Azo compounds for treatment of fibrotic diseases

Abstract

The present invention relates to an azo compound of formula (I) for use in the treatment of fibrosis wherein the azo compound normalizes the collagen I mRNA levels of TGF [beta]-activated fibroblasts and reverses the production of collagen to normal levels in unstimulated fibroblasts # imgabs0 #

Description

Technical Field

[0001] The present invention relates to anti-fibrotic substances which can be used to treat fibrosis, in particular cardiac fibrosis. Background Art

[0002] Fibrosis is one of the largest disease groups for which there is still no effective treatment, although several potential therapeutic targets have been discussed (Leask, Circulation Research 2010, 106, 1675).

[0003] It is well known that fibrotic diseases can cause serious diseases if vital organs are involved. Enhanced infiltration of collagen in muscles or organs with basic body functions can completely hinder their functions. Known examples are connective tissue infiltration in the liver, kidneys, lungs and heart, where lungs and hearts account for the majority of fibrotic diseases, causing more than 800,000 deaths worldwide each year. In particular, myocardial fibrosis, which causes myocardial stiffness, is one of the main causes of end-stage heart failure (Mozaffarian et al., Heart disease and stroke statistics, Rep. Am. Heart Assoc. 2016, 133, e38-e360). The connective tissue infiltration that occurs in these fibrotic diseases is characterized by abnormal and excessive production of endogenous fibroblast collagen.

[0004] Despite the high medical need, there is currently no known established cure. Proposed treatments are mostly indirect, relying on inhibiting common but unspecific activators of fibroblast collagen production or eliminating overactive fibroblasts through toxic intervention points (Hinderer and Schenke-Leyland, Advanced Drug Delivery Reviews 2019, 146, 77; Fan and Guan, Biomaterials Res. 2016, 20, 13 / 1-13; Frangogiannis, Molecular Aspects of Medicine 2019, 65, 70).

[0005] Since it is known that elevated blood pressure causes mechanical stress to smooth muscle cells and can lead to fibroblast activation, the widespread use of antihypertensive drugs can also reduce the risk of fibrosis. Typical methods for lowering blood pressure include angiotensin converting enzyme inhibitors, aldosterone antagonists, angiotensin receptor blockers and calcium antagonists (RG Gourdie, S. Dimmeler, P. Kohl Nat. Rev. Drug Disc. 2016, 15, 620; Y. Shibasaki et al., Hypertens. Res. 2005, 28, 787). Although these drugs can improve general conditions, especially cardiovascular conditions, they are not specific methods for controlling excessive fibroblast activity. Their fine regulation in complex hypertension treatment regimens, known drug interactions, and the fact that they only alleviate one of a variety of fibroblast activation factors hinder their widespread use as prevention and treatment of fibrotic diseases. These considerations also apply to finerenone, a nonsteroidal mineralocorticoid receptor antagonist that is thought to have antifibrotic properties (B. Pitt et al., N Engl J Med 2021, 385:2252).

[0006] Some approaches rely on the inhibition of growth factors that play a general role in cell activation and intracellular signaling, primarily those that have been discussed or targeted for cancer therapy. These drugs include MMP inhibitors (FG Spinale, Phys. Rev. 2007, 87, 1285), mast cell function inhibitors (S. Oyamada, S. Bianchi, S. Takai, LM Chu, J. Pharm. Exp. Ther. 2011, 339, 143), monoclonal antibodies neutralizing MCP1 (S. Hayashidani et al. Circulation 2003, 108, 2134), CXC chemokine ligand 10 (M. Bujak, Circ. Res. 2009, 105, 973), endothelin pathway inhibitors (F. Rodriguez-Pascual, O. Busnadiego, J. Gonzales-Santamaria, Life Sci. 2014, 118, 156) and WNT signaling regulators (Daskalopoulos et al., Trends Cardiovasc. Med. 2013, 23, 121). These intervention points are not applicable to cell type specific interactions. Their known side effects make long term treatment of fibrosis unlikely to be successful. Anti-proliferative compounds do not reflect the important normal functions of fibroblasts.

[0007] In healthy hearts, fibroblasts are the main cell types involved in the formation and maintenance of connective tissue (KE Porter, NATurner Pharmacol. Ther. 2009, 123, 255). This tissue contains cellular and non-cellular components, and the extracellular matrix (ECM) provides flexible scaffolds for individual myocytes and the entire heart (JB Caulfield, TKB org, Lab. Invest. 1979, 40, 364). This highly organized collagen-rich reticular structure is formed by fibroblasts, which can stabilize the myocardial wall and support force transmission, but still allow complex tissue deformation patterns (PW Hales et al., Prog. Biophys. Mol. Biol. 2012, 110, 319). After myocardial injury, endothelial cells can undergo endothelial-mesenchymal transition (EndMT), resulting in fibrosis (EM Zeisberg et al., Nat Med. 2007, 13, 952). During this process, endothelial cells lose their endothelial properties and acquire mesenchymal or myofibroblast markers, such as expression of αSMA and secretion of type I collagen. Blocking the transformation of smooth muscle cells and collagen overproduction after cardiac injury, such as after multiple cell death caused by ischemia, is an important indication for non-toxic antifibrotic compounds.

[0008] In 2019, studies have shown that hydralazine and dihydralazine, two drugs that have been used clinically to treat hypertonia since 1952, have antifibrotic effects. For example, low doses of dihydralazine have a protective effect because it induces endogenous Tet3 / Tdg-mediated DNA demethylation activity, thereby reversing aberrant promoter Cpg island methylation (B. Tampe, D. Tampe, EM Zeisberg, GA Müller, W. Bechtel-Walz, M. Koziolek, R. Kalluri, M. Zeisberg, EBioMedicine 2015, 2, 19; G. Hasenfuss et al. DE102019126517 A12021.04 01). However, in addition to their potent antihypertensive effects, these two compounds also suffer from high inter-patient variability (JR Batchelor et al., Lancet 1980, 1(8178), 1107; AM Shepherd et al., Clin. Res. 1980, 28, 244A) and drug-induced lupus (M. Bourdi et al., Mol. Pharmacol. 1992, 42, 280; C. Chang, M. Gershwin, J. Autoimmunity 2010, 34, J266).

[0009] In summary, to date, there are no compounds for the treatment of fibrosis itself, and the proposed treatments are mostly indirect and rely on inhibiting common but unspecific activators of fibroblast collagen production or eliminating overactive fibroblasts through toxic intervention points. WO 2016 / 085981 A1 suggests the use of isoprenoid compounds, particularly geranyl-geranyl acetone, to inhibit, reduce or treat fibrosis. WO 2016 / 046130 A1 suggests the use of monoacylglycerol lipase (MGL) inhibitors. WO 2021 / 089828A1 discloses nucleic acid ligase inhibitors as possible treatments for fibrosis. This mode of action is generally anti-proliferative and, as a typical cancer treatment, has known adverse side effects.

[0010] The main factor that activates fibroblasts is the increase of endogenous TGFβ, which induces the enhancement of collagen I mRNA levels, leading to increased collagen production (M. Lodyga and B. Hinz, Semin. Cell. Dev. Biol. 2020, 101, 123; JM Carthy, J. Cell. Physiol. 2018, 233 (1), 98). This has been confirmed in cell culture and in vivo experiments (Lijnen, Pedrov and Fagard, Molecular Genetics and Metabol. 2000, 71, 418). Therefore, TGFβ stimulation of human renal fibroblast cell lines (tFKIF and tNKF) can create an in vitro model representing the pathophysiological mechanism of renal interstitial fibrosis, so that promising treatments can be determined (GA Müller et al., Exp. Nephrol. 1995, 3, 127).

[0011] In view of the foregoing, there is a need for compounds for the treatment of fibrosis that effectively reduce the formation of fibrotic fibers without causing deleterious side effects to the patient. Summary of the invention

[0012] The inventors surprisingly found that compounds of formula I normalize collagen 1 mRNA levels in TGFβ activated fibroblasts and reverse collagen production to normal levels seen in unstimulated fibroblasts. Examples 60 to 62 show the biological properties of the azo compounds of the invention.

[0013]

[0014] As previously mentioned, fibrotic diseases are characterized by abnormal and excessive production of endogenous fibroblast collagen. Adequate treatment of this disease should normalize fibroblast activity without toxic effects on the cell phenotype and hindering its normal connective tissue regeneration function, such as after injury or tissue damage. Unexpectedly, we found that the compounds of general formula I meet this requirement. Specifically, these structures weaken the elevated collagen production back to normal and reverse the fibrous phenotype of overactive fibroblasts to the phenotype of non-activated fibroblasts. This is not achieved by a toxic mode of action because it occurs at an effective level without signs of cytotoxicity. In this way, the compounds of general formula (I) reverse the typical elongated and fibrous phenotype of activated fibroblasts back to normal. This profound and powerful effect usually occurs at concentrations where no attenuation of classical housekeeping enzymes and proteins (such as GAPDH (Western-Blot) or reductase (MTT assay)) is observed.

[0015] Therefore, the compounds of general formula I are of great value for the prevention and treatment of fibrotic diseases with life-threatening consequences or seriously reduced quality of life. Examples of such diseases are not exclusive and include renal fibrosis, liver fibrosis, lung fibrosis and especially cardiac fibrosis.

[0016] Therefore, the present invention relates to an azo compound (I) for use in a method for treating or preventing fibrosis.

[0017] in,

[0018] R is selected from H, D, CN, NHR 5 、NDR 5 , Cl, OR 3 , SR 3 and C 1-4 A group consisting of alkyl groups, especially methyl;

[0019] X is N or CR 1 , wherein nitrogen and carbon atoms are aromatic atoms;

[0020] W is selected from a covalent bond, CR 4 (where the carbon atom is an aromatic ring atom), CH 2 , S, O, N (where the nitrogen atom is an aromatic ring atom), NH and NR 2 The group composed of;

[0021] X 1 Selected from covalent bonds, CR 4 (where the carbon atom is an aromatic ring atom), CH 2 , S, O, N (where the nitrogen atom is an aromatic ring atom), NH and NR 2 The group composed of;

[0022] Y is selected from a covalent bond, CR 4 (where the carbon atom is an aromatic ring atom), CH 2 , S, O, N (where the nitrogen atom is an aromatic ring atom), NH and NR 2 The group composed of;

[0023] Z is selected from a covalent bond, CR 4 (where the carbon atom is an aromatic ring atom), CH 2 , S, O, N (where the nitrogen atom is an aromatic ring atom), NH and NR 2 The group composed of;

[0024] in, represents a single bond or a double bond;

[0025] W, X 1 , Y and Z are members of the same ring and are selected so that the ring consists of five or six members;

[0026] Select W, X 1 , Y and Z are selected such that the ring does not contain more than two nitrogen atoms in the ring, and W, X 1 , Y and Z are such that the ring does not contain an acetal, thioacetal, amine or hydrazine group;

[0027] wherein the compound does not contain peroxide or disulfide groups; and wherein

[0028] R 1 Choose from H, D, CD 3 , CHD 2 , CH 2 D. CF 3 , CHF 2 , CH 2 F. CDF 2 , CD 2 F.C 1-4 -alkyl, optionally substituted by OH, halogen, OR 3 replace;

[0029] R 2 Selected from CHO, COCH 3 、COC 2 H 5 、COC 3 H 7 、COCH(CH 3 ) 2 、COC 4 H 9 、COC(CH 3 ) 3 The group composed of;

[0030] R 3 Choose from C 1-4 A group consisting of alkyl groups;

[0031] R 4 Selected from H, D, F, Cl, methyl, CH 2 F. CHF 2 CF 3 、OCH 3 , OCD 3 the group formed; and

[0032] R 5 C 1-4 Alkyl, optionally substituted with OH.

[0033] The present invention also relates to a pharmaceutical composition comprising an azo compound or a mixture of azo compounds and a pharmaceutically acceptable carrier, wherein each of the azo compounds has a structure (I) as defined in claim 1:

[0034]

[0035] Preferably it is used to treat fibrosis. DETAILED DESCRIPTION OF THE INVENTION

[0037] The present invention relates to a novel azo compound of structure (I), in particular to its use in treating fibrosis:

[0038]

[0039] In general, compounds of formula I can be prepared by methods known in the art (Druey and Rinigier, Helv. Chim. Acta, 34 (1951), 195; Zimmer, Kokosa and Shah, J. Org. Chem. 40 (1975), 2901). If X represents nitrogen (tetrazolyl compound), two typical methods are shown in Scheme I. Therefore, the chloropyridazine of formula II is reacted with a metal azide in a dipolar aprotic solvent at a relatively high temperature (method A). The preferred metal azide is sodium azide, and the favorable conditions are DMF as solvent, a temperature of about 120° C., and a duration of several hours. Method A is exemplified by Examples 2 and 35.

[0040]

[0041] Another method is to use a hydrazine compound of formula III, which reacts with nitrous acid, which is formed in situ from sodium nitrite under acidic conditions (Badr 1984), (Method B). Preferred conditions are dilute acetic acid and a slight excess of nitrite at 0°C to room temperature (rt). Method B is exemplified by Examples 1 and 17.

[0042] If X in formula I represents a substituted carbon atom, several known methods can be applied (Druey 1951). Scheme 2 summarizes a typical method. Therefore, the compound of formula III can be reacted with an active carboxylic acid (method C1) or an activated carboxylic acid derivative (method C2, C3). The active carboxylic acid is a lower alkyl carboxylic acid (e.g., formic acid, acetic acid or propionic acid) or a carboxylic acid containing an electron-withdrawing substituent (e.g., halogen or oxygen) at the α position. The preferred condition is to use a carboxylic acid as a solvent and heat to reflux for several hours. Method C1 is exemplified by Examples 10 and 12.

[0043] Activated carboxylic acid derivatives include anhydrides (Badr, El-Sherief, El-Naggar and Mahgoub, J. Heterocycl. Chem. (1984), 21, 471) (Method C2), formates, orthoesters (Method C3) or carboxylic acid derivatives with appropriate leaving groups. Preferred conditions are reflux with excess anhydride or reaction with orthoesters in an alcohol solvent at room temperature. Method C2 is exemplified by Example 4. Method C3 is exemplified by Examples 3 and 15.

[0044]

[0045] Alternatively, the chloroazines of formula II can be reacted with carboxylic acid hydrazides in an aprotic solvent at elevated temperatures (Method C4). Preferred conditions are 100-120°C, and typical solvents are DMF or dihydrogen sulfoxide. Method C4 is exemplified by Examples 5, 11 and 13.

[0046] If WX 1 -YZ represents a fused heterocycle, such as thiophene or furan, and the intermediate required for synthesizing the compound of formula I can be obtained by directed ortho-metalation (DoM) reaction. Thiophene carboxylic acid or furan carboxylic acid is treated with a strong base (such as butyl lithium). The lithiated heterocycle can be quenched with DMF to produce o-formyl acid (method D1), or quenched with dry ice (carbon dioxide) to obtain the corresponding o-dicarboxylic acid (method D2), (Scheme 3).

[0047]

[0048] The resulting o-formylcarboxylic acid is easily converted to the o-phthalyl ketone by heating with hydrazine hydrate and then treated with phosphorus oxychloride to give the dichlorophthalazine IIb (Method D1). A similar method is used to prepare the dichlorophthalazine IIa (Method D2).

[0049] In the first embodiment, in the general formula (I), R is selected from H, D, CN, NHR 5 、NDR 5 , Cl, OR 3 , SR 3 and C 1-4 Any of the group consisting of alkyl. That is, if R=H, then H is connected to the carbon atom of the ring by a covalent bond: -H, similarly, when R=D, then D is connected to the carbon atom of the ring by a covalent bond: -D, similarly, when R=CN, then CN is connected to the carbon atom of the ring by a covalent bond: -CN, similarly, when R=NHR 5 , then NHR 5 Connected to the carbon atom of the ring by a covalent bond: -NHR 5 , the situation is similar for any group from which R can be selected. Preferably, R is selected from H, CH 3 、Cl、CN、OCH 3 , OC 2 H 5 、NHC 2 H 4 OH, NHCH 3 Further preferably, R is selected from H and CH 3 In the most preferred embodiment, R is H.

[0050] The term "alkyl" as used herein refers to a straight / linear or branched hydrocarbon substituent. Examples of alkyl groups include methyl, ethyl, propyl, butyl, isopropyl, sec-butyl, isobutyl, tert-butyl.

[0051] In the general formula (I), W can be selected from a covalent bond, CR 4 (where the carbon atom is an aromatic ring atom (i.e., bonded to its neighboring atoms via single and double bonds)), CH 2 , S, O, N (where the nitrogen atom is an aromatic ring atom (i.e., bonded to its neighboring atoms via single and double bonds)), NH and NR 2 When W is selected as a covalent bond (and X 1 , Y and Z are not selected as covalent bonds), W, X 1 The ring formed by Y, Z and two bridging carbon atoms is a five-membered ring. Preferably, W is selected from CH (bonded to its adjacent atoms through single bonds and double bonds), CH 2(bonded to its neighboring atoms through two single bonds), N (bonded to its neighboring atoms through a single bond and a double bond), NH (bonded to its neighboring atoms through two single bonds), O, S, and a group consisting of covalent bonds.

[0052] Similarly, X 1 Optional free covalent bond, CR 4 (where the carbon atom is an aromatic ring atom (i.e., bonded to its neighboring atoms via single and double bonds)), CH 2 , S, O, N (where the nitrogen atom is an aromatic ring atom (i.e., bonded to its neighboring atoms via single and double bonds)), NH and NR 2 When X 1 When W, X and Z are selected as covalent bonds (and W, Y and Z are not selected as covalent bonds), W, X 1 The ring formed by X, Y, Z and two bridging carbon atoms is a five-membered ring. 1 Selected from CH (bonded to its adjacent atoms through single and double bonds), CH 2 (bonded to its neighboring atoms through two single bonds), N (bonded to its neighboring atoms through a single bond and a double bond), NH (bonded to its neighboring atoms through two single bonds), O, S, and a group consisting of covalent bonds.

[0053] Similarly, Y can be selected from a covalent bond, CR 4 (where the carbon atom is an aromatic ring atom (i.e., bonded to its neighboring atoms via single and double bonds)), CH 2 , S, O, N (where the nitrogen atom is an aromatic ring atom (i.e., bonded to its neighboring atoms via single and double bonds)), NH and NR 2 When Y is selected as a covalent bond (and W, X 1 and Z are not selected as covalent bonds), W, X 1 The ring formed by , Y, Z and two bridging carbon atoms is a five-membered ring. Preferably, Y is selected from CH (bonded to its adjacent atoms through single bonds and double bonds), CH 2 (bonded to its neighboring atoms through two single bonds), N (bonded to its neighboring atoms through a single bond and a double bond), NH (bonded to its neighboring atoms through two single bonds), O, S, and a group consisting of covalent bonds.

[0054] Similarly, Z is selected from a covalent bond, CR 4 (where the carbon atom is an aromatic ring atom (i.e., bonded to its neighboring atoms via single and double bonds)), CH 2 , S, O, N (where the nitrogen atom is an aromatic ring atom (i.e., bonded to its neighboring atoms via single and double bonds)), NH and NR 2 When Z is selected as a covalent bond (and W, X 1 and Y are not selected as covalent bonds), W, X1 The ring formed by Y, Z and two bridging carbon atoms is a five-membered ring. Preferably, Z is selected from CH (bonded to its adjacent atoms through single bonds and double bonds), CH 2 (bonded to its neighboring atoms through two single bonds), N (bonded to its neighboring atoms through a single bond and a double bond), NH (bonded to its neighboring atoms through two single bonds), O, S, and a group consisting of covalent bonds.

[0055] In the general formula (I), Indicates a single key or double bond While a single bond can be directly adjacent to a single bond or a double bond, a double bond cannot be directly adjacent to an adjacent double bond.

[0056] As shown in the general formula (I), W, X 1 , Y and Z are members of the same ring and are selected so that the ring consists of five or six members. That is, if W is selected to be a covalent bond (single or double bond), then X 1 None of X, Y, or Z can be selected as a covalent bond (neither a single bond nor a double bond). Similarly, if you select X 1 If Y is a covalent bond, then none of W, Y, or Z can be selected as a covalent bond. Similarly, if Y is selected as a covalent bond, then W, X 1 or Z cannot be selected as a covalent bond. Similarly, if Z is selected as a covalent bond, then W, Y, or X 1 Neither of the two can be chosen as covalent bonds.

[0057] In the general formula (I), W, X 1 , Y and Z make W, X 1 The corresponding ring formed by , Y and Z and the two bridging carbon atoms does not contain more than two nitrogen atoms in the ring.

[0058] In the general formula (I), W, X 1 , Y and Z are such that the ring does not contain an acetal, thioacetal, amine or hydrazine group, and the compound does not contain a peroxide or disulfide group.

[0059] In the general formula (I), R 1 Choose from H, D, CD 3 , CHD 2 , CH 2 D. CF 3 , CHF 2 , CH 2 F. CDF 2 , CD 2 F.C 1-4 -alkyl, optionally substituted by OH, halogen, OR3 Preferably, R 1 Select from H, D, CH 3 , CD 3 CF 3 , CH 2 OCH 3 That is, if R 1 =H, then H is covalently bonded to the carbon atom of the ring: -H, for which R can be selected 1 The situation is similar for any group of the group.

[0060] In the general formula (I), R 2 Selected from CHO, COCH 3 、COC 2 H 5 、COC 3 H 7 、COCH(CH 3 ) 2 、COC 4 H 9 、COC(CH 3 ) 3 Preferably, R 2 Selected from CHO and COCH 3 That is, if R 2 =CHO, then CHO is covalently linked to the nitrogen atom of the ring: -CHO, for which R can be selected 2 The situation is similar for any group of the group.

[0061] In the general formula (I), R 3 Choose from C 1-4 The group consisting of alkyl groups, preferably C 1-4 That is, if R 3 =C 1 Alkyl (i.e. CH 3 / methyl), then CH 3 Covalently bonded to the sulfur atom: -CH 3 , for which R can be selected 3 The situation is similar for any group of the group.

