Messenger ribonucleic acid with extended half-life

Abstract

The present disclosure relates to a polynucleotide encoding a polypeptide, the polynucleotide comprising a 5 'UTR, a coding region encoding a polypeptide, and a 3' UTR, as well as lipid nanoparticles comprising the polynucleotide. The polynucleotides and / or lipid nanoparticles of the present disclosure are capable of increasing the level and / or activity of a polypeptide by increasing the half-life and / or expression duration of a polynucleotide encoding the polypeptide. Also disclosed herein are methods of treating a disease or condition in a subject using the lipid nanoparticles of the present disclosure.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of priority to U.S. Provisional Application No. 63 / 323,748 filed on March 25, 2022, U.S. Provisional Application No. 63 / 405,142 filed on September 9, 2022, and U.S. Provisional Application No. 63 / 419,924 filed on October 27, 2022, the contents of which are hereby incorporated by reference. Background Art

[0003] Efforts to increase the potency of messenger RNA (mRNA) have focused on mRNA with optimal sequence design of open reading frames (ORFs). However, there is a need to further improve the potency and persistence of mRNA expression by exploiting RNA biology. Summary of the invention

[0004] The present disclosure provides, inter alia, polynucleotides (e.g., mRNAs) encoding polypeptides, wherein the polynucleotides comprise: (a) a 5'-UTR (e.g., as described herein); (b) a coding region comprising a termination element (e.g., as described herein); and (c) a 3'-UTR (e.g., as described herein), and LNP compositions comprising the polynucleotides. In one embodiment, the coding region comprises a polynucleotide sequence, such as an mRNA, such as an open reading frame (ORF) encoding a peptide or polypeptide payload, such as a therapeutic payload or a prophylactic payload. In one embodiment, the polynucleotide, such as an mRNA, or a polypeptide encoded by the polynucleotide has an increased level and / or activity, such as expression or half-life, compared to a version lacking a 5'-UTR, a 3'-UTR, or a termination element as described herein. In one embodiment, the level and / or activity of a polynucleotide, such as an mRNA, is increased. In one embodiment, the level, activity, and / or duration of expression of a polypeptide encoded by the polynucleotide is increased. Also disclosed herein are methods of using LNP compositions comprising the polynucleotides disclosed herein for treating a disease or disorder or for promoting a desired biological effect in a subject. It will be appreciated that any ORF may be combined with the disclosed elements, for example, an ORF encoding a polypeptide or peptide, whether intracellular, transmembrane or secreted, for example.Additional aspects of the disclosure are described in further detail below.

[0005] Specifically, in some embodiments, provided herein is a messenger RNA (mRNA) comprising a 5′UTR, an open reading frame encoding a polypeptide, and a 3′UTR, wherein the 3′UTR comprises:

[0006] (i) a nucleotide sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146 or SEQ ID NO: 147; or

[0007] (ii) a nucleotide sequence corresponding to the nucleic acid sequence of SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146 or SEQ ID NO: 147, or a deletion variant thereof, in which 1 to 75 consecutive nucleotides are deleted from SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146 or SEQ ID NO: 147, wherein the nucleic acid sequence or deletion variant thereof is modified to include:

[0008] a) one or more miRNA binding sites inserted into said nucleic acid sequence or a deletion variant thereof, and / or

[0009] b) a TENT recruitment sequence, a FUT8 recruitment sequence, one or more identification and ratio determination (IDR) sequences, one or more ribosome attachment detection assay (REDA) sequences, or a combination of one or more IDR sequences and one or more REDA sequences inserted into the nucleic acid sequence or a deletion variant thereof.

[0010] In certain embodiments, the present disclosure provides a 3'UTR comprising a nucleotide sequence at least 99% identical to the nucleic acid sequence of SEQ ID NO: 139. In certain embodiments, the present disclosure provides a 3'UTR comprising a nucleic acid sequence shown in SEQ ID NO:139.

[0011] In certain embodiments, the present disclosure provides a 3'UTR comprising a nucleotide sequence at least 99% identical to the nucleic acid sequence of SEQ ID NO: 140. In certain embodiments, the present disclosure provides a 3'UTR comprising the nucleic acid sequence shown in SEQ ID NO:140.

[0012] In certain embodiments, the present disclosure provides a 3'UTR comprising a nucleotide sequence at least 99% identical to the nucleic acid sequence of SEQ ID NO: 141. In certain embodiments, the present disclosure provides a 3'UTR comprising the nucleic acid sequence shown in SEQ ID NO:141.

[0013] In certain embodiments, the present disclosure provides a 3'UTR comprising a nucleotide sequence at least 99% identical to the nucleic acid sequence of SEQ ID NO: 142. In certain embodiments, the present disclosure provides a 3'UTR comprising the nucleic acid sequence shown in SEQ ID NO:142.

[0014] In certain embodiments, the present disclosure provides a 3'UTR comprising a nucleotide sequence at least 99% identical to the nucleic acid sequence of SEQ ID NO: 143. In certain embodiments, the present disclosure provides a 3'UTR comprising the nucleic acid sequence shown in SEQ ID NO:143.

[0015] In certain embodiments, the present disclosure provides a 3'UTR comprising a nucleotide sequence at least 99% identical to the nucleic acid sequence of SEQ ID NO: 144. In certain embodiments, the present disclosure provides a 3'UTR comprising the nucleic acid sequence shown in SEQ ID NO:144.

[0016] In certain embodiments, the present disclosure provides a 3'UTR comprising a nucleotide sequence at least 99% identical to the nucleic acid sequence of SEQ ID NO: 145. In certain embodiments, the present disclosure provides a 3'UTR comprising a nucleic acid sequence shown in SEQ ID NO:145.

[0017] In certain embodiments, the present disclosure provides a 3'UTR comprising a nucleotide sequence at least 99% identical to the nucleic acid sequence of SEQ ID NO: 146. In certain embodiments, the present disclosure provides a 3'UTR comprising the nucleic acid sequence shown in SEQ ID NO:146.

[0018] In certain embodiments, the present disclosure provides a 3'UTR comprising a nucleotide sequence at least 99% identical to the nucleic acid sequence of SEQ ID NO: 147. In certain embodiments, the present disclosure provides a 3'UTR comprising the nucleic acid sequence shown in SEQ ID NO:147.

[0019] In some aspects of the present disclosure, the 3′UTR comprises a nucleotide sequence corresponding to a nucleic acid sequence of SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147, wherein the nucleic acid sequence is modified to include one or more miRNA binding sites inserted into the nucleic acid sequence. In some cases, the one or more miRNA binding sites are selected from SEQ ID NOs: 148-157. In some embodiments, the one or more miRNA binding sites comprise at least one copy of SEQ ID NO: 149 and at least one copy of SEQ ID NO: 150. In some embodiments, the one or more miRNA binding sites comprise at least three copies of SEQ ID NO: 150. In some embodiments, the one or more miRNA binding sites comprise at least two copies of SEQ ID NO: 149. In some embodiments, the one or more miRNA binding sites comprise at least two copies of SEQ ID NO: 149 and at least one copy of SEQ ID NO: 150. In some embodiments, the one or more miRNA binding sites comprise at least three copies of SEQ ID NO:148.

[0020] In some aspects provided herein, the 3'UTR comprises a nucleotide sequence corresponding to a nucleic acid sequence of SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146 or SEQ ID NO: 147, wherein the nucleic acid sequence is modified to include a TENT recruitment sequence inserted into the nucleic acid sequence.

[0021] In some embodiments provided herein, the 3'UTR comprises a nucleotide sequence corresponding to a nucleic acid sequence of SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147, wherein the nucleic acid sequence is modified to include a FUT8 recruitment sequence inserted into the nucleic acid sequence.

[0022] In some cases provided herein, the 3'UTR comprises a nucleotide sequence corresponding to a nucleic acid sequence of SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147, wherein the nucleic acid sequence is modified to include one or more IDR sequences inserted into the nucleic acid sequence.

[0023] In some aspects provided herein, the 3'UTR comprises a nucleotide sequence corresponding to the nucleic acid sequence of SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146 or SEQ ID NO: 147, wherein the nucleic acid sequence is modified to include one or more REDA sequences inserted into the nucleic acid sequence.

[0024] In some aspects provided herein, 1 to 60 consecutive nucleotides are deleted from SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147 in the deletion variant. In some aspects provided herein, 1 to 50 consecutive nucleotides are deleted from SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147 in the deletion variant. In some aspects provided herein, 1 to 40 consecutive nucleotides are deleted from SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147 in the deletion variant. In some aspects provided herein, 1 to 30 consecutive nucleotides are deleted from SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147 in the deletion variant. In some aspects provided herein, 1 to 20 consecutive nucleotides are deleted from SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147 in the deletion variant. In some aspects provided herein, 1 to 10 consecutive nucleotides are deleted from SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147 in the deletion variant.In some aspects provided herein, fewer than 10 contiguous nucleotides are deleted from SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147 in the deletion variant.

[0025] In certain embodiments of any of the mRNAs described above, the 5'UTR comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 50. In some embodiments, the 5'UTR comprises the nucleic acid sequence set forth in SEQ ID NO: 50.

[0026] In certain embodiments provided herein, the 3'UTR comprises the nucleic acid sequence set forth in SEQ ID NO:139, and wherein the 5'UTR comprises the nucleic acid sequence set forth in SEQ ID NO:50.

[0027] In certain embodiments provided herein, the 3'UTR comprises the nucleic acid sequence set forth in SEQ ID NO:140, and wherein the 5'UTR comprises the nucleic acid sequence set forth in SEQ ID NO:50.

[0028] In certain embodiments provided herein, the 3'UTR comprises the nucleic acid sequence set forth in SEQ ID NO:141, and wherein the 5'UTR comprises the nucleic acid sequence set forth in SEQ ID NO:50.

[0029] In certain embodiments provided herein, the 3'UTR comprises the nucleic acid sequence set forth in SEQ ID NO:142, and wherein the 5'UTR comprises the nucleic acid sequence set forth in SEQ ID NO:50.

[0030] In certain embodiments provided herein, the 3'UTR comprises the nucleic acid sequence set forth in SEQ ID NO:143, and wherein the 5'UTR comprises the nucleic acid sequence set forth in SEQ ID NO:50.

[0031] In certain embodiments provided herein, the 3'UTR comprises the nucleic acid sequence set forth in SEQ ID NO:144, and wherein the 5'UTR comprises the nucleic acid sequence set forth in SEQ ID NO:50.

[0032] In certain embodiments provided herein, the 3'UTR comprises the nucleic acid sequence set forth in SEQ ID NO:145, and wherein the 5'UTR comprises the nucleic acid sequence set forth in SEQ ID NO:50.

[0033] In certain embodiments provided herein, the 3'UTR comprises the nucleic acid sequence set forth in SEQ ID NO:146, and wherein the 5'UTR comprises the nucleic acid sequence set forth in SEQ ID NO:50.

[0034] In certain embodiments provided herein, the 3'UTR comprises the nucleic acid sequence set forth in SEQ ID NO:147, and wherein the 5'UTR comprises the nucleic acid sequence set forth in SEQ ID NO:50.

[0035] In certain aspects of any of the mRNAs described above, the mRNA comprises a termination box. In some embodiments, the termination box is selected from SEQ ID NOs: 158-174. In some embodiments, the termination box is UAAAGCUCCCCGGGG (SEQ ID NO: 165) or UAAGCCCC UCCGGGG (SEQ ID NO: 164).

[0036] In certain aspects of any of the mRNAs described above, the mRNA comprises a 5′ terminal cap. In some embodiments, the 5′ terminal cap comprises m 7 GpppG 2’OMc , m7G-ppp-Gm-A, m7G-ppp-Gm-AG, cap 0, cap 1, ARCA, inosine, N1-methyl-guanosine, 2′-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azidoguanosine, cap 2, cap 4, 5′ methyl G cap or its analogues.

[0037] In some aspects of any of the mRNAs described above, the mRNA comprises a poly A region. In some embodiments, the length of the poly A region is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90 nucleotides, or at least about 100 nucleotides in length. In some embodiments, the length of the poly A region is about 10 to about 200, about 20 to about 180, about 50 to about 160, about 70 to about 140, or about 80 to about 120 nucleotides. In some embodiments, the poly A region comprises A100-UCUAG-A20-reverse deoxy-thymidine.

[0038] In some aspects of any one of the mRNAs described above, the mRNA comprises at least one chemically modified nucleobase, sugar, backbone, or any combination thereof. In some embodiments, at least one chemically modified nucleobase is selected from the group consisting of pseudouracil (ψ), N1-methyl pseudouracil (m1ψ), 1-ethyl pseudouracil, 2-thiouracil (s2U), 4′-thiouracil, 5-methylcytosine, 5-methyluracil, 5-methoxyuracil, and any combination thereof.

[0039] In certain aspects of any of the mRNAs described above, the polypeptide comprises a secretory protein, a membrane-bound protein, or an intercellular protein. In some embodiments, the polypeptide is a cytokine, an antibody, a vaccine, a receptor, an enzyme, a hormone, a transcription factor, a ligand, a membrane transporter, a structural protein, a nuclease, or a component, variant, or fragment thereof.

[0040] Also provided herein is a pharmaceutical composition comprising any one of the mRNAs described above and a pharmaceutically acceptable carrier.

[0041] Also provided herein are lipid nanoparticles comprising any of the mRNAs described above. In some embodiments, the lipid nanoparticles comprise: (i) ionizable lipids, (ii) phospholipids, (iii) structural lipids, and (iv) PEG-lipids. In some embodiments, the lipid nanoparticles comprise a compound of formula (I):

[0042] or an N-oxide thereof, or a salt or isomer thereof,

[0043] Where R′ a is R′ 支链 ;in

[0044] R′ 支链 yes: in Indicates a connection point;

[0045] Where R aα , R aβ , R aγ and R aδ Each independently selected from H, C 2-12 Alkyl and C 2-12 A group consisting of alkenyl groups;

[0046] R 2 and R 3 Each independently selected from C 1-14 Alkyl and C 2-14 A group consisting of alkenyl groups;

[0047] R 4Selected from the group consisting of: -(CH 2 ) n OH, wherein n is selected from the group consisting of 1, 2, 3, 4 and 5, and

[0048] in represents a connection point;

[0049] R 10 YesN(R) 2 ; Each R is independently selected from C 1-6 Alkyl, C 2-3 alkenyl and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10;

[0050] Each R 5 Independently selected from C 1-3 Alkyl, C 2-3 A group consisting of an alkenyl group and H;

[0051] Each R 6 Independently selected from C 1-3 Alkyl, C 2-3 A group consisting of an alkenyl group and H;

[0052] M and M' are each independently selected from the group consisting of -C(O)O- and -OC(O)-;

[0053] R′ is C 1-12 Alkyl or C 2-12 alkenyl;

[0054] 1 is selected from the group consisting of 1, 2, 3, 4 and 5; and

[0055] m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12 and 13.

[0056] In some embodiments, the lipid nanoparticle comprises:

[0057] (a) (i) Compound II, (ii) cholesterol, and (iii) PEG-DMG or Compound I;

[0058] (b) (i) Compound VI, (ii) cholesterol, and (iii) PEG-DMG or Compound I;

[0059] (c) (i) Compound II, (ii) DSPC or DOPE, (iii) cholesterol, and (iv) PEG-DMG or Compound I;

[0060] (d) (i) Compound VI, (ii) DSPC or DOPE, (iii) cholesterol, and (iv) PEG-DMG or Compound I;

[0061] (e) (i) Compound II, (ii) cholesterol, and (iii) Compound I;

[0062] (f) (i) Compound II, (ii) DSPC or DOPE, (iii) cholesterol, and (iv) Compound I;

[0063] (g) (i) Compound B, (ii) DSPC or DOPE, (iii) cholesterol, and (iv) PEG-DMG or Compound I;

[0064] (h) (i) Compound B, (ii) cholesterol, and (iii) Compound I; or

[0065] (i) (i) Compound B, (ii) DSPC or DOPE, (iii) cholesterol, and (iv) Compound I.

[0066] In some embodiments, the lipid nanoparticles comprise Compound II and Compound I. In some embodiments, the lipid nanoparticles comprise Compound B and Compound I. In some embodiments, the lipid nanoparticles comprise Compound II, DSPC, cholesterol, and Compound I. In some embodiments, the lipid nanoparticles comprise a molar ratio of about 20-60% ionizable lipids: 5-25% phospholipids: 25-55% cholesterol: and 0.5-15% PEG lipids. In some embodiments, the lipid nanoparticles are formulated for intravenous, subcutaneous, intramuscular, intranasal, intraocular, rectal, pulmonary, or oral delivery.

[0067] Also provided herein are pharmaceutical compositions comprising any of the lipid nanoparticles described above. Also provided herein are cells comprising any of the lipid nanoparticles described above.

[0068] In some embodiments, also provided herein is a method of increasing polypeptide expression, the method comprising administering to a cell any of the lipid nanoparticles described above.

[0069] Also provided herein is a method of delivering any of the lipid nanoparticles described above to a cell, the method comprising contacting the cell with the lipid nanoparticle in vitro, in vivo or ex vivo.

[0070] In some cases, also provided herein is a method of delivering any of the lipid nanoparticles described above to a human subject suffering from a disease or disorder, the method comprising administering to the human subject in need thereof an effective amount of the lipid nanoparticle.

[0071] Also provided herein are methods of treating, preventing, or preventing a symptom of a disease or disorder in a human subject in need thereof, comprising administering to the human subject an effective amount of any of the lipid nanoparticles described above.

[0072] Also provided herein are methods of treating, preventing, or preventing a symptom of a disease or disorder in a human subject in need thereof, comprising administering to the human subject an effective amount of any of the lipid nanoparticles described above.

[0073] Other features and advantages of the invention will be apparent from the following detailed description and drawings, and from the claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] Figure 1A-1G is a graph depicting the expression of luciferase or target protein encoded by mRNA constructs having v1.1 5'UTR (SEQ ID NO: 56) or v2.0 5'UTR (SEQ ID NO: 50) in combination with α 3'UTR or κ 3'UTR. Figure 1A Systemic ffLuc activity is shown 96 hours after dosing. Figure 1B Systemic ffLuc activity 72 hours after dosing is shown. Figure 1C Systemic ffLuc activity is shown within 0-4 days after dosing. Figure 1D Expression in liver is shown. Figure 1E Expression in spleen is shown. Figure 1F The target protein (ie, EPO) expression in serum 96 hours after administration is shown. FIG1 G shows the target protein (ie, EPO) expression in serum 0-4 days after administration.

[0075] Figure 2A-2I Graphs depicting overall mean fluorescence intensity or percentage of mOX40L+ cells encoded by mRNA constructs having v2.0 5′UTR in combination with control 3′UTR (labeled “triple” in the legend), kappa 3′UTR, or iota 3′UTR in various immune cells 1, 2, and 3 days after dosing. Figure 2A Mean fluorescence intensity and % of mOX40L+ cells in LSK+ hematopoietic stem and progenitor cells are shown. Figure 2B Mean fluorescence intensity and % of mOX40L+ cells in splenic dendritic cells are shown. Figure 2C Mean fluorescence intensity and % of mOX40L+ cells in splenic macrophages are shown. Figure 2D Mean fluorescence intensity and % of mOX40L+ cells in splenic neutrophils are shown. Figure 2E Mean fluorescence intensity and % of mOX40L+ cells in splenic monocytes are shown. Figure 2F Mean fluorescence intensity and % of mOX40L+ cells in splenic eosinophils are shown. Figure 2G Mean fluorescence intensity and % of mOX40L+ cells in splenic CD4+ T cells are shown. Figure 2H Mean fluorescence intensity and % of mOX40L+ cells in splenic CD8+ T cells are shown. Fig.2I Mean fluorescence intensity and % of mOX40L+ cells in splenic B cells are shown.

[0076] Figure 3A are images showing protein levels of FANCA (upper row of each sample) and nucleolin (lower row of each sample) in FaDu triplet cell lines at the indicated time points for cells transfected with the indicated constructs. The fold change of FANCA expression was calculated and normalized to the loading control and wild type (WT) mean.

[0077] Figure 3B is a graph showing FANCA expression levels normalized to nucleolin and expressed as fold change relative to the mean expression of FANCA in WT FaDu cell line.

[0078] Figure 4 is a graph showing the survival percentage of FaDu-WT, FaDu-KO transfected with 1 ug GFP mRNA construct, or FaDu-KO transfected with 1 ug FANCA construct and treated with indicated concentrations of mitomycin C (MMC) 24 hours after transfection. Survival was assessed 5 days after treatment using Cell titer Glo.

[0079] Figure 5A Is a graph showing cell accumulation in the G2-M phase of the cell cycle in cells treated with control (Ctl) or 1,3-butadiene diepoxide (DEB) and MMC. WT-GFP refers to FaDu WT cells transfected with GFP mRNA; KO-GFP refers to FaDu KO cells transfected with GFP mRNA; FANCA_01-FANCA-04 refers to FaDu KO cells transfected with FANCA constructs. Transfection occurred 6 hours before treatment.

[0080] Figure 5B Yes Display Figure 5A Figure 2 shows the G2M frequency of the data, expressed as mean ± SD. Statistical significance was calculated using the student t-test. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

[0081] Fig. 6AIs a graph showing cell accumulation in the G2-M phase of the cell cycle in cells treated with control (Ctl) or 1,3-butadiene diepoxide (DEB) and MMC. WT-GFP refers to FaDu WT cells transfected with GFP mRNA; KO-GFP refers to FaDu KO cells transfected with GFP mRNA; FANCA_01-FANCA-04 refers to FaDu KO cells transfected with FANCA constructs. Transfection occurred 72 hours before treatment.

[0082] Figure 6B Yes Display Fig. 6A The data are presented as mean ± SD. Statistical significance was calculated using Student's t-test. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

[0083] Figure 6C is a graph showing FANCA expression levels normalized to nucleolin and expressed as fold change relative to FANCA in WT FaDu cell line.

[0084] Figure 7 Ovalbumin concentrations 6 and 48 hours after dosing are shown. The mRNAs evaluated had a kappa 3'UTR (SEQ ID NO: 139) and either a v1.1 5'UTR (SEQ ID NO: 56) or a v2.0 5'UTR (SEQ ID NO: 50). Both mRNAs were prepared using the same "alpha" process.

[0085] Figure 8 is a bar graph showing antibody responses when using mRNA comprising v2.0 5'UTR (SEQ ID NO: 50) and kappa 3'UTR (SEQ ID NO: 139).

[0086] Fig. 9 is a bar graph showing the effect of the FUT8 sequence in the 3′UTR compared to the absence of the FUT8 sequence. Shown from left to right: PBS control, mRNA containing v1.0 UTR, mRNA with v2.0 5′UTR (SEQ ID NO: 50) and the re-optimized coding sequence, mRNA with elements from (2) plus a 3′UTR with a 'δ' stop box and a 'FUT8' sequence (3′UTR corresponds to SEQ ID NO: 140), and two positive controls.

[0087] Fig.10 is a schematic diagram showing that the presence of v2.0 5'UTR mRNA encoding hemagglutinin increases immunogenicity in mice.

[0088] Fig.11 is a bar graph showing that the presence of v2.0 5'UTR and v2.0 3'UTR enhances the expression of mRNA encoding hemagglutinin in vitro. DETAILED DESCRIPTION

[0089] The potency and persistence of mRNA can be optimized by: (1) ensuring that mRNA delivered to the cytoplasm associates properly and efficiently with ribosomes; and (2) maximizing the time that the mRNA spends actively producing the desired protein product. The sequence of the mRNA is an important determinant of performance in these aspects.

[0090] The following findings are disclosed herein, inter alia: the sequence of the 3' untranslated region (UTR) can be optimized to increase the potency and / or persistence of the mRNA. In some embodiments, the sequence of the 3'UTR can be optimized in combination with the 5'UTR and / or termination element of the mRNA to increase the potency and / or persistence of the mRNA, for example, by extending the half-life and / or duration of expression of the mRNA. In some embodiments, the disclosure provides polynucleotides and lipid nanoparticle compositions comprising optimized 3'UTRs that can increase the efficacy (e.g., level and / or activity) of mRNA or a polypeptide encoded by the mRNA.

[0091] 1. Untranslated region (UTR)

[0092] The untranslated region (UTR) is the nucleic acid portion of the polynucleotide that is not translated before the start codon (5'UTR) and after the stop codon (3'UTR). In some embodiments, the polynucleotide of the present invention (e.g., ribonucleic acid (RNA)) comprising an open reading frame (ORF) encoding a polypeptide, such as mRNA, further comprises a UTR (e.g., a 5'UTR or a functional fragment thereof, a 3'UTR or a functional fragment thereof, or a combination thereof).

[0093] The UTR can be homologous or heterologous to the coding region in the polynucleotide. In some embodiments, the UTR is homologous to the ORF encoding the therapeutic payload or the prophylactic payload. In some embodiments, the UTR is heterologous to the ORF encoding the therapeutic payload or the prophylactic payload.

[0094] In some embodiments, the polynucleotide comprises two or more 5'UTRs or functional fragments thereof, each having the same or different nucleotide sequences. In some embodiments, the polynucleotide comprises two or more 3'UTRs or functional fragments thereof, each having the same or different nucleotide sequences.

[0095] In some embodiments, the 5'UTR or a functional fragment thereof, the 3'UTR or a functional fragment thereof, or any combination thereof is sequence optimized.

[0096] In some embodiments, the 5'UTR or a functional fragment thereof, the 3'UTR or a functional fragment thereof, or any combination thereof comprises at least one chemically modified nucleobase, for example, N1-methylpseudouracil or 5-methoxyuracil.

[0097] The UTR may have features that provide regulatory effects, e.g., increased or decreased stability, localization, and / or translation efficiency. A polynucleotide comprising a UTR may be administered to a cell, tissue, or organism, and one or more regulatory features may be measured using conventional methods. In some embodiments, a functional fragment of a 5′UTR or 3′UTR comprises one or more regulatory features of a full-length 5′ or 3′UTR, respectively.

