A C-to-K base editor for plants

Abstract

The present invention belongs to the field of mutation or genetic engineering, and discloses a base editor for plant C to K. The technical problem solved by the present invention is how to achieve base editing from C to K in plants. The base editor for plant C to K disclosed in the present invention contains Cas protein and uracil DNA glycosylase, and the amino acid sequence of uracil DNA glycosylase is the 20-244th position of SEQ ID No.2. Experiments have shown that the base editor of the present invention achieves targeted C to K editing with a base editing efficiency of up to 66.66%, broadening the scope of base editors. By accurately solving single nucleotide variations that affect plant traits, base editors have paved the way for optimizing crop traits (such as disease resistance, drought resistance and yield).

Description

Technical Field

[0001] The present invention belongs to the field of mutation or genetic engineering, and specifically relates to a base editor for plant C to K. Background Art

[0002] Base editors achieve high-precision and high-efficiency single-base editing, providing powerful tools for fields such as life sciences and medicine, and greatly promoting the research of plant functional genomics and crop improvement. So far, two major types of base editors have been developed: deaminase-based base editors (dBE) and glycosylase-based base editors (gBE). All dBE base conversions require the deamination of adenine (A) or cytosine (C) as the first key step. In recent years, some researchers have also developed a base editor that can directly edit guanine (G) based on the evolved human N-methylpurine DNA glycosylase (MPG). In plants, the evolving DNA base editors have achieved direct editing of adenine (A), cytosine (C) and guanine (G), however, base editors that achieve efficient deaminase-free cytosine (C) to guanine and thymine (K) have not yet been developed. Summary of the invention

[0003] The technical problem to be solved by the present invention is how to achieve base editing from C to K (K is G or T) in plants, especially rice.

[0004] To solve the above technical problems, the present invention first provides a protein, which is a base editor for plant C to K (named CKBE), which contains Cas protein and uracil DNA glycosylase, and the uracil DNA glycosylase is shown in positions 20-244 of SEQ ID No.2.

[0005] The Cas protein refers to an RNA-guided nuclease comprising a Cas9 protein or a fragment thereof (e.g., a protein comprising an active, inactive or partially active DNA cleavage domain of Cas9, and / or a gRNA binding domain of Cas9), which may be an nCas9 protein, such as nCas9 (D10A). The nCas9 protein may be as shown in positions 277-1643 of SEQ ID No. 2.

[0006] The above-mentioned base editor can be a protein formed by connecting the uracil DNA glycosylase, the Cas protein and the nuclear localization signal.

[0007] The nuclear localization signal may be a bipartite nuclear localization sequence (bpNLS), such as the bipartite nuclear localization sequence shown at positions 1-19 and 1648-1664 of SEQ ID No.2.

[0008] The uracil DNA glycosylase, the Cas protein and the nuclear localization signal can be directly connected or connected through a common connecting peptide, as long as it does not affect the function of the base editor. In an embodiment of the present invention, the connecting peptide is 245-276 and 1644-1647 of SEQ ID No.2.

[0009] Specifically, the base editor can be A1) the protein shown in SEQ ID No.2, or A2) a protein having the same function by replacing and / or deleting and / or adding one or several amino acid residues in the amino acid sequence shown in SEQ ID No.2 in the sequence list, or A3) a fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of A1) or A2).

[0010] The protein in A2) above is a protein having 75% or more identity with the amino acid sequence of the protein shown in SEQ ID No.2 and having the same function. Identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as a matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default value) respectively, and searching for the identity of a pair of amino acid sequences, the identity value (%) can be calculated, and then the identity value (%) can be obtained. The 75% or greater identity may be 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% greater identity.

[0011] The protein in A2) above can be artificially synthesized, or its encoding gene can be synthesized first and then expressed biologically.

[0012] The coding gene of the protein in A2) above can be obtained by deleting one or several codons of amino acid residues in the DNA sequence shown in SEQ ID No.1, and / or performing missense mutation of one or several base pairs, and / or attaching a coding sequence of a tag at its 5′ end and / or 3′ end. The DNA molecule shown in SEQ ID No.1 encodes the CKBE protein shown in SEQ ID No.2.

[0013] The tag in A3) can be a polypeptide or protein fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag and / or SUMO tag, etc.