[0062] In the general formula (I), R 4 Selected from H, D, F, Cl, methyl, CH 2 F. CHF 2 CF 3 、OCH 3 , OCD 3 Preferably, R 4 Selected from H, F, Cl and OCH3 , optionally H, F and Cl. That is, if R 4 =H, then H is covalently bonded to the carbon atom of the ring: -CH 3 , for which R can be selected 4 The situation is similar for any group of the group. Optionally, when X=N, R 4 Neither OCH 3 , nor OCD 3 That is, optionally, when X=N, R 4 Selected from H, D, F, Cl, methyl, CH 2 F. CHF 2 and CF 3 Composed of groups.

[0063] In the general formula (I), R 5 It is C 1-4 Alkyl, optionally substituted with OH. That is, if R 5 =C 1 Alkyl (i.e. CH 3 / methyl), then CH 3 Covalently bonded to nitrogen: -CH 3 , for which R can be selected 5 The situation is similar for any group of the group.

[0064] In the context of the present invention, all "embodiments" described herein can be combined with each other. That is, for example, if an "embodiment" defines R 1 , we can combine it with the definition of R 2 or any other "embodiment" combination of substituents.

[0065] The azo compound represented by general formula (I) is used to treat fibrosis. Examples of fibrosis include, but are not limited to, renal fibrosis, liver fibrosis, pulmonary fibrosis and cardiac fibrosis, optionally cardiac fibrosis. Cardiac fibrosis may lead to heart failure and other cardiac complications in patients with hypertensive heart disease.

[0066] The azo compound represented by general formula (I) can be used to treat fibrosis using a single compound or a mixture of any two or more thereof. Optionally, the azo compound is administered in combination with an excipient selected from an inorganic excipient or an organic excipient or a combination thereof. Inorganic excipients include calcium phosphate, calcium carbonate, calcium sulfate, halides, metal oxides, talc. Organic excipients include carbohydrates, such as sugars, sugar alcohols, starch, cellulose, such as cellulose ethers, cellulose esters, carboxymethyl cellulose, microcrystalline cellulose, petrochemical products, povidone, acrylic acid polymers.

[0067] As mentioned above, in the general formula (I), Indicates a single key or double bond or aromatic ring systems. Also represents single bonds to adjacent ring carbon atoms or double bond The carbon atom is connected to W, X 1 , Y and Z rings and directly connected rings. The structure formed by general formula (I) includes:

[0068]

[0069] and:

[0070]

[0071] Preferably choose W, X 1 The structure formed by W, X and Y can be represented by the general formula (II ac) and (III ad), wherein the general formula (II ac) represents the structure formed by W, X and Y. 1 , Y and Z and two bridging carbon atoms to form a six-membered ring, the general formula (III ad) represents a six-membered ring composed of W, X 1 , Y and Z and two bridging carbon atoms form a five-membered ring:

[0072]

[0073] For the general formula (IIb), W, X 1 , one of Y and Z is N, and the rest are CH groups.

[0074] For the general formula (IIc), W, X 1 , one of Y and Z is NH, and the others are CH 2 Group.

[0075]

[0076] For the general formula (IIIa), Z is S, W, X 1 One of Y is a covalent bond, and the remaining members are CH groups.

[0077] For the general formula (IIIb), W is S, X 1 , one of Y and Z is a covalent bond, and the remaining members are CH groups.

[0078] For general formula (IIIc), Y or X 1 For S, X 1 , one of Y and Z is a covalent bond, and the remaining members are CH groups.

[0079] For the general formula (IIId), W is O, X 1, one of Y and Z is a covalent bond, and the remaining members are CH groups.

[0080] It should be noted that no hydrogen atoms are shown in formula (I). In addition, any atom in formula (I) may be substituted by any isotope thereof. That is, any hydrogen atom (not shown in formula (I)) in formula (I) may be substituted (partially or completely) by deuterium D. The preferred positions for replacing hydrogen with deuterium are as defined in the claims. For example, R may be selected from the group consisting of hydrogen and deuterium as defined in the claims. In addition, R 1 can be selected from the group consisting of hydrogen and deuterium as defined in the claims. 1 Any alkyl group in may be arbitrarily replaced in whole or in part by deuterium instead of hydrogen. 4 may be selected from the group consisting of hydrogen and deuterium as defined in the claims. 1 =CD 3 or R=D and / or R 4 =D.

[0081] Furthermore, any carbon atom in the general formula (I) may be replaced by any of its isotopes (preferably 13 In addition, any nitrogen atom in the general formula (I) may be replaced by 15 N substitution (partial or complete).

[0082] In a second embodiment, R is selected from H, CN, NHR 5 , Cl, OR 3 , methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, cyclopropyl and SR 3 Composed of groups.

[0083] In another embodiment, R 1 Choose from H, D, CD 3 , CHD 2 , CH 2 D. CF 3 , CHF 2 , CH 2 F, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl and cyclopropyl, optionally substituted by OH, halogen or OR 3 substituted, optionally, wherein R 1 Selected from H, methyl, CD 3 CF 3 , CH 2 OH, ethyl, CH 2 OCH 3 and cyclopropyl group.

[0084] In another embodiment, R 3 Selected from the group consisting of methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl and tert-butyl.

[0085] In another embodiment, R 5 Selected from the group consisting of methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, optionally substituted with OH.

[0086] In another embodiment, W, X are selected 1 , Y and Z are such that the compound does not contain a peroxide group and / or such that the compound does not contain a disulfide group.

[0087] In another embodiment, X is selected from N and CR 1 The group consists of 1 Selected from H, methyl, CH 2 F.CD 2 F. CHF 2 , CDF 2 and CF 3 The group consisting of, preferably, wherein X is CR 1 and R is H or D. Optionally, when X=N, R 4 Neither OCH 3 Not OCD 3 That is, optionally, when X=N, R 4 Selected from H, D, F, Cl, methyl, CH 2 F. CHF 2 and CF 3 Composed of groups.

[0088] In another embodiment, W, X are selected 1 , Y and Z are such that the ring consists of carbon atoms or the ring consists of carbon atoms and one heteroatom.

[0089] In another embodiment, W, X are selected 1 , Y and Z make the ring aromatic or non-aromatic.

[0090] In another embodiment, W, X are selected 1 , Y and Z to form a moiety according to one of the following ring atom sequences (W...X 1…Y…Z): C…C…C…C, N…C…C…C, C…N…C…C, C…C…N…C, C…C…C…N, S…C…C…C, C…S…C…C, C…C…S…C, C…C…C…S, O…C…C…C, C…O…C…C, C…C…O…C, C…C…C…O, C…C…C, N…C…C, C…N…C, C…C…N, S…C…C, C…S…C, C…C…S,, O…C…C, C…O…C, C…C…O, where “…” represents a single bond or a double bond.

[0091] In another embodiment, W, X are independently selected 1 , Y and Z form a ring pyrrolidine, dihydrofuran, dihydrothiophene, pyrrole, furan, thiophene, The structure of the present invention comprises oxazole, thiazole, tetrahydrobenzene, ethylene oxide, cyclopentane sulfide, benzene, pyridine, pyran, thiopyran, preferably benzene, pyridine, dihydropyridine, thiophene or furan.

[0092] In another embodiment, W, X 1 , Y and Z are independently selected to form a ring selected from CH=CH-CH=CH (forming an aromatic ring), CH=N-CH=CH (forming an aromatic ring), N=CH-CH=CH (forming an aromatic ring), CH=CH-CH=N (forming an aromatic ring), NH-CH 2 -CH 2 -CH 2 , CH 2 -NH-CH 2 =CH 2 , CH 2 -NCOCH 3 -CH 2 -CH 2 , S-CH=CH, CH=CH-S, CH-S-CH, CH=CH-O (W...X 1 ...Y...Z), preferably CH=CH-CH=CH (forming an aromatic ring) or CH-S-CH.

[0093] In another embodiment, R═H, X═CH, and W, X1, Y, and Z are independently selected to comprise one or both of CF or C—Cl.

[0094] In another embodiment, R═H, X═CH, and W, X1, Y, and Z are independently selected to form a CH═CH—CH═CH moiety.

[0095] In another embodiment, R=H, X=C-CH 3 or N, and independently choose W, X 1 , Y and Z to form a CH=CH-CH=CH moiety.

[0096] In another embodiment, R=H, X=C-CH 3 or N, and independently choose W, X 1 , Y and Z to form a CH-S-CH moiety.

[0097] In another embodiment, X and R are independently selected such that the following compounds are excluded: X═C—CH 3 , R=CH, and W, X 1 , Y and Z=CH.

[0098] In another embodiment, W, X are selected 1 , Y and Z to form a CH=CH-CH=CH moiety, and R=H, X is N.

[0099] In another embodiment, W, X are selected 1 , Y and Z to form a CH=CH-CH=CH moiety, and R=H, X is C-CH 3 .

[0100] In another embodiment, W, X are selected 1 , Y and Z to form a CH=CH-CH=CH moiety, and R=H, X is CH.

[0101] In another embodiment, W, X are selected 1 , Y and Z to form a CH-S-CH moiety, and R=H, X is C-CH 3 .

[0102] In another embodiment, W, X are selected 1 , Y and Z to form a CH-S-CH portion, and R=H, X is N.

[0103] In another embodiment, X is C—CH 3 , R is H, and W, X 1 , Y and Z form a group CR 4 =CR 4 -CR 4 =CR 4 , where one R 4 The group is selected from F, Cl and OCH 3 The remaining three R 4 The group is hydrogen.

[0104] In another embodiment, X is C—CH 3 , R is H, and W, X 1 , Y and Z form a group CR 4 =CR 4-CR 4 =CR 4 , where two R 4 The groups are independently selected from F, Cl and OCH 3 The remaining two R 4 The group is hydrogen.

[0105] In another embodiment, the azo compound (I) is selected from the group consisting of:

[0106]

[0107]

[0108]

[0109] The azo compound represented by general formula (I) is used in a method for treating or preventing fibrosis. In another embodiment, the fibrosis is selected from the group consisting of renal fibrosis, liver fibrosis, lung fibrosis and cardiac fibrosis, optionally cardiac fibrosis.

[0110] In another embodiment, one or more of the carbon (C) atoms and nitrogen (N) atoms in the embodiments disclosed herein may be 13 C isotopes, N atoms can be 15 N isotopes, among which there may be 13 C isotopes and 15 In addition, changing the isotopic composition of H / D, C, and N can be applied to the evaluation of drug pharmacology to determine the pharmacokinetic characteristics or mode of action of drug substances. Secondly, stable isotopes can be used as internal standards to evaluate the concentration of drugs or their metabolites in blood or urine by analytical quantitative LC-MS, HPLC-MS, LC-MS-MS, or HPLC-MS-MS methods.

[0111] In another embodiment, a pharmaceutical composition for the treatment of fibrosis is provided, comprising an azo compound or a mixture of azo compounds and a pharmaceutically acceptable carrier, wherein each of the azo compounds has a structure (I) as defined in claim 1:

[0112]

[0113] In the general formula (I), Indicates a single key or double bond or aromatic ring systems. It also indicates that the connection includes W, X 1 , Y and Z rings and directly connected to the adjacent ring carbon atom single bond or double bond

[0114] In another embodiment, the pharmaceutical composition is an oral solid dosage form and / or the azo compound is present in an effective amount. The effective amount of the azo compound ranges from 5 to 500 mg, preferably 10 to 200 mg. The compounds of the present invention and their pharmaceutically acceptable salts can be used as medicines, for example in the form of pharmaceutical compositions. The pharmaceutical composition can be administered orally, for example in the form of tablets, coated tablets, dragees, hard and soft gelatin capsules, solutions, emulsions or suspensions. However, administration can be parenteral, for example in the form of injection solutions.

[0115] The above-mentioned pharmaceutical composition can be obtained by processing the compound of the present invention with a pharmaceutically acceptable, inorganic or organic carrier. For example, lactose, corn starch or its derivatives, talcum, stearic acid or its salts, etc. can be used as carriers for tablets, coated tablets, dragees and hard gelatin capsules. Suitable carriers for soft gelatin capsules are, for example, vegetable oils, waxes, fats, semisolid and liquid polyols, etc. However, depending on the properties of the active substance, carriers are usually not required in the case of soft gelatin capsules. Suitable carriers for the production of solutions and syrups are, for example, water, polyols, glycerol, vegetable oils, etc. Suitable carriers for suppositories are, for example, natural or hardened oils, waxes, fats, semi-liquid or liquid polyols, etc.

[0116] In addition, the pharmaceutical compositions may also contain preservatives, solubilizers, stabilizers, wetting agents, emulsifiers, sweeteners, colorants, flavoring agents, salts for varying the osmotic pressure, buffers, masking agents or antioxidants. They may also contain other therapeutically valuable substances.

[0117] The pharmaceutical composition may include, for example, the following:

[0118] a) Tablet formulation (wet granulation):

[0119]

[0120] b) Capsule formula:

[0121]

[0122] The term "therapeutically effective amount" of a compound as used herein refers to the amount of the compound that can effectively prevent, alleviate or improve disease symptoms or prolong the survival of a subject. Determining a therapeutically effective amount is within the scope of the prior art in the art.

[0123] The therapeutically effective amount or dosage of the compounds of the present invention can vary within a wide range and can be determined using methods known in the art. Such dosages will be adjusted according to the individual needs of each specific case, including the specific compound administered, the route of administration, the disease treated, and the patient treated. Generally speaking, in the case of oral or parenteral administration to an adult weighing about 70 kg, a daily dose of about 5 mg to about 500 mg, preferably about 10 mg to about 200 mg can be considered as a therapeutically effective amount, but the upper limit can be exceeded according to the instructions. The daily dose can be administered as a single dose or divided doses, or for parenteral administration, it can be administered by continuous infusion.

[0124] As used herein, "pharmaceutically acceptable carrier" is intended to include any and all materials compatible with pharmaceutical administration, including solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and other materials and compounds compatible with pharmaceutical administration. Unless any conventional media or agents are incompatible with the active compound, they are contemplated for use in the compositions of the present invention. Supplementary active compounds may also be added to the compositions.

[0125] The compounds of the present invention can exist and be administered in the form of their pharmaceutically acceptable salts or esters. The term "pharmaceutically acceptable salt" refers to conventional acid addition salts formed by suitable non-toxic organic or inorganic acids and retaining the biological effectiveness and characteristics of the compound of formula I. Examples of acid addition salts include salts derived from inorganic acids (such as hydrochloric acid, sulfuric acid), and salts derived from organic acids (such as p-toluenesulfonic acid, naphthalenesulfonic acid, naphthalenedisulfonic acid, methanesulfonic acid, ethanesulfonic acid, etc.). Chemical modification of drug compounds (i.e., drugs) to salts is a technique well known to pharmaceutical chemists, which can improve the physical and chemical stability, hygroscopicity, fluidity and solubility of the compound (see Bastin, RJ et al., Organic Proc. Res. Dev. 4 (2000) 427-435). Pharmaceutically acceptable salts preferably formed with p-toluenesulfonic acid, naphthalenesulfonic acid, naphthalenedisulfonic acid, methanesulfonic acid, sulfuric acid and hydrochloric acid.

[0126] In a preferred embodiment, the azo compound defined in the claims is administered in the form of a tablet. Example

[0127] Synthesis of compounds

[0128] Example 1

[0129] Tetrazo[5,1-a]phthalazine 1

[0130] 370 mg (5.35 mmol) of sodium nitrite dissolved in a small amount of water was added to a solution of 982 mg (5.00 mmol) of hydralazine hydrochloride and 450 mg (5.50 mmol) of sodium acetate in 10 mL of 2N acetic acid at 0°C with stirring. A precipitate was formed immediately. After 30 minutes, the precipitate was separated by filtration and washed with a small amount of ice-cold water. Vacuum drying at 40°C gave 784 mg (86%) of 1. The combined filtrate was extracted with ethyl acetate to give another 60 mg (6%) of 1. 1 H-NMR (300MHz, CDCl 3 ): δ=8.03(td,J=7.7,1.3Hz,1H),8.14(mc,2H),8.76(d,J=7.9Hz,1H),8.96(s,1H,6H).

[0131] Example 2

[0132] 6-Methyl-tetrazo[5,1-a]phthalazine 2

[0133] A mixture of 200 mg (3.1 mmol) of sodium azide, 264 mg (1.48 mmol) of 1-chloro-4-methylphthalazine and 10 mL of DMF was heated to 120° C. and maintained for 5 hours. After adding 20 mL of water at 0° C., the light yellow precipitate formed was sucked off. It was washed twice with 5 mL of ice water and dried under vacuum to give 230 mg (84%) of 2 as colorless felt-like needles. 1 H-NMR (300MHz, CDCl 3 ):δ=3.02(s,3H,CH 3 )8.03(td,J=7.5,1.4Hz,1H),8.10(td,J=7.5,1.4Hz,1H),8.22(d,J=7.6Hz,1H),8.77(d,J=7.8Hz,1H).

[0134] Example 3

[0135] 3-Methyl-1,2,4-triazolo[3,4-a]phthalazine

[0136] 1.01 mL (5.50 mmol) of triethyl orthoacetate was added to a mixture of 983 mg (5.00 mmol) of hydralazine hydrochloride and 10 mL of methanol and stirred at room temperature. After 15 minutes, the suspension became clear and new precipitation began to appear. After 1 hour, another 10 mL of methanol was added, stirring was continued for 1 hour, and then the mixture was evaporated. The residue was dissolved in 40 mL of water and washed with solid NaHCO 3The pH was adjusted to 7. The precipitate formed was isolated by filtration, washed with ice-cold water, and sucked dry. Drying in vacuo at 50°C gave 833 mg (90%) of 3. The combined filtrates were extracted with 40 mL of ethyl acetate to give an additional 30 mg (3%) of 3. 1 H-NMR (300MHz,): δ = 2.83 (s, 3H, CH 3 ), 7.79(ddd,J=8.3,7.4,1.2Hz,1H),7.93(td,J=8.7,1.2Hz,1H),7.99(td,J=7.6,1.2Hz,1H),8.61(s,1H),8.63(dd,J=9.1,1.2Hz,1H).

[0137] Example 4

[0138] 6-Chloro-3-methyl-1,2,4-triazolo[3,4-a]phthalazine 4

[0139] A mixture of 2.58 g (13.0 mmol) of 1,4-dichlorophthalazine, 50 mL of ethanol and 5.0 mL of 55% hydrazine was heated to reflux for 30 minutes. After cooling to room temperature (rt), the felt-like precipitate was sucked off and washed twice with ice-cold ethanol. After washing with 10 mL of tert-butyl methyl ether and 10 mL of pentane, the residue was dried in vacuo. 2.23 g (84%) of 1-chloro-4-hydrazinylphthalazine were obtained.

[0140] An analytical sample from above (211 mg, 1.08 mmol) was treated with 0.9 mL (1.12 mmol) of 1.25 M HCl in methanol, evaporated and dried in vacuo to give the hydrochloride salt of 1-chloro-4-hydrazinophthalazine. 1 H-NMR (300MHz, D 2 O):δ=7.97-8.29(m,4H).

[0141] Acetic anhydride (0.5 mL, 5 mmol) was added to 195 mg (1.00 mmol) of 1-chloro-4-hydrazinephthalazine in 6.0 mL of distilled water. The mixture was suspended in 2-(4-(2-nitropropene)-2-nitropropene and heated to reflux for 1 h. After evaporation, the residue was treated with 10 mL of ice water and the pH was adjusted to 7 by adding sodium bicarbonate. After extraction with 2×25 mL of dichloromethane and evaporation, the remaining solid was purified (silica gel, dichloromethane / methanol 20:1). After vacuum drying, 198 mg of 4 was obtained. 1 H-NMR (300MHz, CDCl 3 ):δ=2.82(s,3H,CH 3), 7.86 (ddd, J=8.3, 7.4, 1.2Hz, 1H), 8.00 (td, J=7.6, 1.2Hz, 1H), 8.26 (ddd, J=8.2, 1.3, 0.6Hz, 1H), 8.67 (ddd, J=8.0, 1.3, 0.7Hz, 1H).

[0142] Example 5

[0143] 3,6-Dimethyl-1,2,4-triazolo[3,4-a]phthalazine 5

[0144] 174 mg (0.97 mmol) of 1-chloro-3-methylphthalazine, 150 mg of acetic hydrazide (2.02 mmol) and 5.0 mL of dichloromethane were added. The mixture of alkane was heated to reflux for 1 hour. After cooling to room temperature, the mixture was evaporated and the residue was treated with 30 mL of water. Extraction with 2×30 mL of dichloromethane and evaporation gave 219 mg of residue. Purification by flash chromatography on silica gel (eluent dichloromethane / methanol 20:1) gave 176 mg (90%) of the title compound 5. 1 H-NMR (300MHz, CDCl 3 ):δ=2.80(s,3H,CH 3 ),2.83(s,3H,CH 3 ), 7.78 (ddd, J=8.6, 7.4, 1.3Hz, 1H), 7.90 (td, J=7.7, 1.2Hz, 1H) 7.98 (ddd, J=8.0, 7.7, 1.2Hz, 1H), 8.64 (ddd, J=8.0, 1.4, 0.6Hz, 1H).

[0145] Example 6

[0146] 3-Methyl-1,2,4-triazolo[3,4-a]phthalazine-6-carbonitrile

[0147] A mixture of 135 mg (1.20 mmol) potassium cyanide, 127 mg (0.58 mmol) 4 and 5.0 mL DMSO was heated to 100 ° C and maintained for 2 hours. After cooling to room temperature, 20 mL of water was added and the mixture was extracted twice with 50 mL of dichloromethane. The combined dichloromethane extracts were washed with 10 mL of water, dried over sodium sulfate and evaporated. Purification by silica gel column chromatography (eluent dichloromethane / methanol 20:1) gave 110 mg (83%) 6 after vacuum drying. 1 H-NMR (300MHz, CDCl 3 ):δ=2.87(s,3H,CH 3), 7.96 (ddd, J=8.3, 7.4, 1.2Hz, 1H), 8.09 (ddd, J=8.0, 7.7, 1.2Hz, 1H), 8.27 (dt, J=8.3, 1.0Hz, 1H), 8.71 (dt, J=8.1, 1.0Hz, 1H).