[0098] Natural 5'UTRs have features that play a role in translation initiation. They have features like the Kozak sequence, which is generally known to be involved in the process of ribosome initiation of translation of many genes. The Kozak sequence has a consensus CCR(A / G)CCAUGG (SEQ ID NO: 125), where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), followed by another 'G'. 5'UTRs are also known to form secondary structures involved in the binding of elongation factors.

[0099] By engineering features commonly found in genes that are abundantly expressed in specific target organs, the stability and protein production of polynucleotides can be enhanced. For example, the introduction of a 5′UTR of a liver-expressed mRNA such as albumin, serum amyloid A, apolipoprotein A / B / E, transferrin, alpha-fetoprotein, erythropoietin, or factor VIII can enhance the expression of polynucleotides in hepatocyte cell lines or the liver. Likewise, it is possible for muscle (e.g., MyoD, Myosin, Myoglobin, Myogenin, Herculin), endothelial cells (e.g., Tie-1, CD36), myeloid cells (e.g., C / EBP, AML1, G-CSF, GM-CSF, CD11b, MSR, Fr-1, i-NOS), leukocytes (e.g., CD45, CD18,), adipose tissue (e.g., CD36, GLUT4, ACRP30, adiponectin), and lung epithelial cells (e.g., SP-A / B / C / D) to use 5′UTRs from other tissue-specific mRNAs to increase expression in that tissue.

[0100] In some embodiments, the UTR is selected from a family of transcripts whose proteins share a common function, structure, feature, or property. For example, the encoded polypeptide may belong to a family of proteins that are expressed in a particular cell, tissue, or at a particular time during development (i.e., share at least one function, structure, feature, location, origin, or expression pattern). A UTR from any one of the genes or mRNAs may be exchanged with any one of the other UTRs of the same or different protein family to generate a new polynucleotide.

[0101] In some embodiments, the 5'UTR and 3'UTR may be heterologous. In some embodiments, the 5'UTR may be derived from a different species than the 3'UTR.

[0102] International Patent Application Publication No. WO / 2014 / 164253, herein incorporated by reference in its entirety, provides a list of exemplary UTRs that can be used as flanking regions of the ORF in the polynucleotides of the present invention.

[0103] Additional exemplary UTRs of the present application include, but are not limited to, one or more 5′UTRs and / or 3′UTRs derived from the following nucleic acid sequences: a globulin, such as an α-globulin or a β-globulin (e.g., Xenopus, mouse, rabbit, or human globulin); a strong Kozak translation initiation signal; a CYBA (e.g., human cytochrome b-245α polypeptide); an albumin (e.g., human albumin 7); HSD17B4 (hydroxysteroid (17-β) dehydrogenase); a virus (e.g., tobacco etch virus (TEV), Venezuelan equine encephalitis virus (VEEV), dengue virus, cytomegalovirus (CMV) (e.g., CMV immediate early 1 (IE1)), a hepatitis virus (e.g., hepatitis B virus), a sindbis virus (e.g., virus or PAV barley yellow dwarf virus); heat shock protein (e.g., hsp70); translation initiation factor (e.g., eIF4G); glucose transporter (e.g., hGLUT1 (human glucose transporter 1)); actin (e.g., human α or β actin); GAPDH; tubulin; histone; citric acid cycle enzyme; topoisomerase (e.g., 5′UTR of TOP gene lacking 5′ TOP motif (oligopyrimidine sequence stretch)); ribosomal protein large 32 (L32); ribosomal protein (e.g., human or mouse ribosomal protein, such as rps9); ATP synthase (e.g., ATP5A1 or β subunit of mitochondrial H+-ATP synthase); growth hormone e (e.g., bovine (bGH) or human (hGH)); elongation factor (e.g., elongation factor 1 αα1 (EEF1 A1)); manganese superoxide dismutase (MnSOD); myocyte enhancer factor 2A (MEF2A); β-F1-ATPase, creatine kinase, myoglobin, granulocyte colony stimulating factor (G-CSF); collagen (e.g., type I collagen alpha 2 (Col1A2), type I collagen alpha 1 (Col1A1), type VI collagen alpha 2 (Col6A2), type VI collagen alpha 1 (Col6A1)); ribosome binding protein (e.g., ribosome binding protein I (RPNI)); low-density lipoprotein receptor-related protein (e.g., LRP1); cardiotrophin-like cytokine (e.g., Nnt1); calreticulin (Calr); procollagen-lysine 2-oxoglutarate 5-dioxygenase 1 (Plod1); and nuclear ligins (e.g., Nucb1).

[0104] In some embodiments, the 5′UTR is selected from the group consisting of: β-globin 5′UTR; a 5′UTR containing a strong Kozak translation initiation signal; cytochrome b-245 alpha polypeptide (CYBA) 5′UTR; hydroxysteroid (17-β) dehydrogenase (HSD17B4) 5′UTR; tobacco etch virus (TEV) 5′UTR; Venezuelan equine encephalitis virus (TEEV) 5′UTR; 5′-proximal open reading frame of rubella virus (RV) RNA encoding non-structural proteins; dengue virus (DEN) 5′UTR; heat shock protein 70 (Hsp70) 5′UTR; eIF4G 5′UTR; GLUT1 5′UTR; functional fragments thereof, and any combination thereof.

[0105] A wild-type UTR derived from any gene or mRNA can be incorporated into the polynucleotides of the present invention. In some embodiments, the UTR can be altered relative to the wild-type or native UTR to produce a variant UTR, for example, by changing the orientation or position of the UTR relative to the ORF; or by including additional nucleotides, deletions of nucleotides, exchanges of nucleotides, or transposition. In some embodiments, variants of the 5' or 3' UTR can be utilized, for example, mutants of the wild-type UTR, or variants in which one or more nucleotides are added to or removed from the end of the UTR.

[0106] Additionally, one or more synthetic UTRs may be used in combination with one or more non-synthetic UTRs. See, e.g., Mandal and Rossi, Nat. Protoc. 2013 8(3):568-82, the contents of which are incorporated herein by reference in their entirety.

[0107] The UTRs or portions thereof may be placed in the same orientation as the transcript from which they were selected, or may have an altered orientation or position. Thus, the 5' and / or 3' UTR may be inverted, shortened, lengthened, or combined with one or more other 5' UTRs or 3' UTRs.

[0108] In some embodiments, the polynucleotide comprises multiple UTRs, e.g., double, triple, or quadruple 5′UTRs or 3′UTRs. For example, the double UTR comprises two tandem or substantially tandem copies of the same UTR. For example, the double β-globin 3′UTR can be used (see US2010 / 0129877, the contents of which are incorporated herein by reference in their entirety).

[0109] The polynucleotides of the present invention may comprise a combination of features. For example, an ORF may be flanked by a 5′UTR comprising a strong Kozak translation initiation signal and / or a 3′UTR comprising an oligo(dT) sequence for templated addition of a polyA tail. The 5′UTR may comprise a first polynucleotide fragment and a second polynucleotide fragment from the same and / or different UTRs (see, e.g., US2010 / 0293625, incorporated herein by reference in its entirety).

[0110] Other non-UTR sequences can be used as regions or subregions within the polynucleotides of the present invention. For example, an intron or part of an intron sequence can be incorporated into the polynucleotides of the present invention. The incorporation of an intron sequence can increase protein production and polynucleotide expression levels. In some embodiments, the polynucleotides of the present invention include an internal ribosome entry site (IRES) instead of UTR or in addition to UTR (see, e.g., Yakubov et al., Biochem. Biophys. Res. Commun. 2010 394 (1): 189-193, the contents of which are incorporated herein by reference in their entirety). In some embodiments, the polynucleotides include an IRES instead of a 5′UTR sequence. In some embodiments, the polynucleotides include an ORF and a viral capsid sequence. In some embodiments, the polynucleotides include a combination of a synthetic 5′UTR and a non-synthetic 3′UTR.

[0111] In some embodiments, the UTR may also include at least one translation enhancer polynucleotide, translation enhancer element, or translational enhancer element (collectively referred to as "TEE", which refers to a nucleic acid sequence that increases the amount of a polypeptide or protein produced from a polynucleotide). As a non-limiting example, a TEE may be located between a transcriptional promoter and a start codon. In some embodiments, a 5'UTR comprises a TEE.

[0112] In one aspect, TEEs are conserved elements in UTRs that can promote translational activity of nucleic acids, such as, but not limited to, cap-dependent or cap-independent translation.

[0113] a.5′UTR sequence

[0114] The 5′UTR sequence is important for ribosome recruitment to mRNA and has been reported to play a role in translation (Hinnebusch A et al., (2016) Science, 352:6292:1413-6).

[0115] In particular, a polynucleotide encoding a polypeptide is disclosed herein, the polynucleotide particularly comprising a 5′UTR. In one embodiment, the polynucleotide disclosed herein comprises: (a) a 5′-UTR (e.g., as provided in Table 1 or a variant or fragment thereof); (b) a coding region; and (c) a termination element and a 3′-UTR (e.g., as provided in Table 2 or a variant or fragment thereof), and an LNP composition comprising the polynucleotide. In one embodiment, the polynucleotide comprises a 5′-UTR comprising a sequence provided in Table 1 or a variant or fragment thereof (e.g., a functional variant or fragment thereof). It will be understood that such 5′UTR is incorporated into a construct not found in nature, for example, such 5′UTR is synthetic, altered in sequence from a naturally occurring 5′UTR, is a truncated or elongated form of those found in nature, comprises chemically modified bases, is 5′ of an ORF sequence different from those that may be found in nature, and the like.

[0116] In one embodiment, the 5'UTR comprises a sequence provided in Table 1, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 5'UTR sequence provided in Table 1, or a variant or fragment thereof. In one embodiment, the 5'UTR comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57 or SEQ ID NO:58.

[0117] In one embodiment, the 5'UTR comprises a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:50. In one embodiment, the 5'UTR comprises a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:51. In one embodiment, the 5'UTR comprises a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:52. In one embodiment, the 5'UTR comprises a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:53. In one embodiment, the 5'UTR comprises a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 54. In one embodiment, the 5'UTR comprises a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 55. In one embodiment, the 5'UTR comprises a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 56. In one embodiment, the 5'UTR comprises a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 57. In one embodiment, the 5'UTR comprises a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:58.

[0118] In one embodiment, the 5'UTR comprises a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:64.

[0119] In one embodiment, the 5'UTR comprises the sequence of SEQ ID NO: 50. In one embodiment, the 5'UTR consists of the sequence of SEQ ID NO:50.

[0120] In one embodiment, the 5'UTR comprises the sequence of SEQ ID NO: 64. In one embodiment, the 5'UTR consists of the sequence of SEQ ID NO:64.

[0121] In one embodiment, the 5'UTR sequences provided in Table 1 have a first nucleotide that is A. In one embodiment, the 5'UTR sequences provided in Table 1 have a first nucleotide that is G. In one embodiment, the 5'UTR sequences provided in Table 1 have a first two nucleotides that are AG. In one embodiment, the 5'UTR sequences provided in Table 1 have a first two nucleotides that are GA.

[0122] Table 1: 5′UTR sequences

[0123]

[0124]

[0125]

[0126] In one embodiment, the 5'UTR comprises a variant of SEQ ID NO: 50. In one embodiment, the variant of SEQ ID NO: 50 comprises a nucleic acid sequence of formula A:

[0127]

[0128] in:

[0129] (N 2 ) x is uracil and x is an integer from 0 to 5, for example, wherein x=3 or 4;

[0130] (N 3 ) x is guanine and x is an integer from 0 to 1;

[0131] (N 4 ) x is cytosine and x is an integer from 0 to 1;

[0132] (N 5 ) x is uracil and x is an integer from 0 to 5, for example, wherein x=2 or 3;

[0133] N 6 is uracil or cytosine;

[0134] N 7 is uracil or guanine;

[0135] N 8 is adenine or guanine and x is an integer from 0 to 1.

[0136] In one embodiment, (N 2 ) x is uracil and x is 0. In one embodiment, (N2 ) x is uracil and x is 1. In one embodiment, (N 2 ) x is uracil and x is 2. In one embodiment, (N 2 ) x is uracil and x is 3. In one embodiment, (N 2 ) x is uracil and x is 4. In one embodiment, (N 2 ) x is uracil and x is 5.

[0137] In one embodiment, (N 3 ) x is guanine and x is 0. In one embodiment, (N 3 ) x is guanine and x is 1.

[0138] In one embodiment, (N 4 ) x is cytosine and x is 0. In one embodiment, (N 4 ) x is cytosine and x is 1.

[0139] In one embodiment, (N 5 ) x is uracil and x is 0. In one embodiment, (N 5 ) x is uracil and x is 1. In one embodiment, (N 5 ) x is uracil and x is 2. In one embodiment, (N 5 ) x is uracil and x is 3. In one embodiment, (N 5 ) x is uracil and x is 4. In one embodiment, (N 5 ) x is uracil and x is 5.

[0140] In one embodiment, N6 is uracil.In one embodiment, N6 is cytosine.

[0141] In one embodiment, N7 is uracil. In one embodiment, N7 is guanine.

[0142] In one embodiment, N8 is adenine and x is 0. In one embodiment, N8 is adenine and x is 1.

[0143] In one embodiment, N8 is guanine and x is 0. In one embodiment, N8 is guanine and x is 1.

[0144] In one embodiment, the 5′UTR comprises a variant of SEQ ID NO: 50. In one embodiment, the variant of SEQ ID NO: 50 comprises a sequence that is at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 50. In one embodiment, the variant of SEQ ID NO: 50 comprises a sequence that is at least 50% identical to SEQ ID NO: 50. In one embodiment, the variant of SEQ ID NO: 50 comprises a sequence that is at least 60% identical to SEQ ID NO: 50. In one embodiment, the variant of SEQ ID NO: 50 comprises a sequence that is at least 70% identical to SEQ ID NO: 50. In one embodiment, the variant of SEQ ID NO: 50 comprises a sequence that is at least 80% identical to SEQ ID NO: 50. In one embodiment, the variant of SEQ ID NO: 50 comprises a sequence that is at least 90% identical to SEQ ID NO: 50. In one embodiment, a variant of SEQ ID NO:50 comprises a sequence that is at least 95% identical to SEQ ID NO:50. In one embodiment, a variant of SEQ ID NO:50 comprises a sequence that is at least 96% identical to SEQ ID NO:50. In one embodiment, a variant of SEQ ID NO:50 comprises a sequence that is at least 97% identical to SEQ ID NO:50. In one embodiment, a variant of SEQ ID NO:50 comprises a sequence that is at least 98% identical to SEQ ID NO:50. In one embodiment, a variant of SEQ ID NO:50 comprises a sequence that is at least 99% identical to SEQ ID NO:50.

[0145] In one embodiment, the 5′UTR comprises a variant of SEQ ID NO: 64. In one embodiment, the variant of SEQ ID NO: 64 comprises a sequence that is at least 64%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 64. In one embodiment, the variant of SEQ ID NO: 64 comprises a sequence that is at least 64% identical to SEQ ID NO: 64. In one embodiment, the variant of SEQ ID NO: 64 comprises a sequence that is at least 60% identical to SEQ ID NO: 64. In one embodiment, the variant of SEQ ID NO: 64 comprises a sequence that is at least 70% identical to SEQ ID NO: 64. In one embodiment, the variant of SEQ ID NO: 64 comprises a sequence that is at least 80% identical to SEQ ID NO: 64. In one embodiment, the variant of SEQ ID NO: 64 comprises a sequence that is at least 90% identical to SEQ ID NO: 64. In one embodiment, a variant of SEQ ID NO: 64 comprises a sequence that is at least 95% identical to SEQ ID NO: 64. In one embodiment, a variant of SEQ ID NO: 64 comprises a sequence that is at least 96% identical to SEQ ID NO: 64. In one embodiment, a variant of SEQ ID NO: 64 comprises a sequence that is at least 97% identical to SEQ ID NO: 64. In one embodiment, a variant of SEQ ID NO: 64 comprises a sequence that is at least 98% identical to SEQ ID NO: 64. In one embodiment, a variant of SEQ ID NO: 64 comprises a sequence that is at least 99% identical to SEQ ID NO: 64.

[0146] In one embodiment, the 5'UTR comprises a variant of SEQ ID NO: 55. In one embodiment, the variant of SEQ ID NO: 55 comprises a sequence that is at least 55%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 55. In one embodiment, the variant of SEQ ID NO: 55 comprises a sequence that is at least 55% identical to SEQ ID NO: 55. In one embodiment, the variant of SEQ ID NO: 55 comprises a sequence that is at least 60% identical to SEQ ID NO: 55. In one embodiment, the variant of SEQ ID NO: 55 comprises a sequence that is at least 70% identical to SEQ ID NO: 55. In one embodiment, the variant of SEQ ID NO: 55 comprises a sequence that is at least 80% identical to SEQ ID NO: 55. In one embodiment, the variant of SEQ ID NO: 55 comprises a sequence that is at least 90% identical to SEQ ID NO: 55. In one embodiment, a variant of SEQ ID NO:55 comprises a sequence that is at least 95% identical to SEQ ID NO:55. In one embodiment, a variant of SEQ ID NO:55 comprises a sequence that is at least 96% identical to SEQ ID NO:55. In one embodiment, a variant of SEQ ID NO:55 comprises a sequence that is at least 97% identical to SEQ ID NO:55. In one embodiment, a variant of SEQ ID NO:55 comprises a sequence that is at least 98% identical to SEQ ID NO:55. In one embodiment, a variant of SEQ ID NO:55 comprises a sequence that is at least 99% identical to SEQ ID NO:55.

[0147] In one embodiment, the 5′UTR comprises a variant of SEQ ID NO: 56. In one embodiment, the variant of SEQ ID NO: 56 comprises a sequence that is at least 56%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 56. In one embodiment, the variant of SEQ ID NO: 56 comprises a sequence that is at least 56% identical to SEQ ID NO: 56. In one embodiment, the variant of SEQ ID NO: 56 comprises a sequence that is at least 60% identical to SEQ ID NO: 56. In one embodiment, the variant of SEQ ID NO: 56 comprises a sequence that is at least 70% identical to SEQ ID NO: 56. In one embodiment, the variant of SEQ ID NO: 56 comprises a sequence that is at least 80% identical to SEQ ID NO: 56. In one embodiment, the variant of SEQ ID NO: 56 comprises a sequence that is at least 90% identical to SEQ ID NO: 56. In one embodiment, a variant of SEQ ID NO:56 comprises a sequence that is at least 95% identical to SEQ ID NO:56. In one embodiment, a variant of SEQ ID NO:56 comprises a sequence that is at least 96% identical to SEQ ID NO:56. In one embodiment, a variant of SEQ ID NO:56 comprises a sequence that is at least 97% identical to SEQ ID NO:56. In one embodiment, a variant of SEQ ID NO:56 comprises a sequence that is at least 98% identical to SEQ ID NO:56. In one embodiment, a variant of SEQ ID NO:56 comprises a sequence that is at least 99% identical to SEQ ID NO:56.

[0148] In one embodiment, the 5'UTR comprises a variant of SEQ ID NO: 58. In one embodiment, the variant of SEQ ID NO: 58 comprises a sequence that is at least 58%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 58. In one embodiment, the variant of SEQ ID NO: 58 comprises a sequence that is at least 58% identical to SEQ ID NO: 58. In one embodiment, the variant of SEQ ID NO: 58 comprises a sequence that is at least 60% identical to SEQ ID NO: 58. In one embodiment, the variant of SEQ ID NO: 58 comprises a sequence that is at least 70% identical to SEQ ID NO: 58. In one embodiment, the variant of SEQ ID NO: 58 comprises a sequence that is at least 80% identical to SEQ ID NO: 58. In one embodiment, the variant of SEQ ID NO: 58 comprises a sequence that is at least 90% identical to SEQ ID NO: 58. In one embodiment, a variant of SEQ ID NO:58 comprises a sequence that is at least 95% identical to SEQ ID NO:58. In one embodiment, a variant of SEQ ID NO:58 comprises a sequence that is at least 96% identical to SEQ ID NO:58. In one embodiment, a variant of SEQ ID NO:58 comprises a sequence that is at least 97% identical to SEQ ID NO:58. In one embodiment, a variant of SEQ ID NO:58 comprises a sequence that is at least 98% identical to SEQ ID NO:58. In one embodiment, a variant of SEQ ID NO:58 comprises a sequence that is at least 99% identical to SEQ ID NO:58.

[0149] In one embodiment, the 5′UTR comprises a variant of SEQ ID NO: 76. In one embodiment, the variant of SEQ ID NO: 76 comprises a sequence that is at least 76%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 76. In one embodiment, the variant of SEQ ID NO: 76 comprises a sequence that is at least 76% identical to SEQ ID NO: 76. In one embodiment, the variant of SEQ ID NO: 76 comprises a sequence that is at least 60% identical to SEQ ID NO: 76. In one embodiment, the variant of SEQ ID NO: 76 comprises a sequence that is at least 70% identical to SEQ ID NO: 76. In one embodiment, the variant of SEQ ID NO: 76 comprises a sequence that is at least 80% identical to SEQ ID NO: 76. In one embodiment, the variant of SEQ ID NO: 76 comprises a sequence that is at least 90% identical to SEQ ID NO: 76. In one embodiment, a variant of SEQ ID NO:76 comprises a sequence that is at least 95% identical to SEQ ID NO:76. In one embodiment, a variant of SEQ ID NO:76 comprises a sequence that is at least 96% identical to SEQ ID NO:76. In one embodiment, a variant of SEQ ID NO:76 comprises a sequence that is at least 97% identical to SEQ ID NO:76. In one embodiment, a variant of SEQ ID NO:76 comprises a sequence that is at least 98% identical to SEQ ID NO:76. In one embodiment, a variant of SEQ ID NO:76 comprises a sequence that is at least 99% identical to SEQ ID NO:76.

[0150] In one embodiment, the 5′UTR comprises a variant of SEQ ID NO: 78. In one embodiment, the variant of SEQ ID NO: 78 comprises a sequence that is at least 78%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 78. In one embodiment, the variant of SEQ ID NO: 78 comprises a sequence that is at least 78% identical to SEQ ID NO: 78. In one embodiment, the variant of SEQ ID NO: 78 comprises a sequence that is at least 60% identical to SEQ ID NO: 78. In one embodiment, the variant of SEQ ID NO: 78 comprises a sequence that is at least 70% identical to SEQ ID NO: 78. In one embodiment, the variant of SEQ ID NO: 78 comprises a sequence that is at least 80% identical to SEQ ID NO: 78. In one embodiment, the variant of SEQ ID NO: 78 comprises a sequence that is at least 90% identical to SEQ ID NO: 78. In one embodiment, a variant of SEQ ID NO:78 comprises a sequence that is at least 95% identical to SEQ ID NO:78. In one embodiment, a variant of SEQ ID NO:78 comprises a sequence that is at least 96% identical to SEQ ID NO:78. In one embodiment, a variant of SEQ ID NO:78 comprises a sequence that is at least 97% identical to SEQ ID NO:78. In one embodiment, a variant of SEQ ID NO:78 comprises a sequence that is at least 98% identical to SEQ ID NO:78. In one embodiment, a variant of SEQ ID NO:78 comprises a sequence that is at least 99% identical to SEQ ID NO:78.

[0151] In one embodiment, the variant of SEQ ID NO: 50 comprises at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70% or 80% uridine content. In one embodiment, the variant of SEQ ID NO: 50 comprises at least 5% uridine content. In one embodiment, the variant of SEQ ID NO: 50 comprises at least 10% uridine content. In one embodiment, the variant of SEQ ID NO: 50 comprises at least 20% uridine content. In one embodiment, the variant of SEQ ID NO: 50 comprises at least 30% uridine content. In one embodiment, the variant of SEQ ID NO: 50 comprises at least 40% uridine content. In one embodiment, the variant of SEQ ID NO: 50 comprises at least 50% uridine content. In one embodiment, the variant of SEQ ID NO: 50 comprises at least 60% uridine content. In one embodiment, the variant of SEQ ID NO: 50 comprises at least 70% uridine content. In one embodiment, the variant of SEQ ID NO: 50 comprises at least 80% uridine content.

[0152] In one embodiment, the variant of SEQ ID NO: 64 comprises a uridine content of at least 5%, 10%, 20%, 30%, 40%, 64%, 60%, 70% or 80%. In one embodiment, the variant of SEQ ID NO: 64 comprises a uridine content of at least 5%. In one embodiment, the variant of SEQ ID NO: 64 comprises a uridine content of at least 10%. In one embodiment, the variant of SEQ ID NO: 64 comprises a uridine content of at least 20%. In one embodiment, the variant of SEQ ID NO: 64 comprises a uridine content of at least 30%. In one embodiment, the variant of SEQ ID NO: 64 comprises a uridine content of at least 40%. In one embodiment, the variant of SEQ ID NO: 64 comprises a uridine content of at least 64%. In one embodiment, the variant of SEQ ID NO: 64 comprises a uridine content of at least 60%. In one embodiment, the variant of SEQ ID NO: 64 comprises a uridine content of at least 70%. In one embodiment, the variant of SEQ ID NO: 64 comprises a uridine content of at least 80%.

[0153] In one embodiment, the variant of SEQ ID NO: 55 comprises at least 5%, 10%, 20%, 30%, 40%, 55%, 60%, 70% or 80% uridine content. In one embodiment, the variant of SEQ ID NO: 55 comprises at least 5% uridine content. In one embodiment, the variant of SEQ ID NO: 55 comprises at least 10% uridine content. In one embodiment, the variant of SEQ ID NO: 55 comprises at least 20% uridine content. In one embodiment, the variant of SEQ ID NO: 55 comprises at least 30% uridine content. In one embodiment, the variant of SEQ ID NO: 55 comprises at least 40% uridine content. In one embodiment, the variant of SEQ ID NO: 55 comprises at least 55% uridine content. In one embodiment, the variant of SEQ ID NO: 55 comprises at least 60% uridine content. In one embodiment, the variant of SEQ ID NO: 55 comprises at least 70% uridine content. In one embodiment, the variant of SEQ ID NO: 55 comprises at least 80% uridine content.