[0014] In the above, the connection refers to the connection between proteins or polypeptides through a peptide bond formed by an amino acid residue at the C-terminus of one protein or polypeptide and an amino acid residue at the N-terminus of another protein or polypeptide.

[0015] The present invention also provides a biological material related to the base editor, wherein the biological material is at least one of the following B1) to B7):

[0016] B1) a nucleic acid molecule encoding the base editor;

[0017] B2) an expression cassette containing the nucleic acid molecule described in B1);

[0018] B3) a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2);

[0019] B4) a recombinant microorganism containing the nucleic acid molecule described in B1), a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0020] B5) a transgenic plant cell line containing the nucleic acid molecule described in B1), a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3);

[0021] B6) transgenic plant tissue containing the nucleic acid molecule described in B1), transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3);

[0022] B7) A transgenic plant organ containing the nucleic acid molecule described in B1), a transgenic plant organ containing the expression cassette described in B2), or a transgenic plant organ containing the recombinant vector described in B3).

[0023] In the above biological material, the nucleic acid molecule described in B1) may be the following: b11) or b12):

[0024] b11) Coding sequence (CDS) is a DNA molecule whose nucleotide sequence is SEQ ID No. 1 in the sequence list;

[0025] b12) A DNA molecule that has 75% or more identity with the nucleotide sequence defined in b11) and encodes the base editor.

[0026] b11) The DNA molecule may specifically be a DNA molecule whose nucleotide sequence of the coding strand is SEQ ID No. 1 in the sequence list.

[0027] Those skilled in the art can easily mutate the nucleotide sequence encoding CKBE of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequence of CKBE of the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode CKBE and have CKBE function.

[0028] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the present invention encoding the protein consisting of the amino acid sequence shown in SEQ ID No.2. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0029] Specifically, the above-mentioned 75% or more identity may be 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or more identity.

[0030] In the above-mentioned biological material, the expression cassette refers to a DNA capable of expressing CKBE in a host cell (such as a plant cell), and the DNA may include not only a promoter for initiating transcription of the CKBE gene, but also a terminator for terminating transcription of the CKBE gene. Further, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters, tissue, organ and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to, the Ubiquitin promoter of corn, the constitutive promoter 35S of cauliflower mosaic virus; the wound-inducible promoter from tomato, leucine aminopeptidase ("LAP"); the chemically inducible promoter from tobacco, pathogenesis-related protein 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiocarboxylic acid S-methyl ester)); the tomato proteinase inhibitor II promoter (PIN2) or the LAP promoter (both inducible by methyl jasmonate); heat shock promoters (U.S. Pat. No. 5,187,267); tetracycline-inducible promoters (U.S. Pat. No. 5,057,422); seed-specific promoters, such as millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 2007 1 0099169.7)), seed storage protein-specific promoters (e.g., phaseolusin, napin, oleosin and soybean beta conglycin) The terminators are promoters of plants (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62,

[0031] In one embodiment of the present invention, the expression of the CKBE gene is driven by the ZmUBI promoter.

[0032] In the above biological materials, the vector may be a plasmid, a cosmid, a phage or a virus vector.

[0033] B3) The recombinant vector may specifically be pCKBE. pCKBE is a recombinant vector obtained by replacing the DNA fragment between the KpnI and SpeI recognition sequences of the rABE8e vector (containing bpNLS, TadA8e V106W, 32aa linker and the coding gene of nCas9) with the CKBE gene shown in SEQID No.1. pCKBE contains the DNA molecule of sgRNA and the CKBE gene, the transcription of sgRNA is driven by the OsU6 promoter, and the expression of the CKBE gene is driven by the ZmUBI promoter.

[0034] In the above biological materials, the microorganism can be yeast, bacteria, algae or fungi. Among them, the bacteria can be Agrobacterium, such as Agrobacterium EHA105.

[0035] Among the above-mentioned biological materials, the transgenic plant cell lines, transgenic plant tissues and transgenic plant organs may or may not include propagation materials.

[0036] The present invention also provides a method for base editing from C to K in plants, the method comprising: introducing the coding gene of the base editor (or its expression box) and the DNA molecule of sgRNA (or its expression box) into the target plant, and expressing / transcribing the base editor and sgRNA, screening C to K editing plants or tissues in the target sequence, and realizing base editing from C to K in plants.