[0148] Example 7

[0149] 2-[(3-Methyl-1,2,4-triazolo[3,4-a]phthalazin-6-yl)amino]-ethanol 7

[0150] 70 mg (mmol) 4 (DHY5), 0.6 mL ethanolamine and 3.0 mL di The mixture of oxane was kept at 100° C. After 20 minutes, a precipitate formed. Heating was continued for 2 hours. After evaporation, the residue was purified by silica gel chromatography (eluent: dichloromethane / methanol 20:1→10:1). 62 mg (80%) of 7 were obtained. 1 H-NMR (300MHz, d 4 -acetic acid):δ=2.66(s,3H,CH 3 ), 3.73 (t, J = 5.2Hz, 2H), 4.03 (t, J = 5.2Hz, 2H), 7.79 (t, J = 7.8Hz, 1H), 7.88 (t, J = 7.5Hz, 1H), 8.05 (d, J = 8.1Hz, 1H), 8.51 (d, J = 7.2Hz, 1H).

[0151] Example 8

[0152] 6-Methoxy-3-methyl-1,2,4-triazolo[3,4-a]phthalazine 8

[0153] Compound 4 (0.050 g, 0.22 mmol, 1.0 equiv) from Example 4 was dissolved in MeOH (3 mL), and Pd-C (10%) (50 mg) was then added. The reaction mixture was stirred at room temperature for 24 hours. The product was collected by filtration and dried under vacuum (41 mg, 84%) of 8. 1 H-NMR (400MHz, CDCl 3 ): δ=8.56(ddd,J=8.0,1.3,0.7Hz,1H),8.14(ddd,J=8.1,1.3,0.7Hz,1H),7.87(ddd, J=8.0,7.3,1.2Hz,1H),7.72(ddd,J=8.1,7.3,1.3Hz,1H),4.18(s,3H),2.74(s,3H). 13 C-NMR (126 MHz, CDCl 3):δ=158.4,147.8,142.6,133.7,130.4,125.1,124.7,123.22,118.69,55.30,9.92.HRMS(ESI):calculated value C 11 H 10 N 4 O[M-1] - 213.0782, measured value [M-1] - 213.0781.

[0154] Example 9

[0155] 8,9-Dimethoxy-3-methyl-1,2,4-triazolo[3,4-a]phthalazine 9

[0156] 57 mg (0.25 mmol) of 1-chloro-6,7-dimethoxyphthalazine, 100 mg (1.3 mmol) of acetic hydrazide and 6.0 mL of dimethoxyphthalazine were added. The mixture of alkanes was heated at reflux for 12 h. After evaporation, the residue was purified by column chromatography on silica gel (dichloromethane / methanol 20:1) to give 38 mg (61%) of 9. 1 H-NMR (300MHz, CDCl 3 ):δ=2.80(s,3H,CH 3 ),4.04(s,3H,OCH 3 ),4.10(s,3H,OCH 3 ),7.22(s,1H),7.96(s,1H),8.48(s,1H).

[0157] Example 10

[0158] 3-Trifluoromethyl-1,2,4-triazolo[3,4-a]phthalazine 10

[0159] 237 mg (1.21 mmol) of hydralazine hydrochloride and 5.0 mL of trifluoroacetic acid were heated to 70°C for 4 hours. The mixture was evaporated and 5.0 mL of water was added. After the pH value was adjusted to 5, the product was extracted with 2×20 mL of dichloromethane. Dry (Na 2 SO 4 ) and evaporated to give 273 mg (92%) of a yellow solid, which was purified by silica gel column chromatography (dichloromethane / methanol 50:1) to give 263 mg (89%) of 10 as a colorless solid. 1 H-NMR (300MHz, CDCl 3 ): δ=7.97 (dd, J=8.4, 7.0Hz, 1H), 8.07 (d, J=8.0Hz, 1H), 8.09 (td, J=7.2, 1.4Hz, 1H), 8.79 (dd, J=7.9, 1.2Hz), 8.84 (s, 1H).

[0160] Embodiment 11

[0161] 3-Methoxymethyl-1,2,4-triazolo[3,4-a]phthalazine 11

[0162] 100 mg (mmol) 1-chlorophthalazine and 200 mg (mmol) methoxyacetylhydrazine were suspended in 5.0 mL distilled water. The reaction mixture was evaporated and the residue was distributed between 20 mL of water and 20 mL of dichloromethane. The aqueous phase was extracted with 20 mL of dichloromethane and the combined organic phase was washed with 10 mL of water. After drying over sodium sulfate and evaporation, the residue was purified by silica gel column (eluent: ethyl acetate). 112 mg (82%) of 11 was obtained. 1 H-NMR (300MHz, CDCl 3 ):δ=3.49(s,3H,OCH 3 ),5.05(s,2H,CH 2 O),7.82(td,J=7.5,1.2Hz),7.95(d,J=7.5Hz,1H),7.96(td,J=7.5,1.1Hz,1H),8.67(dd,J=7.1,1.2Hz,1H),8.68(s,1H).

[0163] Example 12

[0164] 3-D 3 -Methyl-1,2,4-triazolo[3,4-a]phthalazine 12

[0165] 314 mg (1.60 mmol) of hydralazine hydrochloride and 2.5 mL of acetic acid-d 4 Heat to 120 °C and maintain for 6 h. After evaporation, 5.0 mL of water was added and NaHCO 3 Adjust the pH to 7. Extract with 2×50 mL of dichloromethane and dry (Na 2 SO 4 ) and evaporated to give a yellow solid containing d3-acetic acid. Purification by silica gel double column chromatography (first column dichloromethane / methanol 30:1, second column ethyl acetate) gave 236 mg (75%) of colorless solid 12. 1 H-NMR (300MHz, CDCl 3 ): δ=7.75(t,J=7.4Hz,1H),7.88(m,2H),8.56(d,J=7.4Hz,1H),8.57(s,1H).

[0166] Embodiment 13

[0167] 1,2,4-Triazolo[3,4-a]phthalazin-3-yl-methanol 13

[0168] 302 mg (1.83 mmol) of 1-chlorophthalazine and 349 mg (3.87 mmol) of glycolic acid hydrazide were added to 5.0 mL of distilled water. After evaporation, the residue was dissolved in 10 mL of water and the resulting suspension was extracted with 7×50 mL of dichloromethane. 2 SO 4 ) and after evaporation, the residue was purified by silica gel column chromatography (dichloromethane / methanol 20:1) to give 349 mg (90%) of 13 as a colorless solid. 1 H-NMR (300MHz, CDCl 3 ): δ=4.95(s,2H),5.70(br,s,1H,OH),7.94(td,J=7.7,1.2Hz,1H),8,06(td, J=7.6,1.2Hz,1H),8.22(d,J=7.8Hz,1H),8.51(d,J=7.9Hz,1H),9.09(s,1H).

[0169] Embodiment 14

[0170] 3-Ethyl-1,2,4-triazolo[3,4-a]phthalazine 14

[0171] 376 mg of hydralazine hydrochloride (1.91 mmol) was dissolved in 3.0 mL of propionic acid and heated to 120 °C for 4 hours. After cooling to room temperature, 20 mL of water was added and NaHCO 3 Neutralize the solution. Extract with 20 mL of dichloromethane and 2 SO 4 After drying and evaporation, a yellow-brown residue was obtained. Purification by silica gel column chromatography (dichloromethane→dichloromethane / methanol 20:1) gave 38 mg of 14. 1 H-NMR (300MHz, CDCl 3 ):δ=1.50(t,J=7.6Hz,3H,CH 3 ),3.23(q,J=7.6Hz,2H,CH 2 ), 7.78(ddd,J=7.2,6.8,1.2Hz,1H),7.91(d,J=7.4Hz,1H),7.92(t,J=7.9Hz,1H),8.52(s,1H),8.53(d,J=7.9Hz,1H).

[0172] Embodiment 15

[0173] 1,2,4-Triazolo[3,4-a]phthalazine 15

[0174] Add 0.55 mL (3.0 mmol) of triethyl orthoformate to a solution of 500 mg (2.54 mmol) of hydralazine hydrochloride in 5.0 mL of methanol. Continue stirring at room temperature for 2 hours. Within 1 hour, a fine crystalline precipitate forms. After evaporation, add 5 mL of water and wash with solid NaHCO 3 The pH was adjusted to pH 5. After extraction with 3×20 mL of dichloromethane, the organic phase was dried (Na 2 SO 4 ) and evaporated. Drying in vacuo afforded 401 mg (87%) of 15. 1 H-NMR (300MHz, CDCl 3 ): δ=7.83(ddd,J=8.2,7.3,1.2Hz,1H),7.96(d,J=7.9Hz,1H),7.98(td,J=7.5,1.2Hz,1H),8.64(s,1H),8.68(dd,J=7.6,1.2Hz,1H),9.04(s,1H).

[0175] Example 16

[0176] 3-Cyclopropyl-[1,2,4]triazolo[3,4-a]phthalazine 16

[0177] 178 mg NaHCO 3 Add 180 mg of cyclopropanecarboxylic acid in 20 mL of methanol and evaporate. To the residue, add 188 mg of hydralazine hydrochloride, 500 mg of cyclopropanecarboxylic acid and 10 mL of distilled water. The mixture was heated to reflux for 6 hours and subjected to two silica gel column chromatography (first: ethyl acetate / hexane 2:1; second: dichloromethane / methanol 50:1) to obtain 18 mg of 16.

[0178] 1 H NMR (300 MHz, CDCl 3 )δ8.63(d,J=7.9Hz,1H),8.60(s,1H),7.92(t,J=7,5Hz1H),7,91(d,J=7,7Hz,1H),7.79(dd,J=8.5 ,6.6Hz,1H),2.50(tt,J=8.5,5.0Hz,1H),1.39(dt,J=6.4,3.3Hz,2H),1.21(dt,J=8.5,3.3Hz,2H).

[0179] Embodiment 17

[0180] 6-Chloropyrido[4,3-d]tetrazo[1,5-b]pyridazine 17a and 6-chloropyrido[3,4-d]tetrazo[1,5-b] Pyridazine 17b

[0181] 2,3-Dihydropyrido[3,4-d]pyridazine-1,4-dione (i)

[0182] 3,4-pyridinedicarboxylic acid (8.61 g, 51.51 mmol, 1.0 equivalent) was dissolved in acetic anhydride (30 mL, 319.42 mmol, 6.2 equivalent), and the mixture was heated to reflux and stirred for 1 hour. After cooling to room temperature, 30 mL of hydrazine (55% aqueous solution) was added and stirred at reflux for 4 hours. The product was collected by suction filtration, washed with water and dried to obtain an amorphous solid (i) (7.94 g, 95%). 1 H NMR (300MHz, DMSO): δ = 11.90 (s, 2H), 9.32 (s, 1H), 9.02 (d, J = 5.3Hz, 1H), 7.89 (d, J = 5.3Hz, 1H).

[0183] 1,4-Dichloropyrido[3,4-d]pyridazine (ii)

[0184] A mixture of 2,3-dihydropyrido[3,4-d]pyridazine-1,4-dione (i) (6.52 g, 39.96 mmol, 1.0 eq) (0.04 mol) and phosphorus oxychloride (18.6 mL, 189.84 mmol, 4.75 eq) in pyridine (6.46 mL, 79.93 mmol, 2.0 eq) was heated to reflux and stirred for 8 h. The mixture was then poured into a slurry of 400 g of ice and then treated with NaHCO 3 Neutralize and then extract with ethyl acetate (3×100 mL). Separate the organic phase, wash with water, and 2 SO 4 Dry and evaporate to dryness. The crude product was purified by dichloromethane column chromatography to give a yellow amorphous solid (ii) (4.01 g, 50%). 1 H NMR (300 MHz, CDCl 3 ), major isomers: δ = 9.75 (d, J = 1.0 Hz, 1H), 9.24 (d, J = 5.6 Hz, 1H), 8.07 (dd, J = 5.6, 1.0 Hz, 1H).

[0185] 4-Chloro-1-hydrazinopyrido[3,4-d]pyridazine (iiia) and 1-chloro-4-hydrazinopyrido[3,4-d]pyridazine (iiib)

[0186] To a solution of 1,4-dichloropyrido[3,4-d]pyridazine (ii) (1.0 g, 4.99 mmol, 1.0 equiv) in methanol (15 mL) was slowly added hydrazine (55% in water) (0.32 g, 9.99 mmol, 2.0 equiv) and the reaction mixture was refluxed for 10 minutes to give a yellow precipitate. The product was collected by suction filtration and dried to give the product as an isomeric mixture (iiia / iiib) which was then used without further purification. HRMS (ESI): calculated value C 7 H 6 N 5 Cl[M+1] + 196.0390, measured value [M+1] + 196.0382.

[0187] 6-Chloropyrido[4,3-d]tetrazo[1,5-b]pyridazine 17a and 6-Chloropyrido[3,4-d]tetrazo[1,5-b]pyridazine 17b

[0188] A solution of the isomeric mixture (iiia and iiib) (0.20 g, 1.02 mmol, 1.0 equiv) in acetic acid (5 mL, 2N) was cooled with ice water, and then cold NaNO was added dropwise with stirring. 2 Aqueous solution (84 mg, 1.22 mmol, 1.2 equivalents dissolved in 2 mL of water). Continue stirring at room temperature for 1 hour. Extract the product with dichloromethane (3×25 mL). The organic phase is washed with Na 2 SO 4 Drying and evaporation gave 17a / 17b as an amorphous solid (181 mg, 86%). 1 H NMR (300 MHz, DMSO): δ = 10.05 (s, 1H), 9.77 (s, 0.4H), 9.36-9.34 (m, 1.4H), 8.65 (d, J = 5.4 Hz, 0.4H), 8.36 (d, J = 5.4 Hz, 1H). HRMS (ESI): calculated value C 7 H 3 N 6 Cl[M+1] + 207.0186, measured value [M+1] + 207.0181.

[0189] Embodiment 18

[0190] Pyrido[4,3-d]tetraazolo[1,5-b]pyridazine 18a and pyrido[3,4-d]tetraazolo[1,5-b]pyridazine 18b

[0191] To a solution of the isomer 17a / 17b mixture (50 mg, 0.24 mmol, 1.0 equiv) in ethanol (3 mL) was slowly added hydrazine (55% in water) (15.5 mg, 0.48 mmol, 2.0 equiv) and the reaction mixture was refluxed for 2 hours to produce a precipitate. The product was collected by suction filtration and dried. Then, 0.15 M potassium trimethylsilanol (TMSOK) (31 mg, 0.24 mmol, 1.0 equiv) in water (1.6 mL) was added and the resulting slurry was stirred at room temperature for 24 hours. The resulting mixture was extracted with dichloromethane (4×20 mL). The reaction mixture was washed with Na 2 SO 4 The organic phase was dried and evaporated to give an amorphous solid as a mixture of isomers 18a / 18b (14 mg, 34%). 1 HNMR (500MHz, CDCl 3 )δ=10.15(d,J=0.9Hz,1H),9.56(d,J=1.0Hz,0.4H),9.29–9.27(m,1.4H),9.11(d,J=0.8Hz ,0.4H),9.03(d,J=0.7Hz,1H),8.58(dt,J=5.4,0.9Hz,0.4H),7.99(dt,J=5.4,0.8Hz,1H). 13 C NMR (126 MHz, CDCl 3 ):δ=153.64,152.38,151.05,148.06,147.99,147.73,140.67,140.24,128.74,127.65,119.80,119.19,117.09,116.36.HRMS(ESI):calculated value C 7 H 5 N 6 [M+1] + 173.0570, measured value [M+1] + 173.0568, calculated value C 7 H 4 N 6 Na[M+Na] + 195.0390, measured value [M+Na] + 195.0387.

[0192] Embodiment 19

[0193] 6-Chloro-3-methylpyrido[4,3-d][1,2,4]triazolo[4,3-b]pyridazine 19a and 6-chloro-3-methylpyridine [3,4-d][1,2,4]triazolo[4,3-b]pyridazine 19b

[0194] The isomeric mixture (iiia / iiib, from Example 17) (0.20 g, 1.02 mmol, 1.0 equiv) and triethyl orthoacetate (0.25 g, 1.53 mmol, 1.5 equiv) were refluxed in methanol (5 mL) for 20 minutes to give a solid product. The product was collected by suction filtration and dried to give an isomeric mixture 19a / 19b (0.16 g, 74%). 1 H NMR (300 MHz, DMSO): δ = 9.82 (d, J = 0.9 Hz, 1H), 9.52 (d, J = 0.9 Hz, 0.6H), 9.16 (dd, J = 7.2, 5.4 Hz, 1.7H), 8.41 (dd, J = 5.3, 1.0 Hz, 0.6H), 8.14 (dd, J = 5.5, 0.9 Hz, 1H), 2.71 (broad signal, 5H). HRMS (ESI): calculated value C 9 H 6 C1N 5 [M+1] + 220.0384, measured value [M+1] + 220.0386, calculated value C 9 H 6 C1N 5 Na[M+Na] + 242.0204, measured value [M+Na] + 242.0206.

[0195] Embodiment 20

[0196] 3-Methylpyrido[4,3-d][1,2,4]triazolo[4,3-b]pyridazine 20a and 3-methylpyrido[3,4-d] [1,2,4]triazolo[4,3-b]pyridazine 20b

[0197] To a solution of a mixture of isomer 19 (50 mg, 0.22 mmol, 1.0 eq.) in ethanol (3 mL) was slowly added N 2 H 4 .H 2 O (55%) (14.5 mg, 0.44 mmol, 2.0 eq.) was added, and the mixture was refluxed for 2 hours to produce a precipitate. The product was collected by suction filtration and dried. Then, a solution of 0.15 M TMSOK (30 mg, 0.24 mmol, 1.0 eq.) in water (1.5 mL) was added and the slurry was stirred at room temperature for 24 hours. The resulting mixture was extracted with dichloromethane (4×20 mL). The mixture was washed with Na 2 SO 4 The organic phase was dried and evaporated to give an amorphous solid (20a / 20b) (12 mg, 34%). 1 H NMR (300 MHz, CDCl 3):δ=10.01(s,1H),9.30(s,0.5H),9.07(d,J=5.3Hz,0.5H),9.08(d,J=5.3Hz,1H),8.75(s,0.5H),8.67(s,1H),8.45(d,J=5.3Hz,0.5H),7.75(d,J=5.3Hz,1H),2.86(broad signal,4.5H). 13 C NMR (126 MHz, CDCl 3 ):δ=153.12,150.74,150.56,149.33,148.85,146.96,146.11,145.77,140.87,140.37,129.13,127.06,119.74,117.87,117.81,116.15,10.04,9.98.HRMS(ESI):calculated value C 9 H 8 N 5 [M+1] + 186.0774, measured value [M+1] + 186.0771, calculated value C 9 H 7 N 5 Na[M+Na] + 208.0594, measured value [M+Na] + 208.0589.

[0198] Embodiment 21

[0199] 6-Chloropyrido[3,2-d]tetrazo[1,5-b]pyridazine 21a and 6-Chloropyrido[2,3-d]tetrazo[1,5-b] Pyridazine 21b

[0200] 6,7-Dihydropyrido[2,3-d]pyridazine-5,8-dione (iv)

[0201] This compound was prepared from the diacid according to Example 17, compound (i). 1 H NMR (300MHz, DMSO): δ=11.63 (s, 2H), 9.11 (dd, J=4.5, 1.7Hz, 1H), 8.46 (dd, J=8.1, 1.7Hz, 1H), 7.88 (dd, J=8.1, 4.5Hz, 1H).

[0202] 5,8-Dichloropyrido[2,3-d]pyridazine (v)

[0203] This compound was prepared from compound (iv) according to Example 17, compound (ii). 1 H NMR (300 MHz, CDCl 3): δ=9.41(dd,J=4.4,1.6Hz,1H), 8.64(dd,J=8.4,1.6Hz,1H), 8.02(dd,J=8.4,4.4Hz,1H). 13 C NMR (75MHz, CDCl 3 ): δ=154.33,141.13,134.38,129.09,124.02.

[0204] 6-Chloropyrido[3,2-d]tetrazo[1,5-b]pyridazine 21a and 6-Chloropyrido[2,3-d]tetrazo[1,5-b]pyridazine 21b

[0205] Compound (21a / 21b) was prepared from compound (v) according to Example 17, compound (iii). 1 H NMR (300 MHz, CDCl 3 ): δ=9.42(dd,J=4.6,1.6Hz,1H),9.39(dd,J=4.6,1.6Hz,0.45H),9.08(dd,J=8.2,1.7Hz,0.4 5H), 8.76 (dd, J=8.2, 1.7Hz, 1H), 8.11 (dd, J=8.2, 4.5Hz, 0.45H), 8.06 (dd, J=8.2, 4.5Hz, 1H).

[0206] The isomeric mixture was separated by column chromatography.

[0207] First eluting isomer: 6-chloropyrido[3,2-d]tetrazo[1,5-b]pyridazine 21a. 1 H NMR (600 MHz, CDCl 3 )δ9.39(dd,J=4.5,1.7Hz,1H),9.09(dd,J=8.1,1.7Hz,1H),8.09(dd,J=8.1,4.5Hz,1H). 13 C NMR (126 MHz, CDCl 3 )δ155.56,154.35,141.96,139.60,133.25,129.29,119.72.

[0208] Second eluting isomer: 6-chloropyrido[2,3-d]tetrazo[1,5-b]pyridazine 21b. 1 H NMR (600 MHz, CDCl 3)δ9.42(dd,J=4.5,1.6Hz,1H),8.76(dd,J=8.4,1.6Hz,1H),8.06(dd,J=8.4,4.6Hz,1H). 13 C NMR (126 MHz, CDCl 3 )δ157.71,151.65,142.40,140.00,135.96,127.80,121.58.