[0154] In one embodiment, the variant of SEQ ID NO: 56 comprises a uridine content of at least 5%, 10%, 20%, 30%, 40%, 56%, 60%, 70% or 80%. In one embodiment, the variant of SEQ ID NO: 56 comprises a uridine content of at least 5%. In one embodiment, the variant of SEQ ID NO: 56 comprises a uridine content of at least 10%. In one embodiment, the variant of SEQ ID NO: 56 comprises a uridine content of at least 20%. In one embodiment, the variant of SEQ ID NO: 56 comprises a uridine content of at least 30%. In one embodiment, the variant of SEQ ID NO: 56 comprises a uridine content of at least 40%. In one embodiment, the variant of SEQ ID NO: 56 comprises a uridine content of at least 56%. In one embodiment, the variant of SEQ ID NO: 56 comprises a uridine content of at least 60%. In one embodiment, the variant of SEQ ID NO: 56 comprises a uridine content of at least 70%. In one embodiment, the variant of SEQ ID NO: 56 comprises a uridine content of at least 80%.

[0155] In one embodiment, the variant of SEQ ID NO: 58 comprises a uridine content of at least 5%, 10%, 20%, 30%, 40%, 58%, 60%, 70% or 80%. In one embodiment, the variant of SEQ ID NO: 58 comprises a uridine content of at least 5%. In one embodiment, the variant of SEQ ID NO: 58 comprises a uridine content of at least 10%. In one embodiment, the variant of SEQ ID NO: 58 comprises a uridine content of at least 20%. In one embodiment, the variant of SEQ ID NO: 58 comprises a uridine content of at least 30%. In one embodiment, the variant of SEQ ID NO: 58 comprises a uridine content of at least 40%. In one embodiment, the variant of SEQ ID NO: 58 comprises a uridine content of at least 58%. In one embodiment, the variant of SEQ ID NO: 58 comprises a uridine content of at least 60%. In one embodiment, the variant of SEQ ID NO: 58 comprises a uridine content of at least 70%. In one embodiment, the variant of SEQ ID NO: 58 comprises a uridine content of at least 80%.

[0156] In one embodiment, the variant of SEQ ID NO: 76 comprises a uridine content of at least 5%, 10%, 20%, 30%, 40%, 76%, 60%, 70% or 80%. In one embodiment, the variant of SEQ ID NO: 76 comprises a uridine content of at least 5%. In one embodiment, the variant of SEQ ID NO: 76 comprises a uridine content of at least 10%. In one embodiment, the variant of SEQ ID NO: 76 comprises a uridine content of at least 20%. In one embodiment, the variant of SEQ ID NO: 76 comprises a uridine content of at least 30%. In one embodiment, the variant of SEQ ID NO: 76 comprises a uridine content of at least 40%. In one embodiment, the variant of SEQ ID NO: 76 comprises a uridine content of at least 76%. In one embodiment, the variant of SEQ ID NO: 76 comprises a uridine content of at least 60%. In one embodiment, the variant of SEQ ID NO: 76 comprises a uridine content of at least 70%. In one embodiment, the variant of SEQ ID NO: 76 comprises a uridine content of at least 80%.

[0157] In one embodiment, the variant of SEQ ID NO: 78 comprises at least 5%, 10%, 20%, 30%, 40%, 78%, 60%, 70% or 80% uridine content. In one embodiment, the variant of SEQ ID NO: 78 comprises at least 5% uridine content. In one embodiment, the variant of SEQ ID NO: 78 comprises at least 10% uridine content. In one embodiment, the variant of SEQ ID NO: 78 comprises at least 20% uridine content. In one embodiment, the variant of SEQ ID NO: 78 comprises at least 30% uridine content. In one embodiment, the variant of SEQ ID NO: 78 comprises at least 40% uridine content. In one embodiment, the variant of SEQ ID NO: 78 comprises at least 78% uridine content. In one embodiment, the variant of SEQ ID NO: 78 comprises at least 60% uridine content. In one embodiment, the variant of SEQ ID NO: 78 comprises at least 70% uridine content. In one embodiment, the variant of SEQ ID NO: 78 comprises at least 80% uridine content.

[0158] In one embodiment, a variant of SEQ ID NO: 50 comprises at least 2, 3, 4, 5, 6, or 7 consecutive uridines (e.g., a polyuridine stretch). In one embodiment, a polyuridine stretch in a variant of SEQ ID NO: 50 comprises at least 1-7, 2-7, 3-7, 4-7, 5-7, 6-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-6, or 3-5 consecutive uridines. In one embodiment, a polyuridine stretch in a variant of SEQ ID NO: 50 comprises 4 consecutive uridines. In one embodiment, a polyuridine stretch in a variant of SEQ ID NO: 50 comprises 5 consecutive uridines.

[0159] In one embodiment, a variant of SEQ ID NO: 64 comprises at least 2, 3, 4, 5, 6, or 7 consecutive uridines (e.g., a polyuridine stretch). In one embodiment, a polyuridine stretch in a variant of SEQ ID NO: 64 comprises at least 1-7, 2-7, 3-7, 4-7, 5-7, 6-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-6, or 3-5 consecutive uridines. In one embodiment, a polyuridine stretch in a variant of SEQ ID NO: 64 comprises 4 consecutive uridines. In one embodiment, a polyuridine stretch in a variant of SEQ ID NO: 64 comprises 5 consecutive uridines.

[0160] In one embodiment, a variant of SEQ ID NO: 55 comprises at least 2, 3, 4, 5, 6, or 7 consecutive uridines (e.g., a polyuridine stretch). In one embodiment, a polyuridine stretch in a variant of SEQ ID NO: 55 comprises at least 1-7, 2-7, 3-7, 4-7, 5-7, 6-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-6, or 3-5 consecutive uridines. In one embodiment, a polyuridine stretch in a variant of SEQ ID NO: 55 comprises 4 consecutive uridines. In one embodiment, a polyuridine stretch in a variant of SEQ ID NO: 55 comprises 5 consecutive uridines.

[0161] In one embodiment, a variant of SEQ ID NO: 56 comprises at least 2, 3, 4, 5, 6, or 7 consecutive uridines (e.g., a polyuridine stretch). In one embodiment, a polyuridine stretch in a variant of SEQ ID NO: 56 comprises at least 1-7, 2-7, 3-7, 4-7, 5-7, 6-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-6, or 3-5 consecutive uridines. In one embodiment, a polyuridine stretch in a variant of SEQ ID NO: 56 comprises 4 consecutive uridines. In one embodiment, a polyuridine stretch in a variant of SEQ ID NO: 56 comprises 5 consecutive uridines.

[0162] In one embodiment, a variant of SEQ ID NO: 58 comprises at least 2, 3, 4, 5, 6, or 7 consecutive uridines (e.g., a polyuridine stretch). In one embodiment, a polyuridine stretch in a variant of SEQ ID NO: 58 comprises at least 1-7, 2-7, 3-7, 4-7, 5-7, 6-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-6, or 3-5 consecutive uridines. In one embodiment, a polyuridine stretch in a variant of SEQ ID NO: 58 comprises 4 consecutive uridines. In one embodiment, a polyuridine stretch in a variant of SEQ ID NO: 58 comprises 5 consecutive uridines.

[0163] In one embodiment, a variant of SEQ ID NO: 76 comprises at least 2, 3, 4, 5, 6, or 7 consecutive uridines (e.g., a polyuridine stretch). In one embodiment, a polyuridine stretch in a variant of SEQ ID NO: 76 comprises at least 1-7, 2-7, 3-7, 4-7, 5-7, 6-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-6, or 3-5 consecutive uridines. In one embodiment, a polyuridine stretch in a variant of SEQ ID NO: 76 comprises 4 consecutive uridines. In one embodiment, a polyuridine stretch in a variant of SEQ ID NO: 76 comprises 5 consecutive uridines.

[0164] In one embodiment, a variant of SEQ ID NO: 78 comprises at least 2, 3, 4, 5, 6, or 7 consecutive uridines (e.g., a polyuridine stretch). In one embodiment, a polyuridine stretch in a variant of SEQ ID NO: 78 comprises at least 1-7, 2-7, 3-7, 4-7, 5-7, 6-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-6, or 3-5 consecutive uridines. In one embodiment, a polyuridine stretch in a variant of SEQ ID NO: 78 comprises 4 consecutive uridines. In one embodiment, a polyuridine stretch in a variant of SEQ ID NO: 78 comprises 5 consecutive uridines.

[0165] In one embodiment, the variant of SEQ ID NO: 50 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 polyuridine stretches. In one embodiment, the variant of SEQ ID NO: 50 comprises 3 polyuridine stretches. In one embodiment, the variant of SEQ ID NO: 50 comprises 4 polyuridine stretches. In one embodiment, the variant of SEQ ID NO: 50 comprises 5 polyuridine stretches.

[0166] In one embodiment, the variant of SEQ ID NO: 64 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 polyuridine stretches. In one embodiment, the variant of SEQ ID NO: 64 comprises 3 polyuridine stretches. In one embodiment, the variant of SEQ ID NO: 64 comprises 4 polyuridine stretches. In one embodiment, the variant of SEQ ID NO: 64 comprises 5 polyuridine stretches.

[0167] In one embodiment, the variant of SEQ ID NO: 55 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 polyuridine stretches. In one embodiment, the variant of SEQ ID NO: 55 comprises 3 polyuridine stretches. In one embodiment, the variant of SEQ ID NO: 55 comprises 4 polyuridine stretches. In one embodiment, the variant of SEQ ID NO: 55 comprises 5 polyuridine stretches.

[0168] In one embodiment, the variant of SEQ ID NO: 56 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 polyuridine stretches. In one embodiment, the variant of SEQ ID NO: 56 comprises 3 polyuridine stretches. In one embodiment, the variant of SEQ ID NO: 56 comprises 4 polyuridine stretches. In one embodiment, the variant of SEQ ID NO: 56 comprises 5 polyuridine stretches.

[0169] In one embodiment, the variant of SEQ ID NO: 58 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 polyuridine stretches. In one embodiment, the variant of SEQ ID NO: 58 comprises 3 polyuridine stretches. In one embodiment, the variant of SEQ ID NO: 58 comprises 4 polyuridine stretches. In one embodiment, the variant of SEQ ID NO: 58 comprises 5 polyuridine stretches.

[0170] In one embodiment, the variant of SEQ ID NO: 76 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 polyuridine stretches. In one embodiment, the variant of SEQ ID NO: 76 comprises 3 polyuridine stretches. In one embodiment, the variant of SEQ ID NO: 76 comprises 4 polyuridine stretches. In one embodiment, the variant of SEQ ID NO: 76 comprises 5 polyuridine stretches.

[0171] In one embodiment, the variant of SEQ ID NO: 78 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 polyuridine stretches. In one embodiment, the variant of SEQ ID NO: 78 comprises 3 polyuridine stretches. In one embodiment, the variant of SEQ ID NO: 78 comprises 4 polyuridine stretches. In one embodiment, the variant of SEQ ID NO: 78 comprises 5 polyuridine stretches.

[0172] In one embodiment, one or more of the polyuridine stretches are adjacent to a different polyuridine stretch. In one embodiment, each, eg, all, of the polyuridine stretches are adjacent to each other, eg, the polyuridine stretches are all contiguous.

[0173] In one embodiment, one or more of the polyuridine stretches are separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, or 60 nucleotides. In one embodiment, each, e.g., all, of the polyuridine stretches are separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, or 60 nucleotides.

[0174] In one embodiment, the first polyuridine stretch and the second polyuridine stretch are adjacent to each other.

[0175] In one embodiment, a subsequent, e.g., third, fourth, fifth, sixth or seventh, eighth, ninth or tenth polyuridine stretch is separated from any of the first polyuridine stretch, the second polyuridine stretch or a subsequent polyuridine stretch by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50 or 60 nucleotides.

[0176] In one embodiment, a first polyuridine stretch is separated from a subsequent polyuridine stretch, e.g., a second, third, fourth, fifth, sixth or seventh, eighth, ninth or tenth polyuridine stretch, by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 2, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50 or 60 nucleotides. In one embodiment, one or more of the subsequent polyuridine stretches are adjacent to a different polyuridine stretch.

[0177] In one embodiment, the 5'UTR comprises a Kozak sequence, for example, a GCCRCC nucleotide sequence (SEQ ID NO: 79), wherein R is adenine or guanine. In one embodiment, the Kozak sequence is located at the 3' end of the 5'UTR sequence.

[0178] In one embodiment, a polynucleotide comprising a 5'UTR sequence disclosed herein comprises a coding region encoding a payload, such as a therapeutic or prophylactic payload.

[0179] In one aspect, the polynucleotides (e.g., mRNA) comprising a 5'UTR sequence disclosed herein are formulated into LNPs. In one embodiment, the LNP composition comprises: (i) an ionizable lipid, e.g., an amino lipid; (ii) a sterol or other structural lipid; (iii) a non-cationic auxiliary lipid or phospholipid; and (iv) a PEG-lipid.

[0180] In another aspect, the LNP compositions of the present disclosure are used in a method of treating a disease or disorder, or in a method of suppressing an immune response in a subject.

[0181] In one aspect, LNP compositions comprising a polynucleotide disclosed herein encoding a therapeutic payload or a prophylactic payload (eg, as described herein) can be administered with an additional agent (eg, as described herein).

[0182] b. Termination element + 3′UTR sequence

[0183] The translation termination codons UAA, UAG and UGA are important components of the genetic code and are signals for the termination of mRNA translation. During protein synthesis, the termination codon interacts with protein release factors and this interaction can regulate ribosome activity, thereby affecting translation (Tate WP et al., (2018) Biochem Soc Trans, 46(6): 1615-162).

[0184] The 3′ UTR sequence has been shown to affect the translation, half-life, and subcellular localization of mRNA (Mayr C., ColdSpring Harb Persp Biol 2019 Oct 1;11(10):a034728).

[0185] In particular, disclosed herein is a polynucleotide encoding a polypeptide having a combination of a termination element and a 3'UTR that confers increased half-life, increased expression, and / or increased activity to the polypeptide encoded by the polynucleotide or the polynucleotide itself. In one embodiment, the polynucleotide disclosed herein comprises: (a) a 5'-UTR; (b) a coding region; and (c) a termination element and a 3'-UTR (e.g., as described herein), and an LNP composition comprising the polynucleotide.

[0186] In particular, a polynucleotide encoding a polypeptide is disclosed herein, the polynucleotide particularly comprising a 3′UTR. In one embodiment, the polynucleotide disclosed herein comprises: (a) a 5′-UTR (e.g., as provided in Table 1 or a variant or fragment thereof); (b) a coding region; and (c) a termination element and a 3′-UTR (e.g., as provided in Table 2 or a variant or fragment thereof), and an LNP composition comprising the polynucleotide. In one embodiment, the polynucleotide comprises a 3′-UTR comprising a sequence provided in Table 2 or a variant or fragment thereof (e.g., a functional variant or fragment thereof). It will be understood that such 3′UTR is incorporated into a construct not found in nature, for example, such 3′UTR is synthetic, altered in sequence from a naturally occurring 3′UTR, is a truncated or elongated form of those found in nature, comprises chemically modified bases, is 3′ of an ORF sequence different from those that may be found in nature, and the like.

[0187] In one embodiment, the 3'UTR comprises a sequence provided in Table 2, or a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 3'UTR sequence provided in Table 2, or a variant or fragment thereof. In one embodiment, the 3'UTR comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147.

[0188] Table 2: 3′UTR sequences (stop box is italicized; miR binding site is bold)

[0189]

[0190]

[0191] In one embodiment, the polynucleotide comprises a termination element and a 3'-UTR, wherein the sequence is (termination element is italicized):

[0192] or a variant or fragment thereof (eg, a fragment lacking the initial one, two, three, four, five, six or more nucleotides of SEQ ID NO: 139).

[0193] In one embodiment, a polynucleotide having a 3′UTR sequence provided in SEQ ID NO: 139, or a variant or fragment thereof, increases the half-life of the polynucleotide, for example, the half-life of the polynucleotide increases by about 1.5-10 times. In one embodiment, the half-life increases by about 1.5, 2, 3, 4, 5, 6, 7, 8, 9 or 10 times or more. In one embodiment, the half-life increases by about 1.5 times or more. In one embodiment, the half-life increases by about 2 times or more. In one embodiment, the half-life increases by about 3 times or more. In one embodiment, the half-life increases by about 4 times or more. In one embodiment, the half-life increases by about 5 times or more. In one embodiment, the half-life increases by about 6 times or more. In one embodiment, the half-life increases by about 7 times or more. In one embodiment, the half-life increases by about 8 times. In one embodiment, the half-life increases by about 9 times or more. In one embodiment, the half-life increases by about 10 times or more.

[0194] In one embodiment, a polynucleotide having a 3'UTR sequence provided in SEQ ID NO: 139, or a variant or fragment thereof, results in increased level and / or activity (eg, output) of a polypeptide encoded by the polynucleotide.

[0195] In one embodiment, the increase is compared to an otherwise similar polynucleotide having no 3'UTR, having a different 3'UTR, or having no 3'UTR of SEQ ID NO: 139, or a variant or fragment thereof.

[0196] In one embodiment, the polynucleotide comprises the 3'UTR sequence provided in SEQ ID NO: 139, or a sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the 3'UTR sequence provided in SEQ ID NO: 139.

[0197] In one embodiment, the polynucleotide comprises a termination element and a 3'-UTR, wherein the sequence is (termination element is italicized):

[0198] or a variant or fragment thereof (eg, a fragment lacking the initial one, two, three, four, five, six or more nucleotides of SEQ ID NO: 140).

[0199] In one embodiment, a polynucleotide having a 3′UTR sequence provided in SEQ ID NO: 140, or a variant or fragment thereof, increases the half-life of the polynucleotide, for example, the half-life of the polynucleotide increases by about 1.5--10 times. In one embodiment, the half-life increases by about 1.5, 2, 3, 4, 5, 6, 7, 8, 9 or 10 times or more. In one embodiment, the half-life increases by about 1.5 times or more. In one embodiment, the half-life increases by about 2 times or more. In one embodiment, the half-life increases by about 3 times or more. In one embodiment, the half-life increases by about 4 times or more. In one embodiment, the half-life increases by about 5 times or more. In one embodiment, the half-life increases by about 6 times or more. In one embodiment, the half-life increases by about 7 times or more. In one embodiment, the half-life increases by about 8 times. In one embodiment, the half-life increases by about 9 times or more. In one embodiment, the half-life increases by about 10 times or more.

[0200] In one embodiment, a polynucleotide having a 3'UTR sequence provided in SEQ ID NO: 140, or a variant or fragment thereof, results in increased level and / or activity (eg, output) of a polypeptide encoded by the polynucleotide.

[0201] In one embodiment, the increase is compared to an otherwise similar polynucleotide having no 3'UTR, having a different 3'UTR, or having no 3'UTR of SEQ ID NO: 140, or a variant or fragment thereof.

[0202] In one embodiment, the polynucleotide comprises the 3'UTR sequence provided in SEQ ID NO: 140, or a sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the 3'UTR sequence provided in SEQ ID NO: 140.

[0203] In one embodiment, the polynucleotide comprises a termination element and a 3'-UTR, wherein the sequence is (termination element is italicized):

[0204] or a variant or fragment thereof (eg, a fragment lacking the initial one, two, three, four, five, six or more nucleotides of SEQ ID NO: 141).

[0205] In one embodiment, a polynucleotide having a 3′UTR sequence provided in SEQ ID NO: 141, or a variant or fragment thereof, increases the half-life of the polynucleotide, for example, the half-life of the polynucleotide increases by about 1.5-10 times. In one embodiment, the half-life increases by about 1.5, 2, 3, 4, 5, 6, 7, 8, 9 or 10 times or more. In one embodiment, the half-life increases by about 1.5 times or more. In one embodiment, the half-life increases by about 2 times or more. In one embodiment, the half-life increases by about 3 times or more. In one embodiment, the half-life increases by about 4 times or more. In one embodiment, the half-life increases by about 5 times or more. In one embodiment, the half-life increases by about 6 times or more. In one embodiment, the half-life increases by about 7 times or more. In one embodiment, the half-life increases by about 8 times. In one embodiment, the half-life increases by about 9 times or more. In one embodiment, the half-life increases by about 10 times or more.

[0206] In one embodiment, a polynucleotide having a 3'UTR sequence provided in SEQ ID NO: 141, or a variant or fragment thereof, results in increased level and / or activity (eg, output) of a polypeptide encoded by the polynucleotide.

[0207] In one embodiment, the increase is compared to an otherwise similar polynucleotide having no 3'UTR, having a different 3'UTR, or having no 3'UTR of SEQ ID NO: 141, or a variant or fragment thereof.

[0208] In one embodiment, the polynucleotide comprises the 3'UTR sequence provided in SEQ ID NO: 141, or a sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the 3'UTR sequence provided in SEQ ID NO: 141.

[0209] In one embodiment, the polynucleotide comprises a termination element and a 3'-UTR, wherein the sequence is (termination element is italicized):

[0210] GCGGC (SEQ ID NO: 142) or a variant or fragment thereof (eg, a fragment lacking the initial one, two, three, four, five, six or more nucleotides of SEQ ID NO: 142).

[0211] In one embodiment, a polynucleotide having a 3'UTR sequence provided in SEQ ID NO: 142, or a variant or fragment thereof, increases the half-life of the polynucleotide, for example, the half-life of the polynucleotide increases by about 1.5-10 times. In one embodiment, the half-life increases by about 1.5, 2, 3, 4, 5, 6, 7, 8, 9 or 10 times or more. In one embodiment, the half-life increases by about 1.5 times or more. In one embodiment, the half-life increases by about 2 times or more. In one embodiment, the half-life increases by about 3 times or more. In one embodiment, the half-life increases by about 4 times or more. In one embodiment, the half-life increases by about 5 times or more. In one embodiment, the half-life increases by about 6 times or more. In one embodiment, the half-life increases by about 7 times or more. In one embodiment, the half-life increases by about 8 times. In one embodiment, the half-life increases by about 9 times or more. In one embodiment, the half-life increases by about 10 times or more.

[0212] In one embodiment, a polynucleotide having a 3'UTR sequence provided in SEQ ID NO: 142, or a variant or fragment thereof, results in increased level and / or activity (eg, output) of a polypeptide encoded by the polynucleotide.

[0213] In one embodiment, the increase is compared to an otherwise similar polynucleotide having no 3'UTR, having a different 3'UTR, or having no 3'UTR of SEQ ID NO: 142, or a variant or fragment thereof.

[0214] In one embodiment, the polynucleotide comprises the 3'UTR sequence provided in SEQ ID NO: 142, or a sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the 3'UTR sequence provided in SEQ ID NO: 142.

[0215] In one embodiment, the polynucleotide comprises a termination element and a 3'-UTR, wherein the sequence is (termination element is italicized):

[0216] or a variant or fragment thereof (eg, a fragment lacking the initial one, two, three, four, five, six or more nucleotides of nucleotides of SEQ ID NO: 143).

[0217] In one embodiment, a polynucleotide having a 3′UTR sequence provided in SEQ ID NO: 143, or a variant or fragment thereof, increases the half-life of the polynucleotide, for example, the half-life of the polynucleotide increases by about 1.5-10 times. In one embodiment, the half-life increases by about 1.5, 2, 3, 4, 5, 6, 7, 8, 9 or 10 times or more. In one embodiment, the half-life increases by about 1.5 times or more. In one embodiment, the half-life increases by about 2 times or more. In one embodiment, the half-life increases by about 3 times or more. In one embodiment, the half-life increases by about 4 times or more. In one embodiment, the half-life increases by about 5 times or more. In one embodiment, the half-life increases by about 6 times or more. In one embodiment, the half-life increases by about 7 times or more. In one embodiment, the half-life increases by about 8 times. In one embodiment, the half-life increases by about 9 times or more. In one embodiment, the half-life increases by about 10 times or more.

[0218] In one embodiment, a polynucleotide having a 3'UTR sequence provided in SEQ ID NO: 143, or a variant or fragment thereof, results in increased level and / or activity (eg, output) of a polypeptide encoded by the polynucleotide.

[0219] In one embodiment, the increase is compared to an otherwise similar polynucleotide having no 3'UTR, having a different 3'UTR, or having no 3'UTR of SEQ ID NO: 143, or a variant or fragment thereof.

[0220] In one embodiment, the polynucleotide comprises the 3'UTR sequence provided in SEQ ID NO: 143, or a sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the 3'UTR sequence provided in SEQ ID NO: 143.

[0221] In one embodiment, the polynucleotide comprises a termination element and a 3'-UTR, wherein the sequence is (termination element is italicized):

[0222] or a variant or fragment thereof (eg, a fragment lacking the initial one, two, three, four, five, six or more nucleotides of SEQ ID NO: 144).

[0223] In one embodiment, a polynucleotide having a 3′UTR sequence provided in SEQ ID NO: 144, or a variant or fragment thereof, increases the half-life of the polynucleotide, for example, the half-life of the polynucleotide increases by about 1.5-10 times. In one embodiment, the half-life increases by about 1.5, 2, 3, 4, 5, 6, 7, 8, 9 or 10 times or more. In one embodiment, the half-life increases by about 1.5 times or more. In one embodiment, the half-life increases by about 2 times or more. In one embodiment, the half-life increases by about 3 times or more. In one embodiment, the half-life increases by about 4 times or more. In one embodiment, the half-life increases by about 5 times or more. In one embodiment, the half-life increases by about 6 times or more. In one embodiment, the half-life increases by about 7 times or more. In one embodiment, the half-life increases by about 8 times. In one embodiment, the half-life increases by about 9 times or more. In one embodiment, the half-life increases by about 10 times or more.

