiment, the CFXTEN fusion protein exhibits reduced binding to antibody B02C11. In another embodiment, compared to the corresponding FVIII not connected to XTEN, in the presence of plasma from hemophilia A subjects with polyclonal antibody FVIII inhibitors, the CFXTEN fusion protein exhibits reduced binding and greater procoagulant activity, wherein the greater procoagulant activity is measured by in vitro assays such as the Bitestar assay or other assays described herein.

[0384] The CFXTEN that shows the combination reduction by FVIII inhibitor can have one or two or three or four or five or six or more individual XTEN, and its embodiment is disclosed in this article.In the aforementioned embodiment of this paragraph, when assessing in vitro in the mensuration (as mensuration as described below herein or those mensuration known in the art) that can measure the combination of antibody and FVIII, CFXTEN shows at least 5% or 10% or 15% or 20% or 30% or 40% or 50% or 60% or 70% or less with the combination of antibody.Or, can be as described in the embodiment, by comparing to the FVIII that is not connected to XTEN, keep the accelerative blood coagulation activity of higher degree under antibody existence to assess the combination reduction of theme CFXTEN and FVIII binding antibody. Thus, in embodiments with respect to reduced binding by a FVIII inhibitor described herein, the CFXTEN exhibits at least 5%, or 10%, or 15%, or 20%, or 30%, or 40%, or 50%, or 60%, or 70%, or 80%, or 100%, or 200%, or 300%, or 400%, or 500% or more activity in a coagulation assay (as described herein below) when reacted with an anti-FVIII antibody, compared to the corresponding FVIII not linked to the XTEN and reacted with the antibody. In the foregoing, the anti-FVIII antibody can be an antibody from Table 9 or a circulating anti-FVIII antibody from a hemophilia A subject. In another embodiment, the invention provides CFXTEN, wherein the fusion protein assayed produces a Bethesda titer that is at least about 2, 4, 6, 8, 10, 12, 15, 20, 30, 40, 50, 60, 70, 80, 100, or 200 Bethesda units less than FVIII not linked to the XTEN and assayed under similar conditions when assayed using the Bethesda assay and an anti-FVIII antibody or polyclonal anti-FVIII antibody preparation selected from Table 10 (such as, but not limited to, plasma from a hemophilia A subject with a FVIII inhibitor). In another embodiment, the invention provides CFXTEN, wherein the fusion protein assayed produces less than 50%, or less than 40%, or less tha...

Claims

1. A recombinant Factor VIII fusion protein comprising a Factor VIII polypeptide fused to at least one extended recombinant polypeptide (XTEN), wherein the Factor VIII polypeptide comprises an A1 domain, an A2 domain, an A3 domain, an a3 domain, a C1 domain, a C2 domain, and optionally a B domain or a portion of the B domain.

2. The recombinant factor VIII fusion protein of claim 1, wherein the at least one XTEN is inserted within at least one domain selected from the A1 domain, the A2 domain, the A3 domain, the B domain, the a3 domain, the C1 domain, or the C2 domain, or the at least one XTEN is fused to the C-terminus of the factor VIII polypeptide.

3. The recombinant Factor VIII fusion protein of claim 1, wherein the at least one XTEN is either inserted into the B domain or a portion of the B domain, or fused to the C-terminus of the Factor VIII polypeptide, or both.

4. The recombinant Factor VIII fusion protein of claim 1, wherein the at least one XTEN is inserted in the A1 domain, the A2 domain, the A3 domain, the a3 domain, or any combination thereof.

5. The recombinant Factor VIII fusion protein of claim 2 or 4, wherein the A1 domain comprises a permissive loop-1 (A1-1) region and a permissive loop-2 (A1-2) region, wherein the at least one XTEN is inserted in A1-1, A1-2, or both.

6. The recombinant factor VIII fusion protein of claim 2 or 4, wherein the A2 domain comprises a permissive loop-1 (A2-1) region and a permissive loop-2 (A2-2) region, wherein the at least one XTEN is inserted in A2-1, A2-2, or both.

7. The recombinant factor VIII fusion protein of claim 2 or 4, wherein the A3 domain comprises a permissive loop-1 (A3-1) region and a permissive loop-2 (A3-2) region, wherein the at least one XTEN is inserted in A3-1, A3-2, or both.

8. The recombinant factor VIII fusion protein of claim 5, wherein the permissive loop-1 (A1-1) region corresponds to the region from about amino acid 15 to about amino acid 45 of SEQ ID NO: 2 in native mature human factor VIII, and wherein the at least one XTEN is inserted into A1-1.

9. The recombinant factor VIII fusion protein of claim 5, wherein the permissive loop-1 (A1-1) region corresponds to the region from about amino acid 18 to about amino acid 32 of SEQ ID NO: 2 in native mature human factor VIII, and wherein the at least one XTEN is inserted into A1-1.

10. The recombinant factor VIII fusion protein of claim 5, wherein the permissive loop-2 (A1-2) region corresponds to the region from about amino acid 201 to about amino acid 232 of SEQ ID NO: 2 in native mature human factor VIII, and wherein the at least one XTEN is inserted into A1-2.

Images