[0209] Embodiment 22

[0210] Pyrido[3,2-d]tetraazolo[1,5-b]pyridazine 22a (minor isomer) and pyrido[2,3 ... 5-b] Pyridazine 22b (major isomer)

[0211] This compound was prepared from compound 21 according to Example 18. 1 H-NMR (600MHz, DMSO): δ = 9.47 (s, 1H), 9.43 (d, J = 0.7Hz, 0.2H), 9.36 (dd, J = 4.6, 1.7Hz, 1H), 9.33 (dd, J = 4.5, 1.6Hz, 0.2H) ),9.06(dd,J=8.2,1.6Hz,0.2H),8.81(dd,J=8.1,1.7Hz,1H),8.16(dd,J=8.2,4.6Hz,0.2H),8.11(dd,J=8.1,4.6Hz,1H). 13 C-NMR (126 MHz, DMSO): δ = 156.77, 155.57, 151.53, 150.74, 143.20, 142.55, 141.86, 139.83, 137.68, 132.36, 129.15, 127.68, 122.20, 119.41. HRMS (ESI): calculated value C 7 H 5 N 6 [M+1] + 173.0570, measured value [M+1] + 173.0571, calculated value C 7 H 4 N 6 Na[M+Na] + 195.0390, measured value [M+Na] + 195.0386.

[0212] Embodiment 23

[0213] 6-Chloro-3-methylpyrido[3,2-d][1,2,4]triazolo[4,3-b]pyridazine 23a and 6-chloro-3-methylpyridine [2,3-d][1,2,4]triazolo[4,3-b]pyridazine 23b

[0214] Compound (23a / 23b) was prepared from compound (v) according to Example 19.1 H NMR (300 MHz, CDCl 3 )δ9.25(dd,J=4.6,1.6Hz,0.6H),9.17(dd,J=4.6,1.6Hz,1H),8.96(dd,J=8.1,1.7Hz,1H),8.54(dd,J=8.1,1.7Hz,0.6H),7.91(dd,J=8.1,4.5Hz,1H),7.81(dd,J=8.1,4.5Hz,0.6H),2.85(s, two single peaks merged, 5H).

[0215] The isomeric mixture was separated by column chromatography.

[0216] First eluting isomer: 1 H NMR (300 MHz, CDCl 3 )δ9.17(dd,J=4.6,1.7Hz,1H),8.97(dd,J=8.1,1.7Hz,1H),7.91(dd,J=8.1,4.6Hz,1H),2.85(s,3H). 13 C NMR (126 MHz, CDCl 3 )δ153.37,151.67,148.36,142.07,137.79,131.81,128.70,121.23,9.89.

[0217] Second eluting isomer: 1 H NMR (300 MHz, CDCl 3 )δ9.25(dd,J=4.6,1.6Hz,1H),8.54(dd,J=8.3,1.6Hz,1H),7.81(dd,J=8.3,4.6Hz,1H),2.85(s,3H).

[0218] Embodiment 24

[0219] 3-Methylpyrido[3,2-d][1,2,4]triazolo[4,3-b]pyridazine (minor isomer) 24a and 3-methylpyrido[3,2-d][1,2,4]triazolo[4,3-b]pyridazine Imido[2,3-d][1,2,4]triazolo[4,3-b]pyridazine 24b (major isomer)

[0220] This compound was prepared from compound 23 according to Example 20. 1 H-NMR (500MHz, CDCl 3): δ=9.17(dd,J=4.7,1.7Hz,1H),9.06(dd,J=4.6,1.7Hz,0.6H),8.89(dd,J=8.2,1.7Hz,0.6H),8.83(s,0.6H),8. 67(s,1H),8.28(dd,J=8.1,1.7Hz,1H),7.82(dd,J=8.1,4.6Hz,0.6H),7.73(dd,J=8.0,4.6Hz,1H),2.83(wide signal,4H). 13 C-NMR (126 MHz, CDCl 3 );δ=155.78,153.15,148.68,148.66,148.38,146.52,142.80,141.88,141.07,140.04,135.59,130.88,127.69,125.31,120.41,118.86,9.89,9.72.HRMS(ESI):calculated value C 9 H 8 N 5 [M+1] + 186.0774, measured value [M+1] + 186.0772, calculated value C 9 H 7 N 5 Na[M+Na] + 208.0594, measured value [M+Na] + 208.0594.

[0221] Embodiment 25

[0222] Preparation of single isomers:

[0223] 3-Methylpyrido[3,2-d][1,2,4]triazolo[4,3-b]pyridazine 25

[0224] Furo[3,4-b]pyridin-5(7H)-one (vi)

[0225] 2,3-Pyridinedicarboxylic acid (2.0 g, 11.97 mmol, 1.0 eq) was dissolved in acetic anhydride (4.88 g, 47.87 mmol, 4 eq) and heated to reflux with stirring for 4 hours. The acetic anhydride was evaporated to dryness to give quinoline anhydride (1.82 g, 97%). This compound was used without further purification.

[0226] Under argon, NaBH 44-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4-[4- 3 The aqueous phase was extracted with 4% paraformaldehyde (3 x 40 mL) and the combined organic layers were concentrated. i Recrystallization from -PrOH gave compound (vi) (0.52 g, 32%) as a light yellow solid. 1 H NMR (300 MHz, CDCl 3 )δ8.88(dd,J=4.9,1.6Hz,1H),8.22(dd,J=7.8,1.6Hz,1H),7.49(dd,J=7.8,4.9Hz,1H),5.35(s,2H). 13 C NMR (75MHz, CDCl 3 )δ169.11,166.54,155.39,134.15,124.00,119.81,70.61.

[0227] 7-Bromofuro[3,4-b]pyridin-5(7H)-one (vii)

[0228] Compound (vi) (0.500 g, 3.67 mmol, 1.0 eq.) was mixed with NBS (0.72 g, 4.04 mmol, 1.1 eq.) and AIBN (10 mg) in anhydrous CCl 4 (20 mL) was heated to reflux for 2 hours. The reaction mixture was cooled to room temperature, the succinate was filtered off, and the filtrate was concentrated and purified by silica gel column chromatography (DCM) to give the product (vii) (0.42 g 54%) as an oil. 1 H NMR (300 MHz, CDCl 3 )δ8.99(dd,J=4.9,1.5Hz,1H),8.25(dd,J=7.8,1.6Hz,1H),7.58(dd,J=7.8,4.8Hz,1H),7.39(s,1H).

[0229] Pyrido[2,3-d]pyridazin-5(6H)-one (viii)

[0230] Compound (vii) (0.38 g, 1.78 mmol, 1.0 equivalent) was dissolved in 5% HCl (5 mL / mmol), refluxed and stirred for 2 hours, and then the reaction was cooled to room temperature. After cooling, appropriate hydrazine (68.5 mg, 2.14 mmol, 1.2 equivalent) was added to the solution and stirred for another 2 hours at room temperature. The resulting precipitate was then collected and recrystallized from hot ethanol to obtain pure compound (viii) (0.17 g 66%). 1 H NMR (300MHz, DMSO) δ12.97(s,1H),9.11(dt,J=4.6,1.3Hz,1H),8.57(dd,J=8.1,1.7Hz,1H),8.40(s,1H),7.83(ddd,J=8.1,4.6,0.9Hz,1H).

[0231] 5-Chloropyrido[2,3-d]pyridazine(ix)

[0232] A mixture of compound (viii) (0.147 g, 1.0 mmol, 1.0 eq.) and phosphorus oxychloride (0.382 g, 2.5 mmol, 2.5 eq.) was heated to reflux in pyridine (0.2 mL) and stirred for 8 h. The mixture was then poured into a slurry of 50 g of ice and then treated with NaHCO 3 Neutralize and then extract with ethyl acetate (3×100 mL). Separate the organic phase, wash with water, and 2 SO 4 Dry and evaporate to dryness.The crude product was purified by column chromatography using dichloromethane to give a yellow amorphous solid (ix) (36 mg, 22%). 1 H NMR (300 MHz, CDCl 3 )δ9.73(s,1H),9.32(dd,J=4.4,1.6Hz,1H),8.61(dd,J=8.5,1.5Hz,1H),7.93(dd,J=8.4,4.4Hz,1H).

[0233] 3-Methylpyrido[3,2-d][1,2,4]triazolo[4,3-b]pyridazine 25

[0234] Compound (ix) (30 mg, 0.18 mmol, 1.0 equiv) and acetic acid hydrazide (27 mg, 0.36 mmol, 2.0 equiv) were mixed in distilled water. The mixture was refluxed in oxane (3 mL) for 2 hours. The reaction mixture was extracted with dichloromethane (4 × 20 mL). 2 SO 4The organic phase was dried and evaporated. The crude product was purified by column chromatography using dichloromethane to give (25) as an amorphous solid (21 mg, 65%). 1 H NMR (400 MHz, CDCl 3 )δ9.07(dd,J=4.6,1.7Hz,1H),8.91(ddd,J=8.2,1.6,0.7Hz,1H),8.85(d,J=0.7Hz,1H),7.82(dd,J=8.2,4.6Hz,1H),2.84(s,3H). 13 C NMR (101 MHz, CDCl 3 )δ153.31,148.86,148.60,142.08,140.26,131.10,127.86,120.65,9.92.

[0235] Embodiment 26

[0236] N,3-Dimethylpyrido[3,4-d][1,2,4]triazolo[4,3-b]pyridazin-6-amine 26b (major isomer) and N,3-Dimethylpyrido[4,3-d][1,2,4]triazolo[4,3-b]pyridazin-6-amine 26a (minor isomer)

[0237] Compound 19 (0.050 g, 0.22 mmol, 1.0 equiv) was dissolved in isopropanol (25 mL) and then an appropriate methylamine solution (30%) (0.5 mL) was added. The reaction mixture was refluxed for 3 hours. The mixture was then cooled and poured into ice water (20 mL). The formed precipitate was filtered, washed with water, and crystallized from ethanol to give a mixture of 26a / 26b isomers (ratio 0.7:1.0) (29 mg, 60%). 1 H NMR (600MHz, DMSO) δ9.61(d,J=0.9Hz,1H),9.49(d,J=0.9Hz,0.7H),8.97–8.96(m,1.7H),8.20(dd,J=5.3,0 .9Hz,0.7H),8.12(dd,J=5.7,0.9Hz,1H),7.98–7,85(m,1.7H),2.96(t,J=4.6Hz,5H),2.57(d,J=5.1Hz,5H). 13 C NMR (126 MHz, DMSO) δ 151.85, 151.20, 150.73, 150.07, 147.05, 146.93, 146.51, 145.42, 139.60, 139.04, 128.82, 123.85, 117.99, 116.74, 115.32, 113.37, 28.19, 28.12, 9.32, 9.30. HRMS (ESI): calculated value C 10 H 10 N 6 [M+1]+ 215.1040, measured value [M+1] + 215.1041, calculated value C 10 H 10 N 6 Na[M+Na] + 237.0859, measured value [M+Na] + 237.0859.

[0238] Embodiment 27

[0239] N-Methylpyrido[2,3-d]tetrazo[1,5-b]pyridazin-6-amine 27

[0240] Compound 21b (0.050 g, 0.22 mmol, 1.0 equiv) was dissolved in isopropanol (25 mL) and then an appropriate methylamine solution (30%) (0.5 mL) was added. The reaction mixture was refluxed for 3 hours. The mixture was then cooled and poured into ice water (20 mL). The formed precipitate was filtered, washed with water and crystallized from ethanol to give a single isomer 27 (25 mg, 61%). 1 H NMR (600MHz, DMSO) δ9.15(dd,J=4.6,1.6Hz,1H),8.88(dd,J=8.1,1.6Hz,1H),8.44(q,J=4.9Hz,1H),8.06(dd,J=8.1,4.6Hz,1H),3.03(d,J=4.9Hz,3H). 13 C NMR (126 MHz, DMSO) δ 153.62, 153.18, 139.49, 136.44, 132.60, 128.23, 117.82, 28.04. HRMS (ESI): calculated value C 8 H 7 N 7 [M+1] + 202.0836, measured value [M+1] + 202.0837, calculated value C 8 H 7 N 7 Na[M+Na] + 224.0655, measured value [M+Na] + 224.0655.

[0241] Embodiment 28

[0242] 6-Ethoxy-3-methylpyrido[4,3-d][1,2,4]triazolo[4,3-b]pyridazine 28a (major isomer) and 6-Ethoxy-3-methylpyrido[3,4-d][1,2,4]triazolo[4,3-b]pyridazine 28b (minor isomer)

[0243] Compound (19) (0.050 g, 0.22 mmol, 1.0 eq) was dissolved in ethanol (3 mL), and KCN (0.016 mg, 0.25 mmol, 1.1 eq) was then added. The reaction mixture was refluxed for 4 hours. Then, the mixture was cooled and poured into ice water (20 mL), and extracted with DCM (3×20 mL). The organic solvent was evaporated in vacuo and crystallized from DCM to give the product (28a / 28b) (36 mg, 69%). 1 H NMR (300 MHz, CDCl 3 )δ9.90(s,1H),9.45(s,0.5H),9.03(d,J=5.4Hz,0.5H),8.98(d,J=5.4Hz,1H),8.34(d,J=5.4Hz,0.5H),7.94(d,J=5.4Hz,1H),4.61(m,3H),2.74(m,5H),1.58(m,5H).HRMS(ESI):calculated value C 11 H 11 N 5 O[M+1] + 230.1036, measured value [M+1] + 230.1037, calculated value C 11 H 11 N 5 ONa[M+Na] + 252.0856, measured value [M+Na] + 252.0852.

[0244] Embodiment 29

[0245] 6-Isopropoxy-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine 29

[0246] Example 4 (70 mg, 0.32 mmol, 1.0 eq.) and K 2 CO 3 (88 mg, 0.64 mmol, 2.0 equiv) was refluxed in isopropanol (5 mL) for 48 h and then concentrated under reduced pressure. The reaction mixture was extracted with dichloromethane (4×40 mL). The organic phase was washed with Na 2 SO 4 Dry and concentrate by rotary evaporation. The crude product is purified by column chromatography in dichloromethane to give an amorphous solid (91%). 1 HNMR (300MHz, CDCl 3)δ8.56(dd,J=8.0,1.2Hz,1H),8.15(dd,J=8.0,1.2Hz,1H),7.86(td,J=7.7,1.3Hz,1H),7 .72(td,J=7.7,1.3Hz,1H),5.45(hept,J=6.2Hz,1H),2.72(s,3H),1.52(d,J=6.2Hz,6H). 13 C NMR (126 MHz, CDCl 3 )δ157.16,147.60,142.46,133.44,130.23,125.28,124.74,123.10,119.17,71.53,21.84,9.87.HRMS(ESI):calculated value C 13 H 14 N 4 O[M+1] + 243.1240, measured value [M+1] + 243.1241, calculated value C 13 H 14 N 4 O[M+Na] + 265.1067, measured value [M+Na] + 265.1060.

[0247] Embodiment 30

[0248] 3-Methyl-7,8,9,10-tetrahydropyrido[3,2-d][1,2,4]triazolo[4,3-b]pyridazine 30

[0249] Using a ThalesNano H-Cube apparatus, a methanol solution of compound 23 (50 mg) was pumped into a CatCart (Pd-C) at a liquid flow rate of 1.0 mL / min and a temperature of 60° C. The crude product was purified by column chromatography using dichloromethane and methanol to afford 32 mg (74%) of compound 30 as a white amorphous solid. 1 HNMR(600MHz,MeOD)δ8.01(s,1H),3.39(ddd,J=7.0,4.0,1.0Hz,2H),2.85(tt,J=6.5,1.0Hz,2H),2.63(s,3H),2.02–1.95(m,2H). 13 CNMR (126 MHz, MeOD) δ 147.31, 146.78, 142.26, 139.08, 104.02, 41.37, 20.82, 20.41, 9.25. HRMS (ESI): calculated value C 9 H 12 N 5 [M+1] +190.1087, measured value [M+1] + 190.1092, calculated value C 9 H 11 N 5 Na[M+Na] + 212.0907, measured value [M+Na] + 212.0908.

[0250] Embodiment 31

[0251] 7,8,9,10-Tetrahydropyrido[3,2-d]tetrazo[1,5-b]pyridazine 31a and 7,8,9,10-tetrahydropyrido[3,2-d]tetrazo[1,5-b]pyridazine 31a [2,3-d]tetrazo[1,5-b]pyridazine 31b

[0252] Prepared from 50 mg of compound 21 under the same conditions as in Example 30, yielding 30 mg (72%). 1 H-NMR(600MHz,DMSO)δ8.25(s,1H),8.22(s,0.2H),7.35(s,1H),3.36–3.30(m ,2H),2.85(t,J=6.3Hz,2H),2.73(t,J=6.2Hz,0.4H),1.88(h,J=5.7Hz,2.4H).

[0253] Embodiment 32

[0254] 3-Methyl-7,8,9,10-tetrahydropyrido[4,3-d][1,2,4]triazolo[4,3-b]pyridazine 32a and 3-methyl- 7,8,9,10-Tetrahydropyrido[3,4-d][1,2,4]triazolo[4,3-b]pyridazine 32b

[0255] Prepared from 50 mg of compound 19 under the same conditions as in Example 30, yielding 25 mg (60%). 1 H NMR (300MHz, CD 3 OD_SPE)δ8.36(s,1H),8.34(s,0.5H),4.25(t,J=2.1Hz,2H),4.05(t,J=2.1Hz,1H),3.29–3.21(m,3H),3.14–3.03(m,1H),2.88–2.83(m,2H),2.76(s, broad signal,4H).

[0256] Embodiment 33

[0257] 1-(9,10-dihydropyrido[4,3-d]tetrazo[1,5-b]pyridazin-8(7H)-yl)ethan-1-one 33a and 1- (7,10-Dihydropyrido[3,4-d]tetrazo[1,5-b]pyridazin-9(8H)-yl)ethan-1-one 33b

[0258] 7,8,9,10-Tetrahydropyrido[4,3-d]tetrazo[1,5-b]pyridazine (x)

[0259] Prepared from 50 mg of compound 17 under the same conditions as in Example 30 to give compound (x) (22 mg, 52%). 1H NMR (300MHz, DMSO) δ8.77 (s, 0.5H), 8.76 (s, 1H), 4.03 (d, J = 2.4Hz, 2H), 3.90 (s, 0H), 3.14–2.96 (m, 4H).

[0260] Compound (x) (1.0 equivalent) was dissolved in dichloromethane and Et 3 N (1.2 eq) and acetyl chloride (1.2 eq) were added and stirred at room temperature for 6 hours. The reaction mixture was extracted with DCM and water. The crude product was purified by column chromatography using DCM and MeOH (9:1) to give 33a / 33b (25 mg, 48%) as an amorphous solid. 1 H NMR (300 MHz, CDCl 3 )δ8.47(s,0.5H),8.44(s,1H),5.19–5.03(m,2H),4.95–4.78(m,1H),4.01–3.98(m,1H),3.93–3.82(m,2H),3.38–3.23(m,1H),3.07-3.00(m,2H),2.25(s, broad signal,5H).

[0261] Embodiment 34

[0262] 3-Methylthieno[3,2-d][1,2,4]triazolo[4,3-b]pyridazine 34

[0263] 2-Formylthiophene-3-carboxylic acid

[0264] n-BuLi (15.60 mL, 39.01 mmol, 2.5 mol / L, 2.5 equiv) was added dropwise to a stirred solution of commercially available thiophene-3-carboxylic acid 1 (2.0 g, 15.60 mmol, 1.0 equiv) in anhydrous THF (40 mL) at -78 °C. After 2 h, DMF (6 mL, 78.03 mmol, 5.0 equiv) was added. After an additional 1 h, the cooling bath was removed and the mixture was stirred at ambient temperature for 16 h. HCl (aqueous solution, 1 M, 60 mL) was added. The mixture was extracted with ethyl acetate (3 x 30 mL) and dried (Na2O3). 2 SO 4 ) and concentrated in vacuo. The resulting yellow solid (xi) (yield 2.20 g, 91%) was used without further purification. 1 H NMR (300 MHz, CDCl 3 )δ10.60(s,1H),7.72–7.65(m,2H).HRMS(ESI):calculated value C 6 H 4 O 3 S[M+1] +156.9954, measured value [M+1] + 156.9951, calculated value C 6 H 4 O 3 SNa[M+Na] + 178.9773, measured value [M+Na] + 178.9772.

[0265] Thieno[2,3-d]pyridazin-4(5H)-one (xii)

[0266] A round-bottom flask was equipped with a stirring rod and a reflux condenser. (xi) product (1.9 g, 12.16 mmol, 1.0 eq.), hydrazine hydrate (55%) (1.52 g, 30.41 mmol, 2.5 eq.) and EtOH (5 mL) were added to the flask and refluxed for 3 hours. The reaction was cooled to room temperature and concentrated by rotary evaporation. Water (20 mL) was added and the filtrate was separated from the insoluble solid. The aqueous layer was concentrated by rotary evaporation to obtain a light yellow solid. The solid was dried overnight in a vacuum oven at 50 ° C. The desired compound (xii) (1.56 g, 84% yield) was obtained. 1 H NMR (500MHz, DMSO) δ12.84(s,1H),8.57(s,1H),8.04(d,J=5.2Hz,1H),7.63(d,J=5.1Hz,1H). 13 C NMR (126 MHz, DMSO) δ 158.38, 140.71, 135.85, 133.50, 133.08, 123.93. HRMS (ESI): calculated value C 6 H 4 N 2 OS[M+1] + 153.0117, measured value [M+1] + 153.0119, calculated value C 6 H 4 N 2 OSNa[M+Na] + 174.9937, measured value [M+Na] + 174.9936.