[0224] In one embodiment, a polynucleotide having a 3'UTR sequence provided in SEQ ID NO: 144, or a variant or fragment thereof, results in increased level and / or activity (eg, output) of a polypeptide encoded by the polynucleotide.

[0225] In one embodiment, the increase is compared to an otherwise similar polynucleotide having no 3'UTR, having a different 3'UTR, or having no 3'UTR of SEQ ID NO: 144, or a variant or fragment thereof.

[0226] In one embodiment, the polynucleotide comprises the 3'UTR sequence provided in SEQ ID NO: 144, or a sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the 3'UTR sequence provided in SEQ ID NO: 144.

[0227] In one embodiment, the polynucleotide comprises a termination element and a 3'-UTR, wherein the sequence is (termination element is italicized):

[0228] or a variant or fragment thereof (eg, a fragment lacking the initial one, two, three, four, five, six or more nucleotides of SEQ ID NO: 145).

[0229] In one embodiment, a polynucleotide having a 3'UTR sequence provided in SEQ ID NO: 145, or a variant or fragment thereof, increases the half-life of the polynucleotide, for example, the half-life of the polynucleotide increases by about 1.5-10 times. In one embodiment, the half-life increases by about 1.5, 2, 3, 4, 5, 6, 7, 8, 9 or 10 times or more. In one embodiment, the half-life increases by about 1.5 times or more. In one embodiment, the half-life increases by about 2 times or more. In one embodiment, the half-life increases by about 3 times or more. In one embodiment, the half-life increases by about 4 times or more. In one embodiment, the half-life increases by about 5 times or more. In one embodiment, the half-life increases by about 6 times or more. In one embodiment, the half-life increases by about 7 times or more. In one embodiment, the half-life increases by about 8 times. In one embodiment, the half-life increases by about 9 times or more. In one embodiment, the half-life increases by about 10 times or more.

[0230] In one embodiment, a polynucleotide having a 3'UTR sequence provided in SEQ ID NO: 145, or a variant or fragment thereof, results in increased level and / or activity (eg, output) of a polypeptide encoded by the polynucleotide.

[0231] In one embodiment, the increase is compared to an otherwise similar polynucleotide having no 3'UTR, having a different 3'UTR, or having no 3'UTR of SEQ ID NO: 145, or a variant or fragment thereof.

[0232] In one embodiment, the polynucleotide comprises the 3'UTR sequence provided in SEQ ID NO: 145, or a sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the 3'UTR sequence provided in SEQ ID NO: 145.

[0233] In one embodiment, the polynucleotide comprises a termination element and a 3'-UTR, wherein the sequence is (termination element is italicized):

[0234] or a variant or fragment thereof (eg, a fragment lacking the initial one, two, three, four, five, six or more nucleotides of nucleotides of SEQ ID NO: 146).

[0235] In one embodiment, a polynucleotide having a 3′UTR sequence provided in SEQ ID NO: 1 46, or a variant or fragment thereof, increases the half-life of the polynucleotide, for example, the half-life of the polynucleotide increases by about 1.5-10 times. In one embodiment, the half-life increases by about 1.5, 2, 3, 4, 5, 6, 7, 8, 9 or 10 times or more. In one embodiment, the half-life increases by about 1.5 times or more. In one embodiment, the half-life increases by about 2 times or more. In one embodiment, the half-life increases by about 3 times or more. In one embodiment, the half-life increases by about 4 times or more. In one embodiment, the half-life increases by about 5 times or more. In one embodiment, the half-life increases by about 6 times or more. In one embodiment, the half-life increases by about 7 times or more. In one embodiment, the half-life increases by about 8 times. In one embodiment, the half-life increases by about 9 times or more. In one embodiment, the half-life increases by about 10 times or more.

[0236] In one embodiment, a polynucleotide having a 3'UTR sequence provided in SEQ ID NO: 146, or a variant or fragment thereof, results in increased level and / or activity (eg, output) of a polypeptide encoded by the polynucleotide.

[0237] In one embodiment, the increase is compared to an otherwise similar polynucleotide having no 3'UTR, having a different 3'UTR, or having no 3'UTR of SEQ ID NO: 146, or a variant or fragment thereof.

[0238] In one embodiment, the polynucleotide comprises the 3'UTR sequence provided in SEQ ID NO: 146, or a sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the 3'UTR sequence provided in SEQ ID NO: 146.

[0239] In one embodiment, the polynucleotide comprises a termination element and a 3'-UTR, wherein the sequence is (termination element is italicized):

[0240] or a variant or fragment thereof (eg, a fragment lacking the initial one, two, three, four, five, six or more nucleotides of SEQ ID NO: 147).

[0241] In one embodiment, a polynucleotide having a 3'UTR sequence provided in SEQ ID NO: 147, or a variant or fragment thereof, increases the half-life of the polynucleotide, for example, the half-life of the polynucleotide increases by about 1.5-10 times. In one embodiment, the half-life increases by about 1.5, 2, 3, 4, 5, 6, 7, 8, 9 or 10 times or more. In one embodiment, the half-life increases by about 1.5 times or more. In one embodiment, the half-life increases by about 2 times or more. In one embodiment, the half-life increases by about 3 times or more. In one embodiment, the half-life increases by about 4 times or more. In one embodiment, the half-life increases by about 5 times or more. In one embodiment, the half-life increases by about 6 times or more. In one embodiment, the half-life increases by about 7 times or more. In one embodiment, the half-life increases by about 8 times. In one embodiment, the half-life increases by about 9 times or more. In one embodiment, the half-life increases by about 10 times or more.

[0242] In one embodiment, a polynucleotide having a 3'UTR sequence provided in SEQ ID NO: 147, or a variant or fragment thereof, results in increased level and / or activity (eg, output) of a polypeptide encoded by the polynucleotide.

[0243] In one embodiment, the increase is compared to an otherwise similar polynucleotide having no 3'UTR, having a different 3'UTR, or having no 3'UTR of SEQ ID NO: 147, or a variant or fragment thereof.

[0244] In one embodiment, the polynucleotide comprises the 3'UTR sequence provided in SEQ ID NO: 147, or a sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the 3'UTR sequence provided in SEQ ID NO: 147.

[0245] 2.3′ stable region

[0246] In particular, a polynucleotide encoding a polypeptide is disclosed herein, wherein the polynucleotide comprises: (a) a 5′-UTR (e.g., as described herein); (b) a coding region comprising a termination element (e.g., as described herein); (c) a 3′-UTR (e.g., as described herein); and (d) a 3′ stabilizing region. Also disclosed herein is an LNP composition comprising the polynucleotide.

[0247] In one embodiment, the polynucleotide comprises a 3' stabilizing region, such as a stabilizing tail, e.g., as described herein. Polynucleotides containing a 3'-stabilizing region (e.g., a 3'-stabilizing region comprising alternative nucleobases, sugars and / or backbones) may be particularly effective for use in therapeutic compositions because they may benefit from increased stability, high expression levels.

[0248] In one embodiment, the 3' stabilizing region comprises a poly A tail, e.g., a poly A tail comprising 80-150, e.g., 120 adenines (SEQ ID NO: 123). In one embodiment, the poly A tail comprises one or more non-adenosine residues, e.g., one or more guanosines, e.g., as described herein. In one embodiment, the poly A tail comprises the UCUAG sequence (SEQ ID NO: 44). In one embodiment, the poly A tail comprises about 80-120, e.g., 100 adenines upstream of SEQ ID NO: 44. In one embodiment, the poly A tail comprises about 1-40, e.g., 20 adenines downstream of SEQ ID NO: 44.

[0249] In one embodiment, the 3' stabilizing region comprises at least one alternative nucleoside. In one embodiment, the alternative nucleoside is an inverted thymidine (idT). In one embodiment, the alternative nucleoside is located at the 3' end of the 3' stabilizing region.

[0250] In one embodiment, the 3' stabilizing region comprises the structure of Formula VII:

[0251]

[0252] or a salt thereof, wherein each X is independently O or S, and A represents adenine and T represents thymine.

[0253] In one aspect, disclosed herein is a polynucleotide encoding a polypeptide, wherein the polynucleotide comprises: (a) a 5'-UTR, e.g., as described herein; (b) a coding region comprising a termination element (e.g., as described herein); (c) a 3'-UTR (e.g., as described herein); and (d) a 3' stabilizing region, e.g., as described herein.

[0254] In one aspect, LNP compositions comprising a polynucleotide comprising a stabilizing region disclosed herein comprise: (i) an ionizable lipid, e.g., an amino lipid; (ii) a sterol or other structured lipid; (iii) a non-cationic helper lipid or phospholipid; and (iv) a PEG-lipid.

[0255] In another aspect, the LNP compositions of the present disclosure are used in a method of treating a disease or disorder, or in a method of suppressing an immune response in a subject.

[0256] In one aspect, LNP compositions comprising a polynucleotide disclosed herein encoding a therapeutic payload or a prophylactic payload (eg, as described herein) can be administered with an additional agent (eg, as described herein).

[0257] 3. MicroRNA (miRNA) binding sites

[0258] Nucleic acid molecules (e.g., RNA, e.g., mRNA) of the present disclosure can include regulatory elements, e.g., microRNA (miRNA) binding sites, transcription factor binding sites, structured mRNA sequences and / or motifs, artificial binding sites engineered to act as pseudo-receptors for endogenous nucleic acid binding molecules, and combinations thereof.

[0259] In some embodiments, the nucleic acid molecules (e.g., RNA, e.g., mRNA) of the present disclosure comprise an open reading frame (ORF) encoding a polypeptide of interest and further comprise one or more miRNA binding sites. Based on the tissue-specific and / or cell-type-specific expression of naturally occurring miRNAs, the inclusion or incorporation of one or more miRNA binding sites provides regulation of the nucleic acid molecules (e.g., RNA, e.g., mRNA) of the present disclosure, thereby providing regulation of the polypeptide encoded therefrom.

[0260] MiRNA, such as naturally occurring miRNA, is a non-coding RNA of 19-25 nucleotides in length, which binds to a nucleic acid molecule (e.g., RNA, such as mRNA) and downregulates gene expression by reducing the stability of a polynucleotide or by inhibiting its translation. The miRNA sequence comprises a "seed" region, i.e., a sequence in the region of position 2-8 of a mature miRNA. The miRNA seed may comprise position 2-8 or 2-7 of a mature miRNA. In some embodiments, the miRNA seed may comprise 7 nucleotides (e.g., nucleotides 2-8 of a mature miRNA), wherein the seed complementary site in the corresponding miRNA binding site is flanked by an adenosine (A) relative to miRNA position 1. In some embodiments, the miRNA seed may comprise 6 nucleotides (e.g., nucleotides 2-7 of a mature miRNA), wherein the seed complementary site in the corresponding miRNA binding site is flanked by an adenosine (A) relative to miRNA position 1. See, e.g., Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP, Bartel DP; Mol Cell. 2007 Jul 6; 27(1): 91-105. The miRNA of a target cell or tissue can be profiled to determine the presence or absence of the miRNA in the cell or tissue. In some embodiments, the nucleic acid molecules (e.g., RNA, e.g., mRNA) of the present disclosure comprise one or more microRNA binding sites, microRNA target sequences, microRNA complementary sequences, or microRNA seed complementary sequences. Such sequences may correspond to any known microRNA, such as those taught in U.S. Publication US2005 / 0261218 and U.S. Publication US2005 / 0059005, for example, having complementarity with the microRNA, the contents of each of which are incorporated herein by reference in their entirety.

[0261] As used herein, the term "microRNA (miRNA or miR) binding site" refers to a sequence within a nucleic acid molecule (e.g., within a DNA or within an RNA transcript, including in a 5'UTR and / or 3'UTR) that has sufficient complementarity to interact, associate or bind with the entire miRNA or a region thereof. In some embodiments, a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the present disclosure comprises an ORF encoding a polypeptide of interest and further comprises one or more miRNA binding sites. In an exemplary embodiment, the 5'UTR and / or 3'UTR of a nucleic acid molecule (e.g., RNA, e.g., mRNA) comprises one or more miRNA binding sites.

[0262] The miRNA binding site with sufficient complementarity to the miRNA refers to a degree of complementarity sufficient to promote miRNA-mediated nucleic acid molecule (e.g., RNA, such as mRNA) regulation, for example, miRNA-mediated translational inhibition or degradation of nucleic acid molecules (e.g., RNA, such as mRNA). In exemplary aspects of the present disclosure, the miRNA binding site with sufficient complementarity to the miRNA refers to a degree of complementarity sufficient to promote miRNA-mediated nucleic acid molecule (e.g., RNA, such as mRNA) degradation, for example, miRNA-guided RNA-induced silencing complex (RISC)-mediated mRNA cleavage. The miRNA binding site may have complementarity with, for example, a miRNA sequence of 19-25 nucleotides, a miRNA sequence of 19-23 nucleotides, or a miRNA sequence of 22 nucleotides. The miRNA binding site may be complementary to only a portion of the miRNA, for example, a portion of less than 1, 2, 3, or 4 nucleotides of the full length of a naturally occurring miRNA sequence. When the desired regulation is mRNA degradation, sufficient or complete complementarity (e.g., sufficient complementarity or complete complementarity over all or most of the length of a naturally occurring miRNA) is preferred.

[0263] In some embodiments, the miRNA binding site includes a sequence that has complementarity (e.g., partial or complete complementarity) with a miRNA seed sequence. In some embodiments, the miRNA binding site includes a sequence that has complete complementarity with a miRNA seed sequence. In some embodiments, the miRNA binding site includes a sequence that has complementarity (e.g., partial or complete complementarity) with a miRNA sequence. In some embodiments, the miRNA binding site includes a sequence that has complete complementarity with a miRNA sequence. In some embodiments, the miRNA binding site has complete complementarity with the miRNA sequence, but has 1, 2 or 3 nucleotide substitutions, terminal additions and / or truncations.

[0264] In some embodiments, the length of the miRNA binding site is the same as that of the corresponding miRNA. In other embodiments, at 5' end, 3' end or both ends, the miRNA binding site is one, two, three, four, five, six, seven, eight, nine, ten, eleven or twelve nucleotides shorter than the corresponding miRNA. In other embodiments, at 5' end, 3' end or both ends, the microRNA binding site is two nucleotides shorter than the corresponding microRNA. The miRNA binding site shorter than the corresponding miRNA can still degrade the mRNA incorporated into one or more miRNA binding sites or prevent mRNA translation.

[0265] In some embodiments, the miRNA binding site binds to the corresponding mature miRNA, which is a part of the active RISC containing Dicer. In another embodiment, the combination of the miRNA binding site and the corresponding miRNA in RISC degrades the mRNA containing the miRNA binding site or prevents mRNA translation. In some embodiments, the miRNA binding site has sufficient complementarity with the miRNA, so that the RISC complex comprising the miRNA causes the nucleic acid molecule (e.g., RNA, such as mRNA) comprising the miRNA binding site to be cracked. In other embodiments, the miRNA binding site has imperfect complementarity, so that the RISC complex comprising the miRNA induces instability in the nucleic acid molecule (e.g., RNA, such as mRNA) comprising the miRNA binding site. In another embodiment, the miRNA binding site has imperfect complementarity, so that the RISC complex comprising the miRNA suppresses the transcription of the nucleic acid molecule (e.g., RNA, such as mRNA) comprising the miRNA binding site.

[0266] In some embodiments, the miRNA binding site has one, two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve mismatches with the corresponding miRNA. In some embodiments, the miRNA binding site has at least about ten, at least about eleven, at least about twelve, at least about thirteen, at least about fourteen, at least about fifteen, at least about sixteen, at least about seventeen, at least about eighteen, at least about nineteen, at least about twenty, or at least about twenty-one consecutive nucleotides that are complementary to at least about ten, at least about eleven, at least about twelve, at least about thirteen, at least about fourteen, at least about fifteen, at least about sixteen, at least about seventeen, at least about eighteen, at least about nineteen, at least about twenty, or at least about twenty-one consecutive nucleotides of the corresponding miRNA, respectively.

[0267] By engineering one or more miRNA binding sites into the nucleic acid molecules (e.g., RNA, e.g., mRNA) of the present disclosure, the nucleic acid molecules (e.g., RNA, e.g., mRNA) can be targeted for degradation or reduced translation, provided that the miRNA in question is available. This can reduce off-target effects during delivery of nucleic acid molecules (e.g., RNA, e.g., mRNA). For example, if the nucleic acid molecules (e.g., RNA, e.g., mRNA) of the present disclosure are not intended to be delivered to a tissue or cell, but terminate in the tissue or cell, then if one or more binding sites of the miRNA are engineered into the 5′UTR and / or 3′UTR of the nucleic acid molecules (e.g., RNA, e.g., mRNA), the miRNAs abundant in the tissue or cell can inhibit the expression of the gene of interest.

[0268] For example, one skilled in the art will appreciate that one or more miR binding sites can be included in nucleic acid molecules (e.g., RNA, e.g., mRNA) to minimize expression in cell types other than lymphoid cells. In one embodiment, the miR122 binding site can be used. In another embodiment, the miR126 binding site can be used. In yet another embodiment, multiple copies of these miR binding sites or combinations can be used.

[0269] Conversely, miRNA binding sites can be removed from nucleic acid molecules (e.g., RNA, e.g., mRNA) sequences in which these binding sites naturally occur to increase protein expression in specific tissues. For example, binding sites for specific miRNAs can be removed from nucleic acid molecules (e.g., RNA, e.g., mRNA) to improve protein expression in tissues or cells containing the miRNA.

[0270] Regulation of expression in various tissues can be achieved by introducing or removing one or more miRNA binding sites, such as one or more different miRNA binding sites. It can be determined whether to remove or insert miRNA binding sites based on miRNA expression patterns and / or spectrum analysis in tissues and / or cells in development and / or disease. The identification of miRNAs, miRNA binding sites, and their expression patterns and roles in biology have been reported (e.g., Bonauer et al., Curr Drug Targets 2010 11:943-949; Anand and Cheresh Curr Opin Hematol 2011 18:171-176; Contreras and Rao Leukemia 2012 26:404-413 (Dec. 20, 2011. doi:10.1038 / leu.2011.356); Bartel Cell 2009 136:215-233; Landgraf et al., Cell, 2007 129:1401-1414; Gentner and Naldini, Tissue Antigens. 2012 80:393-403 and all references therein; each of which is incorporated herein by reference in its entirety).

[0271] The miRNA and miRNA binding sites can correspond to any known sequence, including the non-limiting examples described in U.S. Publication Nos. 2014 / 0200261, 2005 / 0261218, and 2005 / 0059005, each of which is herein incorporated by reference in its entirety.

[0272] Examples of tissues in which miRNAs are known to regulate mRNA and thereby protein expression include, but are not limited to, liver (miR-122), muscle (miR-133, miR-206, miR-208), endothelial cells (miR-17-92, miR-126), bone marrow cells (miR-142-3p, miR-142-5p, miR-16, miR-21, miR-223, miR-24, miR-27), adipose tissue (1et-7, miR-30c), heart (miR-1d, miR-149), kidney (miR-192, miR-194, miR-204), and lung epithelial cells (1et-7, miR-133, miR-126).

[0273] Specifically, miRNAs are known to be differentially expressed in immune cells (also called hematopoietic cells), such as antigen presenting cells (APCs) (e.g., dendritic cells and monocytes), monocytes, mononuclear cells, B lymphocytes, T lymphocytes, granulocytes, natural killer cells, etc. Immune cell-specific miRNAs are involved in immunogenicity, autoimmunity, immune responses to infection, inflammation, and unwanted immune responses following gene therapy and tissue / organ transplantation. Immune cell-specific miRNAs also regulate many aspects of the development, proliferation, differentiation, and apoptosis of hematopoietic cells (immune cells). For example, miR-142 and miR-146 are only expressed in immune cells, especially in myeloid dendritic cells. It has been demonstrated that immune responses to nucleic acid molecules (e.g., RNA, such as mRNA) can be turned off by adding a miR-142 binding site to the 3′-UTR of a polynucleotide, enabling more stable gene transfer in tissues and cells. miR-142 effectively degrades exogenous nucleic acid molecules (e.g., RNA, such as mRNA) in antigen-presenting cells and inhibits cytotoxic elimination of transduced cells (e.g., Annoni A et al., blood, 2009, 114, 5152-5161; Brown BD et al., Nat med. 2006, 12(5), 585-591; Brown BD et al., blood, 2007, 110(13): 4144-4152, each of which is incorporated herein by reference in its entirety).

[0274] Antigen-mediated immune responses can refer to immune responses triggered by foreign antigens that are processed by antigen-presenting cells when they enter the organism and are presented on the surface of antigen-presenting cells. T cells can recognize the presented antigens and induce cytotoxic elimination of cells expressing the antigens.

[0275] Introducing miR-142 binding sites into the 5'UTR and / or 3'UTR of the nucleic acid molecules of the present disclosure can selectively inhibit gene expression in antigen presenting cells through miR-142-mediated degradation, thereby limiting antigen presentation in antigen presenting cells (e.g., dendritic cells) and thereby preventing the appearance of antigen-mediated immune responses after delivery of nucleic acid molecules (e.g., RNA, e.g., mRNA). The nucleic acid molecules (e.g., RNA, e.g., mRNA) are then stably expressed in target tissues or cells without triggering cytotoxic elimination.

[0276] In one embodiment, the binding site of miRNA known to be expressed in immune cells, especially antigen presenting cells, can be engineered into the nucleic acid molecules (e.g., RNA, e.g., mRNA) of the present invention to inhibit the expression of nucleic acid molecules (e.g., RNA, e.g., mRNA) in antigen presenting cells by miRNA-mediated RNA degradation, thereby inhibiting antigen-mediated immune responses. Nucleic acid molecules (e.g., RNA, e.g., mRNA) are maintained in non-immune cells in which immune cell-specific miRNAs are not expressed. For example, in some embodiments, in order to prevent immunogenic responses to liver-specific proteins, any miR-122 binding sites can be removed and miR-142 (and / or mirR-146) binding sites can be engineered into the 5'UTR and / or 3'UTR of the nucleic acid molecules of the present invention.

[0277] To further drive selective degradation and inhibition in APCs and macrophages, the nucleic acid molecules (e.g., RNA, e.g., mRNA) disclosed herein can include another negative regulatory element in the 5'UTR and / or 3'UTR, alone or in combination with miR-142 and / or miR-146 binding sites. As a non-limiting example, another negative regulatory element is a constitutive attenuation element (CDE).

[0278] Immune cell-specific miRNAs include but are not limited to hsa-let-7a-2-3p, hsa-let-7a-3p, hsa-7a-5p, hsa-let-7c, hsa-let-7e-3p, hsa-let-7e-5p, hsa-1et-7g-3p, hsa-let-7g-5p, hsa-let-7i-3p, hsa-let-7i-5p, miR-10a-3p, miR-10a-5p, miR-1184, hsa-let-7f-1--3p, hsa-let-7f-2--5p, hsa-let-7f-5p, miR-125b-1-3p, miR-125b-2-3p, miR-125b-5p, miR-1279, miR-130a-3p, miR-130a-5p, miR-132-3p, miR-132-5p, miR-142-3p, miR-142-5p, miR-143-3p, miR-143-5p, miR-146a-3p, miR-146a-5p, miR-146b-3p, miR-146b-5p, miR-147a, miR-147b, miR-148a-5p, miR-148a-3p, miR-150-3p, miR-150-5p, miR-151b, miR-155-3p, miR-155-5p, miR-15a-3p, miR-15a-5p, miR-15b-5p, miR-15b-3p, miR-16-1-3p, miR-16-2-3p, miR-16-5p, miR-17-5p, miR-181a-3p, miR-181a-5p, miR-181a-2-3p, miR-182-3p, miR-182-5p, miR-197-3p, miR-197-5p, miR-21-5p, miR-21-3p, miR-214-3p, miR-214-5p, miR-223-3p, miR-223-5p, miR-221-3p, miR-221-5p, miR-23b-3p, miR-23b-5p, miR-24-1-5p, miR-24-2-5p, miR-24-3p, miR-26a-1-3p, miR-26a-2-3p, miR-26a-5p, miR-26b-3p, miR-26b-5p, miR-27a-3p, miR-27a-5p, miR-27b-3p, miR-27b-5p, miR-28-3p, miR-28-5p, miR-2909, miR-29a-3p, miR-29a-5p, miR-29b-1-5p,miR-29b-2-5p,miR-29c-3p,miR-29c-5p,miR-30e-3p,miR-30e-5p,miR-331-5p,miR-339-3p,miR-339-5 p,miR-345-3p,miR-345-5p,miR-346,miR-34a-3p,miR-34a-5p,miR-363-3p,miR-363-5p,miR-372,miR- 377-3p,miR-377-5p,miR-493-3p,miR-493-5p,miR-542,miR-548b-5p,miR548c-5p,miR-548i,miR-548j ,miR-548n,miR-574-3p,miR-598,miR-718,miR-935,miR-99a-3p,miR-99a-5p,miR-99b-3p and miR-99b-5p. In addition, novel miRNAs can be identified in immune cells by microarray hybridization and slicer analysis (e.g., Jima DD et al., Blood, 2010, 116:el18-el27; Vaz C et al., BMC Genomics, 2010, 11, 288, the contents of each of which are incorporated herein by reference in their entirety).

[0279] In some embodiments, a miRNA binding site is inserted into a nucleic acid molecule (e.g., RNA, e.g., mRNA) of the present disclosure at any position (e.g., 5′UTR and / or 3′UTR) of a nucleic acid molecule (e.g., RNA, e.g., mRNA). In some embodiments, the 5′UTR comprises a miRNA binding site. In some embodiments, the 3′UTR comprises a miRNA binding site. In some embodiments, the 5′UTR and the 3′UTR comprise miRNA binding sites. The insertion site in a nucleic acid molecule (e.g., RNA, e.g., mRNA) can be at any position in a nucleic acid molecule (e.g., RNA, e.g., mRNA), as long as, in the absence of a corresponding miRNA, the insertion of a miRNA binding site in a nucleic acid molecule (e.g., RNA, e.g., mRNA) does not interfere with the translation of a functional polypeptide; and in the presence of a miRNA, the insertion of a miRNA binding site in a nucleic acid molecule (e.g., RNA, e.g., mRNA) and the binding of the miRNA binding site to the corresponding miRNA can degrade a polynucleotide or prevent the translation of a nucleic acid molecule (e.g., RNA, e.g., mRNA).