[0037] The base editor encoding gene (or its expression box) and the DNA molecule (or its expression box) of the sgRNA targeting the target sequence can be introduced into the target plant through the same vector or through different vectors.

[0038] In an embodiment of the present invention, the expression cassette of the base editor and the expression cassette of the sgRNA targeting the target sequence are introduced into the target plant through pCKBE.

[0039] The target sequence of the sgRNA is 5′-N 19-20 PAM-3′, the N 19-20 The N is 19-20 Ns, the PAM (protospacer adjacent motif) is NGG, and the N is A, G, C or T.

[0040] The present invention also provides the use of the base editor or the biological material in base editing or in the preparation of a base editing product (reagent or kit), wherein the base editing is editing from C to K (or insertion or deletion) in plants.

[0041] In the present invention, the C to K base editing can be the editing of C at any of positions 2-7, 9-11, 13, 15 and 16 in the target sequence.

[0042] The position in the target sequence is determined based on the PAM sequence. The first position of the target sequence farthest from the PAM sequence is recorded as position 1, and positions 2, 3, etc. gradually move closer to the PAM sequence.

[0043] In the present invention, the C to K base editing is base editing in a target sequence whose PAM sequence is NGG.

[0044] In the present invention, the plant may be M1) or M2) or M3):

[0045] M1) monocots or dicots;

[0046] M2) Gramineae;

[0047] M3) Rice.

[0048] Experiments have shown that the base editor of the present invention has a base editing efficiency of up to 46.06% in callus tissue, and analysis of eight endogenous target sites in T0 rice plants showed that CKBE achieved targeted C to K editing with a base editing efficiency of up to 66.66%, broadening the scope of base editors. By accurately addressing single nucleotide variations that affect plant traits, base editors have paved the way for optimizing crop traits such as disease resistance, drought resistance, and yield.

[0049] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0050] The term "base editor (BE)" or "nucleobase editor (NBE)" refers to a reagent comprising a polypeptide that is capable of modifying a base (e.g., A, T, C, G, or U) within a nucleic acid (e.g., DNA or RNA).

[0051] The term "nuclear localization sequence" or "NLS" refers to an amino acid sequence that facilitates the import of a protein into the cell nucleus (eg, by nuclear transport).

[0052] The term "promoter" refers to a control region of a nucleic acid sequence that controls the initiation and transcription rate of the remainder of the nucleic acid sequence. A promoter may also contain subregions to which regulatory proteins and molecules (such as RNA polymerase and other transcription factors) may bind.

[0053] The terms "nucleic acid" and "nucleic acid molecule" refer to a compound comprising a nucleobase and an acidic moiety (e.g., a nucleoside, a nucleotide, or a polymer of nucleotides). Typically, a polymeric nucleic acid, such as a nucleic acid molecule comprising three or more nucleotides, is a linear molecule in which adjacent nucleotides are linked to each other via phosphodiester linkages.

[0054] The terms "protein", "peptide" and "polypeptide" are used interchangeably herein and refer to a polymer of amino acid residues linked together by peptide (amide) bonds. The term refers to proteins, peptides or polypeptides of any size, structure or function. Typically, a protein, peptide or polypeptide will be at least three amino acids long. A protein, peptide or polypeptide may refer to an individual protein or a collection of proteins. One or more amino acids in a protein, peptide or polypeptide may be modified, for example by adding chemical entities such as carbohydrate groups, hydroxyl groups, phosphate groups, farnesyl groups, isofarnesyl groups, fatty acid groups, joints for conjugation, functionalization or other modifications, etc. A protein, peptide or polypeptide may also be a single molecule or may be a multimolecular complex. A protein, peptide or polypeptide may be only a fragment of a naturally occurring protein or peptide. A protein, peptide or polypeptide may be naturally occurring, recombinant or synthetic, or any combination thereof. The term "fusion protein" as used herein refers to a hybrid polypeptide comprising protein domains from at least two different proteins. A protein may be located at the amino terminal (N-terminal) portion of a fusion protein or a carboxyl terminal (C-terminal) protein, thereby forming an "amino terminal fusion protein" or a "carboxyl terminal fusion protein", respectively. The protein can comprise different domains, such as a nucleic acid binding domain (e.g., the gRNA binding domain of Cas9 that guides the protein to bind to the target site) and a nucleic acid cleavage domain or a catalytic domain of a nucleic acid editing protein.