[0267] 4-Chlorothieno[2,3-d]pyridazine (xiii)

[0268] The round-bottom flask was equipped with a stirring bar and a reflux condenser. The product of (xii) (1.3 g, 8.54 mmol, 1.0 equiv), phosphorus oxychloride (8 mL, 85.43 mmol, 10.0 equiv) and pyridine (1.4 mL, 17.08 mmol, 2.0 equiv) were added to the flask and refluxed for 24 h. The reaction was cooled to room temperature, poured into ice, and then washed with NaHCO 3 Neutralize. Separate the mixture and extract the aqueous layer with chloroform (4×30 mL). Combine the organic layers and dry (Na 2 SO 4 ) and concentrated by rotary evaporation to give a yellow solid (xiii) (0.73 g, 50% yield). 1 H NMR (400 MHz, CDCl 3 )δ9.58(d,J=0.8Hz,1H),7.96(d,J=5.3Hz,1H),7.63(dd,J=5.3,0.8Hz,1H). 13 C NMR (101 MHz, CDCl 3 )δ151.33,145.69,140.39,136.00,134.23,122.44.HRMS(EI):calculated value C 6 H 3 C1N 2 S[M] + 169.9700, measured value [M] + 169.9698.

[0269] 3-Methylthieno[3,2-d][1,2,4]triazolo[4,3-b]pyridazine 34

[0270] Compound (xiii) (75 mg, 0.43 mmol, 1.0 equiv.) and acetic acid hydrazide (65 mg, 0.87 mmol, 2.0 equiv.) were mixed in distilled water. The mixture was refluxed in oxane (3 mL) for 3 hours. The reaction mixture was extracted with dichloromethane (4 × 20 mL). 2 SO 4 The organic phase was dried and evaporated. The crude product was purified by column chromatography using dichloromethane to give 34 (72 mg, 87%) as an amorphous solid. 1 H NMR (400 MHz, CDCl 3 )δ8.73(d,J=0.7Hz,1H),8.07(dd,J=5.2,0.8Hz,1H),8.00(d,J=5.3Hz,1H),2.84(s,3H). 13 C NMR (101 MHz, CDCl 3)δ147.65,142.51,140.03,134.99,131.53,130.12,122.73,10.28.HRMS(ESI):calculated value C 8 H 6 N 4 S[M+1] + 191.0386, measured value [M+1] + 191.0388, calculated value C 8 H 6 N 4 SNa[M+Na] + 213.0205, measured value [M+Na] + 213.0208.

[0271] Embodiment 35

[0272] Tetrazo[1,5-b]thieno[3,2-d]pyridazine 35

[0273] Compound (xiii) (70 mg, 0.41 mmol, 1.0 eq) was dissolved in DMF (1 mL), and sodium azide (32 mg, 0.48 mmol, 1.2 eq) was then added. The reaction mixture was heated at 120 °C for 3 h. The reaction was cooled to room temperature and poured into water. The mixture was separated and the aqueous layer was extracted with chloroform (4 x 20 mL). The organic layers were combined and dried (Na 2 SO 4 ) and concentrated by rotary evaporation to afford 35 as a yellow amorphous solid (70 mg, 97% yield). 1 H NMR (300MHz, DMSO) δ9.55 (s, 1H), 8.63 (d, J = 5.2Hz, 1H), 8.19 (d, J = 5.2Hz, 1H). 13 C NMR (75 MHz, DMSO) δ 143.62, 141.48, 140.39, 134.60, 130.26, 122.42. HRMS (ESI): calculated value C 6 H 3 N 5 S[M+1] + 178.0182, measured value [M+1] + 178.0184, calculated value C 6 H 3 N 5 SNa[M+Na] + 200.0001, measured value [M+Na] + 200.0006.

[0274] Embodiment 36

[0275] 3-Methylthieno[2,3-d][1,2,4]triazolo[4,3-b]pyridazine 36

[0276] 3-Formylthiophene-2-carboxylic acid (xiv)

[0277] Compound (xiv) was prepared according to Compound (xi) in Example 34 from thiophene-2-carboxylic acid. 1 H NMR (300 MHz, CDCl 3 )δ10.48(s,1H),7.64–7.59(m,2H).HRMS(ESI):calculated value C 6 H 4 O 3 S[M+1] + 156.9954, measured value [M+1] + 156.9948, calculated value C 6 H 4 O 3 SNa[M+Na] + 178.9773, measured value [M+Na] + 178.9770.

[0278] Thieno[2,3-d]pyridazin-7(6H)-one (xv)

[0279] Compound (xv) was prepared from compound (xiv) according to compound (xii) in Example 34. 1 H NMR (500MHz, DMSO) δ12.93 (s, 1H), 8.44 (s, 1H), 8.19 (d, J = 5.1Hz, 1H), 7.58 (d, J = 5.1Hz, 1H). 13 C NMR (126 MHz, DMSO) δ 158.19, 139.97, 136.24, 135.83, 134.55, 124.82. HRMS (ESI): calculated value C 6 H 4 N 2 OS[M+1] + 153.0117, measured value [M+1] + 153.0118, calculated value C 6 H 4 N 2 OSNa[M+Na] + 174.9937, measured value [M+Na] + 174.9942.

[0280] 7-Chlorothieno[2,3-d]pyridazine (xvi)

[0281] Compound (xvi) was prepared from compound (xv) according to compound (xiii) in Example 34. 1 H NMR (600 MHz, CDCl 3 )δ9.49(s,1H),7.94(d,J=5.3Hz,1H),7.58(d,J=5.3Hz,1H). 13 C NMR (126 MHz, CDCl 3 )δ150.89,146.07,139.51,138.28,134.53,123.26.HRMS(ESI):calculated value C 6 H 3 C1N 2 S[M+1] + 170.9778, measured value [M+1] + 170.9781, calculated value C 6 H 3 C1N 2 SNa[M+Na] + 192.9598, measured value [M+Na] + 192.9596.

[0282] 3-Methylthieno[2,3-d][1,2,4]triazolo[4,3-b]pyridazine 36

[0283] Compound 36 was prepared from compound (xvi) according to compound 34. 1 H NMR (600 MHz, CDCl 3 )δ8.69(s,1H),7.73(d,J=5.2Hz,1H),7.55(d,J=5.2Hz,1H),2.85(s,3H). 13 C NMR (126 MHz, CDCl 3 )δ147.76,142.17,141.23,132.51,130.76,129.98,124.00,10.31.HRMS(ESI):calculated value C 8 H 6 N 4 S[M+1] + 191.0386, measured value [M+1] + 191.0388, calculated value C 8 H 6 N 4 SNa[M+Na] + 213.0205, measured value [M+Na] + 213.0207.

[0284] Embodiment 37

[0285] Tetrazo[1,5-b]thieno[2,3-d]pyridazine 37

[0286] Compound 37 was prepared from compound (xvi) according to compound 35. 1 H NMR (500MHz, DMSO) δ9.43 (s, 1H), 8.43 (d, J = 5.1Hz, 1H), 7.99 (d, J = 5.1Hz, 1H). 13 C NMR (126 MHz, DMSO) δ 144.02, 141.33, 134.94, 134.78, 130.73, 125.22. HRMS (ESI): calculated value C 6 H 3 N 5 S[M+1] + 178.0182, measured value [M+1] + 178.0183, calculated value C 6 H 3 N 5 SNa[M+Na] + 200.0001, measured value [M+Na] + 200.0003.

[0287] Embodiment 38

[0288] 6-Chloro-3-methylthieno[3,4-d][1,2,4]triazolo[4,3-b]pyridazine 38

[0289] Dimethylthiophene-3,4-dicarboxylate (xvii)

[0290] The round-bottom flask was equipped with a stirring bar and a reflux condenser. The commercially available diacid (2.5 g, 14.52 mmol, 1.0 equiv) was charged into the flask and dissolved in MeOH (65 mL) containing a catalytic amount of H 2 SO 4 (~2.5 mL). The reaction was heated to reflux and stirred for 24 hours. The reaction was cooled to room temperature and concentrated by rotary evaporation. The residue was purified by silica gel chromatography and eluted with DCM to give dimethylthiophene-3,4-dicarboxylate (xvii) as a solid (2.42 g, 83%). 1 H NMR (400 MHz, CDCl 3 )δ7.85(s,2H),3.88(s,6H). 13 C NMR (101 MHz, CDCl 3 )δ163.62,133.37,131.97,52.49.HRMS(ESI):calculated value C 8 H 8O 4 S[M+1] + 201.0216, measured value [M+1] + 201.0216, calculated value C 8 H 8 O 4 SNa[M+Na] + 223.0036, measured value [M+Na] + 223.0040.

[0291] 2,3-Dihydrothieno[3,4-d]pyridazine-1,4-dione (xviii)

[0292] Compound (xvii) (2.0 g, 0.9.99 mmol, 1.0 equivalent) was charged into ethanol (15 mL) in a round bottom flask and reacted with hydrazine hydrate (1.35 g, 26.97 mmol, 2.7 equivalent). The reaction mixture was refluxed for 4 hours. After the reaction was complete, the reaction mixture was cooled to room temperature and concentrated under vacuum. The crude solid compound was dissolved in 1% volume NH 4 OH in water and precipitated by adding concentrated HCl to the solution. Finally, the solid compound was washed with cold water, MeOH, and then dried at room temperature to obtain solid (xviii) (1.3 g, 78%). 1 H NMR (400MHz, DMSO) δ11.20 (broadsinglet, 2H), 8.36 (s, 2H). 13 C NMR (101 MHz, DMSO) δ 153.12, 130.42, 128.41. HRMS (ESI): calculated value C 6 H 4 N 2 O 2 S[M+1] + 169.0066, measured value [M+1] + 169.0069, calculated value C 6 H 4 N 2 O 2 SNa[M+Na] + 190.9886, measured value [M+Na] + 190.9891.

[0293] 1,4-Dichlorothieno[3,4-d]pyridazine (xix)

[0294] The round bottom flask was equipped with a stirring bar and a reflux condenser. The product (xviii) (1.3 g, 7.73 mmol, 1.0 equiv), phosphorus oxychloride (4 mL) and pyridine (1 mL) were added to the flask and refluxed under argon for 16 hours. The reaction was cooled to room temperature and poured onto ice. The mixture was separated and the aqueous layer was extracted with chloroform (4×75 mL). The organic layers were combined and dried (Na 2 SO 4 ) and concentrated by rotary evaporation. The residue was purified by silica gel column chromatography eluting with DCM to afford (xix) as a yellow solid (0.72 g, 46%). 1 H NMR (400 MHz, CDCl 3 )δ8.31(s,2H). 13 C NMR (126 MHz, CDCl 3 )δ150.37,131.24,126.40.HRMS(ESI):calculated value C 6 H 2 N 2 SCl 2 [M+1] + 204.9389, measured value [M+1] + 204.9389, calculated value C 6 H 2 N 2 SCl 2 Na[M+Na] + 226.9208, measured value [M+Na] + 226.9209.

[0295] 6-Chloro-3-methylthieno[3,4-d][1,2,4]triazolo[4,3-b]pyridazine 38

[0296] Compound (xix) (0.204 g, 1.0 mmol, 1.0 equiv) and acetic hydrazide (0.222 g, 3.0 mmol, 2.0 equiv) were mixed in distilled water. The mixture was refluxed in oxane (3 mL) for 16 h. The reaction mixture was extracted with chloroform (4 × 30 mL). 2 SO 4 The organic phase was dried and evaporated. The crude product was purified by column chromatography using dichloromethane to give 38 (0.192 g, 86%) as an amorphous solid. 1 H NMR (600 MHz, CDCl 3 )δ8.42(d,J=3.0Hz,2H),8.28(d,J=3.1Hz,2H),2.75(s,6H). 13 C NMR (126 MHz, CDCl 3)δ147.78,145.11,141.19,129.60,127.87,124.31,122.63,10.20.HRMS(ESI):calculated value C 8 H 5 N 4 SCl[M+1] + 224.9996, measured value [M+1] + 224.9997, calculated value C 8 H 5 N 4 SClNa[M+Na] + 246.9816, measured value [M+Na] + 246.9822.

[0297] Embodiment 39

[0298] 3-Methylthieno[3,4-d][1,2,4]triazolo[4,3-b]pyridazine 39

[0299] Compound 38 (40 mg, 0.17 mmol, 1.0 equiv) was dissolved in ethanol (3 mL), and hydrazine hydride (55%) (17.8 mg, 0.35 mmol, 2.0 equiv) was slowly added. The reaction mixture was refluxed for 2 hours to produce a precipitate. The product was collected by suction filtration and dried. Then, a solution of 0.15 M TMSOK (22 mg, 0.17 mmol, 1.0 equiv) in water (1.6 mL) was added and the slurry was stirred at room temperature for 48 hours. The resulting mixture was extracted with chloroform (4×20 mL). The mixture was purified by evaporation with Na 2 SO 4 The organic phase was dried and evaporated to give 39 as an amorphous solid (12 mg, 35%). 1 H NMR (600 MHz, CDCl 3 )δ8.49(d,J=0.9Hz,1H),8.39(dd,J=2.9,0.9Hz,1H),8.15(d,J=2.9Hz,1H),2.76(s,3H). 13 C NMR (126 MHz, CDCl 3 )δ148.18,142.27,141.73,128.44,128.31,124.58,121.39,10.26.HRMS(ESI):calculated value C 8 H 6 N 4 S[M+1] + 191.0386, measured value [M+1] + 191.0387, calculated value C 8 H 6 N 4SNa[M+Na] + 213.0205, measured value [M+Na] + 213.0199.

[0300] Embodiment 40

[0301] 6-Chlorotetrazolo[1,5-b]thieno[3,4-d]pyridazine 40

[0302] 1,4-Dichlorothieno[3,4-d]pyridazine (xix) (0.100 g, 0.49 mmol, 1.0 equiv) was dissolved in methanol (8 mL), hydrazine hydride (55%) (0.049 g, 0.98 mmol, 2.0 equiv) was slowly added, and the reaction mixture was refluxed for 1 hour. After the reaction was completed, the reaction mixture was cooled to room temperature and concentrated in vacuo to obtain a crude yellow precipitate. It was dissolved in acetic acid (5 mL, 2 N) and the ice-cold solution was heated with cold NaNO under stirring. 2 Aqueous solution (50 mg, 0.73 mmol, 1.5 equiv. in 2 mL of water) was treated dropwise. The reaction mixture was stirred at room temperature for 1 hour. The compound was extracted with chloroform (3×25 mL). 2 SO 4 The organic phase was dried and evaporated to give 40 as an amorphous solid (48 mg, 46%). 1 H NMR (500MHz, DMSO) δ8.99 (d, J = 2.8 Hz, 1H), 8.80 (d, J = 2.8 Hz, 1H). 13 C NMR (126MHz, DMSO) δ150.35, 140.43, 130.79, 126.37, 124.04, 121.94.

[0303] Embodiment 41

[0304] Tetrazo[1,5-b]thieno[3,4-d]pyridazine 41

[0305] Compound 40 (40 mg, 0.18 mmol, 1.0 eq) was dissolved in ethanol (3 mL), hydrazine hydride (55%) (18.9 mg, 0.37 mmol, 2.0 eq) was slowly added, and the reaction mixture was refluxed for 2 hours to produce a precipitate. The product was collected by suction filtration and dried. Then, a solution of 0.15 M TMSOK (24 mg, 0.18 mmol, 1.0 eq) in water (1.7 mL) was added, and the slurry was stirred at room temperature for 48 hours. The resulting mixture was extracted with chloroform (4×20 mL). The mixture was washed with Na 2 SO 4 The organic phase was dried and evaporated to give 41 as an amorphous solid (8 mg, 23%). 1 H NMR (600 MHz, CDCl 3)δ9.34(s,1H),8.48(d,J=3.2Hz,1H),7.96(d,J=3.2Hz,1H). 13 C NMR (126 MHz, CDCl 3 )δ157.22,135.32,132.41,131.03,130.35,126.09.HRMS(ESI):calculated value C 6 H 3 N 5 S[M+1] + 178.0182, actual value [M+1] + 178.0192.

[0306] Embodiment 42

[0307] 3-Methylfuro[2,3-d][1,2,4]triazolo[4,3-b]pyridazine 42

[0308] 2-Formylfuran-3-carboxylic acid (xx)

[0309] n-BuLi (17.84 mL, 44.61 mmol, 2.5 mol / L, 2.5 eq) was added dropwise to a stirred solution of commercially available furan-2-carboxylic acid (2.0 g, 17.84 mmol, 1.0 eq) in anhydrous THF (60 mL) at -78 °C. After 2 h, DMF (2.7 mL, 35.68 mmol, 2.0 eq) was added. After another hour, the cooling bath was removed and the mixture was stirred at ambient temperature for 16 h. Then, HCl (aqueous solution, 1 M, 60 mL) was added. The mixture was extracted with ethyl acetate (3 x 40 mL) and dried (Na2O3). 2 SO 4 ) and concentrated in vacuo. The resulting yellow solid (xx) (yield 2.36 g, 94%) was used without further purification.

[0310] 7-Chlorofuro[2,3-d]pyridazine (xxi)

[0311] The round bottom flask was equipped with a stirring bar and a reflux condenser. The product 2-formylfuran-3-carboxylic acid (xx) (0.500 g, 3.57 mmol, 1.0 equiv), hydrazine hydrate (55%) (0.446 g, 8.92 mmol, 2.5 equiv) and MeOH (10 mL) were added to the flask and refluxed for 4 h. The reaction was cooled to room temperature, concentrated by rotary evaporation, and dried under high vacuum to give crude furano[2,3-d]pyridazin-7(6H)-one. Then, phosphorus oxychloride (5.46 g, 3.3 mL, 35.71 mmol, 10.0 equiv) and pyridine (0.56 g, 0.57 mL, 7.14 mmol, 2.0 equiv) were added and refluxed for 24 h. The reaction was cooled to room temperature, poured into ice, and then washed with NaHCO 3 Neutralize. Separate the mixture and extract the aqueous layer with chloroform (4×50 mL). Combine the organic layers and dry (Na 2 SO 4 ) and concentrated by rotary evaporation. The residue was purified by silica gel column chromatography eluting with DCM to give 7-chlorofuro[2,3-d]pyridazine (xxi) (0.135 g, 25% yield) as a yellow solid. 1 H NMR (400 MHz, CDCl 3 )δ9.47(s,1H),7.94(d,J=2.1Hz,1H),7.00(d,J=2.1Hz,1H). 13 C NMR (126 MHz, CDCl 3 )δ149.84,149.15,146.51,141.89,105.74.HRMS(EI):calculated value C 6 H 3 C1N 2 O[M] + 153.9928, actual value [M] + 153.9927.

[0312] 3-Methylfuro[2,3-d][1,2,4]triazolo[4,3-b]pyridazine 42

[0313] 7-Chlorofuro[2,3-d]pyridazine (xxi) (25 mg, 0.16 mmol, 1.0 equiv) and acetic hydrazide (24 mg, 0.32 mmol, 2.0 equiv) were mixed in distilled water. The mixture was refluxed in 2 mL of oxane for 24 h. The reaction mixture was extracted with chloroform (4 × 20 mL). 2 SO 4The organic phase was dried and evaporated. The crude product was purified by column chromatography using dichloromethane to afford 3-methylfuro[2,3-d][1,2,4]triazolo[4,3-b]pyridazine 42 as an amorphous solid (17 mg, 60%). 1 H NMR (400 MHz, CDCl 3 )δ8.66(s,1H),7.90(d,J=2.1Hz,1H),7.00(d,J=2.1Hz,1H),2.85(s,3H). 13 C NMR (126 MHz, CDCl 3 )δ147.96,147.31,145.54,140.93,138.11,117.60,106.72,10.39.HRMS(ESI):calculated value C 8 H 6 N 4 O[M+1] + 175.0614, actual value [M+1] + 175.0617, calculated value C 8 H 6 N 4 ONa[M+Na] + 197.0434, actual value [M+Na] + 197.0434.

[0314] Embodiment 43

[0315] Furo[2,3-d]tetrazo[1,5-b]pyridazine 43

[0316] 7-Chlorofuro[2,3-d]pyridazine (xxi) (50 mg, 0.32 mmol, 1.0 eq) was dissolved in DMF (1 mL) and sodium azide (31 mg, 0.48 mmol, 1.5 eq) was added. The reaction mixture was heated at 120 °C for 24 h. The reaction was cooled to room temperature and poured into water. The mixture was separated and the aqueous layer was extracted with chloroform (4 x 25 mL). The organic layers were combined and dried (Na 2 SO 4 ) and concentrated by rotary evaporation to afford furano[2,3-d]tetrazo[1,5-b]pyridazine 43 as a yellow amorphous solid (40 mg, 76% yield). 1 H NMR (400 MHz, CDCl 3 )δ9.01(s,1H),8.14(d,J=2.1Hz,1H),7.23(d,J=2.1Hz,1H). 13 C NMR (101 MHz, CDCl 3)δ149.91,144.73,142.13,137.04,122.11,107.26.HRMS(ESI):calculated value C 6 H 3 N 5 O[M+1] + 162.0410, actual value [M+1] + 162.0409, calculated value C 6 H 3 N 5 ONa[M+Na] + 184.0230, actual value [M+Na] + 184.0235.

[0317] Embodiment 44

[0318] 6,10-dichloro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine 44a (major isomer) and 6,7-dichloro-3- Methyl-[1,2,4]triazolo[3,4-a]phthalazine 44b (minor isomer)

[0319] 5-Chloro-2,3-dihydrophthalazine-1,4-dione

[0320] 4-Chloroisobenzofuran-1,3-dione (10 g, 54.76 mmol, 1.0 eq) was dissolved in 10% HCl (50 mL), hydrazine hydrate (55%) (2.63 g, 82.14 mmol, 1.5 eq) was added, and the mixture was stirred and refluxed for 16 hours. The product was collected by suction filtration, washed with water and dried to obtain an amorphous solid (10.1 g, 93%). 1 H NMR (300 MHz, DMSO) δ 11.60 (s, 2H), 8.00 (d, J = 7.6 Hz, 1H), 7.84 (m, 2H). HRMS (ESI): calculated value C 8 H 5 C1N 2 O 2 [M+1] + 197.0112, actual value [M+1] + 197.0110, calculated value C 8 H 5 C1N 2 O 2 [M+Na] + 218.9932, actual value [M+Na] + 218.9938.