[0280] In some embodiments, the miRNA binding site is inserted into at least about 30 nucleotides downstream of the stop codon of the ORF in a nucleic acid molecule (e.g., RNA, e.g., mRNA) comprising an ORF of the present disclosure. In some embodiments, the miRNA binding site is inserted into at least about 10 nucleotides, at least about 15 nucleotides, at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, at least about 35 nucleotides, at least about 40 nucleotides, at least about 45 nucleotides, at least about 50 nucleotides, at least about 55 nucleotides, at least about 60 nucleotides, at least about 65 nucleotides, at least about 70 nucleotides, at least about 75 nucleotides, at least about 80 nucleotides, at least about 85 nucleotides, at least about 90 nucleotides, at least about 95 nucleotides, or at least about 100 nucleotides downstream of the stop codon of the ORF in the polynucleotides of the present disclosure. In some embodiments, the miRNA binding site is inserted into the nucleic acid molecule (e.g., RNA, e.g., mRNA) of the present disclosure within about 10 nucleotides to about 100 nucleotides, about 20 nucleotides to about 90 nucleotides, about 30 nucleotides to about 80 nucleotides, about 40 nucleotides to about 70 nucleotides, about 50 nucleotides to about 60 nucleotides, about 45 nucleotides to about 65 nucleotides downstream of the stop codon of the ORF.

[0281] miRNA gene regulation may be affected by the sequences surrounding the miRNA, such as, but not limited to, the species of the surrounding sequences, the type of sequence (e.g., heterologous, homologous, exogenous, endogenous, or artificial), regulatory elements in the surrounding sequences, and / or structural elements in the surrounding sequences. miRNA may be affected by 5′UTR and / or 3′UTR. As a non-limiting example, a non-human 3′UTR may increase the regulatory effect of a miRNA sequence on the expression of a polypeptide of interest compared to a human 3′UTR of the same sequence type.

[0282] In one embodiment, other regulatory elements and / or structural elements of the 5'UTR may affect miRNA-mediated gene regulation. An example of a regulatory element and / or structural element is a structured IRES (internal ribosome entry site) in the 5'UTR, which is necessary for binding translation elongation factors to initiate protein translation. The binding of EIF4A2 to this secondary structural element in the 5'-UTR is necessary for miRNA-mediated gene expression (Meijer HA et al., Science, 2013, 340, 82-85, incorporated herein by reference in its entirety). The nucleic acid molecules (e.g., RNA, e.g., mRNA) disclosed herein may also include this structured 5'UTR to enhance microRNA-mediated gene regulation.

[0283] At least one miRNA binding site can be engineered into the 3'UTR of the polynucleotide of the present disclosure. In this case, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten or more miRNA binding sites can be engineered into the 3'UTR of the nucleic acid molecule (e.g., RNA, such as mRNA) of the present disclosure. For example, 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2 or 1 miRNA binding site can be engineered into the 3'UTR of the nucleic acid molecule (e.g., RNA, such as mRNA) of the present disclosure. In one embodiment, the miRNA binding site incorporated into the nucleic acid molecule (e.g., RNA, such as mRNA) of the present disclosure can be the same or can be different miRNA sites. The combination of different miRNA binding sites incorporated into the nucleic acid molecule (e.g., RNA, such as mRNA) of the present disclosure can include a combination in which more than one copy of any one of the different miRNA sites is incorporated. In another embodiment, the miRNA binding site incorporated into the nucleic acid molecules (e.g., RNA, e.g., mRNA) of the present disclosure can target the same or different tissues in vivo. As a non-limiting example, by introducing tissue, cell type or disease specific miRNA binding sites in the 3'-UTR of the nucleic acid molecules (e.g., RNA, e.g., mRNA) of the present disclosure, the expression level in a specific cell type (e.g., hepatocytes, bone marrow cells, endothelial cells, cancer cells, etc.) can be reduced.

[0284] In one embodiment, the miRNA binding site can be engineered near the 5' end of the 3'UTR in the nucleic acid molecule (e.g., RNA, e.g., mRNA) disclosed herein, about halfway between the 5' end and the 3' end of the 3'UTR, and / or near the 3' end of the 3'UTR. As a non-limiting example, the miRNA binding site can be engineered near the 5' end of the 3'UTR and about halfway between the 5' end and the 3' end of the 3'UTR. As another non-limiting example, the miRNA binding site can be engineered near the 3' end of the 3'UTR and about halfway between the 5' end and the 3' end of the 3'UTR. As yet another non-limiting example, the miRNA binding site can be engineered near the 5' end of the 3'UTR and near the 3' end of the 3'UTR.

[0285] In another embodiment, the 3'UTR may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 miRNA binding sites. The miRNA binding sites may be complementary to the miRNA, miRNA seed sequence and / or the miRNA sequence flanking the inoculum sequence.

[0286] The nucleic acid molecules (e.g., RNA, e.g., mRNA) of the present disclosure can be engineered to be more targeted in specific tissues, cell types, or biological conditions based on the expression patterns of miRNAs in different tissues, cell types, or biological conditions. By introducing tissue-specific miRNA binding sites, the nucleic acid molecules (e.g., RNA, e.g., mRNA) of the present disclosure can be designed to perform optimal protein expression in tissues or cells or in the context of biological conditions.

[0287] In some embodiments, the nucleic acid molecules (e.g., RNA, e.g., mRNA) of the present disclosure may include at least one miRNA binding site in the 3'UTR to selectively degrade the mRNA therapeutic in immune cells to inhibit undesired immunogenic responses caused by therapeutic delivery. As a non-limiting example, the miRNA binding site may make the nucleic acid molecules (e.g., RNA, e.g., mRNA) of the present disclosure more unstable in antigen presenting cells. Non-limiting examples of these miRNAs are shown in Table 3 below.

[0288] Table 3: miRNA binding site sequences

[0289]

[0290]

[0291] In some embodiments, the 3'UTR of the nucleic acid molecules described herein comprises miR122bs (i.e., SEQ ID NO: 148 as shown in Table 3 above). In some embodiments, the 3'UTR of the nucleic acid molecules described herein comprises miR-142-3p bs (i.e., SEQ ID NO: 149 as shown in Table 3 above). In some embodiments, the 3'UTR of the nucleic acid molecules described herein comprises miR-126-3p bs (i.e., SEQ ID NO: 150 as shown in Table 3 above).

[0292] In some embodiments, the 3'UTR of nucleic acid molecules described herein comprises more than one miRNA binding site. In some embodiments, the 3'UTR of nucleic acid molecules described herein comprises 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 miRNA binding sites. In some embodiments, in the presence of more than one miRNA binding site, the miRNA binding site is the same. In some cases where there is more than one miRNA binding site, miRNA binding site (for example, any combination of any miRNA binding site listed in Table 3 above). In some embodiments, in the presence of more than one miRNA binding site, about 1-25 nucleotides may be present between each miRNA binding site. For example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides may be present between each miRNA binding site.

[0293] In some embodiments, the 3'UTR of the nucleic acid molecules described herein comprises both miR142-3p bs and miR-126-3p bs. In some embodiments, the 3'UTR of the nucleic acid molecules described herein comprises three copies of miR-142-3p bs. In some embodiments, the 3'UTR of the nucleic acid molecules described herein comprises two copies of miR-142-3p bs. In some embodiments, the 3'UTR of the nucleic acid molecules described herein comprises two copies of miR-142-3p bs and one copy of miR-126-3p bs. In some embodiments, the 3'UTR of the nucleic acid molecules described herein comprises three copies of miR122bs.

[0294] 4. Nucleotide cap

[0295] The present disclosure also includes a polynucleotide comprising both a 5' cap and a polynucleotide of the present invention (eg, a polynucleotide comprising a nucleotide sequence encoding a polypeptide to be expressed).

[0296] The 5' cap structure of natural mRNA is involved in nuclear export, increases mRNA stability and binds mRNA cap binding protein (CBP), which is responsible for mRNA stability and translation competence in cells through the association of CBP with poly(A) binding protein to form mature circular mRNA species. The cap further facilitates the removal of 5' proximal introns during mRNA splicing.

[0297] Endogenous mRNA molecules can be capped at the 5' end, thereby generating a 5'-ppp-5'-triphosphate bond between the terminal guanosine cap residue of the mRNA molecule and the sense nucleotide transcribed at the 5'-end. This 5'-guanylate cap can then be methylated to generate an N7-methyl-guanylate residue. The ribose of the terminal and / or pre-terminal transcribed nucleotides at the 5' end of the mRNA can also be optionally 2'-O-methylated. 5'-decapping by hydrolysis and cleavage of the guanylate cap structure can target nucleic acid molecules, such as mRNA molecules, for degradation.

[0298] In some embodiments, a polynucleotide of the invention (eg, a polynucleotide comprising a nucleotide sequence encoding a polypeptide) incorporates a cap moiety.

[0299] In some embodiments, the polynucleotides of the invention comprise a non-hydrolyzable cap structure that prevents decapping and thus increases the half-life of the mRNA. Because hydrolysis of the cap structure requires cleavage of the 5'-ppp-5' phosphodiester bond, modified nucleotides can be used during the capping reaction. For example, the vaccinia capping enzyme from New England Biolabs (Ipswich, MA) can be used with αα-thio-guanosine nucleotides according to the manufacturer's instructions to generate a phosphorothioate bond in the 5'-ppp-5' cap. Additional modified guanosine nucleotides, such as α α-Methyl-phosphonic acid and seleno-phosphate nucleotides.

[0300] Additional modifications include, but are not limited to, 2'-O-methylation of the ribose of the 5'-terminus and / or the 5'-terminal prenucleotide of the polynucleotide (as mentioned above) on the 2'-hydroxyl of the sugar ring. A plurality of different 5'-cap structures can be used to produce the 5'-cap of nucleic acid molecules, such as polynucleotides used as mRNA molecules. Cap analogs, also referred to herein as synthetic cap analogs, chemical caps, chemical cap analogs or structural or functional cap analogs, have a chemical structure that is different from the natural (ie, endogenous, wild-type or physiological) 5'-cap while retaining the cap function. Cap analogs can be chemically (ie, non-enzymatically) or enzymatically synthesized and / or attached to the polynucleotides of the present invention.

[0301] For example, the anti-reverse cap analog (ARCA) cap contains two guanines linked by a 5′-5′-triphosphate group, one of which contains an N7 methyl group and a 3′-O-methyl group (i.e., N7, 3′-O-dimethyl-guanosine-5′-triphosphate-5′-guanosine (m 7 G-3'mppp-G; can be equivalently named 3'O-Me-m 7G(5')ppp(5')G). The 3'-O atom of the other unmodified guanine becomes attached to the 5'-terminal nucleotide of the capping polynucleotide. The N7- and 3'-O-methylated guanines provide the terminal portion of the capping polynucleotide.

[0302] Another exemplary cap is mCAP, which is similar to ARCA but has a 2′-O-methyl group on guanosine (i.e., N7, 2′-O-dimethyl-guanosine-5′-triphosphate-5′-guanosine, m 7 Gm-ppp-G).

[0303] Another exemplary cap is m 7 GpppG 2’OMc or m 7 G-ppp-Gm-A (i.e., N7, guanosine-5′-triphosphate-2′-O--dimethyl-guanosine-adenosine).

[0304] In some embodiments, the cap is a dinucleotide cap analog. As a non-limiting example, the dinucleotide cap analog can be modified with a boranophosphate group or a selenophosphate group at different phosphate positions, such as the dinucleotide cap analogs described in U.S. Pat. No. US 8,519,110, the contents of which are incorporated herein by reference in their entirety.

[0305] In another embodiment, the cap is a cap analog that is a N7-(4-chlorophenoxyethyl) substituted dinucleotide form of a cap analog known in the art and / or described herein. Non-limiting examples of N7-(4-chlorophenoxyethyl) substituted dinucleotide forms of cap analogs include N7-(4-chlorophenoxyethyl)-G(5′)ppp(5′)G and N7-(4-chlorophenoxyethyl)-m 3′ - O G(5')ppp(5')G cap analogs (see, e.g., Kore et al., Bioorganic & Medicinal Chemistry 2013 21:4570-4574 for various cap analogs and methods of synthesizing cap analogs; the contents of which are incorporated herein by reference in their entirety). In another embodiment, the cap analog of the invention is a 4-chloro / bromophenoxyethyl analog.

[0306] The polynucleotides of the present invention may also be capped using enzymes after manufacture (whether IVT or chemical synthesis) to produce a more realistic 5′-cap structure. As used herein, the phrase “more realistic” refers to features that closely reflect or mimic endogenous or wild-type features in structure or function. That is, “more realistic” features are more representative of endogenous, wild-type, natural or physiological cellular functions and / or structures than synthetic features or analogs of the prior art, or are superior to corresponding endogenous, wild-type, natural or physiological features in one or more aspects. Non-limiting examples of more realistic 5′ cap structures of the present invention are those cap structures that have enhanced cap-binding protein binding, increased half-life, reduced sensitivity to 5′ endonucleases and / or reduced 5′ decapping, etc., compared to synthetic 5′ cap structures (or wild-type, natural or physiological 5′ cap structures) known in the art. For example, a recombinant vaccinia virus capping enzyme and a recombinant 2'-O-methyltransferase can generate a canonical 5'-5'-triphosphate bond between the 5'-terminal nucleotide of a polynucleotide and a guanine cap nucleotide, wherein the cap guanine contains N7 methylation and the 5'-terminal nucleotide of the mRNA contains a 2'-O-methyl group. This structure is referred to as a cap 1 structure. Compared to other 5' cap analog structures known in the art, for example, this cap allows for higher translational capacity and cellular stability and reduced activation of cellular proinflammatory cytokines. Cap structures include, but are not limited to, 7mG(5')ppp(5')N1pN2p (cap 0), 7mG(5')ppp(5')N1mpNp (cap 1), and 7mG(5')-ppp(5')N1mpN2mp (cap 2).

[0307] As a non-limiting example, post-manufacturing capping of chimeric polynucleotides may be more efficient because nearly 100% of the chimeric polynucleotides may be capped, as compared to approximately 80% when the cap analog is attached to the chimeric polynucleotide during an in vitro transcription reaction.

[0308] According to the present invention, the 5' terminal cap may include an endogenous cap or a cap analog. According to the present invention, the 5' terminal cap may comprise a guanine analog. Available guanine analogs include, but are not limited to, inosine, N1-methyl-guanosine, 2'fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine and 2-azido-guanosine.

[0309] Also provided herein are exemplary caps, including those caps that can be used in co-transcriptional capping methods for ribonucleic acid (RNA) synthesis, wherein the synthesis uses an RNA polymerase, such as a wild-type RNA polymerase or a variant thereof, such as those described herein. In one embodiment, a cap can be added when RNA is produced in a "one pot" reaction, without the need for a separate capping reaction. Therefore, in some embodiments, the method includes reacting a polynucleotide template with an RNA polymerase variant, a nucleoside triphosphate, and a cap analog under in vitro transcription reaction conditions to produce an RNA transcript.

[0310] As used herein, the term "cap" includes an inverted G nucleotide and may include one or more additional nucleotides 3' to the inverted G nucleotide, e.g., 3' to the inverted G nucleotide and 1, 2, 3 or more nucleotides 5' to a 5'UTR (e.g., a 5'UTR described herein).

[0311] An exemplary cap comprises G G. G A or G The sequence of GA, where the underlined italic G is the inverted G nucleotide, is followed by a 5'-5'-triphosphate group.

[0312] In one embodiment, the cap comprises a compound of formula (I) or a stereoisomer, tautomer or salt thereof, wherein

[0313]

[0314] Ring B 1 is modified or unmodified guanine;

[0315] Ring B 2 and Ring B 3 each independently is a nucleobase or a modified nucleobase;

[0316] X 2 Yes O, S(O) p NR 24 or CR 25 R 26 , where p is 0, 1, or 2;

[0317] Y 0 O or CR 6 R 7 ;

[0318] Y1 is O, S(O) n , CR 6 R 7 or NR 8 , where n is 0, 1, or 2;

[0319] Each --- is a single bond or does not exist, wherein when each --- is a single bond, Yi is O, S(O) n , CR 6 R 7 or NR 8 ; and when each --- does not exist, Y 1 is missing;

[0320] Y 2 Yes(OP(O)R 4 ) m , where m is 0, 1 or 2, or -O-(CR 40 R 41 ) 0 -(CR 42 R 43 )v-, where Q 0 is a bond, O, S(O) r NR 44 or CR 45 R 46 , r is 0, 1 or 2, and each of u and v is independently 1, 2, 3 or 4;

[0321] Each R 2 and R 2 ' is independently halogen, LNA or OR 3 ;

[0322] Each R 3 Independently H, C 1 -C 6 Alkyl, C 2 -C 6 Alkenyl or C 2 -C 6 Alkynyl, and when R 3 It is C 1 -C 6 Alkyl, C 2 -C 6 Alkenyl or C 2 -C 6 Alkynyl is optionally substituted with one or more of: halo, OH and optionally with one or more OH or OC(O)-C 1 -C 6 Alkyl substituted C 1 -C 6 Alkoxy;

[0323] Each R 4 and R 4 ' is independently H, halo, C 1 -C 6 Alkyl, OH, SH, SeH or BH 3 - ;

[0324] R 6 , R 7 and R 8 Each of which is independently -Q 1 -T 1 , where Q 1 is a bond or is optionally substituted by halogen, cyano, OH and C 1 -C 6 One or more alkoxy groups substituted with C 1 -C 3 alkyl linker, and T 1 is H, halide, OH, COOH, cyano, or R s1 , where R s1 It is C 1 -C 3 Alkyl, C 2 -C 6 Alkenyl, C 2 -C 6 Alkynyl, C 1 -C 6 Alkoxy, C(O)OC 1 -C 6 Alkyl, C 3 -C 8 Cycloalkyl, C 6 -C 10 Aryl, NR 31 R 32 ,(NR 31 R 32 R 33 ) + , 4- to 12-membered heterocycloalkyl or 5- or 6-membered heteroaryl, and R s1 Optionally substituted with one or more substituents selected from the group consisting of halo, OH, oxo, C 1 -C 6 Alkyl, COOH, C(O)OC 1 -C 6 Alkyl, cyano, C 1 -C 6 Alkoxy, NR 31 R 32 ,(NR 31 R 32 R 33 ) + , C 3 -C 8 Cycloalkyl, C 6 -C 10 aryl, 4- to 12-membered heterocycloalkyl, and 5- or 6-membered heteroaryl;

[0325] R 10 , R11 , R 12 , R 13 , R 14 and R 15 Each of which is independently -Q 2 -T 2 , where Q 2 is a bond or optionally halogen, cyano, OH and C 1 -C 6 One or more alkoxy groups substituted with C 1 -C 3 alkyl linker, and T 2 H, halogen, OH, NH 2 , cyano, NO 2 、N 3 , R s2 OR s2 , where R s2 It is C 1 -C 6 Alkyl, C 2 -C 6 Alkenyl, C 2 -C 6 Alkynyl, C 3 -C 8 Cycloalkyl, C 6 -C 10 Aryl, NHC(O)-C 1 -C 6 Alkyl, NR 31 R 32 ,(NR 31 R 32 R 33 ) + , 4- to 12-membered heterocycloalkyl or 5- or 6-membered heteroaryl, and R s2 Optionally substituted with one or more substituents selected from the group consisting of halo, OH, oxo, C 1 -C 6 Alkyl, COOH, C(O)OC 1 -C 6 Alkyl, cyano, C 1 -C 6 Alkoxy, NR 31 R 32 ,(NR 31 R 32 R 33 ) + , C 3 -C 8 Cycloalkyl, C 6 -C 10 aryl, 4- to 12-membered heterocycloalkyl, and 5- or 6-membered heteroaryl; or alternatively, R12 With R 14 Together is oxo, or R 13 With R 15 Together is oxygen,

[0326] R 20 , R 21 , R 22 and R 23 Each of which is independently -Q 3 -T 3 , where Q 3 is a bond or is optionally substituted by halogen, cyano, OH and C 1 -C 6 One or more alkoxy groups substituted with C 1 -C 3 alkyl linker, and T 3 H, halogen, OH, NH 2 , cyano, NO 2 、N 3 , R S3 OR S3 , where R S3 It is C 1 -C 6 Alkyl, C 2 -C 6 Alkenyl, C 2 -C 6 Alkynyl, C 3 -C 8 Cycloalkyl, C 6 -C 10 Aryl, NHC(O)-C 1 -C 6 Alkyl, single C 1 -C 6 Alkylamino, di-C 1 -C 6 alkylamino, 4- to 12-membered heterocycloalkyl, or 5- or 6-membered heteroaryl, and Rs 3 Optionally substituted with one or more substituents selected from the group consisting of halo, OH, oxo, C 1 -C 6 Alkyl, COOH, C(O)OC 1- C 6 Alkyl, cyano, C 1 -C 6 Alkoxy, amino, mono C 1 -C 6 Alkylamino, di-C 1 -C 6 Alkylamino, C 3 -C 8 Cycloalkyl, C 6 -C10 aryl, 4- to 12-membered heterocycloalkyl, and 5- or 6-membered heteroaryl;

[0327] R 24 , R 25 and R 26 Each of which is independently H or C 1 -C 6 alkyl;

[0328] R 27 and R 28 Each of which is independently H or OR 29 ; or R 27 With R 28 Together we form OR 30 -O; each R 29 Independently H, C 1 -C 6 Alkyl, C 2 -C 6 Alkenyl or C 2 -C 6 Alkynyl, and when R 29 It is C 1 -C 6 Alkyl, C 2 -C 6 Alkenyl or C 2 -C 6 Alkynyl is optionally substituted with one or more of: halo, OH and optionally with one or more OH or OC(O)-C 1 -C 6 Alkyl substituted C 1 -C 6 Alkoxy;

[0329] R 30 is optionally substituted with halogen, OH and C 1 -C 6 One or more alkoxy groups substituted with C 1 -C 6 Alkylene;

[0330] R 31 , R 32 and R 33 Each of which is independently H, C 1 -C 6 Alkyl, C 3 -C 8 Cycloalkyl, C 6 -C 10 Aryl, 4- to 12-membered heterocycloalkyl, or 5- or 6-membered heteroaryl;

[0331] R 40 , R 41 , R42 and R 43 Each of which is independently H, halo, OH, cyano, N 3 OP(O)R 47 R 48 or optionally one or more OP(O)R 47 R 48 Substituted C 1 -C 6 Alkyl, or an R 41 and an R 43 The carbon atoms to which they are attached and Q 0 Together they form C 4 -C 10 Cycloalkyl, 4- to 14-membered heterocycloalkyl, C 6 -C 10 aryl or 5- to 14-membered heteroaryl, and each of the cycloalkyl, heterocycloalkyl, phenyl or 5- to 6-membered heteroaryl is optionally substituted with one or more of: OH, halo, cyano, N 3 , oxy, OP(O)R 47 R 48 , C 1 -C 6 Alkyl, C 1 -C 6 Haloalkyl, COOH, C(O)OC 1 -C 6 Alkyl, C 1 -C 6 Alkoxy, C 1 -C 6 Haloalkoxy, amino, mono-C 1 -C 6 Alkylamino and di-C 1 -C 6 Alkylamino;

[0332] R 44 It is H, C 1 -C 6 Alkyl or amine protecting groups;

[0333] R 45 and R 46 Each of which is independently H, OP(O)R 47 R 48 or optionally one or more OP(O)R 47 R 48 Substituted C 1 -C 6 Alkyl, and

[0334] R 47 and R 48Each of which is independently H, halo, C 1 -C 6 Alkyl, OH, SH, SeH or BH 3 .

[0335] It should be understood that the cap analogs as provided herein may include any of the cap analogs described in International Publication No. WO2017 / 066797, published on April 20, 2017, which is incorporated herein by reference in its entirety.

[0336] In some embodiments, B 2 The middle position may be a non-ribose molecule, such as arabinose.

[0337] In some embodiments, R 2 It is ethyl based.

[0338] Thus, in some embodiments, the cap comprises the following structure:

[0339]

[0340] In other embodiments, the cap comprises the following structure:

[0341]

[0342] In other embodiments, the cap comprises the following structure:

[0343]

[0344] In other embodiments, the cap comprises the following structure:

[0345]

[0346] In some embodiments, R is alkyl (eg, C 1 -C 6 In some embodiments, R is methyl (e.g., C 1 In some embodiments, R is ethyl (e.g., C 2 alkyl).

[0347] In some embodiments, the cap comprises a sequence selected from the group consisting of GAA, GAC, GAG, GAU, GCA, GCC, GCG, GCU, GGA, GGC, GGG, GGU, GUA, GUC, GUG, and GUU. In some embodiments, the cap comprises GAA. In some embodiments, the cap comprises GAC. In some embodiments, the cap comprises GAG. In some embodiments, the cap comprises GAU. In some embodiments, the cap comprises GCA. In some embodiments, the cap comprises GCC. In some embodiments, the cap comprises GCG. In some embodiments, the cap comprises GCU. In some embodiments, the cap comprises GGA. In some embodiments, the cap comprises GGC. In some embodiments, the cap comprises GGG. In some embodiments, the cap comprises GGU. In some embodiments, the cap comprises GUA. In some embodiments, the cap comprises GUC. In some embodiments, the cap comprises GUG. In some embodiments, the cap comprises GUU.

[0348] In some embodiments, the cap comprises a sequence selected from the group consisting of: m 7 GpppG、m 7 GpppApA、m 7 GpppApC、m 7 GpppApG、m 7 GpppApU、m 7 GpppCpA、m 7 GpppCpC,m 7 GpppCpG、m 7 GpppCpU、m 7 GpppGpA、m 7 GpppGpC、m 7 GpppGpG,m 7 GpppGpU、m 7 GpppUpA、m 7 GpppUpC、m 7 GpppUpG and m 7 GpppUpU.