[0055] The term "RNA-guided nuclease" refers to a nuclease that forms a complex (e.g., binds or associates) with one or more RNAs that are not cleavage targets. Typically, the bound RNA is referred to as a guide RNA (gRNA). The gRNA can exist as a complex of two or more RNAs or as a single RNA molecule. A gRNA that exists as a single RNA molecule can be referred to as a single guide RNA (sgRNA).

[0056] RNA-guided nucleases such as Cas9 use RNA:DNA hybridization to target DNA cleavage sites, so these proteins can in principle be targeted to any sequence specified by the guide RNA.

[0057] The term "target site" refers to the binding location of the base editor in the plant genome under the guidance of sgRNA.

[0058] The term "recombinant" refers to a protein or nucleic acid that does not occur in nature but is the product of human engineering. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 . Schematic diagram of the key fragments of pCKBE in Example 1. ∨: 1-88 amino acids of human UNG2 truncation.

[0060] Figure 2.Editing efficiency and characteristics of CKBE in rice. (a) Summary of CKBE editing efficiency of endogenous genes in stable T0 transgenic plants. In the “Target sequence (PAM)” column, red fonts indicate the C bases that were detected to have been edited; “Stable editing in T0 plants” is the editing efficiency. The numbers in brackets in each column indicate the number of T0 plants with at least one C edited in the target sequence on the left side of “ / ” and the number of T0 plants detected on the right side. (b) Summary of CKBE editing efficiency of endogenous genes in approximately 250 positive calli per transformation. (c) Average frequency of C conversion by CKBE at editing sites 1-20 (where PAM is located at positions 21-23). ​​(d, e, f) Frequency of T (d), G (e) and A (f) conversions by CKBE at editing sites 1-20 (where PAM is located at positions 21-23) in Figure (a). (g) Editing purity percentage of C to K conversion achieved by pCKBE at different target sites in Figure (a). In the figure, pCKBE represents the base editor CKBE. DETAILED DESCRIPTION

[0061] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources. The quantitative tests in the following examples were all repeated at least three times, and the results were averaged. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.

[0062] The rABE8e vector in the following embodiments is the binary plant expression vectors rABE8e-NGG in the literature (Wei, C., Wang, C., Jia, M., Guo, HX, Luo, PY, Wang, MG, Zhu, JK, and Zhang, H. (2021). Efficient generation of homozygous substitutions in rice in one generation utilizing an rABE8e base editor. J. Integr. Plant Biol. 63: 1595–1599.). The public can obtain the biological material from the applicant. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0063] Example 1: Base editor CKBE can be used for editing C to K in rice

[0064] In this example, a cytosine (C) base editor was established in rice, named CKBE. The human uracil DNA glycosylase variant UNG2Δ88-K184A / N213D / A214V (mhUNGv2) was fused with Cas9 nickase (nCas9) and connected using a 32-amino acid linker (LINKER). In order to improve the efficiency of entering the cell nucleus, the fusion bipartite nuclear localization sequence (bpNLS) was fused with mhUNGv2 to form CKBE ( Figure 1 ), CKBE can achieve C to K (K = G or T) base editing in rice.

[0065] 1. Construction of recombinant vector

[0066] The DNA fragment between the KpnI and SpeI recognition sequences of the rABE8e vector (containing bpNLS, TadA8e V106W, 32aa linker, and the coding gene of nCas9) was replaced with the CKBE gene to obtain the recombinant vector pCKBE, which contains the DNA sequence of sgRNA and the CKBE gene. The transcription of sgRNA is driven by the OsU6 promoter, and the expression of the CKBE gene is driven by the ZmUBI promoter ( Figure 1 ).

[0067] The CKBE gene is shown in SEQ ID No.1, and encodes the CKBE fusion protein shown in SEQ ID No.2.

[0068] In SEQ ID No.1, positions 1-57 and positions 4942-4992 represent the bipartite nuclear localization DNA sequence, positions 58-732 represent the rice codon-optimized mhUNGv2 gene, positions 733-828 represent the coding DNA of the connecting peptide, positions 829-4929 represent the nCas9 gene, and positions 4930-4941 represent the coding DNA of the connecting peptide.