[0321] 1,4,5-Trichlorophthalazine

[0322] A round bottom flask was equipped with a stirring bar and a reflux condenser. 5-Chloro-2,3-dihydrophthalazine-1,4-dione (10 g, 50.86 mmol, 1.0 equiv) and phosphorus oxychloride (23.65 mL, 508.64 mmol, 5.0 equiv) were added to the flask and refluxed for 24 hours. The reaction was cooled to room temperature and poured into ice. The mixture was separated and the aqueous layer was extracted with chloroform (4×60 mL). The organic layers were combined and dried (Na 2 SO 4 ) and concentrated by rotary evaporation. The crude product was purified by column chromatography using dichloromethane to give an amorphous solid (2.1 g, 26%). 1 H NMR (400 MHz, CDCl 3 )δ8.34(dd,J=8.3,1.2Hz,1H),8.11(dd,J=7.8,1.2Hz,1H),7.94(dd,J=8.3,7.8Hz,1H). 13 C NMR (126 MHz, CDCl 3 )δ155.28,152.45,137.79,134.17,132.06,129.45,125.83,124.59.HRMS(ESI):calculated value C 8 H 3 Cl 3 N 2 [M+1] + 232.9435, actual value [M+1] + 232.9441, calculated value C 8 H 3 Cl 3 N 2 [M+Na] + 254.9254, actual value [M+Na] + 254.9263.

[0323] 6,10-dichloro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine 44a (major isomer) and 6,7-dichloro-3- Methyl-[1,2,4]triazolo[3,4-a]phthalazine 44b (minor isomer)

[0324] 1,4,5-Trichlorophthalazine (500 mg, 2.15 mmol, 1.0 equiv) and acetic hydrazide (318 mg, 4.31 mmol, 2.0 equiv) were mixed in a The mixture was refluxed in oxane (6 mL) for 4 hours. The reaction mixture was extracted with dichloromethane (4×40 mL). The organic phase was washed with Na 2 SO 4 Drying and concentration by rotary evaporation gave a solid (421 mg, 77%). 1 H NMR (300 MHz, CDCl 3)δ8.67(dd,J=7.4,2.0Hz,0.17H),8.23(dd,J=8.1,1.1Hz,1H),8.03(dd,J=8.0,1.2Hz,1H),7.88–7.80(m,0.36H),7.77(t,J=8.1Hz,1H),2.83(s,3H),2.81(s,0.60H).HRMS(ESI):calcd. 10 H 6 Cl 2 N 4 [M+1] + 253.0042, actual value [M+1] + 253.0042, calculated value C 10 H 6 Cl 2 N 4 [M+Na] + 274.9862, actual value [M+Na] + 274.9868.

[0325] The isomer mixture was separated by column chromatography. First eluent isomer: 6,10-dichloro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine 44a (major isomer) 1 H NMR (300 MHz, CDCl 3 )δ8.23 (dd, J = 8.1, 1.3 Hz, 1H), 8.04 (dd, J = 8.1, 1.3 Hz, 1H), 7.77 (t, J = 8.1 Hz, 1H), 2.83 (s, 3H). Second eluting isomer: 6,7-dichloro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine 44b (minor isomer) 1 H NMR (300 MHz, CDCl 3 )δ8.68(dd,J=7.3,1.9Hz,1H),7.91–7.80(m,2H),2.81(s,3H).

[0326] Embodiment 45

[0327] 10-Chloro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine 45

[0328] Compound 44a (major isomer) (250 mg, 0.98 mmol, 1.0 equiv) was dissolved in ethanol (5 mL), hydrazine hydride (55%) (63.24 mg, 1.97 mmol, 2.0 equiv) was slowly added, and the reaction mixture was refluxed for 3 hours to produce a precipitate. The product was collected by suction filtration and dried. Then, 0.15 M TMSOK (126 mg, 0.98 mmol, 1.0 equiv) in water was added and the slurry was stirred at room temperature for 48 hours. The resulting mixture was extracted with chloroform (4×30 mL). The mixture was purified by HPLC. 2 SO 4 The organic phase was dried and evaporated. The crude product was purified by column chromatography using dichloromethane to give an amorphous solid (45 mg, 21%). 1 H NMR (300 MHz, CDCl 3 )δ8.59(s,1H),7.98(dd,J=7.9,1.2Hz,1H),7.84(dd,J=7.8,1.2Hz,1H),7.71(t,J=7.9Hz,1H),2.84(s,3H).HRMS(ESI):calculated value C 10 H 7 C1N 4 [M+1] + 219.0432, actual value [M+1] + 219.0435, calculated value C 10 H 7 C1N 4 [M+Na] + 241.0251, actual value [M+Na] + 241.0259.

[0329] Embodiment 46

[0330] 6,10-Dichlorotetrazo[5,1-a]phthalazine 46

[0331] 1,4,5-Trichlorophthalazine (800 mg, 3.44 mmol, 1.0 equiv) was dissolved in ethanol (10 mL), hydrazine hydride (55%) (221 mg, 6.89 mmol, 2.0 equiv) was slowly added, and the reaction mixture was refluxed for 1 hour. After the reaction was completed, the reaction mixture was cooled to room temperature and concentrated in vacuo to obtain a crude yellow precipitate. It was dissolved in acetic acid (15 mL, 2N) and the ice-cold solution was heated with cold NaNO under stirring. 2 Aqueous solution (356 mg, 5.17 mmol, 1.5 eq. in 2 mL of water) was treated dropwise. The reaction mixture was stirred at room temperature for 1 hour. The compound was extracted with chloroform (3×35 mL). 2 SO 4The organic phase was dried and evaporated to give an amorphous solid (452 ​​mg, 55%). 1 H NMR (300 MHz, CDCl 3 )δ8.43(dd,J=8.3,1.1Hz,1H),8.21(dd,J=8.0,1.1Hz,1H),8.01(t,J=8.1Hz,1H).HRMS(ESI):calculated value C 8 H 3 Cl 2 N 5 [M+1] + 239.9838, actual value [M+1] + 239.9842, calculated value C 8 H 3 Cl 2 N 5 [M+Na] + 261.9658, actual value [M+Na] + 261.9664.

[0332] Embodiment 47

[0333] 10-Chlorotetrazolo[5,1-a]phthalazine (47a) and 7-Chlorotetrazolo[5,1-a]phthalazine (47b)

[0334] Prepared from compound 46 according to the method given in Example 45. Yield 22%. The isomer mixture was separated by silica gel column chromatography using DCM as solvent. First isomer: 10-chlorotetrazo[5,1-a]phthalazine (47a). 1 H NMR (600 MHz, CDCl 3 )δ8.95(s,1H),8.16(dd,J=7.9,1.1Hz,1H),8.07(dd,J=7.9,1.1Hz,1H),7.95(t,J=7.9Hz,1H). 13 C NMR (126 MHz, CDCl 3 )δ148.91,140.92,136.18,132.89,132.77,127.09,126.44,121.19. The second isomer: 7-chlorotetrazo[5,1-a]phthalazine (47b). 1 H NMR (600MHz, DMSO) δ9.56 (s, 1H), 8.64 (d, J = 7.8Hz, 1H), 8.24 (dd, J = 7.9, 1.1Hz, 1H), 8.19 (t, J = 7.9Hz, 1H). 13CNMR (126 MHz, DMSO) δ 147.01, 142.05, 136.46, 133.70, 133.43, 124.28, 123.42, 122.98. HRMS (ESI): calculated value C 8 H 4 N 5 Cl[M+1] + 206.0228,[M+2] + 208.0199 Actual value [M+1] + 206.0234,[M+2] + 208.0230 Calculated value C 8 H 4 N 5 ClNa[M+1] + 228.0047,[M+2] + 230.0018 Actual value [M+1] + 228.0045,[M+2] + 230.0018.

[0335] Embodiment 48

[0336] 6,9-Dichloro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine(48a)6,8-Dichloro-3-methyl-[1,2,4] Triazolo[3,4-a]phthalazine(48b)

[0337] 6-Chloro-2,3-dihydrophthalazine-1,4-dione (xxiv)

[0338] Prepared from 5-chloroisobenzofuran-1,3-dione as described for compound (xxii) in Example 44. Yield 98%. 1 H NMR (300MHz, DMSO) δ8.07(d,J=8.6Hz,1H),8.00(d,J=2.1Hz,1H),7.90(dd,J=8.5,2.2Hz,1H). 13 C NMR (75MHz, DMSO) δ138.07, 136.13, 133.32, 131.08, 130.99, 128.40, 128.16, 124.90.

[0339] 1,4,6-Trichlorophthalazine (xxv)

[0340] Prepared from (xxiv) as described for compound (xxiii) in Example 44. Yield 51%. 1 H NMR (300 MHz, CDCl 3 )δ8.31–8.26(m,2H),8.01(ddd,J=8.9,2.0,0.9Hz,1H). 13CNMR (75MHz, CDCl3) δ154.80,154.07,141.39,135.55,128.25,127.94,125.71,125.28.

[0341] 6,9-Dichloro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine (48a) and 6,8-Dichloro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine (48b)

[0342] Prepared from compound (xxv) as described in Example 44. Yield 91%. 1 H NMR (300 MHz, CDCl 3 )δ8.64(d,J=2.1Hz,1H),8.62(d,J=8.6Hz,1H),8.23(d,J=2.0Hz,1H),8.19(d,J=8.8Hz,1H),7.97–7.91(m,1H),7.82–7.76(m,1H),2.81(s,6H). 13 C NMR (75MHz, CDCl 3 )δ149.30,148.69,148.53,148.03,141.85,137.78,135.43,131.88,12 9.21,127.18,125.33,125.29,123.39,123.31,122.52,120.42,9.93(2x CH 3 ).

[0343] Embodiment 49

[0344] 9-Chloro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine (49a) and 8-chloro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine [3,4-a]Phthaloazine (49b)

[0345] Prepared from (48a / 48b) as described in Example 45. The isomeric mixture was separated by silica gel column chromatography using DCM and methanol (100 to 98:2) as solvents. First isomer: 9-chloro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine (49a). 1 H NMR (600 MHz, CDCl 3 )δ8.64(d,J=2.0Hz,1H),8.60(s,1H),7.87(d,J=8.5Hz,1H),7.75(dd,J=8.4,2.0Hz,1H),2.83(s,3H). 13 C NMR (126 MHz, CDCl 3)δ148.57,146.73,141.77,140.76,131.52,129.63,124.86,123.17,121.27,10.03. Second isomer: 8-chloro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine (49b). 1 H NMR (600 MHz, CDCl 3 )δ8.68(d,J=8.4Hz,1H),8.60(s,1H),7.95–7.91(m,2H),2.85(s,3H). 13 C NMR (126 MHz, CDCl 3 )δ148.47,146.48,142.10,137.20,134.72,127.62,125.18,124.17,121.93,10.05.

[0346] Embodiment 50

[0347] 6,9-Dichlorotetrazo[5,1-a]phthalazine (50a) and 6,8-Dichlorotetrazo[5,1-a]phthalazine (50b)

[0348] Prepared from compound (xxv) as described in Example 46. Yield (71%). 1 H NMR (300 MHz, CDCl 3 )δ8.78–8.71(m,1.4H),8.46–8.37(m,1.4H),8.13(dt,J=8.6,1.7Hz,1H),8.03(dt,J=8.9,1.8Hz,0.4H). 13 C NMR (75MHz, CDCl 3 )δ151.82,151.79,151.11,143.01,141.55,140.36,136.39,134.15,129.72,127.74,126.80,125.45,124.90,123.61,122.57,120.84.

[0349] Embodiment 51

[0350] 9-Chlorotetrazolo[5,1-a]phthalazine (51a) and 8-Chlorotetrazolo[5,1-a]phthalazine (51b)

[0351] Prepared from 50a / 50b as described in Example 45. Yield (21%). The isomeric mixture was separated by silica gel column chromatography using DCM as solvent. First isomer: 9-chlorotetrazo[5,1-a]phthalazine (51a). 1 H NMR (600 MHz, CDCl 3)δ8.94(d,J=0.7Hz,1H),8.74(dd,J=2.0,0.6Hz,1H),8.11(dd,J=8.5,0.5Hz,1H),7.97(dd,J=8.5,2.0Hz,1H). 13 C NMR (126 MHz, CDCl 3 )δ148.50,141.94,141.42,133.62,130.11,124.52,123.63,123.14. The second isomer: 8-chlorotetrazo[5,1-a]phthalazine (51b). 1 H NMR (600 MHz, CDCl 3 )δ8.90(s,1H),8.72(d,J=8.5Hz,1H),8.14(d,J=2.0Hz,1H),8.08(dd,J=8.6,2.0Hz,1H). 13 C NMR (126 MHz, CDCl 3 )δ148.07,141.82,139.45,135.60,128.08,126.39,125.98,120.82.

[0352] Embodiment 52

[0353] 6,8,9-Trichloro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine

[0354] 6,7-Dichloro-2,3-dihydrophthalazine-1,4-dione (xxvi)

[0355] 4,5-Dichlorophthalic acid (10 g, 42.55 mmol) was dissolved in AcCl (60 mL), refluxed for 2 h, and then concentrated in vacuo to give 5,6-dichloroisobenzofuran-1,3-dione (9.21 g, 99% yield) as a light brown solid; the crude product was used directly in the next step without further purification. 1 H NMR (300 MHz, CDCl 3 )δ8.11(s,2H). 13 C NMR (75MHz, CDCl3) δ160.82, 141.87, 130.42, 127.57.

[0356] To a stirred solution of 5,6-dichloroisobenzofuran-1,3-dione (9.2 g, 42.39 mmol) in 10% HCl (60 mL) was added hydrazine (55%) (2.71 g, 84.79 mmol), and the mixture was refluxed for 24 hours to form a precipitate. The product was collected by suction filtration, washed with water and dried to give compound (xxvi) (9.51 g, 94%) as an amorphous solid.

[0357] 1,4,6,7-Tetrachlorophthalazine (xxvii)

[0358] Prepared from compound (xxvi) as described for compound (xxiii) in Example 44. Yield 29%. 1 H NMR (300 MHz, CDCl 3 )δ8.41(s,2H). 13 C NMR (75MHz, CDCl 3 )δ153.59,140.40,127.53,126.21.

[0359] 6,8,9-Trichloro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine 52

[0360] Prepared from compound (xxvii) as described in Example 44. Yield (74%). 1 H NMR (300 MHz, CDCl 3 )δ8.75(s,1H),8.33(s,1H),2.81(s,3H). 13 C NMR (75MHz, CDCl3) δ148.41,148.08,141.53,140.50,136.37,129.19,125.34,123.18,121.32,9.94.

[0361] Embodiment 53

[0362] 8,9-Dichloro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine

[0363] Prepared from 52 as described in Example 45. Yield (19%). 1 H NMR (300 MHz, CDCl 3 )δ8.76(s,1H),8.56(s,1H),8.04(d,J=1.1Hz,1H),2.84(d,J=1.1Hz,3H).

[0364] Embodiment 54

[0365] 6,8,9-Trichlorotetrazo[5,1-a]phthalazine

[0366] Prepared from compound (xxvii) as described in Example 46. Yield (51%). 1 H NMR (300 MHz, CDCl 3 )δ8.87(s,1H),8.53(s,1H). 13 C NMR (75MHz, CDCl 3)δ141.79,140.80,140.78,139.14,129.66,126.78,123.36,121.40.

[0367] Embodiment 55

[0368] 8,9-Dichlorotetrazo[5,1-a]phthalazine

[0369] Prepared from 54 as described in Example 45. Yield (26%). 1 H NMR (600 MHz, CDCl 3 )δ8.89(s,1H),8.86(s,1H),8.26(s,1H). 13 C NMR (126 MHz, CDCl 3 )δ147.48,140.98,140.71,138.31,129.96,126.48,123.89,121.52.

[0370] Embodiment 56

[0371] 6-Chloro-10-fluoro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine (56a) and 6-chloro-7-fluoro-3-methyl-[1, 2,4]Triazolo[3,4-a]phthalazine (56b)

[0372] 5-Fluoro-2,3-dihydrophthalazine-1,4-dione (xxviii)

[0373] Prepared from commercially available 4-fluoroisobenzofuran-1,3-dione as described for compound (xxii) in Example 44. Yield (95%). 1 H NMR (300MHz, DMSO) δ11.58(s,2H),7.95–7.81(m,2H),7.73–7.58(m,1H). 19 FNMR (282MHz, DMSO) δ-111.42. HRMS (ESI): calculated value C 8 H 5 N 2 O 2 F[M+1] + 181.0408, actual value [M+1] + 181.0404, calculated value C 8 H 5 N 2 O 2 F[M+Na] + 203.0227, actual value [M+Na] + 203.0237.

[0374] 1,4-Dichloro-5-fluorophthalazine (xxix)

[0375] Prepared from compound (xxviii) as described for compound (xxiii) in Example 44. Yield (38%). 1 HNMR (300MHz, CDCl 3 )δ8.18 (dd, J=8.4,1.0 Hz,1H),8.11–7.97 (m,1H),7.80–7.67 (m,1H).HRMS(ESI):calculated value C 8 H 3 N 2 Cl 2 F[M+1] + 216.9730, actual value [M+1] + 216.9724, calculated value C 8 H 3 N 2 Cl 2 F[M+Na] + 238.9550, actual value [M+Na] + 240.9520.

[0376] 6-Chloro-10-fluoro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine (56a) and 6-chloro-7-fluoro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine (56b)

[0377] Prepared from compound (xxix) as described in Example 44. Yield (82%). 1 H NMR (300 MHz, CDCl 3 )δ8.52–8.47(m,0.5H),8.10(dd,J=8.1,1.1Hz,1H),7.95(td,J=8.1,4.6Hz,0.5H),7.84(td,J=8. 2,5.0Hz,1H),7.75(td,J=8.7,8.1,1.1Hz,1H),7.57–7.46(m,0.5H),2.82(s,3H),2.81(s,1.5H).

[0378] Embodiment 57

[0379] 10-Fluoro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine (57a) and 7-fluoro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine [3,4-a]Phthaloazine (57b)

[0380] Prepared from 56a / 56b as described in Example 45. Yield (31%). 1 H NMR (300 MHz, CDCl 3)δ8.91(s,1H),8.63(d,J=2.1Hz,1H),8.44(d,J=8.0Hz,1H),7.91(td,J=8.1,5.3Hz,1H),7.81–7.65(m,3H),7.51–7.43(m,1H),2.84(s,6H). 19 FNMR (282MHz, CDCl 3 )δ-107.77,-118.06.

[0381] After recrystallization from hexane, 10-fluoro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine (57a) was obtained as a crystalline solid. 1 H NMR (600MHz, DMSO) δ9.02(s,1H),8.11–8.07(m,1H),7.83–7.78(m,2H),2.62(s,3H). 13 C NMR (126MHz, DMSO) δ158.57,156.53,152.55,146.03,138.39,131.23,119.78,119.31,112.62,9.40.

[0382] Embodiment 58

[0383] 6-Chloro-10-fluorotetrazo[5,1-a]phthalazine (58a) and 6-chloro-7-fluorotetrazo[5,1-a]phthalazine (58b)

[0384] Prepared from compound (xxix) as described in Example 46. Yield (69%). 1 H NMR (300 MHz, CDCl 3 )δ8.62(d,J=8.0Hz,0.5H),8.31(d,J=8.0Hz,1H),8.19–8.07(m,1.5H),7.92(td,J=8.5,0.9Hz,1H),7.75(ddd,J=11.6,8.3,1.1Hz,0.5H).

[0385] Embodiment 59

[0386] 10-Fluorotetrazo[5,1-a]phthalazine (59a) and 7-Fluorotetrazo[5,1-a]phthalazine (59b)

[0387] Prepared from 58a / 58b as described in Example 45. Yield (37%). 1 H NMR (300 MHz, CDCl 3)δ9.23(s,0.3H),8.98(s,1H),8.56(d,J=8.1Hz,0.3H),8.15–8.07(m,0.3H), 8.05–7.94(m,2H),7.86(td,J=8.3,7.4,1.6Hz,1H),7.69(t,J=8.9Hz,0.3H). 19 F NMR (282 MHz, CDCl 3 )δ-106.33,-115.77. The isomer mixture was separated by silica gel column chromatography using dichloromethane as solvent. The first isomer: 7-fluorotetrazo[5,1-a]phthalazine (59b). 1 H NMR (400 MHz, CDCl 3 )δ9.24(d,J=0.8Hz,1H),8.56(d,J=8.0Hz,1H),8.11(td,J=8.1,5.2Hz,1H),7.69(ddd,J=9.3,8.3,0.9Hz,1H). Second isomer: 10-fluorotetrazo[5,1-a]phthalazine (59a). 1 H NMR (400 MHz, CDCl 3 )δ8.98(d,J=2.0Hz,1H),8.08–7.96(m,2H),7.86(ddd,J=9.2,7.8,1.3Hz,1H).

[0388] Embodiment 60

[0389] 6-Chloro-9-fluoro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine (60a) and 6-chloro-8-fluoro-3-methyl-[1, 2,4]Triazolo[3,4-a]phthalazine (60b)

[0390] 6-Fluoro-2,3-dihydrophthalazine-1,4-dione (xxx)

[0391] Prepared from commercially available 5-fluoroisobenzofuran-1,3-dione as described for compound (xxii) in Example 44. Yield (96%). 1 H NMR (300MHz, DMSO) δ11.67 (s, 2H), 8.15 (dd, J = 9.6, 5.3Hz, 1H), 8.17–7.69 (m, 2H). 19 F NMR (282MHz, DMSO) δ-105.04.