[0349] In some embodiments, the cap comprises m 7 GpppApA. In some embodiments, the cap comprises m 7 GpppApC. In some embodiments, the cap comprises m 7 GpppApG. In some embodiments, the cap comprises m 7 GpppApU. In some embodiments, the cap comprises m 7 GpppCpA. In some embodiments, the cap comprises m 7GpppCpC. In some embodiments, the cap comprises m 7 GpppCpG. In some embodiments, the cap comprises m 7 GpppCpU. In some embodiments, the cap comprises m 7 GpppGpA. In some embodiments, the cap comprises m 7 GpppGpC. In some embodiments, the cap comprises m 7 GpppGpG. In some embodiments, the cap comprises m 7 GpppGpU. In some embodiments, the cap comprises m 7 GpppUpA. In some embodiments, the cap comprises m 7 GpppUpC. In some embodiments, the cap comprises m 7 GpppUpG. In some embodiments, the cap comprises m 7 GpppUpU.

[0350] In some embodiments, the cap comprises a sequence selected from the group consisting of: m 7 G 3′OMc pppApA、m 7 G 3′OMc pppApC、m 7 G 3′OMc pppApG,m 7 G 3′OMc pppApU、m 7 G 3′OMe pppCpA、m 7 G 3′OMe pppCpC、m 7 G 3′OMe pppCpG、m 7 G 3′ OMe pppCpU、m 7 G 3′OMe pppGpA,m 7 G 3′OMe pppGpC、m 7 G 3′OMe pppGpG,m 7 G 3′OMe pppGpU、m 7 G 3′OMc pppUpA、m 7 G 3′OMc pppUpC、m 7 G 3′OMc pppUpG and m 7 G 3′OMc pppUpU.

[0351] In some embodiments, the cap comprises m 7 G 3′OMc pppApA. In some embodiments, the cap comprises m 7 G 3′ OMc pppApC. In some embodiments, the cap comprises m 7 G 3′OMc pppApG. In some embodiments, the cap comprises m 7 G 3′ OMc pppApU. In some embodiments, the cap comprises m 7 G 3′OMe pppCpA. In some embodiments, the cap comprises m 7 G 3′ OMe pppCpC. In some embodiments, the cap comprises m 7 G 3′OMe pppCpG. In some embodiments, the cap comprises m 7 G 3′ OMe pppCpU. In some embodiments, the cap comprises m 7 G 3′OMc pppGpA. In some embodiments, the cap comprises m 7 G 3′ OMc pppGpC. In some embodiments, the cap comprises m 7 G 3′OMc pppGpG. In some embodiments, the cap comprises m 7 G 3′ OMc pppGpU. In some embodiments, the cap comprises m 7 G 3′OMc pppUpA. In some embodiments, the cap comprises m 7 G 3′ OMe pppUpC. In some embodiments, the cap comprises m 7 G 3′OMe pppUpG. In some embodiments, the cap comprises m 7 G 3′ OMe pppUpU.

[0352] In other embodiments, the cap comprises a sequence selected from the group consisting of: m 7 G 3′OMe pppA 2′OMe pA、m 7 G 3′ OMe pppA2′OMe pC、m 7 G 3′OMe pppA 2′OMe pG、m 7 G 3′OMe pppA 2′OMe pU、m 7 G 3′OMe pppC 2′OMe pA、m 7 G 3′OMe pppC 2′ OMe pC、m 7 G 3′OMe pppC 2′OMc pG、m 7 G 3′OMc pppC 2′OMc pU、m 7 G 3′OMc pppG 2′OMc pA、m 7 G 3′OMc pppG 2′OMc pC、m 7 G 3′ OMc pppG 2′OMc pG、m 7 G 3′OMc pppG 2′OMc pU、m 7 G 3′OMc U 2′OMc pA、m 7 G 3′OMc U 2′OMc pC、m 7 G 3′OMc U 2′OMc pG and m 7 G 3′OMc U 2′OMe pU.

[0353] In some embodiments, the cap comprises m 7 G 3′OMc pppA 2′OMc pA. In some embodiments, the cap comprises m 7 G 3′ OMe pppA 2′OMe In some embodiments, the cap comprises m 7 G 3′OMe pppA 2′OMe pG. In some embodiments, the cap comprises m 7 G 3′OMe pppA 2′OMeIn some embodiments, the cap comprises m 7 G 3′OMe pppC 2′OMe pA. In some embodiments, the cap comprises m 7 G 3′OMe pppC 2′OMc In some embodiments, the cap comprises m 7 G 3′OMc pppC 2′OMc pG. In some embodiments, the cap comprises m 7 G 3′OMc pppC 2′OMc In some embodiments, the cap comprises m 7 G 3′OMe pppG 2′OMe pA. In some embodiments, the cap comprises m 7 G 3′OMe pppG 2′OMe In some embodiments, the cap comprises m 7 G 3′OMe pppG 2′OMc pG. In some embodiments, the cap comprises m 7 G 3′OMc pppG 2′OMc In some embodiments, the cap comprises m 7 G 3′OMc U 2′OMc pA. In some embodiments, the cap comprises m T G 3′OMe U 2′OMe In some embodiments, the cap comprises m T G 3′OMc U 2′OMc pG. In some embodiments, the cap comprises m 7 G 3′OMe U 2′OMe pU.

[0354] In other embodiments, the cap comprises a sequence selected from the group consisting of: 7 GpppG 2′OMe 、m 7 GpppA 2′OMe pA、m 7 GpppA 2′OMe pC、m 7 GpppA 2′OMe pG、m 7 GpppA 2′OMe pU、m 7 Gppp 2′OMe pA、m 7 Gppp2′OMe pC、m 7 Gppp 2′ OMe pG、m 7 Gppp 2′OMe pU、m 7 GpppG 2′OMep A.m 7 GpppG 2′OMe pC、m 7 GpppG 2′OMe pG、m T GpppG 2′OMo pU、m T GpppU 2′OMo pA、m T GpppU 2′OMo pC、m 7 GpppU 2′OMc pG and m 7 GpppU 2′OMc pU.

[0355] In some embodiments, the cap comprises m 7 GpppA 2′OMc pA. In some embodiments, the cap comprises m T GpppA 2, OMc In some embodiments, the cap comprises m 7 GpppA 2,OMc pG. In some embodiments, the cap comprises m 7 GpppA 2,OMc In some embodiments, the cap comprises m T Gppp 2,OMe pA. In some embodiments, the cap comprises m T Gppp 2,OMe In some embodiments, the cap comprises m 7 Gppp 2,OMe pG. In some embodiments, the cap comprises m 7 Gppp 2′OMe In some embodiments, the cap comprises m T GpppG 2,OMo pA. In some embodiments, the cap comprises m T GpppG 2′OMc In some embodiments, the cap comprises m T GpppG 2,OMc pG. In some embodiments, the cap comprises m 7 GpppG 2 ' OMopU. In some embodiments, the cap comprises m 7 GpppU 2′OMc pA. In some embodiments, the cap comprises m 7 GpppU 2,OM In some embodiments, the cap comprises m T GpppU 2,OMe pG. In some embodiments, the cap comprises m T GpppU 2,OMe pU.

[0356] In some embodiments, the cap comprises m T Gpppm 6 A 2,ome pG. In some embodiments, the cap comprises m T Gpppe 6 A 2,ome pG.

[0357] In some embodiments, the cap comprises GAG. In some embodiments, the cap comprises GCG. In some embodiments, the cap comprises GUG. In some embodiments, the cap comprises GGG.

[0358] In some embodiments, the cap comprises any of the following structures:

[0359]

[0360] In some embodiments, the cap comprises m7 Gppp 1 N 2 N 3 , where N 1 、N 2 and N 3 is optional (i.e., may not be present or one or more may be present) and is independently a natural, modified or non-natural nucleobase. In some embodiments, m7 G is further methylated, for example, at the 3' position. In some embodiments, m7 G comprises an O-methyl group at the 3' position. In some embodiments, N 1 、N 2 and N 3 , if present, are optionally independently adenine, uracil, guanidine, thymine, or cytosine. In some embodiments, N 1 、N 2 and N 3 One or more (or all), if present, is methylated, for example, at the 2' position. In some embodiments, N 1 、N 2 and N3 One or more (or all), if present, have an O-methyl group at the 2' position.

[0361] In some embodiments, the cap comprises the following structure:

[0362]

[0363] Among them B 1 , B 2 and B 3 are independently natural, modified or unnatural nucleobases; and R 1 , R 2 , R 3 and R 4 is independently OH or O-methyl. 3 is O-methyl and R 4 is OH. In some embodiments, R 3 and R 4 In some embodiments, R 4 In some embodiments, R 1 Yes OH, R 2 Yes OH, R 3 is O-methyl, and R 4 is OH. In some embodiments, R 1 Yes OH, R 2 Yes OH, R 3 is O-methyl, and R 4 In some embodiments, R 1 and R 2 At least one of them is O-methyl, R 3 is O-methyl, and R 4 is OH. In some embodiments, R 1 and R 2 At least one of them is O-methyl, R 3 is O-methyl, and R 4 It is O-methyl.

[0364] In some embodiments, B 1 , B 3 and B 3 is a natural nucleoside base. In some embodiments, B 1 , B 2 and B 3 In some embodiments, at least one of B is a modified or non-natural base. 1 , B 2 and B 3In some embodiments, at least one of B is N6-methyladenine. 1 is adenine, cytosine, thymine or uracil. 1 is adenine, B 2 is uracil, and B 3 is adenine. In some embodiments, R 1 and R 2 Yes OH, R 3 and R 4 is O-methyl, B 1 is adenine, B 2 is uracil, and B 3 It's adenine.

[0365] In some embodiments, the cap comprises a sequence selected from the group consisting of GAAA, GACA, GAGA, GAUA, GCAA, GCCA, GCGA, GCUA, GGAA, GGCA, GGGA, GGUA, GUCA, and GUUA. In some embodiments, the cap comprises a sequence selected from the group consisting of GAAG, GACG, GAGG, GAUG, GCAG, GCCG, GCGG, GCUG, GGAG, GGCG, GGGG, GGUG, GUCG, GUGG, and GUUG. In some embodiments, the cap comprises a sequence selected from the group consisting of GAAU, GACU, GAGU, GAUU, GCAU, GCCU, GCGU, GCUU, GGAU, GGCU, GGGU, GGUU, GUAU, GUCU, GUGU, and GUUU. In some embodiments, the cap comprises a sequence selected from the group consisting of: GAAC, GACC, GAGC, GAUC, GCAC, GCCC, GCGC, GCUC, GGAC, GGCC, GGGC, GGUC, GUAC, GUCC, GUGC, and GUUC.

[0366] In some embodiments, the cap comprises a sequence selected from the group consisting of: m 7 G 3′OMe pppApApN、m 7 G 3′ OMe pppApCpN、m 7 G 3′OMe pppApGpN、m 7 G 3′OMe pppApUpN、m 7 G 3′OMe pppCpApN、m 7 G 3′OMe pppCpCpN、m 7 G 3′OMe pppCpGpN、m 7 G 3′OMe pppCpUpN、m 7 G 3′OMe pppGpApN、m 7 G 3′OMe pppGpCpN、m 7 G 3′OMe pppGpGpN、m 7 G 3′ OMe pppGpUpN、m 7 G 3′OMe pppUpApN、m 7 G 3′OMe pppUpCpN、m 7 G 3′OMe pppUpGpN and m 7 G 3′OMe pppUpUpN, wherein N is a natural, modified or non-natural nucleobase.

[0367] In other embodiments, the cap comprises a sequence selected from the group consisting of: m 7 G 3′OMc pppA 2′OMe pApN、m 7 G 3′ OMc pppA 2′OMe pCpN、m 7 G 3′OMe pppA 2′OMe pGpN、m 7 G 3′OMe pppA 2′OMe pUpN、m 7 G 3′OMe pppC 2′OMe pApN、m 7 G 3′ OMe pppC 2′OMe pCpN、m 7 G 3′OMe pppC 2′OMe pGpN、m 7 G 3′OMe pppC 2′OMe pUpN、m 7 G 3′OMe pppG 2′OMe pApN、m 7 G 3′ OMe pppG 2′OMe pCpN、m 7 G 3′OMepppG 2′OMe pGpN、m 7 G 3′OMe pppG 2′OMe pUpN、m 7 G 3′OMe U 2′OMe pApN、m 7 G 3′ OMe U 2′OMe pCpN、m 7 G 3′OMc U 2′OMc pGpN and m 7 G 3′OMe U 2′OMc pUpN, wherein N is a natural, modified or non-natural nucleobase.

[0368] In other embodiments, the cap comprises a sequence selected from the group consisting of: m 7 GpppA 2′OMe pApN、m 7 GpppA 2′ OMe pCpN、m 7 GpppA 2′OMe pGpN、m 7 GpppA 2′OMe pUpN、m 7 Gppp 2′OMe pApN、m 7 Gppp 2′OMe pCpN、m 7 Gppp 2′ OMe pGpN、m 7 Gppp 2′OMe pUpN、m 7 GpppG 2′OMe pApN、m 7 GpppG 2′OMe pCpN、m 7 GpppG 2′OMe pGpN、m 7 GpppG 2′ OMe pUpN、m 7 GpppU 2′OMe pApN、m 7 GpppU 2′OMe pCpN、m 7 GpppU 2′OMe pGpN and m 7 GpppU 2′OMepUpN, wherein N is a natural, modified or non-natural nucleobase.

[0369] In other embodiments, the cap comprises a sequence selected from the group consisting of: m 7 G 3′OMe pppA 2′OMe pA 2′OMe pN、m 7 G 3′OMe pppA 2′OMe pC 2′OMe pN、m 7 G 3′OMe pppA 2′OMe pG 2′OMc pN、m 7 G 3′OMe pppA 2′OMc pU 2′OMc pN、m 7 G 3′ OMc pppC 2′OMc pA 2′OMc pN、m 7 G 3′OMc pppC 2′OMc pC 2′OMc pN、m 7 G 3′OMc pppC 2′OMc pG 2′OMc pN、m 7 G 3′OMc pppC 2′ OMc pU 2′OMc pN、m 7 G 3′OMc pppG 2′OMc pA 2′OMc pN、m 7 G 3′OMc pppG 2′OMc pC 2′OMe pN、m 7 G 3′OMe pppG 2′OMe pG 2′OMe pN、m 7 G 3′OMe pppG 2′OMe pU 2′OMe pN、m 7 G 3′OMe U 2′OMe pA 2′OMe pN、m 7 G 3′OMe U 2′OMe pC 2′OMe pN、m 7 G3′ OMe U 2′OMe pG 2′OMe pN and m 7 G 3′OMe U 2′OMe pU 2′OMe pN, wherein N is a natural, modified or non-natural nucleobase.

[0370] In other embodiments, the cap comprises a sequence selected from the group consisting of: m 7 GpppA 2′OMe pA 2′OMc pN、m 7 GpppA 2′OMc pC 2′OMc pN、m 7 GpppA 2′OMc pG 2′OMc pN、m 7 GpppA 2′OMc pU 2′OMc pN、m 7 Gppp 2′OMc pA 2′OMc pN、m 7 Gppp 2′OMc pC 2′OMc pN、m 7 Gppp 2′OMc pG 2′OMc pN、m 7 Gppp 2′OMc pU 2′OMc pN、m 7 GpppG 2′OMc pA 2′OMe pN、m 7 GpppG 2′OMe pC 2′OMe pN、m 7 GpppG 2′OMe pG 2′OMe pN、m 7 GpppG 2′OMe pU 2′OMe pN、m 7 GpppU 2′OMe pA 2′OMe pN、m 7 GpppU 2′OMe pC 2′OMe pN、m 7 GpppU 2′OMe pG 2′OMe pN and m 7 GpppU 2′OMe pU 2′OMepN, wherein N is a natural, modified or non-natural nucleobase.

[0371] In some embodiments, the cap comprises GGAG. In some embodiments, the cap comprises the following structure:

[0372]

[0373] 5. Termination element

[0374] The translation termination codons UAA, UAG and UGA are important components of the genetic code and are signals for the termination of mRNA translation. During protein synthesis, the termination codon interacts with protein release factors and this interaction can regulate ribosome activity, thereby affecting translation (Tate WP et al., (2018) Biochem Soc Trans, 46(6): 1615-162).

[0375] In particular, a polynucleotide encoding a polypeptide is disclosed herein, the polynucleotide having a coding region comprising a termination element, the termination element conferring increased half-life, increased expression and / or increased activity to the polypeptide encoded by the polynucleotide or the polynucleotide itself. In one embodiment, the polynucleotide comprises: (a) a 5′-UTR (e.g., as described herein); (b) a coding region comprising a termination element (e.g., as described herein); and (c) a 3′-UTR (e.g., as described herein), and an LNP composition comprising the polynucleotide. In one embodiment, the polynucleotide comprises a coding region comprising the termination element provided in Table 4.

[0376] As used herein, a termination element refers to a nucleic acid sequence comprising a stop codon. In the case of DNA, the stop codon may be selected from TGA, TAA and TAG; or in the case of RNA, selected from UGA, UAA and UAG. In one embodiment, the termination element comprises two consecutive stop codons. In one embodiment, the termination element comprises three consecutive stop codons. In one embodiment, the termination element comprises four consecutive stop codons. In one embodiment, the termination element comprises five consecutive stop codons.

[0377] In one embodiment, the termination element comprises a plurality of identical termination codons. In one embodiment, the termination element comprises a plurality of different termination codons.

[0378] In one embodiment, the termination element further comprises at least 1, 2, 3, 4, 5 or 10 nucleotides upstream and / or downstream of one or more termination codons. In one embodiment, the termination element further comprises at least 1, 2, 3, 4, 5 or 10 nucleotides upstream of one or more termination codons. In one embodiment, the termination element further comprises at least 1, 2, 3, 4, 5 or 10 nucleotides downstream of one or more termination codons.

[0379] The present invention also includes a polynucleotide comprising both a stop codon element and a polynucleotide described herein. In some embodiments, the stop codon element comprises a stop codon region. In some embodiments, the coding region of the polynucleotide comprises a stop element. In some embodiments, the stop element is upstream of, for example, before, the 3′UTR sequence in the polynucleotide.

[0380] In some embodiments, the polynucleotides of the present invention may include at least two stop codons before the 3' untranslated region (UTR). In the case of DNA, the stop codon may be selected from TGA, TAA and TAG; or in the case of RNA, selected from UGA, UAA and UAG. In some embodiments, the polynucleotides of the present invention include the stop codon TGA in the case of DNA, or the stop codon UGA in the case of RNA, and an additional stop codon. In yet another embodiment, the additional stop codon may be TAA or UAA. In another embodiment, the polynucleotides of the present invention include three consecutive stop codons, four stop codons or more.

[0381] It has been observed that a termination element comprising the sequence provided in Table 4 can increase the half-life of a polynucleotide and / or increase the level or activity of a polypeptide encoded by the polynucleotide.

[0382] In one embodiment, the polynucleotides with the termination elements provided in Table 4 increase the half-life of the polynucleotides or increase the level and / or activity (e.g., output) of the polypeptides encoded by the polynucleotides. In one embodiment, the half-life increases by about 1.5-20 times. In one embodiment, the half-life increases by about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 times or more. In one embodiment, the half-life increases by about 1.5 times or more. In one embodiment, the half-life increases by about 2 times or more. In one embodiment, the half-life increases by about 3 times or more. In one embodiment, the half-life increases by about 4 times. In one embodiment, the half-life increases by about 5 times or more.

[0383] In one embodiment, a polynucleotide having a termination element provided in Table 4 increases the level and / or activity (e.g., output or duration of expression) of a polypeptide encoded by the polynucleotide. In one embodiment, the termination element increases the level and / or activity, e.g., detectable level or activity, of a polypeptide encoded by the polynucleotide by about 1.5-20 fold for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 14 days. In one embodiment, the termination element increases the detectable level or activity of a polypeptide encoded by the polynucleotide by about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 14 days.

[0384] In one embodiment, the activity increases by about 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 times or more. In one embodiment, the activity increases by about 1.5 times or more. In one embodiment, the activity increases by about 2 times or more. In one embodiment, the activity increases by about 3 times or more. In one embodiment, the activity increases by about 4 times or more. In one embodiment, the activity increases by about 5 times or more.

[0385] In one embodiment, the increase is compared to an otherwise similar polynucleotide that does not have a termination element, has a different termination element, or does not have a termination element provided in Table 4.

[0386] In one embodiment, the termination element comprises a sequence provided in Table 4. In one embodiment, the termination element comprises a sequence of SEQ ID NO: 158, SEQ ID NO: 159, SEQ ID NO: 160, SEQ ID NO: 161, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 166, SEQ ID NO: 167, or SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 173, or SEQ ID NO: 174. In one embodiment, the termination element comprises a sequence of SEQ ID NO: 158. In one embodiment, the termination element comprises a sequence of SEQ ID NO: 159. In one embodiment, the termination element comprises a sequence of SEQ ID NO: 160. In one embodiment, the termination element comprises a sequence of SEQ ID NO: 161. In one embodiment, the termination element comprises a sequence of SEQ ID NO: 162. In one embodiment, the termination element comprises a sequence of SEQ ID NO: 163. In one embodiment, the termination element comprises a sequence of SEQ ID NO: 164. In one embodiment, the termination element comprises the sequence of SEQ ID NO: 165. In one embodiment, the termination element comprises the sequence of SEQ ID NO: 166. In one embodiment, the termination element comprises the sequence of SEQ ID NO: 167. In one embodiment, the termination element comprises the sequence of SEQ ID NO: 168. In one embodiment, the termination element comprises the sequence of SEQ ID NO: 169. In one embodiment, the termination element comprises the sequence of SEQ ID NO: 173. In one embodiment, the termination element comprises the sequence of SEQ ID NO: 174.

[0387] In some embodiments, the polynucleotide includes a kappa stop box (ie, UAAAGCUCCCCGGGG (SEQ ID NO: 165)) or an iota stop box (ie, UAAGCCCCUCCGGGG (SEQ ID NO: 164)).

[0388] In one embodiment, the coding region of (b) comprises a termination element comprising a consensus sequence of Formula B:

[0389] X- 3 -X -2 -X- 1 -UAAX 1 -X 2 -X 3 -X4 -X 5 -X 6 -X 7 -X 8 -X 9 -X 10 -X 11 -X 12 (SEQ ID NO: 170)

[0390] in:

[0391] X 1 is G or A;

[0392] X 2 , X 4 , X 5 , X 6 or X 7 each independently is C or U;

[0393] X 3 It is C or A;

[0394] X 8 , X 10 , X 11 , X 12 , X -1 or X -3 each independently is C or G;

[0395] X 9 is G or U; and / or

[0396] X -2 It is A or U.

[0397] In one embodiment, X 1 is G. In one embodiment, X 1 It is A.

[0398] In one embodiment, X 2 is C. In one embodiment, X 2 It's U.

[0399] In one embodiment, X 4 is C. In one embodiment, X 4 It's U.

[0400] In one embodiment, X 5 is C. In one embodiment, X 5 It's U.

[0401] In one embodiment, X 6 is C. In one embodiment, X 6 It's U.

[0402] In one embodiment, X 7 is C. In one embodiment, X 7 It's U.

[0403] In one embodiment, X 3 is C. In one embodiment, X 3 It is A.

[0404] In one embodiment, X 8 is C. In one embodiment, X 8 It's G.

[0405] In one embodiment, X 10 is C. In one embodiment, X 10 It's G.

[0406] In one embodiment, X 11 is C. In one embodiment, X 11 It's G.

[0407] In one embodiment, X 12 is C. In one embodiment, X 12 It's G.

[0408] In one embodiment, X -1 is C. In one embodiment, X -1 It's G.

[0409] In one embodiment, X -3 is C. In one embodiment, X -3 It's G.

[0410] In one embodiment, X 9 is G. In one embodiment, X 9 It's U.

[0411] In one embodiment, X -2 is A. In one embodiment, X -2 It's U.

[0412] In one embodiment, the consensus sequence of Formula B (SEQ ID NO: 170) has a high GC content, for example, about 50%, 60%, 70%, 80%, 90% or 99% GC content. In one embodiment, the GC content is about 50%. In one embodiment, the GC content is about 60%. In one embodiment, the GC content is about 70%. In one embodiment, the GC content is about 80%. In one embodiment, the GC content is about 90%. In one embodiment, the GC content is about 99%.

[0413] In one embodiment, the coding region of (b) comprises a termination element comprising a consensus sequence of Formula C:

[0414] X -3 -X -2 -X -1 -UGAX 1 -X 2 -X 3 -X 4 -X 5 -X 6 -X 7 -X 8 -X 9 -X 10 -X 11 -X 12 (SEQ ID NO: 171)

[0415] in:

[0416] X -3 , X -1 , X 2 , X 5 , X 6 , X 7 , X 8 , X 9 or X 12 each independently is G or C;

[0417] X -2 , X 3 or X 4 each independently is A or C;

[0418] X 1 is A or G; and / or

[0419] X 10 or X 11 Each is independently C or U.

[0420] In one embodiment, X -3 is G. In one embodiment, X -3 It is C.

[0421] In one embodiment, X -1 is G. In one embodiment, X -1 It is C.

[0422] In one embodiment, X 2 is G. In one embodiment, X 2 It is C.

[0423] In one embodiment, X 5 is G. In one embodiment, X5 It is C.

[0424] In one embodiment, X 6 is G. In one embodiment, X 6 It is C.

[0425] In one embodiment, X 7 is G. In one embodiment, X 7 It is C.

[0426] In one embodiment, X 8 is G. In one embodiment, X 8 It is C.

[0427] In one embodiment, X 9 is G. In one embodiment, X 9 It is C.

[0428] In one embodiment, X 12 is G. In one embodiment, X 12 It is C.