[0069] In SEQ ID No. 2, positions 1-19 and positions 1648-1664 represent the bipartite nuclear localization sequence, positions 20-244 represent the mhUNGv2 protein, positions 245-276 represent the linker peptide (LINKER), positions 277-1643 represent the nCas9 protein, and positions 1644-1647 represent the linker peptide.

[0070] Construction of three target genes targeting rice ( oeLh , OsNRT1.1B and OsARF2)sgRNA expression vector: A 23-nucleotide targeting sequence (including the PAM sequence) was selected and analyzed using CRISPR-P. The 20-nucleotide Spacer sequence (target sequence) was cloned and inserted into the pCKBE vector using the Golden Gate method. The resulting recombinant vector is the sgRNA expression vector, which can transcribe sgRNAs targeting various targets in rice genes and express pCKBE fusion proteins.

[0071] The target sequences used in pCKBE are as follows:

[0072] oeLh The three targets and targeting sequences of the gene are: target SG1, targeting sequence GCGTCACGTTCCACAAGGCCAGG (SEQ ID No. 3); target SG2, targeting sequence CGGTGCGTCATCCCCATGGGCGG (SEQ ID No. 4); target SG3, targeting sequence GCCGTACGACCCGGGGTACCAGG (SEQ ID No. 5);

[0073] OsNRT1.1B The three targets and targeting sequences of the gene are: target SG1, targeting sequence ACTAGATATCTAAACCATTAAGG (SEQ ID No. 6); target SG2, targeting sequence AGACTTGGATCTTGCAGTGGCGG (SEQ ID No. 7); target SG3, targeting sequence TGCTAGTTTCCACTGGAGAAAGG (SEQ ID No. 8);

[0074] OsARF2 The two targets and targeting sequences of the gene are: target SG1, targeting sequence ACACCTTGAGCTCGACGTTGAGG (SEQ ID No.9); target SG2, targeting sequence ATACCTAGGTTTGTAGTAGACGG (SEQ ID No.10).

[0075] 2. Agrobacterium-mediated genetic transformation of rice and genotype identification

[0076] Xiushui 134 rice variety was used as the target plant. After inducing callus tissue from its seeds, the sgRNA expression vectors obtained in step 1 were introduced into EHA105 Agrobacterium (Weidi Biotechnology) respectively, and the rice was genetically transformed using the Agrobacterium-mediated rice genetic transformation method to obtain hygromycin B-resistant callus tissue, which was further cultured to obtain T0 generation transgenic plants.

[0077] For each vector, approximately 250 hygromycin B-resistant calli were selected and mixed to extract genomic DNA. Primers were designed upstream and downstream of the target sequence to amplify the target sequence and perform Hi-TOM sequencing to evaluate the mutation frequency. In order to genotype the T0 generation transgenic plants, genomic DNA was extracted from the leaves. The target site was amplified using two rounds of PCR and analyzed by next-generation sequencing (NGS). In the Hi-TOM test, the editing efficiency was determined with a threshold of 10%.

[0078] 3. Results

[0079] To study the editing properties of CKBE at endogenous loci in rice, the inventors selected three genes ( OsNRT1.1B , OsARF2 and oeLh ) A total of 8 targets were used to test editing activity and editing window ( Figure 2 (a)). Genomic DNA was extracted from approximately 250 positive calli for each transformation and analyzed by Hi-TOM. Sequencing of the target site showed that the base conversion efficiency from C to K in the positive calli (i.e., base editing efficiency, which is defined as the proportion of C to K detected in Hi-TOM sequencing of the target gene site) was as high as 46.06% (ranging from 5.55% to 46.06%) ( Figure 2 The inventors also found that CKBE induced insertion or deletion mutations (InDel) at 8 editing sites, with frequencies ranging from 19.05% to 45.57%.