[0392] 1,4-Dichloro-6-fluorophthalazine (xxxi)

[0393] Prepared from compound (xxx) as described for compound (xxiii) in Example 44. Yield (53%). 1 H NMR (300 MHz, CDCl3 )δ8.39(dd,J=9.1,5.0Hz,1H),7.94(dd,J=8.1,2.5Hz,1H),7.80(ddd,J=9.1,8.1,2.5Hz,1H).HRMS(ESI):calculated value C 8 H 3 N 2 Cl 2 F[M+1] + 216.9730, actual value [M+1] + 216.9742, calculated value C 8 H 3 N 2 Cl 2 F[M+Na] + 238.9550, actual value [M+Na] + 240.9560.

[0394] 6-Chloro-9-fluoro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine (60a) and 6-Chloro-8-fluoro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine (60b)

[0395] Prepared from 1,4-dichloro-6-fluorophthalazine (xxxi) as described in Example 44. Yield (80%). 1 H NMR (300 MHz, CDCl 3 )δ8.68(dd,J=8.8,5.1Hz,1H),8.33–8.24(m,2H),7.91(dd,J=8.8,2.5Hz,1H),7.72(td,J=8.4,2.5Hz,1H),7.54(ddd,J=9.1,8.1,2.6Hz,1H),2.81(s,3H),2.80(s,3H).HRMS(ESI):calcd. 10 H 6 N 4 ClF[M+1] + 237.0338, actual value [M+1] + 237.0346, calculated value C 10 H 6 N 4 ClF[M+Na] + 259.0157, actual value [M+Na] + 259.0167.

[0396] Embodiment 61

[0397] 9-Fluoro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine (61a) and 8-Fluoro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine [3,4-a]Phthaloazine (61b)

[0398] Prepared from 60a / 60b as described in Example 45. Yield (24%). The isomeric mixture was separated by silica gel column chromatography using DCM as solvent. HRMS (ESI): Calculated value C 10 H 7 N 4 F[M+1] + 203.0728, actual value [M+1] + 203.0722, calculated value C 10 H 7 N 4 F[M+Na] + 225.0547, actual value [M+Na] + 225.0542. First isomer: 9-fluoro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine (61a). 1 H NMR (500 MHz, CDCl 3 )δ8.61(s,1H),8.32(dd,J=8.5,2.5Hz,1H),7.98(dd,J=8.7,5.0Hz,1H),7.52(td,J=8.5,2.5Hz,1H),2.85(s,3H). Second isomer: 8-fluoro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine (61b). 1 H NMR (500 MHz, CDCl 3 )δ8.68(dd,J=8.7,5.0Hz,1H),8.58(s,1H),7.69(td,J=8.5,2.5Hz,1H),7.59(dd,J=8.1,2.5Hz,1H),2.82(s,3H).

[0399] Embodiment 62

[0400] 6-Chloro-9-fluorotetrazo[5,1-a]phthalazine (62a) and 6-chloro-8-fluorotetrazo[5,1-a]phthalazine (62b)

[0401] Prepared from 1,4-dichloro-6-fluorophthalazine (xxxi) as described in Example 46. Yield (77%). 1 HNMR (300MHz, CDCl 3 )δ8.82(dd,J=8.8,5.0Hz,1H),8.52(dd,J=9.1,4.9Hz,1H),8.41(dd,J=7.6,2.6Hz,1H),8.11(dd,J=8.5,2.5Hz,1H),7.91(td,J=8.4,2.5Hz,1H),7.80(td,J=8.5,2.5Hz,1H).HRMS(ESI):calcd.8 H 3 N 5 FCl[M+1] + 224.0134, actual value [M+1] + 224.0145, calculated value C 8 H 3 N 5 FCl[M+Na] + 245.9953, actual value [M+Na] + 245.9961.

[0402] Embodiment 63

[0403] 9-Fluorotetrazo[5,1-a]phthalazine (63a) and 8-Fluorotetrazo[5,1-a]phthalazine (63b)

[0404] Prepared from 62a / 62b as described in Example 45. Yield (25%). 1 H NMR (300 MHz, CDCl 3 )δ8.94(s,0.3H),8.93(s,1H),8.80(dd,J=8.8,4.9Hz,1H),8.40(dd,J=7.8,2.5Hz,0.3H),8.21(dd,J=8.8,4.9Hz,0.3H),7.89–7.80(m,2H),7.74(td,J=8.5,2.4Hz,0.3H).HRMS(ESI):calcd. 8 H 4 N 5 F[M+1] + 190.0523, actual value [M+1] + 190.0519, calculated value C 8 H 4 N 5 F[M+Na] + 212.0343, actual value [M+Na] + 212.0342. The isomer mixture was separated by silica gel column chromatography using DCM as solvent. The first isomer: 9-fluorotetrazo[5,1-a]phthalazine (63a). 1 H NMR (500 MHz, CDCl 3 )δ8.94(s,1H),8.40(dd,J=7.8,2.5Hz,1H),8.21(dd,J=8.8,4.9Hz,1H),7.74(ddd,J=8.8,8.2,2.5Hz,1H). 19 FNMR (282MHz, CDCl 3)δ-97.05 (td, J=8.1, 4.8 Hz). Second isomer: 8-fluorotetrazo[5,1-a]phthalazine (63b). 1 H NMR (500 MHz, CDCl 3 )δ8.92(s,1H),8.80(dd,J=8.8,4.9Hz,1H),7.90–7.79(m,2H). 19 F NMR (282 MHz, CDCl 3 )δ-102.02(td,J=7.9,4.8Hz).

[0405] Embodiment 64

[0406] 6-Chloro-8,9-difluoro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine 64

[0407] 6,7-Difluoro-2,3-dihydrophthalazine-1,4-dione (xxxii)

[0408] 4,5-Difluorophthalic acid (5 g, 24.74 mmol) was dissolved in Ac 2 O (30 mL), refluxed for 2 h, and then concentrated in vacuo to give 5,6-difluoroisobenzofuran-1,3-dione (4.51 g, 99% yield) as a light brown solid; the crude product was used directly in the next reaction without further purification. 1 H NMR (300MHz, CDCl3) δ7.83 (t, J=7.0Hz, 2H).

[0409] To a stirred solution of 5,6-difluoroisobenzofuran-1,3-dione (4.5 g, 24.59 mmol) in ethanol (50 mL) was added hydrazine (55%) (1.57 g, 49.18 mmol, 2.0 equiv), and the mixture was heated to reflux for 24 hours to form a precipitate. The product was collected by suction filtration, washed with water and dried to give compound (xxxii) (4.62 g, 95%) as an amorphous solid. 1 HNMR (300MHz, DMSO) δ11.76 (s, 2H), 7.98 (t, J = 9.0Hz, 2H).

[0410] 1,4-Dichloro-6,7-difluorophthalazine (xxxiii)

[0411] Prepared from compound (xxxii) as described for compound (xxiii) in Example 44. Yield (52%). 1 HNMR (300MHz, CDCl 3 )δ8.11(t,J=8.3Hz,2H).HRMS(ESI):calculated value C 8 H2 N 2 F 2 Cl 2 [M+1] + 234.9636,[M+2] + 236.9607 Actual value [M+1] + 234.9643,[M+2] + 236.9615 Calculated value C 8 H 2 N 2 F 2 Cl 2 Na[M+1] + 256.9455,[M+2] + 258.9426 Actual value [M+Na] + 256.9461,[M+2] + 258.9430.

[0412] 6-Chloro-8,9-difluoro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine

[0413] Prepared from compound (xxxiii) as described in Example 44. Yield (81%). 1 H NMR (300 MHz, CDCl 3 )δ8.45(dd,J=9.4,7.3Hz,1H),8.07(dd,J=9.4,7.3Hz,1H),2.81(s,3H).HRMS(ESI):calculated value C 10 H 5 N 4 F 2 Cl[M+1] + 255.0244,[M+2] + 257.0214 Actual value [M+1] + 255.0246,[M+2] + 257.0225Calculated value C 10 H 5 N 4 F 2 ClNa[M+1] + 277.0063,[M+2] + 279.0034 Actual value [M+1] + 277.0064,[M+2] + 279.0034.

[0414] Embodiment 65

[0415] 8,9-Difluoro-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine

[0416] Prepared from 64 as described in Example 45. Yield (22%). 1 H NMR (300 MHz, CDCl 3 )δ8.56(s,1H),8.44(dd,J=9.7,7.3Hz,1H),7.75(dd,J=9.2,7.2Hz,1H).HRMS(ESI):calculated value C 10 H 6 N 4 F 2 [M+1] + 221.0633, actual value [M+1] + 221.0638, calculated value C 10 H 6 N 4 F 2 [M+Na] + 243.0453, actual value [M+Na] + 243.0463.

[0417] Embodiment 66

[0418] 6-Chloro-8,9-difluorotetrazo[5,1-a]phthalazine

[0419] Prepared from compound (xxxiii) as described in Example 46. Yield (49%). 1 H NMR (300 MHz, CDCl 3 )δ8.00–7.90(m,2H).

[0420] Embodiment 67

[0421] 8,9-Difluorotetrazo[5,1-a]phthalazine

[0422] Prepared from 66 as described in Example 45. Yield (15%). 1 H NMR (300 MHz, CDCl 3 )δ9.18(s,1H),7.84(d,J=8.2Hz,1H),7.13(d,J=8.2Hz,1H).

[0423] Embodiment 68

[0424] 6-Chloro-9-methoxy-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine (68a) and 6-chloro-8-methoxy-3- Methyl-[1,2,4]triazolo[3,4-a]phthalazine (68b)

[0425] 6-Methoxy-2,3-dihydrophthalazine-1,4-dione (xxxiv)

[0426] 4,5-Dichlorophthalic acid (5 g, 25.48 mmol, 1.0 equiv) was dissolved in Ac2 O (40mL), refluxed for 2 hours, and then concentrated in vacuo to give 5-methoxyisobenzofuran-1,3-dione as a light brown solid; the crude product was used directly in the next step without further purification. To a stirred solution of 5-methoxyisobenzofuran-1,3-dione in ethanol (40mL) was added hydrazine (55%) (1.63 g, 50.97 mmol, 2.0 equiv), and the mixture was refluxed for 24 hours to form a precipitate. The product was collected by suction filtration, washed with water and dried to give compound (xxxiv) (4.1 g, 85%) as an amorphous solid.

[0427] 1,4-Dichloro-6-methoxyphthalazine (xxxv)

[0428] A mixture of 6-methoxy-2,3-dihydro-o-benzodiazepine-1,4-dione (xxxiv) (4.0 g, 20.82 mmol, 1.0 equiv) and phosphorus oxychloride (15.92 g, 104.11 mmol, 5.0 equiv) was refluxed for 4 hours. The reaction mixture was cooled to room temperature and poured into crushed ice. The phases were separated and the aqueous phase was extracted with chloroform (4×70 mL). The combined organic phases were dried (Na 2 O 4 0 ... 2 SO 4 ) and concentrated in vacuo. The crude product was purified by silica gel column chromatography using dichloromethane as solvent to give Compound (xxxv) (1.35 g, 28%) as an amorphous solid. 1 H NMR (300 MHz, CDCl 3 )δ8.20(d,J=9.1Hz,1H),7.60(dd,J=9.1,2.5Hz,1H),7.49(d,J=2.5Hz,1H),4.06(s,3H). 13 C NMR (75MHz, CDCl 3 )δ164.03,154.21,129.49,127.99,126.18,122.17,121.10,104.18,56.29.HRMS(ESI):calculated value C 9 H 6 N 2 OCl 2 [M+1] + 228.9930,[M+2] + 230.9901 Actual value [M+1] + 228.9933,[M+2] + 230.9908 Calculated value C 9 H 6 N 2 OCl 2 Na[M+1] +250.9749,[M+2] + 252.9720 Actual value [M+1] + 250.9757,[M+2] + 252.9730.

[0429] 6-Chloro-9-methoxy-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine (68a) and 6-Chloro-8-methoxy-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine (68b)

[0430] Prepared from 1,4-dichloro-6-methoxyphthalazine (xxxv) as described in Example 44. Yield (86%). 1 H NMR (300 MHz, CDCl 3 )δ8.58(d,J=8.7Hz,0.7H),8.14(d,J=9.1Hz,1H),8.02(d,J=2.6Hz,1H),7.61–7.52(m, 1.5H), 7.35 (dd, J=9.1, 2.6Hz, 1H), 4.05 (s, 3H), 4.01 (s, 2H), 2.81 (s, 3H), 2.79 (s, 2H).

[0431] Embodiment 69

[0432] 9-Methoxy-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine (69a) and 8-methoxy-3-methyl-[1,2, 4]Triazolo[3,4-a]phthalazine (69b)

[0433] Prepared from 68a / 68b as described in Example 45. Yield (21%). The isomeric mixture was separated by column chromatography on silica gel with DCM / MeOH (98 / 2). First isomer: 9-methoxy-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine (69a) 1 H NMR (600 MHz, CDCl 3 )δ8.53(s,1H),8.06(d,J=2.5Hz,1H),7.83(d,J=8.7Hz,1H),7.33(dd,J=8.7,2.4Hz,1H),4.04(s,3H),2.83(s,3H). 13 C NMR (126MHz, CDCl3) δ164.11, 148.24, 146.92, 143.02, 130.03, 125.75, 121.21, 117.26, 104.03, 56.43, 10.09. Second isomer: 8-methoxy-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine (69b) 1 H NMR (600 MHz, CDCl 3)δ8.57(d,J=8.8Hz,1H),8.55(s,1H),7.52(dd,J=8.8,2.5Hz,1H),7.28(d,J=2.5Hz,1H),3.98(s,3H),2.81(s,3H). 13 C NMR (126 MHz, CDCl 3 )δ161.31,147.65,146.92,142.74,125.01,124.63,122.98,117.27,109.38,55.80,9.90.

[0434] Embodiment 70

[0435] 9-Chloro-6-isopropoxy-3-methyl-[1,2,4]triazolo[3,4-a]phthalazine (70a) and 8-chloro-6-isopropoxy 3-Methyl-[1,2,4]triazolo[3,4-a]phthalazine (70b)

[0436] 48 (100 mg, 0.39 mmol, 1.0 equiv) and K 2 CO 3 A mixture of (109 mg, 0.79 mmol, 2.0 equiv) was heated at reflux in isopropanol (5 mL) for 36 h and then concentrated in vacuo. The residue was extracted with dichloromethane (4×40 mL) and washed with Na 2 SO 4 The combined organic phases were dried and concentrated in vacuo. The crude product was purified by silica gel column chromatography using dichloromethane as solvent to afford an isomeric mixture of 70a and 70b as an amorphous solid in 89% yield. 1 H NMR (300 MHz, CDCl 3 )δ8.53(d,J=2.1Hz,1H),8.50(d,J=8.5Hz,1H),8.12(d,J=2.1Hz,1H),8.08(d,J=8.7Hz,1H),7.82(dd,J=8.5,2.1Hz,1H),7.65(dd,J=8.6,2.1Hz,1H),5.45(hept,J=6.2Hz,2H),2.72(s,6H),1.52(d,J=6.2Hz,12H).HRMS(ESI):calcd. 13 H 13 N 4 OCl[M+1] + 277.0851,[M+2] + 279.0822 Actual value [M+1] + 277.0850,[M+2] + 279.0824 Calculated value C 13 H 13 N 4 OCl Na[M+1]+ 299.0670,[M+2] + 301.0641 Actual value [M+1] + 299.0670,[M+2] + 301.0639.

[0437] Embodiment 71

[0438] 9-Chloro-6-isopropoxytetrazo[5,1-a]phthalazine (71a) and 8-chloro-6-isopropoxytetrazo[5,1-a]phthalazine Oxazine (71b)

[0439] Prepared from 50 as described in Example 70. Yield (81%). 1 H NMR (300 MHz, CDCl 3 )δ8.62(d,J=2.1Hz,0.5H),8.58(d,J=8.5Hz,1H),8.28(d,J=2.1Hz,1H),8.25(d,J=8.8Hz,0.5H),7.98(dd,J=8.5,2.1Hz,1H),7.86(dd,J=8.7,2.1Hz,0.5H),5.63(hept,J=6.2,1.5H),1.57(d,J=6.2Hz,9H).HRMS(ESI):calcd. 11 H 10 N 5 OCl[M+1] + 264.0647,[M+2] + 266.0618 Actual value [M+1] + 264.0647,[M+2] + 266.0613 Calculated value C 11 H 10 N 5 OCl Na[M+1] + 286.0466,[M+2] + 288.0437 Actual value [M+1] + 286.0465,[M+2] + 288.0438.

[0440] The isomeric mixture was separated by silica gel column chromatography using DCM as solvent.

[0441] First isomer: 9-chloro-6-isopropoxytetrazo[5,1-a]phthalazine (71a). 1 H NMR (300 MHz, CDCl 3)δ8.62(d,J=2.1Hz,1H),8.25(d,J=8.7Hz,1H),7.86(dd,J=8.7,2.1Hz,1H),5.62(hept,J=6.2Hz,1H),1.57(d,J=6.2Hz,6H). 13 C NMR (75MHz, CDCl 3 )δ157.59,141.07,140.36,132.74,127.41,124.13,123.96,118.90,73.59,21.70.

[0442] Second isomer: 8-chloro-6-isopropoxytetrazo[5,1-a]phthalazine (71b). 1 H NMR (300 MHz, CDCl 3 )δ8.58(d,J=8.5Hz,1H),8.27(d,J=2.1Hz,1H),7.98(dd,J=8.5,2.1Hz,1H),5.62(hept,J=6.2Hz,1H),1.57(d,J=6.1Hz,6H). 13 C NMR (75MHz, CDCl 3 )δ157.73,140.46,138.85,134.79,126.57,125.53,121.87,121.10,72.67,22.59.

[0443] Embodiment 72

[0444] 10-Chloro-6-isopropoxytetrazo[5,1-a]phthalazine 72

[0445] Prepared from 46a as described in Example 70. Yield (86%). 1 H NMR (300 MHz, CDCl 3 )δ8.27(d,J=8.1Hz,1H),8.05(d,J=8.1Hz,1H),7.84(t,J=8.1Hz,1H),5.63(hept,J=6.1Hz,1H),1.57(d,J=6.1Hz,6H). 13 C NMR (126 MHz, CDCl3) δ 158.36, 139.91, 135.85, 132.66, 132.37, 124.38, 122.56, 121.70, 73.84, 21.83. HRMS (ESI): calculated value C 11 H 10 N 5 OCl[M+1] + 264.0647,[M+2]+ 266.0618 Actual value [M+1] + 264.0645,[M+2] + 266.0616 Calculated value C 11 H 10 N 5 OCl Na[M+1] + 286.0466,[M+2] + 288.0437 Actual value [M+1] + 286.0464,[M+2] + 288.0438.

[0446] Embodiment 73

[0447] 6-Isopropoxytetrazo[5,1-a]phthalazine 73

[0448] To a stirred solution of 1-chloro-4-hydrazinophthalazine (400 mg, 2.405 mmol, 1.0 equiv) in acetic acid (20 mL, 2N) was added dropwise NaNO 2 The mixture was extracted with chloroform (3×40 mL) and dried (Na2O3) and the mixture was stirred for 1 hour at room temperature. 2 SO 4 ) The combined organic phases were evaporated in vacuo to give 6-chlorotetrazo[5,1-a]phthalazine (335 mg, 80%) as an amorphous solid. 1 H NMR (300 MHz, CDCl 3 )δ8.78(dd,J=7.8,1.4Hz,1H),8.45(dd,J=7.8,1.4Hz,1H),8.18(td,J=7.8,1.4Hz,1H),8.09(td,J=7.8,1.4Hz,1H). 13 C NMR (75MHz, CDCl 3 )δ152.25,141.89,135.67,133.37,128.04,125.11,124.17,122.37.

[0449] 6-Chlorotetrazolo[5,1-a]phthalazine (200 mg, 0.97 mmol, 1.0 equiv) and K 2 CO 3 A mixture of 1,2-dichloro-2-yl pyridine (268 mg, 1.94 mmol, 2.0 equiv) was dissolved in isopropanol (8 mL) and refluxed for 36 h, then concentrated in vacuo. After extraction with dichloromethane (4×40 mL), the combined organic phases were washed with Na 2 SO 4After drying, it was concentrated in vacuo. The crude product was purified by silica gel column chromatography using dichloromethane as solvent to afford 190 mg (86%) of 73 as an amorphous solid. 1 H NMR (300 MHz, CDCl 3 )δ8.62(dd,J=8.1,1.3Hz,1H),8.31(dd,J=8.1,1.3Hz,1H),8.01(td,J=7.7,1.3Hz ,1H),7.92(td,J=7.7,1.3Hz,1H),5.62(hept,J=6.1Hz,1H),1.56(d,J=6.1Hz,6H). 13 C NMR (126 MHz, CDCl3) δ 158.87, 141.07, 134.31, 132.26, 125.86, 124.56, 122.86, 120.82, 73.30, 21.86. HRMS (ESI): calculated value C 11 H 11 N 5 O[M+1] + 230.1036, actual value [M+1] + 230.1038, calculated value C 11 H 11 N 5 O[M+Na] + 252.0856, actual value [M+Na] + 252.0857.

[0450] Biological results

[0451] Embodiment 74

[0452] Cell culture

[0453] Compound reconstitution. Before treatment, each compound was taken from a 10 mg / mL DMSO stock solution. The final concentration of DMSO in cell culture was kept below 0.1%.