[0429] In one embodiment, X -2 is A. In one embodiment, X -2 It is C.

[0430] In one embodiment, X 3 is A. In one embodiment, X 3 It is C.

[0431] In one embodiment, X 4 is A. In one embodiment, X 4 It is C.

[0432] In one embodiment, X 1 is A. In one embodiment, X 1 It's G.

[0433] In one embodiment, X 10 is C. In one embodiment, X 10 It's U.

[0434] In one embodiment, X 11 is C. In one embodiment, X 11 It's U.

[0435] In one embodiment, the consensus sequence of Formula C (SEQ ID NO: 171) has a high GC content, for example, about 50%, 60%, 70%, 80%, 90% or 99% GC content. In one embodiment, the GC content is about 50%. In one embodiment, the GC content is about 60%. In one embodiment, the GC content is about 70%. In one embodiment, the GC content is about 80%. In one embodiment, the GC content is about 90%. In one embodiment, the GC content is about 99%.

[0436] In one embodiment, the coding region of (b) comprises a termination element comprising a consensus sequence of Formula D:

[0437] X -3 -X -2 -X -1 -UAGX 1 -X 2 -X 3 -X 4 -X 5 -X 6 -X 7 -X 8 -X 9 -X 10 -X 11 -X 12 (SEQ ID NO: 172)

[0438] in:

[0439] X -3 , X -1 , X 2 , X 3 , X 10 each independently is G or C;

[0440] X -2 or X 9 each independently is A or U;

[0441] X 1 or X 4 each independently is A or G;

[0442] X 5 or X 8 each independently A or C; and / or

[0443] X 6 , X 7 , X 11 or X 12 Each is independently C or U.

[0444] In one embodiment, X -3is G. In one embodiment, X -3 It is C.

[0445] In one embodiment, X -1 is G. In one embodiment, X -1 It is C.

[0446] In one embodiment, X 2 is G. In one embodiment, X 2 It is C.

[0447] In one embodiment, X 3 is G. In one embodiment, X 3 It is C.

[0448] In one embodiment, X 10 is G. In one embodiment, X 10 It is C.

[0449] In one embodiment, X -2 is A. In one embodiment, X -2 It's U.

[0450] In one embodiment, X 9 is A. In one embodiment, X 9 It's U.

[0451] In one embodiment, X 1 is A. In one embodiment, X 1 It's G.

[0452] In one embodiment, X 4 is A. In one embodiment, X 4 It's G.

[0453] In one embodiment, X 5 is A. In one embodiment, X 5 It is C.

[0454] In one embodiment, X 8 is A. In one embodiment, X 8 It is C.

[0455] In one embodiment, X 6 is C. In one embodiment, X 6 It's U.

[0456] In one embodiment, X 7 is C. In one embodiment, X 7 It's U.

[0457] In one embodiment, X11 is C. In one embodiment, X 11 It's U.

[0458] In one embodiment, X 12 is C. In one embodiment, X 12 It's U.

[0459] In one embodiment, the consensus sequence of Formula D (SEQ ID NO: 172) has a high GC content, for example, about 50%, 60%, 70%, 80%, 90% or 99% GC content. In one embodiment, the GC content is about 50%. In one embodiment, the GC content is about 60%. In one embodiment, the GC content is about 70%. In one embodiment, the GC content is about 80%. In one embodiment, the GC content is about 90%. In one embodiment, the GC content is about 99%.

[0460] Table 4: Termination Elements

[0461]

[0462]

[0463] In one aspect, disclosed herein is a polynucleotide encoding a polypeptide, wherein the polynucleotide comprises: (a) a 5′-UTR, e.g., as described herein; (b) a coding region comprising a termination element (e.g., as provided in Table 4); and (c) a 3′-UTR (e.g., as described herein).

[0464] 6. Poly A tail

[0465] In some embodiments, the polynucleotides of the present disclosure further comprise a poly A tail. In other embodiments, a terminal group may be incorporated into the poly A tail for stabilization. In other embodiments, the poly A tail comprises a de-3' hydroxyl tail.

[0466] During RNA processing, a long chain of adenine nucleotides (poly A tail) can be added to a polynucleotide (such as an mRNA molecule) to increase stability. Immediately after transcription, the 3' end of the transcript can be cleaved to release the 3' hydroxyl. The poly A polymerase then adds the adenine nucleotide chain to the RNA. The process, called polyadenylation, adds a poly A tail, which can be, for example, between about 80 to about 250 residues in length, including about 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240 or 250 residues in length. In one embodiment, the length of the poly A tail is 100 nucleotides (SEQ ID NO: 121).

[0467]

[0468] The poly A tail can also be added after the construct has been exported from the nucleus.

[0469] According to the present invention, terminal groups can be incorporated into the poly A tail for stabilization. The polynucleotides of the present invention can include a 3′ hydroxyl tail. They can also include structural moieties or 2′-O methyl modifications taught by Junjie Li et al. (Current Biology, Vol. 15, 1501-1507, August 23, 2005, the contents of which are incorporated herein by reference in their entirety).

[0470] The polynucleotides of the present invention can be designed to encode transcripts having alternative poly A tail structures including histone mRNAs. According to Norbury, terminal uridylation is also detected on human replication-dependent histone mRNAs. The turnover of these mRNAs is considered to be important for preventing the accumulation of potentially toxic histones after completion or inhibition of chromosomal DNA replication. These mRNAs are characterized by the lack of a 3′ poly (A) tail, whose function is instead undertaken by a stable stem-loop structure and its cognate stem-loop binding protein (SLBP); the latter performs the same function as PABP on polyadenylated mRNAs (Norbury, "Cytoplasmic RNA: a case of the tail wagging the dog," Nature Reviews Molecular Cell Biology; AOP, published online on August 29, 2013; doi: 10.1038 / nrm3645), the contents of which are incorporated herein by reference in their entirety.

[0471] The unique poly A tail length provides some advantages for the polynucleotide of the present invention. In general, when present, the length of the poly A tail is greater than 30 nucleotide lengths. In another embodiment, the length of the poly A tail is greater than 35 nucleotides (e.g., at least or greater than about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500 and 3,000 nucleotides).

[0472] In some embodiments, a polynucleotide or region thereof includes from about 30 to about 3,000 nucleotides (e.g., from 30 to 50, from 30 to 100, from 30 to 250, from 30 to 500, from 30 to 750, from 30 to 1,000, from 30 to 1,500, from 30 to 2,000, from 30 to 2,500, from 50 to 100, from 50 to 250, from 50 to 500, from 50 to 750, from 50 to 1,000, from 50 to 1,500, from 50 to 2,000, from 50 to 2,500, from 50 to 3,000, from 100 to 500, from 100 to 750, from 100 to 1,000, from 100 to 1, 1,000 to 5,000, 1,500 to 2,000, 1,000 to 2,500, 1,000 to 3,000, 1,500 to 2,000, 1,500 to 2,500, 1,500 to 3,000, 2,000 to 3,000, 2,000 to 2,500, and 2,500 to 3,000).

[0473] In some embodiments, the poly A tail is designed relative to the length of the entire polynucleotide or the length of a specific region of the polynucleotide. This design can be based on the length of the coding region, the length of a specific feature or region or based on the length of the final product expressed from the polynucleotide.

[0474] In this case, the length of the poly A tail can be 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100% longer than polynucleotide or its characteristics. The poly A tail can also be designed to be a part of the polynucleotide to which it belongs. In this case, the poly A tail can be 10, 20, 30, 40, 50, 60, 70, 80 or 90% or more of the construct total length, construct region or construct total length deducting the poly A tail. In addition, the poly A-binding protein engineering binding site and polynucleotide puting together can enhance expression.

[0475] In addition, multiple different polynucleotides can be linked together via PABP (poly A binding protein) through the 3' end using modified nucleotides at the 3' end of the poly A tail. Transfection experiments can be performed in relevant cell lines and protein production can be determined by ELISA at 12 hours, 24 hours, 48 ​​hours, 72 hours and 7 days after transfection.

[0476] In some embodiments, the polynucleotides of the present invention are designed to include a poly AG quadruplex region. The G-quadruplex is a cyclic hydrogen-bonded array of four guanine nucleotides that can be formed by G-rich sequences in DNA and RNA. In this embodiment, the G-quadruplex is incorporated into the end of the poly A tail. The stability, protein yield, and other parameters of the resulting polynucleotides are measured, including the half-life at various time points. It has been found that the poly AG quadruplex results in a protein yield from mRNA equivalent to at least 75% of that seen using a 120-nucleotide poly A tail (SEQ ID NO: 51) alone.

[0477]

[0478] In some embodiments, the poly A tail is a mixed poly A tail with interrupted non-adenosine residues (e.g., guanosine). In some embodiments, the poly A tail is guanylated. Without wishing to be bound by theory, it is believed that in some embodiments, the mixed poly A tail can protect mRNA from rapid deadenylation.

[0479] In some embodiments, the poly A tail comprises one or more non-adenosine residues. In some embodiments, the non-adenosine residue is guanosine. In some embodiments, the poly A tail comprises 1-20, for example, 1-15, 1-10, 1-5, 15-20, 10-20, 5-20, 2-15, 5-10, 1-5, 2-10 or 5-15 non-adenosine residues (e.g., guanosine). For example, the poly A tail can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more non-adenosine residues (e.g., guanosine). In some embodiments, at least 1%, for example at least 2%, 5%, 10%, 15%, 20% or 25% of the residues in the poly A tail are non-adenosine residues (e.g., guanosine). In some embodiments, the poly A tail is guanylated, e.g., comprises one or more guanosine residues.

[0480] In one embodiment, the poly-A tail comprising one or more non-adenosine residues is chemically synthesized.

[0481] In one embodiment, the 3'UTR comprises a TENT recruitment sequence, e.g., as described herein, which recruits one or more terminal nucleotidyl transferases (TENTs) to a polynucleotide comprising a 3'UTR. In one embodiment, the TENT is a TENT4, e.g., TENT4A and / or TENT4B. Without wishing to be bound by theory, it is believed that in some embodiments, one or more TENTs (e.g., TENT4A and / or TENT4B) produce a mixed poly A tail with interrupted non-adenosine residues (e.g., guanosine) that protects the rnRNA from rapid deadenylation.

[0482] Exemplary TENT recruitment sequences include, but are not limited to

[0483]

[0484] and

[0485]

[0486] In one embodiment, the TENT recruitment sequence comprises the nucleotide sequence of SEQ ID NO: 91, or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto, or that differs therefrom by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In one embodiment, the TENT recruitment sequence comprises the nucleotide sequence of SEQ ID NO: 91.

[0487] In one embodiment, the TENT recruitment sequence comprises the nucleotide sequence of SEQ ID NO: 92, or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto, or that differs by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides therefrom. In one embodiment, the TENT recruitment sequence comprises the nucleotide sequence of SEQ ID NO: 92.

[0488] In one embodiment, the 3'UTR comprises one or more (e.g., 2, 3, 4, 5 or more) TENT recruitment sequences, e.g., one or more TENT recruitment sequences described herein. In one embodiment, the 3'UTR comprises one TENT recruitment sequence. In one embodiment, the 3'UTR comprises two TENT recruitment sequences. In one embodiment, the 3'UTR comprises three TENT recruitment sequences. In one embodiment, the 3'UTR comprises four TENT recruitment sequences. In one embodiment, the 3'UTR comprises five TENT recruitment sequences. For example, the multiple TENT recruitment sequences in the 3'UTR can be the same or different.

[0489] In one embodiment, the 3'UTR comprises a TENT recruitment sequence comprising the nucleotide sequence of SEQ ID NO: 91, or a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto, or that differs therefrom by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In one embodiment, the 3'UTR comprises a TENT recruitment sequence comprising the nucleotide sequence of SEQ ID NO: 91.

[0490] In one embodiment, the 3'UTR comprises one or more (e.g., 2, 3, 4, 5 or more) TENT recruitment sequences comprising the nucleotide sequence of SEQ ID NO: 91, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, or differing by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides therefrom. In one embodiment, the 3'UTR comprises one TENT recruitment sequence comprising the nucleotide sequence of SEQ ID NO: 91, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, or differing by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides therefrom. In one embodiment, the 3'UTR comprises two TENT recruitment sequences, each of which comprises the nucleotide sequence of SEQ ID NO: 91, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or a nucleotide sequence that differs therefrom by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In one embodiment, the 3'UTR comprises three TENT recruitment sequences, each of which comprises the nucleotide sequence of SEQ ID NO: 91, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or a nucleotide sequence that differs therefrom by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In one embodiment, the 3'UTR comprises four TENT recruitment sequences, each of which comprises the nucleotide sequence of SEQ ID NO: 91, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or a nucleotide sequence that differs therefrom by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In one embodiment, the 3'UTR comprises five TENT recruitment sequences, each of which comprises the nucleotide sequence of SEQ ID NO: 91, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or a nucleotide sequence that differs therefrom by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides.

[0491] In one embodiment, the 3'UTR comprises one or more (e.g., 2, 3, 4, 5 or more) TENT recruitment sequences comprising the nucleotide sequence of SEQ ID NO: 91. In one embodiment, the 3'UTR comprises two TENT recruitment sequences, each of which comprises the nucleotide sequence of SEQ ID NO: 91. In one embodiment, the 3'UTR comprises three TENT recruitment sequences, each of which comprises the nucleotide sequence of SEQ ID NO: 91. In one embodiment, the 3'UTR comprises four TENT recruitment sequences, each of which comprises the nucleotide sequence of SEQ ID NO: 91. In one embodiment, the 3'UTR comprises five TENT recruitment sequences, each of which comprises the nucleotide sequence of SEQ ID NO: 91.

[0492] 7. Additional 3′UTR elements

[0493] A) Identification and Determination of Ratio (IDR)

[0494] An identification and ratio determination (IDR) sequence is a sequence of a biomolecule (e.g., a nucleic acid or protein) that, when combined with the sequence of a target biomolecule, is used to identify the target biomolecule. Typically, an IDR sequence is a heterologous sequence that is bound within or appended to the sequence of a target biomolecule and can be used as a reference for identifying the target molecule. Thus, in some embodiments, a nucleic acid (e.g., an mRNA) comprises (i) a target sequence of interest (e.g., a coding sequence encoding a therapeutic and / or antigenic peptide or protein); and (ii) a unique IDR sequence.

[0495] RNA species (e.g., RNA with a given coding sequence) can contain IDR sequences that are different from the IDR sequences of other RNA species (e.g., RNA with a different coding sequence). Thus, each IDR sequence identifies a specific RNA species, and the abundance of the IDR sequence can therefore be measured to determine the abundance of each RNA species in the composition. Using different IDR sequences to identify RNA species allows analysis of multivalent RNA compositions (e.g., containing multiple RNA species) that contain RNA species of similar coding sequence and / or length that may be difficult to distinguish using full-length RNA analysis based on PCR or chromatography.

[0496] Each RNA species in a multivalent RNA composition can include an IDR sequence that is not a sequence isomer of an IDR sequence of another RNA species in the multivalent RNA composition (e.g., an IDR sequence does not have the same number of adenosine nucleotides, the same number of cytosine nucleotides, the same number of guanine nucleotides, and the same number of uracil nucleotides as another IDR sequence in the composition, even if those sequences have different sequences). Having the same nucleotide composition results in sequence isomers having the same mass, which poses a challenge to distinguishing sequence isomers using mass-based identification methods (e.g., mass spectrometry).

[0497] Each RNA species in the multivalent RNA composition can include an IDR sequence whose mass is different from the mass of the IDR sequence of each other RNA species in the multivalent RNA composition. For example, the mass of each IDR sequence can differ from the mass of the other IDR sequences by at least 9 Da, at least 25 Da, at least 25 Da, or at least 50 Da. The use of IDR sequences with different masses allows the use of mass-based analytical methods (e.g., mass spectrometry) to distinguish RNA fragments containing different IDR sequences, which do not require reverse transcription, amplification, or sequencing of the RNA.

[0498] Each RNA species in the RNA composition can include an IDR sequence with a different length. For example, each IDR sequence can have a length independently selected from 0 to 25 nucleotides. The length of the nucleic acid affects the rate at which the nucleic acid passes through the chromatographic column, so the use of IDR sequences of different lengths on different RNA species allows the use of chromatography-based methods (e.g., LC-UV) to distinguish RNA fragments with different IDR sequences.

[0499] The IDR sequences may be selected such that no IDR sequence contains the start codon 'AUG'. The absence of a start codon in the IDR sequence prevents undesired translation of nucleotide sequences within and / or downstream of the IDR sequence.

[0500] The IDR sequences can be selected so that no IDR sequence contains a recognition site for a restriction enzyme. In one example, no IDR sequence contains the recognition site 'UCUAG' for XbaI. The lack of a recognition site for a restriction enzyme (e.g., the XbaI recognition site 'UCUAG') allows the restriction enzyme to be used to generate and modify a DNA template for in vitro transcription without affecting the IDR sequence or the sequence of the transcribed RNA.

[0501] B) FUT8

[0502] In some embodiments, the 3′UTR comprises a FUT8 sequence. For example, the FUT8 sequence comprises the following sequence:

[0503] CUGAGAGACCUGUGUGAACUAUUGAGAAGAUCGGAACAGCUCCUUACUCUGAGGAAGUUG SEQ ID NO: 93. In one embodiment, the 3'UTR comprises a FUT8 sequence comprising the nucleotide sequence of SEQ ID NO: 93, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto, or differing therefrom by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In some embodiments, the FUT8 sequence can be combined with any miRNA binding site present in the 3'UTR and as described herein.

[0504] C) Ribosome ligation detection assay (REDA)

[0505] REDA can be used to assess the effectiveness and validity of mRNA translation of cell lipid nanoparticle-nucleic acid uptake and manufactured nucleic acid. The assay incorporates aspects of ribosome engagement detection assay (REDA) to measure the mRNA bound to ribosomes during the translation step in the cell. The assay does not need to relate to actual protein expression, but by demonstrating effective mRNA uptake and associating with ribosomes, and therefore effectively translating in the cell to represent the effectiveness of nucleic acids such as mRNA producing proteins in cells.

[0506] Thus, in some embodiments, any of the 3'UTR sequences as described herein comprises a sequence that can be detected by qPCR in REDA.

[0507] RNA species (e.g., RNA with a given coding sequence) can include REDA sequences different from REDA sequences of other RNA species (e.g., RNA with different coding sequences). Therefore, each REDA sequence identifies a specific RNA species, and therefore the abundance of the REDA sequence can be measured to determine the abundance of each RNA species in the composition. Using different REDA sequences to identify RNA species allows analysis of multivalent RNA compositions (e.g., containing a plurality of RNA species), which contain RNA species similar to coding sequences and / or lengths, which may be difficult to distinguish using full-length RNA analysis based on PCR or chromatography.

[0508] Each RNA species in a multivalent RNA composition can include a REDA sequence that is not a sequence isomer of a REDA sequence of another RNA species in the multivalent RNA composition (e.g., an IDR sequence does not have the same number of adenosine nucleotides, the same number of cytosine nucleotides, the same number of guanine nucleotides, and the same number of uracil nucleotides as another REDA sequence in the composition, even if those sequences have different sequences). Having the same nucleotide composition results in sequence isomers having the same mass, which poses a challenge to distinguishing sequence isomers using mass-based identification methods (e.g., mass spectrometry).

[0509] Each RNA species in the multivalent RNA composition can include a REDA sequence whose mass is different from the mass of the REDA sequence of each other RNA species in the multivalent RNA composition. For example, the mass of each REDA sequence can differ from the mass of other REDA sequences by at least 9Da, at least 25Da, at least 25Da, or at least 50Da. The use of REDA sequences with different masses allows the use of mass-based analytical methods (e.g., mass spectrometry) to distinguish RNA fragments containing different IDR sequences, and the analytical methods do not require reverse transcription, amplification, or sequencing of RNA.

[0510] Each RNA species in the RNA composition can include REDA sequences with different lengths. For example, each IDR sequence can have a length independently selected from 0 to 25 nucleotides. The length of the nucleic acid affects the rate at which the nucleic acid passes through the chromatographic column, so using REDA sequences of different lengths on different RNA species allows the use of chromatography-based methods (e.g., LC-UV) to distinguish RNA fragments with different REDA sequences.

[0511] The REDA sequences may be selected such that no REDA sequence contains the start codon 'AUG'. The absence of a start codon in the IDR sequence prevents undesired translation of nucleotide sequences within and / or downstream of the REDA sequence.

[0512] The REDA sequence can be selected so that no REDA sequence contains a recognition site for a restriction enzyme. In one example, no REDA sequence contains the recognition site 'UCUAG' for XbaI. Lack of a recognition site for a restriction enzyme (e.g., the XbaI recognition site 'UCUAG') allows the restriction enzyme to be used to generate and modify a DNA template for in vitro transcription without affecting the sequence of the IDR sequence or the transcribed RNA.

[0513] 8. Start codon region

[0514] The present invention also includes a polynucleotide comprising both a start codon region and a polynucleotide described herein. In some embodiments, the polynucleotide of the present invention may have a region similar to or functionally similar to a start codon region.

[0515] In some embodiments, the translation of the polynucleotide can be started at a codon other than the start codon AUG. The translation of the polynucleotide can be started at an alternative start codon, such as, but not limited to, ACG, AGG, AAG, CTG / CUG, GTG / GUG, ATA / AUA, ATT / AUU, TTG / UUG (see Touriol et al., Biology of the Cell 95 (2003) 169-178 and Matsuda and Mauro PLoS ONE, 2010 5: 11; the contents of each of the documents are incorporated herein by reference in their entirety).

[0516] As a non-limiting example, the translation of the polynucleotide begins at an alternative start codon ACG. As another non-limiting example, the translation of the polynucleotide begins at an alternative start codon CTG or CUG. As yet another non-limiting example, the translation of the polynucleotide begins at an alternative start codon GTG or GUG.

[0517] It is known that nucleotides flanking a codon that initiates translation (such as, but not limited to, a start codon or an alternative start codon) can affect the translation efficiency, length, and / or structure of a polynucleotide. (See, e.g., Matsuda and Mauro PLoSONE, 2010 5:11; the contents of which are incorporated herein by reference in their entirety). Masking any of the nucleotides flanking a codon that initiates translation can be used to alter the position of translation initiation, the translation efficiency, length, and / or structure of a polynucleotide.

[0518] In some embodiments, a masking agent can be used near a start codon or an alternative start codon to mask or hide a codon to reduce the probability of translation initiation at the masked start codon or alternative start codon. Non-limiting examples of masking agents include antisense locked nucleic acid (LNA) polynucleotides and exon junction complexes (EJCs) (see, e.g., Matsuda and Mauro describe masking agent LNA polynucleotides and EJCs (PLoS ONE, 2010 5: 11); the contents of which are incorporated herein by reference in their entirety).

[0519] In another embodiment, a masking agent can be used to mask the start codon of a polynucleotide to increase the probability that translation will start at an alternative start codon. In some embodiments, a masking agent can be used to mask the first start codon or an alternative start codon to increase the chance that translation starts at a start codon or an alternative start codon downstream of the masked start codon or an alternative start codon.

[0520] In some embodiments, the start codon or alternative start codon can be located in the perfect complement of the miRNA binding site. The perfect complement of the miRNA binding site can be similar to a masking agent to help control the translation, length and / or structure of polynucleotides. As a non-limiting example, the start codon or alternative start codon can be located in the middle of the perfect complement of the miRNA binding site. The start codon or alternative start codon can be located after the first nucleotide, the second nucleotide, the third nucleotide, the fourth nucleotide, the fifth nucleotide, the sixth nucleotide, the seventh nucleotide, the eighth nucleotide, the ninth nucleotide, the tenth nucleotide, the eleventh nucleotide, the twelfth nucleotide, the thirteenth nucleotide, the fourteenth nucleotide, the fifteenth nucleotide, the sixteenth nucleotide, the seventeenth nucleotide, the eighteenth nucleotide, the nineteenth nucleotide, the twentieth nucleotide or the twenty-first nucleotide.

[0521] In another embodiment, can remove the start codon of polynucleotide from polynucleotide sequence, so that the translation of polynucleotide begins on the codon that is not a start codon.The translation of polynucleotide can begin on the codon after the start codon removed or on the downstream start codon or alternative start codon.In a limiting example, start codon ATG or AUG are removed to begin translation on the downstream start codon or alternative start codon as initial 3 Nucleotide of polynucleotide sequence.The polynucleotide sequence that removes the start codon can also comprise at least a masking agent that is used for downstream start codon and / or alternative start codon, to control or attempt to control the initiation of translation, the length of polynucleotide and / or the structure of polynucleotide.

[0522] 9. Combination of mRNA elements

[0523] Any of the polynucleotides disclosed herein may comprise one, two, three or all of the following elements: a 5'-UTR, e.g., as described herein; a coding region; a termination element + a 3'-UTR (e.g., as described herein); and optionally, a 3' stabilizing region, e.g., as described herein. Also disclosed herein are LNP compositions comprising the polynucleotides.

[0524] In one embodiment, the polynucleotide of the present disclosure comprises a 5′UTR or a variant or fragment thereof as described in Table 1, and a termination element + a 3′UTR or a variant or fragment thereof comprising a sequence of SEQ ID NO: 139. In one embodiment, the polynucleotide further comprises a cap structure, e.g., as described herein, or a poly A tail, e.g., as described herein. In one embodiment, the polynucleotide further comprises a 3′ stabilizing region, e.g., as described herein.

[0525] In one embodiment, the polynucleotide of the present disclosure comprises a 5′UTR comprising a sequence of SEQ ID NO: 50, or a variant or fragment thereof, and a termination element + a 3′UTR comprising a sequence of SEQ ID NO: 139, or a variant or fragment thereof. In one embodiment, the polynucleotide further comprises a cap structure, e.g., as described herein, or a poly A tail, e.g., as described herein. In one embodiment, the polynucleotide further comprises a 3′ stabilizing region, e.g., as described herein.