[0080] To evaluate the performance of CKBE in stable transgenic rice, the inventors selected eight targets for three genes in rice ( OsNRT1.1B , OsARF2 and oeLh ) endogenous sites to test editing activity and editing window. A total of 255 T0 stably edited plants were obtained and analyzed by Hi-TOM. Sequencing of the target sites (22 to 47 T0 plants per target site) showed that the base conversion efficiency of C to K in transgenic rice plants (i.e., base editing efficiency, which is defined as the percentage of T0 plants with at least one C edited to K in the target sequence to the total number of T0 plants tested) was as high as 66.66% (range 26.09% to 66.66%; Figure 2 In (a), including C to G editing (average 28.60%) and C to T editing (average 15.68%). CKBE was also found to induce insertion or deletion mutations (InDel) at 8 editing sites, with frequencies ranging from 13.04% to 72.22% ( Figure 2 (a)). However, there was basically no editing of A, T or G at all the sites tested ( Figure 2(d)-(f)). It is noteworthy that the purity of C to G / T conversion (the percentage of C to G and T edited plants to the total number of C base edited plants) was higher than 80% ( Figure 2 (g). Therefore, this base editor was named plant C to K base editor, abbreviated as CKBE. After analyzing the sequences of all the detected sites, it was found that the editable range of CKBE was positions 2-7, 9-11, 13, 15 and 16 ( Figure 2 (c)).

[0081] In general, base editors, as a revolutionary class of genome editing tools, are not only of great significance in biomedical research and therapeutic advances, but also have great potential in agriculture. They can precisely modify DNA in cells without inducing double-strand breaks, thereby reducing off-target effects. By precisely addressing single nucleotide variations that affect plant traits, base editors have paved the way for optimizing crop traits such as disease resistance, drought resistance, and yield. However, there is still a need to further improve the efficiency of C base editors in plants. In this paper, a new deaminase-free base editor pCKBE was constructed, which can directly excise C using an engineered glycosylase (UNG), producing up to 66.66% C to K editing efficiency in stable rice lines. The engineered CKBE will enable multiple base conversions in plants, thereby expanding the plant base editing toolbox and potentially using it for research and genetic improvement of different crops.

[0082] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Use of biological materials related to base editors in base editing or in the preparation of base editing products, characterized in that: The amino acid sequence of the base editor is shown in SEQ ID No. 2, and the biological material is at least one of the following B1) to B5): B1) a recombinant vector containing a nucleic acid molecule, wherein the nucleic acid molecule is shown in SEQ ID No. 1; The recombinant vector is pCKBE, which is a DNA molecule in which the DNA fragment between the KpnI and SpeI recognition sequences of the rABE8e vector is replaced with the CKBE gene shown in SEQ ID No. 1, and contains sgRNA, the transcription of the sgRNA is driven by the OsU6 promoter, and the expression of the CKBE gene is driven by the ZmUBI promoter; B2) a recombinant microorganism containing a nucleic acid molecule or a recombinant microorganism containing the recombinant vector described in B1), wherein the nucleic acid molecule is shown in SEQ ID No. 1; B3) a transgenic plant cell line containing a nucleic acid molecule or a transgenic plant cell line containing the recombinant vector described in B1), wherein the nucleic acid molecule is shown in SEQ ID No. 1; B4) a transgenic plant tissue containing a nucleic acid molecule or a transgenic plant tissue containing the recombinant vector described in B1), wherein the nucleic acid molecule is shown in SEQ ID No. 1; B5) a transgenic plant organ containing a nucleic acid molecule or a transgenic plant organ containing the recombinant vector described in B1), wherein the nucleic acid molecule is shown in SEQ ID No. 1; The base editing is C to K editing in rice.

2. Use of biological materials related to base editors in base editing or in the preparation of base editing products, characterized in that: The amino acid sequence of the base editor is shown in SEQ ID No. 2, and the biological material is at least one of the following C1)-C5): C1) a recombinant vector containing an expression cassette, wherein the expression cassette is an expression cassette containing a DNA molecule as shown in SEQ ID No. 1; C2) a recombinant microorganism containing an expression cassette, wherein the expression cassette is an expression cassette containing a DNA molecule as shown in SEQ ID No. 1; C3) a transgenic plant cell line containing an expression cassette, wherein the expression cassette is an expression cassette containing a DNA molecule as shown in SEQ ID No. 1; C4) a transgenic plant tissue containing an expression cassette, wherein the expression cassette is an expression cassette containing a DNA molecule as shown in SEQ ID No. 1; C5) a transgenic plant organ containing an expression cassette, wherein the expression cassette is an expression cassette containing a DNA molecule as shown in SEQ ID No. 1; The base editing is C to K editing in rice.

Images