[0454] Cell culture and treatment. The human renal fibroblast cell line TK173 was derived from normal human kidney (laboratory stock; (GA Müller et al., Exp. Nephrol. 1995, 3, 127). The stabilization of the cell line for research purposes was approved by the Ethics Committee of the Georg-August-University. The cells were cultured at 37°C in humidified air (5% CO 2), TK173 cells were grown in Dulbecco's modified Eagle's medium (DMEM, Gibco, USA) containing 10% fetal bovine serum (FBS, Gibco, Germany) and 1% penicillin-streptomycin (PS, Gibco, USA). Cell lines were regularly tested for mycoplasma contamination. To study the effects of compounds after profibrotic drug treatment, 3 × 10 4 TK173 cells were seeded in one well of a 6-well culture plate. After 24 hours, the medium was removed and the cells were incubated for another 24 hours in a medium without FBS (starvation medium). Then, 10 ng / mL TGF 1 (R&D Systems, USA) was added to the starvation medium, and the medium was replaced with fresh TGF 1 every other day. After 5 days of TGF 1 treatment, the cell culture medium was replaced with starvation medium containing different concentrations of compounds and then incubated for the next 48 hours.

[0455] Embodiment 75

[0456] Enzyme-linked immunosorbent assay (ELISA) to detect secreted type I collagen

[0457] After 48 hours of compound treatment, the conditioned medium containing the secretome of TK173 fibroblasts was harvested. The secretion of procollagen 1 was assessed using the Human Procollagen Iα1 DuoSet ELISA (R&D Systems, USA). To prepare the ELISA plate, the human procollagen Iα1 capture antibody was diluted in ELISA plate coating buffer at a working concentration of 4μg / mL. 100μl of the diluted capture antibody was added to a 96-well microplate and incubated overnight at room temperature. After washing three times with wash buffer, 300μl of reagent diluent was added and the microplate was blocked for 1 hour at room temperature. For ELISA, human procollagen Iα1 standards were diluted in reagent diluent (range between 31.3pg / mL-2000pg / mL) and 100μl of standards or conditioned medium were added to the designated wells. The microplate was incubated for 2 hours at room temperature. The human procollagen Iα1 detection antibody was prepared in the reagent diluent at a working concentration of 100 ng / mL, and after thorough washing, 100 μl of the diluted detection antibody was applied at room temperature for 2 hours. Then, the working solution was prepared by diluting streptavidin-HRP with the reagent diluent at 1:40 and added to each well. After incubation at room temperature for 20 minutes, the microplate was washed and 100 μl of substrate solution was applied for 20 minutes, followed by the addition of the stop solution after washing. Finally, the signal at 450 nm absorbance was measured using a PHOmo microplate reader (Autobio, China). The amount of procollagen 1 antibody fusion was quantified by extrapolating the signal to the linear range of the procollagen 1 standard curve. Screening compounds were typically tested at concentrations of 5 to 200 μg / mL. The IC observed for the dose-response curve for each compound (n=4-6, two independent experiments) 50 The values ​​were obtained by nonlinear regression analysis using Prism 9 software (GraphPad, La Jolla, USA) and represent the concentration at which TGFβ-stimulated collagen secretion was attenuated by 50%.

[0458] Selected compound data (μg / mL):

[0459] 1:157; 2:58; 3:96; 5:39; 6:61; 7:32; 9:10; 10:93; 13:87; 15:105; 23:21; 35:30; 38:<80; 39:<80; 41:<60; 45:20; 47a:<5; 49a:<30; 4 9b:30; 59a:<20; 59b:<5; 53:<20; 55:<10; 59b:<10; 61a:≤30; 61b:<30; 63a:<30; 63b:<50; 65:<50; 67:<3; 69a:<30; 69b:<30; 72:<5.

[0460] Embodiment 76

[0461] Collagen I mRNA PCR assay

[0462] RNA isolation. Total RNA was extracted using TRIzol reagent (Life technologies, USA) according to the manufacturer's instructions (slightly modified) and purified using the PureLink RNA mini kit (Ambion, USA). Samples were stored at -80 °C before use. RNA concentration was measured using a NanoDrop spectrophotometer (ThermoFisher Scientific, USA) and balanced to 100 ng for complementary DNA (cDNA) synthesis.

[0463] Quantitative real-time PCR analysis (qPCR). For SYBR Green-based qPCR analysis, DNAse I (Sigma-Aldrich, USA) was used for digestion to remove residual genomic DNA, and cDNA was synthesized using the SuperScript II reverse transcriptase kit (Invitrogen, USA) according to the manufacturer's detailed instructions to prepare cDNA. All qPCR reactions were performed using the StepOne Plus real-time system (Applied Biosystems, USA), and amplification was performed using SYBR Green PCRMaster Mix (Applied Biosystems, USA). The thermal cycling conditions were initially 20 seconds at 95°C, 3 seconds at 95°C, and 30 seconds at 60°C for a total of 40 amplification cycles, and 1 cycle of dissociation at 95°C for 15 seconds, 60 seconds at 60°C, and 15 seconds at 95°C. Each sample was repeated three times. The experimental cycle threshold (Ct) value was standardized to the value of GAPDH, and the relative gene expression level was determined using the 2_ddCT method. The primer sequences are listed in Table 1.

[0464] Table 1

[0465] Primers sequence Human GAPDH-F 5'–ACCCACTCCTCCACCTTTGAC–3' Human GAPDH-R 5'–TCCACCACCCTGTTGCTGTAG–3' Human ACTA2-F 5'–ACTGAGCGTGGCTATTCCTCCGTT–3' Human ACTA2-R 5'–GCAGTGGCCATCTCATTTTCA–3' Human Collagen 1-F 5'–GTACTGGATTGACCCCAACC–3' Human Collagen 1-R 5'–CGCCATACTCGAACTGGAAT–3'

[0466] Selected compound data (IC 50 , μg / mL):

[0467] 1:<80; 3:<20; 5:<20; 12:<50; 51b:<5.

[0468] Embodiment 77

[0469] Collagen I Western Blot

[0470] Protein extraction. Total protein was extracted from cultured cells using NP40 cell lysis buffer (Invitrogen, USA) containing phosphatase (Sigma-Aldrich, USA) and protease inhibitors (Roche, Switzerland), followed by sonication and centrifugation at 12,000 × g for 20 minutes at 4 ° C to clear the lysate. The supernatant was collected and measured using a Pierce BCA protein assay kit (ThermoFisher Scientific) by a PHOmo microplate reader (Autobio, China). Samples were stored at -80 ° C before use.

[0471] Immunoblotting. For western blot analysis, 10 μg of extracted protein was diluted in NuPAGE LDS sample buffer (Novex Life technologies, USA) containing 5% 2-mercaptoethanol (Sigma-Aldrich, Germany) and then denatured at 95°C for 5 min. Proteins were separated by 4-12% NuPAGE SDS-PAGE (Novex Life technologies, USA). Blots were usually stripped using Thermo Scientific Restore PLUS Western Blot Stripping Buffer (ThermoFisher Scientific, Germany) for re-probing. The following antibodies were used for immunoblotting: collagen I (1:1000; ab233080, Abcam, USA), alpha smooth muscle actin (1:1000; ab124964, Abcam, USA), GAPDH (1:8000; sc-32233, Santa Cruz, USA). Proteins were detected using the LumiGLO chemiluminescence system (Cell Signaling Technology, USA) using appropriate secondary antibodies: anti-mouse HRP (1:2500; Dako, Denmark) and anti-rabbit HRP (1:2500; 7074, Cell Signaling Technology, USA) using the ChemiDoC MP imaging system (Bio-Rad, USA).

[0472] Selected compound data (IC 50 , μg / mL):

[0473] 1:<40; 3:<5; 6:<5; 9:<1; 12:<5; 14:<30; 15:<40; 27:<30; 35:<40; 49a:<50; 51a:≤40; 51b:< 5; 53: <60; 55: <20; 61a: <60; 61b: <80; 63a: <70; 63b: <30; 65: <50; 69a: <30; 69b: <80; 72: <5.

[0474] References:

[0475] Reference 1: Leask, Andrew. "Potential therapeutic targets for cardiac fibrosis: TGFβ, angiotensin, endothelin, CCN2, and PDGF, partners in fibroblast activation" Circulation research 106.11 (2010): 1675-1680.

[0476] Reference 2: Mozaffarian, Dariush, et al. “Heart disease and stroke statistics—2016 update: a report from the American Heart Association” Circulation 133.4 (2016): e38-e360.

[0477] Reference 3: Hinderer, Svenja and Katja Schenke-Layland. “Cardiac fibrosis–A short review of causes and therapeutic strategies” Advanced drug delivery reviews 146 (2019): 77-82.

[0478] Reference 4: Fan, Zhaobo and Jianjun Guan. “Antifibrotic therapies to control cardiac fibrosis” Biomaterials research 20.1 (2016): 1-13.

[0479] Reference 5: Frangogiannis, Nikolaos G. “Cardiac fibrosis: cell biological mechanisms, molecular pathways and therapeutic opportunities” Molecular aspects of medicine 65(2019):70-99.

[0480] Reference 6: Gourdie, Robert G., Stefanie Dimmeler, and Peter Kohl. “Novel therapeutic strategies targeting fibroblasts and fibrosis in heart disease” Nature reviews Drug discovery 15.9 (2016): 620-638.

[0481] Reference 7: Shibasaki, Yasunobu et al. "Impact of theangiotensin II receptor antagonist, losartan, on myocardial fibrosis inpatients with end-stage renal disease: assessment by ultrasonic integratedbackscatter and biochemical markers" Hypertension research 28.10(2005):787-795.

[0482] Reference 8: B Pitt, Bertram, et al. "Cardiovascular events with finerenone in kidney disease and type 2 diabetes" New England Journal of Medicine 385.24(2021):2252-2263.

[0483] Reference 9: Spinale, Francis G. "Myocardial matrix remodeling and the matrix metalloproteinases: influence on cardiac form and function" Physiological reviews 87.4 (2007): 1285-1342.

[0484] Reference 10: Oyamada, Shizu et al. “Chymase inhibition reduces infarction and matrix metalloproteinase-9 activation and attenuates inflammation and fibrosis after acute myocardial ischemia / reperfusion” Journal of Pharmacology and Experimental Therapeutics 339.1 (2011): 143-151.

[0485] Reference 11: Hayashidani, Shunji et al. “Anti-monocyte chemoattractant protein-1 gene therapy attenuates left ventricular remodeling and failure after experimental myocardial infarction” Circulation 108.17 (2003): 2134-2140.

[0486] Reference 12: Bujak, Marcin et al. “Induction of the CXC chemokine interferon-γ-inducible protein 10 regulates the reparative response following myocardial infarction” Circulation research 105.10 (2009): 973-983.

[0487] Reference 13: Rodriguez-Pascual, F. and O. Busnadiego. “Gonzalez-Santamaria J.” Life Sci 118.2 (2014): 156.

[0488] Reference 14: Daskalopoulos, Evangelos P. et al. "Targeting the Wnt / frizzled signaling pathway after myocardial infarction: a new tool in the therapeutic toolbox?" Trends in cardiovascular medicine 23.4 (2013): 121-127.

[0489] Reference 15: Porter, Karen E. and Neil A. Turner. “Cardiac fibroblasts: at the heart of myocardial remodeling” Pharmacology & therapeutics 123.2 (2009): 255-278.

[0490] Reference 16: Caulfield, JB and TKBorg “The collagen network of the heart” Laboratory investigation; a journal of technical methods and pathology 40.3 (1979): 364-372.

[0491] Reference 17: Hales, Patrick W. et al. "Histo-anatomical structure of the living isolated rat heart in two contraction states assessed by diffusion tensor MRI" Progress in biophysics and molecular biology 110.2-3 (2012): 319-330.

[0492] Reference 18: Zeisberg, Elisabeth M. et al. “Endothelial-to-mesenchymal transition contributes to cardiac fibrosis” Nature medicine 13.8 (2007): 952-961.

[0493] Reference 19: Tampe, et al. “Induction of Tet3-dependent epigenetic remodeling by low-dosehydralazine attenuates progression of chronic kidney disease.” EBioMedicine 2.1 (2015): 19-36.

[0494] Reference 20: Tampe, et al. “Induction of Tet3-dependent epigenetic remodeling by low-dosehydralazine attenuates progression of chronic kidney disease.” EBioMedicine 2.1 (2015): 19-36.

[0495] Reference 21: Batchelor, JR et al. "Hydralazine-induced systemic lupus erythematosus: influence of HLA-DR and sex on susceptibility" The lancet 315.8178(1980):1107-1109.

[0496] Reference 22: Shepherd, Alexander MM, et al. "Hydralazine kinetics after single and repeated oral doses", Clinical Pharmacology & Therapeutics 28.6 (1980): 804-811.

[0497] Reference 23: Bourdi, Mohammed et al. "Anti-liver microsomes autoantibodies and dihydralazine-induced hepatitis: specificity of autoantibodies and inductive capacity of the drug", Molecular Pharmacology 42.2 (1992): 280-285.

[0498] Reference 24: Chang, Christopher and M. Eric Gershwin. “Drugs and autoimmunity–a contemporary review and mechanistic approach.” Journal of autoimmunity 34.3 (2010): J266-J275.

[0499] Reference 25: Lodyga, Monika and Boris Hinz. "TGF-β1-a truly transforming growth factor in fibrosis and immunity" Seminars in cell & developmental biology. Vol. 101. Academic Press, (2020): 123-139

[0500] Reference 26: Carthy, Jonathon M. "TGFβ signaling and the control of myofibroblast differentiation: Implications for chronic inflammatory disorders" Journal of cellular physiology 233.1 (2018): 98-106.

[0501] Reference 27: Lijnen, PJ, VV Petrov and RH Fagard. "Induction of cardiac fibrosis by transforming growth factor-β1" Molecular genetics and metabolism 71.1-2 (2000): 418-435.

[0502] Reference 28: Müller, GA, et al. “Human renal fibroblast cell lines (tFKIF and tNKF) are new tools to investigate pathophysiologic mechanisms of renal interstitial fibrosis” Experimental Nephrology 3.2 (1995): 127-133.

[0503] Reference 29: Druey, J. and BH Ringier, "Benzodiazepine and Pyridazine Derivatives (Hydrazinderivateder Phtalazin-und Pyridazinreihe)", Helvetica Chimica Acta 34.1 (1951): 195-210.

[0504] Reference 30: Zimmer, Hans, John M. Kokosa and KJ Shah. "Synthesis of condensed heterocyclic systems. VI. Ring closure reactions involving 1-hydrazinophthalazine" The Journal of Organic Chemistry 40.20 (1975): 2901-2906.

[0505] Reference 31: Badr, MZA et al. "Substitution and ring closure reactions of phthalazine derivatives", Journal of heterocyclic chemistry 21.2 (1984): 471-475.

[0506] Reference 32: Müller, GA, et al. “Human renal fibroblast cell lines (tFKIF and tNKF) are new tools to investigate pathophysiologic mechanisms of renal interstitial fibrosis” Experimental Nephrology 3.2 (1995): 127-133.

[0507] Patent Literature:

[0508] WO 2016 / 085981 A1

[0509] WO 2016 / 046130 A1

[0510] WO 2021 / 089828 A1

[0511] DE 102019126517 A1

Claims

1. An azo compound (I) for use in a method for treating or preventing fibrosis in, R is selected from H, D, CN, NHR 5 、NDR 5 , Cl, OR 3 , SR 3 and C 1-4 A group consisting of alkyl, especially H, D, methyl; X is N or CR 1 , wherein nitrogen and carbon atoms are aromatic atoms; W is selected from a covalent bond, CR 4 (where the carbon atom is an aromatic ring atom), CH2, S, O, N (where the nitrogen atom is an aromatic ring atom), NH and NR 2 The group composed of; X 1 Selected from covalent bonds, CR 4 (where the carbon atom is an aromatic ring atom), CH2, S, O, N (where the nitrogen atom is an aromatic ring atom), NH and NR 2 The group composed of; Y is selected from a covalent bond, CR 4 (where the carbon atom is an aromatic ring atom), CH2, S, O, N (where the nitrogen atom is an aromatic ring atom), NH and NR 2 The group composed of; Z is selected from a covalent bond, CR 4 (where the carbon atom is an aromatic ring atom), CH2, S, O, N (where the nitrogen atom is an aromatic ring atom), NH and NR 2 The group composed of; in, represents a single bond or a double bond; W, X 1 , Y and Z are members of the same ring and are selected so that the ring consists of five or six members; Select W, X 1 , Y and Z are selected such that the ring does not contain more than two nitrogen atoms in the ring, and W, X 1 , Y and Z are such that the ring does not contain an acetal, thioacetal, amine or hydrazine group; wherein the compound does not contain peroxide or disulfide groups; and wherein R 1 Selected from H, D, CD3, CHD2, CH2D, CF3, CHF2, CH2F, CDF2, CD2F, C 1-4 A group consisting of alkyl, optionally substituted by OH, halogen, OR 3 replace; R 2 Selected from the group consisting of CHO, COCH3, COC2H5, COC3H7, COCH(CH3)2, COC4H9, COC(CH3)3; R 3 Choose from C 1-4 A group consisting of alkyl groups; R 4 Selected from the group consisting of H, D, F, Cl, methyl, CH2F, CHF2, CF3, OCH3, OCD3; and R 5 C 1-4 -alkyl, optionally substituted by OH.

2. The azo compound (I) used according to claim 1, wherein R is selected from H, CN, NHR 5 , Cl, OR 3 , methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, cyclopropyl and SR 3 Composed of groups.

3. The azo compound (I) for use according to claim 1 or 2, wherein R 1 Selected from the group consisting of H, D, CD3, CHD2, CH2D, CF3, CHF2, CH2F, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl and cyclopropyl, optionally substituted by OH, halogen or OR 3 substituted, optionally, wherein R 1 is selected from the group consisting of H, methyl, CD3, CF3, CH2OH, ethyl, CH2OCH3 and cyclopropyl, and / or where R 3 is selected from the group consisting of methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl and tert-butyl, and / or where R 5 Selected from the group consisting of methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, optionally substituted with OH.

4. The azo compound (I) for use according to any one of claims 1 to 3, wherein Select W, X 1 , Y and Z are such that the compound does not contain a peroxide group and / or such that the compound does not contain a disulfide group.

5. The azo compound (I) for use according to any one of claims 1 to 4, wherein X is selected from N and CR 1 The group consists of 1 is selected from the group consisting of H, methyl, CH2F, CD2F, CHF2, CDF2 and CF3, preferably, wherein X is CR 1 , R is H or D.

6. The azo compound (I) for use according to any one of claims 1 to 5, wherein Select W, X 1 , Y and Z are such that the ring consists of carbon atoms or such that the ring consists of carbon atoms and one heteroatom, And / or among them, select W, X 1 , Y and Z are such that the ring is aromatic or non-aromatic.

7. The azo compound (I) for use according to any one of claims 1 to 6, wherein Select W, X 1 , Y and Z to form a portion according to one of the following ring atom sequences: C...C...C...C, N...C...C...C, C...N...C...C, C...C...N...C, C...C...C...N, S...C...C...C, C...S...C...C, C...C...S...C, C...C...C...S, O...C...C...C, C...O...C...C, C...C...O...C, C...C...C...O, C...C...C, N...C...C, C...N...C, C...C...N, S...C...C, C...S...C, C...C...S, O...C...C, C...O...C, C...C...O, wherein "..." represents a single bond or a double bond, and / or Among them, independently choose W, X 1 , Y and Z are such that the ring forms pyrrolidine, dihydrofuran, dihydrothiophene, pyrrole, furan, thiophene, The structure of the present invention comprises oxazole, thiazole, tetrahydrobenzene, ethylene oxide, cyclopentane sulfide, benzene, pyridine, pyran, thiopyran, preferably benzene, pyridine, dihydropyridine, thiophene or furan.

8. The azo compound (I) for use according to any one of claims 1 to 7, wherein Choose W, X independently 1 , Y and Z to form a moiety selected from the group consisting of CH=CH-CH=CH, CH=N-CH=CH, N=CH-CH=CH, CH=CH-CH=N, NH-CH2-CH2-CH2, CH2-NH-CH2=CH2, CH2-NCOCH3-CH2-CH2, S-CH=CH, CH=CH-S, CH-S-CH, CH=CH-O, preferably CH=CH-CH=CH or CH-S-CH.

9. The azo compound (I) for use according to any one of claims 1 to 8, in, Select W, X 1 , Y and Z to form a CH=CH-CH=CH moiety, wherein R=H and X is N; or Among them, select W, X 1 , Y and Z to form a CH=CH-CH=CH moiety, wherein R=H and X is C-CH3; or Among them, select W, X 1 , Y and Z to form a CH=CH-CH=CH moiety, wherein R=H and X is CH; or Among them, select W, X 1 , Y and Z to form a CH-S-CH moiety, wherein R=H and X is C-CH3; or Among them, select W, X 1 , Y and Z to form a CH-S-CH moiety, wherein R=H and X is N.

10. The azo compound (I) for use according to any one of claims 1 to 9, wherein X is C-CH3, R is H, and W, X 1 , Y and Z form a group CR 4 =CR 4 -CR 4 =CR 4 , where one R 4 A group is selected from the group consisting of F, Cl and OCH3, and wherein the remaining three R 4 The group is hydrogen.

11. The azo compound (I) for use according to any one of claims 1 to 10, wherein X is C-CH3, R is H, and W, X 1 , Y and Z form a group CR 4 =CR 4 -CR 4 =CR 4 , where two R 4 The groups are independently selected from the group consisting of F, Cl and OCH3, and wherein the remaining two R 4 The group is hydrogen.

12. The azo compound (I) for use according to any one of claims 1 to 11, wherein The azo compound (I) is selected from the group consisting of: Optionally, wherein the azo compound (I) is selected from the group consisting of:

13. The azo compound (I) for use according to any one of claims 1 to 12, wherein The fibrosis is selected from the group consisting of renal fibrosis, liver fibrosis, lung fibrosis and cardiac fibrosis, optionally cardiac fibrosis.

14. A pharmaceutical composition for use in the treatment of fibrosis, comprising an azo compound or a mixture of azo compounds and a pharmaceutically acceptable carrier, wherein each of the azo compounds has the structure (I) as defined in claim 1 15. The pharmaceutical composition according to claim 14, which is an oral solid dosage form and / or wherein: The amount of the azo compound is 5 mg to 500 mg, preferably 10 mg to 200 mg.

Images