[0526] In one embodiment, the polynucleotide of the present disclosure comprises a 5′UTR comprising a sequence of SEQ ID NO: 56, or a variant or fragment thereof, and a termination element + a 3′UTR comprising a sequence of SEQ ID NO: 139, or a variant or fragment thereof. In one embodiment, the polynucleotide further comprises a cap structure, e.g., as described herein, or a poly A tail, e.g., as described herein. In one embodiment, the polynucleotide further comprises a 3′ stabilizing region, e.g., as described herein.

[0527] In some embodiments, the 5'UTR is SEQ ID NO: 50 and the 3'UTR is SEQ ID NO: 139 or SEQ ID NO: 144. For example, the 5'UTR is SEQ ID NO: 50 and the 3'UTR is SEQ ID NO: 139, or the 5'UTR is SEQ ID NO: 50 and the 3'UTR is SEQ ID NO: 144. In one embodiment, the polynucleotide further comprises a cap structure, e.g., as described herein, or a poly A tail, e.g., as described herein. In one embodiment, the polynucleotide further comprises a 3' stabilizing region, e.g., as described herein.

[0528] In some embodiments, any one or more of the miRNA binding site sequences selected from Table 3 may be combined with any one of the termination boxes as shown in Table 4. Additionally, in some embodiments, the Tent recruitment sequence may be combined with any one or more of the miRNA binding site sequences selected from Table 3 and any one of the termination boxes as shown in Table 4. Additionally, in some embodiments, the FUT8 sequence may be combined with any one or more of the miRNA binding site sequences selected from Table 3 and any one of the termination boxes as shown in Table 4.

[0529] 10. Therapeutic or preventive payloads

[0530] In particular, disclosed herein is a polynucleotide having a 5′UTR as described herein, a 3′UTR as described herein, and / or a coding region comprising a termination element, the coding region further comprising a sequence encoding a payload, such as a therapeutic payload or a prophylactic payload. In one embodiment, the coding region encodes a payload. In one embodiment, the coding region encodes more than one payload, such as 2, 3, 4, 5, 6 or more payloads, such as the same or different payloads. In one embodiment, the sequence encoding each payload is continuous in the polynucleotide. In one embodiment, the sequence encoding each payload is separated by at least 1-1000 nucleotides. In some embodiments, the therapeutic payload or the prophylactic payload comprises an mRNA encoding: a secreted protein; a membrane-bound protein; or an intercellular protein, or a peptide, a polypeptide, or a biologically active fragment thereof.

[0531] Also disclosed herein is a LNP comprising a polynucleotide comprising a coding region encoding a payload, such as a therapeutic payload or a prophylactic payload. In some embodiments, the therapeutic payload or the prophylactic payload comprises an mRNA encoding a secreted protein; a membrane-bound protein; or an intercellular protein, or a peptide, a polypeptide, or a biologically active fragment thereof.

[0532] In some embodiments, the therapeutic payload or the prophylactic payload comprises an mRNA encoding a secretory protein or a peptide, a polypeptide, or a biologically active fragment thereof. In some embodiments, the secretory protein comprises a cytokine or a variant or fragment thereof (e.g., a biologically active fragment). In some embodiments, the secretory protein comprises an antibody or a variant or fragment thereof (e.g., a biologically active fragment). In some embodiments, the secretory protein comprises an enzyme or a variant or fragment thereof (e.g., a biologically active fragment). In some embodiments, the secretory protein comprises a hormone or a variant or fragment thereof (e.g., a biologically active fragment). In some embodiments, the secretory protein comprises a ligand or a variant or fragment thereof (e.g., a biologically active fragment). In some embodiments, the secretory protein comprises a vaccine (e.g., an antigen, an immunogenic epitope) or a component, variant or fragment thereof (e.g., a biologically active fragment). In some embodiments, the vaccine is a prophylactic vaccine. In some embodiments, the vaccine is a therapeutic vaccine, for example, a cancer vaccine. In some embodiments, the secretory protein comprises a growth factor or a component, variant or fragment thereof (e.g., a biologically active fragment). In some embodiments, the secretory protein comprises an immunomodulator, for example, an immune checkpoint agonist or antagonist.

[0533] In some embodiments, the therapeutic payload or preventive payload comprises mRNA encoding a membrane-bound protein or a peptide, a polypeptide, or a biologically active fragment thereof. In some embodiments, the membrane-bound protein comprises a vaccine (e.g., an antigen, an immunogenic epitope) or a component, variant, or fragment thereof (e.g., a biologically active fragment). In some embodiments, the vaccine is a preventive vaccine. In some embodiments, the vaccine is a therapeutic vaccine, for example, a cancer vaccine. In some embodiments, the membrane-bound protein comprises a ligand, a variant thereof, or a fragment thereof (e.g., a biologically active fragment). In some embodiments, the membrane-bound protein comprises a membrane transporter, a variant thereof, or a fragment thereof (e.g., a biologically active fragment). In some embodiments, the membrane-bound protein comprises a structural protein, a variant thereof, or a fragment thereof (e.g., a biologically active fragment). In some embodiments, the membrane-bound protein comprises an immunomodulator, for example, an immune checkpoint agonist or antagonist.

[0534] In some embodiments, the therapeutic payload or the prophylactic payload comprises an mRNA encoding an intracellular protein or a peptide, a polypeptide, or a biologically active fragment thereof. In some embodiments, the intracellular protein comprises an enzyme or a variant or fragment thereof (e.g., a biologically active fragment). In some embodiments, the intracellular protein comprises a transcription factor or a variant or fragment thereof (e.g., a biologically active fragment). In some embodiments, the intracellular protein comprises a nuclease or a variant or fragment thereof (e.g., a biologically active fragment). In some embodiments, the intracellular protein comprises a structural protein or a variant or fragment thereof (e.g., a biologically active fragment).

[0535] In some embodiments, the therapeutic payload or prophylactic payload is selected from a cytokine, an antibody, a vaccine (e.g., an antigen, an immunogenic epitope), a receptor, an enzyme, a hormone, a transcription factor, a ligand, a membrane transporter, a structural protein, a nuclease, a growth factor, an immunomodulator, or a component, variant, or fragment (e.g., a biologically active fragment) thereof.

[0536] In some embodiments, the therapeutic payload or prophylactic payload comprises a protein or peptide.

[0537] It will be appreciated that the regulatory elements disclosed herein (e.g., 5'UTR, termination element, 3'UTR, stabilizing region (e.g., idT or modified poly A tail) can be used with ORFs encoding payloads described herein. It will be further appreciated that the regulatory elements disclosed herein can be used in a modular manner, i.e., can be used in an mRNA construct combined with other regulatory elements from the art (e.g., 5'UTR of the present invention combined with ORF and other regulatory regions from the art), or can be used in combination with other regulatory elements disclosed herein (e.g., 5'UTR of the present invention and 3'UTR of the present invention, etc.). It will be further appreciated that the termination element of the present invention can be used in combination with a desired ORF lacking a stop codon. It will also be appreciated that when the desired ORF comprises a stop codon, additional stop codons or termination elements will not be included in the final construct. In some embodiments, the stop codon in the desired ORF can be replaced with a termination element described herein.

[0538] 11. Method for preparing polynucleotides

[0539] The present disclosure also provides methods for preparing the polynucleotides disclosed herein or their complement.In some aspects, the polynucleotides disclosed herein (eg, mRNA) can be constructed using in vitro transcription.

[0540] In other aspects, the polynucleotides (e.g., mRNA) disclosed herein can be constructed by chemical synthesis using an oligonucleotide synthesizer. In other aspects, the polynucleotides (e.g., mRNA) disclosed herein are prepared by using host cells. In certain aspects, the polynucleotides (e.g., mRNA) disclosed herein are prepared by one or more combinations of IVT, chemical synthesis, host cell expression, or any other methods known in the art.

[0541] Naturally occurring nucleosides, non-naturally occurring nucleosides, or combinations thereof can completely or partially replace naturally occurring nucleosides present in a candidate nucleotide sequence and can be incorporated into a sequence-optimized nucleotide sequence (e.g., mRNA) encoding a therapeutic payload or a prophylactic payload. The resulting mRNA can then be examined for its ability to produce protein and / or produce a therapeutic outcome.

[0542] Although RNA can be prepared synthetically using methods well known in the art, in one embodiment, RNA transcripts (e.g., mRNA transcripts) are synthesized by contacting a DNA template with an RNA polymerase (e.g., T7 RNA polymerase or a T7 RNA polymerase variant) under conditions that will produce an RNA transcript.

[0543] In some aspects, the disclosure provides methods of performing an IVT (in vitro transcription) reaction, the method comprising contacting a DNA template with an RNA polymerase (e.g., T7 RNA polymerase, such as a T7 RNA polymerase variant) in the presence of nucleoside triphosphates and a buffer under conditions that will produce an RNA transcript.

[0544] Other aspects of the present disclosure provide capping methods, for example, co-transcriptional capping methods or other methods known in the art. In one embodiment, the capping method includes reacting a polynucleotide template with a T7 RNA polymerase variant, a nucleoside triphosphate, and a cap analog to produce an RNA transcript under in vitro transcription reaction conditions.

[0545] IVT conditions generally require a purified linear DNA template containing a promoter, nucleoside triphosphates, a buffer system containing dithiothreitol (DTT) and magnesium ions, and an RNA polymerase. The exact conditions used in the transcription reaction depend on the amount of RNA required for a particular application. A typical IVT reaction is performed by incubating the DNA template with an RNA polymerase and nucleoside triphosphates, including GTP, ATP, CTP, and UTP (or nucleotide analogs), in a transcription buffer. RNA transcripts with a 5′ terminal guanosine triphosphate are produced by this reaction.

[0546] Deoxyribonucleic acid (DNA) is only a nucleic acid template for RNA polymerase. The DNA template may include a polynucleotide encoding a polypeptide of interest (e.g., an antigenic polypeptide). In some embodiments, the DNA template includes an RNA polymerase promoter (e.g., a T7 RNA polymerase promoter) located 5′ of the polynucleotide encoding the polypeptide of interest and operably connected to the polynucleotide. The DNA template may also include a nucleotide sequence encoding a polyadenylated (poly A) tail at the 3′ end of the gene of interest.

[0547] Polypeptides of interest include, but are not limited to, biologics, antibodies, antigens (vaccines), and therapeutic proteins.The term "protein" encompasses peptides.

[0548] In some embodiments, the RNA transcript is the product of an IVT reaction, and as will be appreciated by one of ordinary skill in the art, the DNA template used to prepare the RNA molecule is known based on base complementarity. In some embodiments, the RNA transcript is a messenger RNA (mRNA) comprising a nucleotide sequence encoding a polypeptide of interest linked to a poly A tail. In some embodiments, the mRNA is a modified rnRNA (mmRNA) comprising at least one modified nucleotide.

[0549] Nucleotides include nitrogenous bases, pentose (ribose or deoxyribose) and at least one phosphate group. Nucleotides include monophosphate nucleosides, diphosphate nucleosides and triphosphate nucleosides. Monophosphate nucleosides (NMP) include nucleobases connected to ribose and a single phosphate; diphosphate nucleosides (NDP) include nucleobases connected to ribose and two phosphates; and triphosphate nucleosides (NTP) include nucleobases connected to ribose and three phosphates. Nucleotide analogs are compounds with the general structure of nucleotides or similar in structure to nucleotides. For example, nucleotide analogs include analogs of nucleobases, analogs of sugars and / or analogs of one or more phosphate groups of nucleotides.

[0550] Nucleosides include a nitrogenous base and a 5-carbon sugar. Thus, a nucleoside plus a phosphate group produces a nucleotide. Nucleoside analogs are compounds that have the general structure of a nucleoside or are structurally similar to a nucleoside. For example, nucleoside analogs include analogs of nucleobases and / or analogs of nucleoside sugars.

[0551] It should be understood that the term "nucleotide" includes naturally occurring nucleotides, synthetic nucleotides, and modified nucleotides unless otherwise indicated. As provided herein, examples of naturally occurring nucleotides used to generate RNA (e.g., in an IVT reaction) include adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytidine triphosphate (CTP), uridine triphosphate (UTP), and 5-methyluridine triphosphate (m-U). 5 In some embodiments, adenosine diphosphate (ADP), guanosine diphosphate (GDP), cytidine diphosphate (CDP), and / or uridine diphosphate (UDP) are used.

[0552] Examples of nucleotide analogs include, but are not limited to, antiviral nucleotide analogs, phosphate analogs (soluble or immobilized, hydrolyzable or non-hydrolyzable), dinucleotides, trinucleotides, tetranucleotides, e.g., cap analogs, or precursors / substrates for enzymatic capping (vaccinia or ligase), nucleotides labeled with a functional group to facilitate attachment / conjugation of a cap or 5' moiety (IRES), 5' PO 4Nucleotides labeled to facilitate attachment of a cap or 5' portion, or nucleotides labeled with a functional group / protecting group that can be cleaved chemically or enzymatically. Examples of antiviral nucleotide / nucleoside analogs include, but are not limited to, Ganciclovir, Entecavir, Telbivudine, Vidarabine, and Cidofovir.

[0553] Modified nucleotides may include modified nucleobases. For example, RNA transcripts of the present disclosure (e.g., mRNA transcripts) may include a modified nucleobase selected from pseudouridine (ψ), 1-methyl pseudouridine (m1ψ), 1-ethyl pseudouridine, 2-thiouridine, 4′-thiouridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methoxyuridine (mo5U) and 2′-O-methyluridine. In some embodiments, the RNA transcript (eg, mRNA transcript) includes a combination of at least two (eg, 2, 3, 4, or more) of the aforementioned modified nucleobases.

[0554] As provided herein, nucleoside triphosphates (NTPs) may include unmodified or modified ATP, modified or unmodified UTP, modified or unmodified GTP, and / or modified or unmodified CTP. In some embodiments, the NTPs of the IVT reaction include unmodified ATP. In some embodiments, the NTPs of the IVT reaction include modified ATP. In some embodiments, the NTPs of the IVT reaction include unmodified UTP. In some embodiments, the NTPs of the IVT reaction include modified UTP. In some embodiments, the NTPs of the IVT reaction include unmodified GTP. In some embodiments, the NTPs of the IVT reaction include modified GTP. In some embodiments, the NTPs of the IVT reaction include unmodified CTP. In some embodiments, the NTPs of the IVT reaction include modified CTP.

[0555] The concentrations of nucleoside triphosphates and cap analogs present in the IVT reaction may vary. In some embodiments, the NTPs and cap analogs are present in the reaction at equimolar concentrations. In some embodiments, the molar ratio of cap analogs (e.g., trinucleotide caps) to nucleoside triphosphates in the reaction is greater than 1:1. For example, the molar ratio of cap analogs to nucleoside triphosphates in the reaction can be 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 15:1, 20:1, 25:1, 50:1, or 100:1. In some embodiments, the molar ratio of cap analogs (e.g., trinucleotide caps) to nucleoside triphosphates in the reaction is less than 1:1. For example, the molar ratio of cap analog (e.g., trinucleotide cap) to nucleoside triphosphate in the reaction can be 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:25, 1:50, or 1:100.

[0556] The composition of the NTPs in the IVT reaction may also vary. For example, ATP may be used in excess of GTP, CTP, and UTP. As a non-limiting example, an IVT reaction may include 7.5 mM GTP, 7.5 mM CTP, 7.5 mM UTP, and 3.75 mM ATP. The same IVT reaction may include 3.75 mM cap analog (e.g., a trinucleotide cap). In some embodiments, the molar ratio of G:C:U:A:cap is 1:1:1:0.5:0.5. In some embodiments, the molar ratio of G:C:U:A:cap is 1:1:0.5:1:0.5. In some embodiments, the molar ratio of G:C:U:A:cap is 1:0.5:1:1:0.5. In some embodiments, the molar ratio of G:C:U:A:cap is 0.5:1:1:1:0.5.

[0557] In some embodiments, the RNA transcript (e.g., mRNA transcript) includes a modified nucleobase selected from the group consisting of pseudouridine (ψ), 1-methylpseudouridine (m 1 ψ), 5-methoxyuridine (mo 5 U), 5-methylcytidine (m 5 C), α-thio-guanosine or α-thio-adenosine. In some embodiments, the RNA transcript (eg, mRNA transcript) includes a combination of at least two (eg, 2, 3, 4 or more) of the aforementioned modified nucleobases.

[0558] In some embodiments, the RNA transcript (e.g., mRNA transcript) includes pseudouridine (ψ). In some embodiments, the RNA transcript (e.g., mRNA transcript) includes 1-methylpseudouridine (m 1In some embodiments, the RNA transcript (e.g., mRNA transcript) includes 5-methoxyuridine (m 5 In some embodiments, the RNA transcript (e.g., mRNA transcript) includes 5-methylcytidine (m 5 C). In some embodiments, the RNA transcript (eg, mRNA transcript) includes α-thio-guanosine. In some embodiments, the RNA transcript (eg, mRNA transcript) includes αα-thio-adenosine.

[0559] In some embodiments, polynucleotides (e.g., RNA polynucleotides, such as mRNA polynucleotides) are uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a specific modification. For example, polynucleotides can be uniformly modified with 1-methylpseudouridine (m 1 ψ) modification, meaning that all uridine residues in the mRNA sequence are replaced by 1-methylpseudouridine (m 1 ψ) replacement. Similarly, polynucleotides can be uniformly modified for any type of nucleoside residues present in the sequence by replacing with modified residues (such as any one of those residues described above). Alternatively, polynucleotides (such as RNA polynucleotides, such as mRNA polynucleotides) may not be uniformly modified (for example, partially modified, a part of the sequence is modified). Every possibility represents a separate embodiment of the present invention.

[0560] In some embodiments, the buffer system contains tris. For example, the concentration of tris used in the IVT reaction can be at least 10 mM, at least 20 mM, at least 30 mM, at least 40 mM, at least 50 mM, at least 60 mM, at least 70 mM, at least 80 mM, at least 90 mM, at least 100 mM, or at least 110 mM phosphate. In some embodiments, the concentration of phosphate is 20-60 mM or 10-100 mM.

[0561] In some embodiments, the buffer system contains dithiothreitol (DTT). For example, the concentration of DTT used in the IVT reaction can be at least 1 mM, at least 5 mM, or at least 50 mM. In some embodiments, the concentration of DTT used in the IVT reaction is 1-50 mM or 5-50 mM. In some embodiments, the concentration of DTT used in the IVT reaction is 5 mM.

[0562] In some embodiments, the buffer system contains magnesium. In some embodiments, the NTPs present in the IVT reaction are combined with magnesium ions (Mg 2+ ; For example, MgCl 2) is 1:1 to 1:5. For example, the molar ratio of NTP to magnesium ion can be 1:1, 1:2, 1:3, 1:4 or 1:5.

[0563] In some embodiments, the NTPs present in the IVT reaction plus a cap analog (e.g., a trinucleotide cap such as GAG) are reacted with a magnesium ion (Mg 2+ ; For example, MgCl 2 ) is 1:1 to 1:5. For example, the molar ratio of NTP+trinucleotide cap (eg, GAG) to magnesium ion can be 1:1, 1:2, 1:3, 1:4 or 1:5.

[0564] In some embodiments, the buffer system contains Tris-HCl, spermidine (e.g., at a concentration of 1-30 mM), X-100 (polyethylene glycol p-(1,1,3,3-tetramethylbutyl)-phenyl ether) and / or polyethylene glycol (PEG).

[0565] The addition of nucleoside triphosphates (NTPs) to the 3' end of the growing RNA chain is catalyzed by a polymerase, such as T7 RNA polymerase, e.g., any one or more of the T7 RNA polymerase variants (e.g., G47A) disclosed herein. In some embodiments, the RNA polymerase (e.g., T7 RNA polymerase variant) is present in the reaction (e.g., IVT reaction) at a concentration of 0.01 mg / ml to 1 mg / ml. For example, the RNA polymerase may be present in the reaction at a concentration of 0.01 mg / mL, 0.05 mg / ml, 0.1 mg / ml, 0.5 mg / ml, or 1.0 mg / ml.

[0566] In some embodiments, the polynucleotides of the present disclosure are IVT polynucleotides. Traditionally, the basic components of an mRNA molecule include at least a coding region, a 5′UTR, a 3′UTR, a 5′ cap, and a poly A tail. The IVT polynucleotides of the present disclosure can function as mRNAs, but differ from wild-type mRNAs in their functional and / or structural design features, which are used, for example, to overcome existing problems in the efficient production of polypeptides using nucleic acid-based therapeutics.

[0567] The primary construct of the IVT polynucleotide comprises a first region of linked nucleotides flanked by a first flanking region and a second flanking region. This first region may include, but is not limited to, an encoded therapeutic payload or a prophylactic payload. The first flanking region may include a sequence of linked nucleosides that functions as a 5' untranslated region (UTR), such as a 5'UTR of any of the nucleic acids encoding the native 5'UTR or non-native 5'UTR of a polypeptide, such as, but not limited to, a heterologous 5'UTR or a synthetic 5'UTR. The IVT encoding the therapeutic payload or the prophylactic payload may include a signal sequence region encoding one or more signal sequences at its 5' end. The flanking region may include a region of linked nucleotides that include one or more complete or incomplete 5'UTR sequences. The flanking region may also include a 5' terminal cap. The second flanking region may include a region of linked nucleotides that include one or more complete or incomplete 3'UTRs that may encode the native 3'UTR of the therapeutic payload or the prophylactic payload, or a non-native 3'UTR, such as, but not limited to, a heterologous 3'UTR or a synthetic 3'UTR. The flanking region may further comprise a 3' tailing sequence. The 3' tailing sequence may be, but is not limited to, a poly A tail, a poly AG quadruplex and / or a stem-loop sequence.

[0568] Additional and exemplary features of IVT polynucleotide architectures and methods of making polynucleotides are disclosed in International PCT Application WO 2017 / 201325 filed on May 18, 2017, the entire contents of which are hereby incorporated by reference.

[0569] 12. Purification

[0570] In other aspects, the polynucleotides (e.g., mRNA) disclosed herein can be purified. Purification of polynucleotides (e.g., mRNA) described herein can include, but are not limited to, polynucleotide cleanup, quality assurance, and quality control. Cleanup can be performed by methods known in the art, such as, but not limited to, beads (Beckman CoulterGenomics, Danvers, MA), poly-T beads, LNATM oligo-T capture probes ( Inc, Vedbaek, Denmark) or HPLC-based purification methods, such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC) and hydrophobic interaction HPLC (HIC-HPLC). The term "purified" when used with respect to polynucleotides, such as "purified polynucleotides", refers to polynucleotides separated from at least one contaminant. As used herein, a "contaminant" is any substance that makes another substance unsuitable, impure or inferior. Thus, purified polynucleotides (e.g., DNA and RNA) exist in a form or configuration different from that in which they are found in nature, or in a form or configuration different from that which existed prior to treatment or purification methods.

[0571] In some embodiments, a polynucleotide of the present disclosure (e.g., m mm Purification of RNA removes impurities, which can reduce or eliminate undesirable immune responses, for example, reducing cytokine activity.

[0572] In some embodiments, polynucleotides (e.g., mRNA) of the present disclosure are purified prior to administration using column chromatography (e.g., strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC), or (LCMS). In some embodiments, polynucleotides purified by column chromatography (e.g., strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC), or (LCMS)) encoding a therapeutic payload or prophylactic payload disclosed herein increase expression of the therapeutic payload or prophylactic payload compared to a polynucleotide encoding the therapeutic payload or prophylactic payload purified by a different purification method.

[0573] In some embodiments, the polynucleotides purified by column chromatography (e.g., strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC), or (LCMS)) encode therapeutic or prophylactic payloads. In some embodiments, the purified polynucleotides encode therapeutic or prophylactic payloads.

[0574] In some embodiments, a purified polynucleotide is at least about 80% pure, at least about 85% pure, at least about 90% pure, at least about 95% pure, at least about 96% pure, at least about 97% pure, at least about 98% pure, at least about 99% pure, or about 100% pure.

[0575] Quality assurance and / or quality control checks may be performed using methods such as, but not limited to, gel electrophoresis, UV absorbance, or analytical HPLC.

[0576] In another embodiment, the polynucleotides may be sequenced by methods including, but not limited to, reverse transcriptase-PCR.

[0577] 13. Chemical modification of polynucleotides

[0578] As described above, modified nucleosides and nucleotides of nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids) can be included in the polynucleotides of the present invention. "Nucleoside" refers to a compound containing a sugar molecule (e.g., pentose or ribose) or a derivative thereof combined with an organic base (e.g., purine or pyrimidine) or its derivative (also referred to herein as "nucleobase") or its derivative. "Nucleotide" refers to a nucleoside including a phosphate group. Modified nucleotides can be synthesized by any useful method such as chemical, enzymatic or recombinant to include one or more modified or non-natural nucleosides. Nucleic acids can include one or more regions of connected nucleosides. Such regions may have variable main chain linkages. The linkage can be a standard phosphodiester linkage, in which case the nucleic acid will include a nucleotide region.

[0579] The modified nucleotide base pairing not only covers standard adenosine-thymine, adenosine-uracil or guanosine-cytosine base pairs, but also covers base pairs formed between nucleotides and / or modified nucleotides comprising non-standard or modified bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors allows hydrogen bonding between non-standard bases and standard bases or between two complementary non-standard base structures, for example, in those nucleic acids with at least one chemical modification. An example of such non-standard base pairing is base pairing between modified nucleotides inosine and adenine, cytosine or uracil. Any combination of bases / sugars or linkers can be incorporated into nucleic acids of the present disclosure.

[0580] In some embodiments, the modified nucleobase in nucleic acid (e.g., RNA nucleic acid, such as mRNA nucleic acid) includes N1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C) and / or pseudouridine (ψ). In some embodiments, the modified nucleobase in nucleic acid (e.g., RNA nucleic acid, such as mRNA nucleic acid) includes 5-methoxymethyluridine, 5-methylthiouridine, 1-methoxymethylpseudouridine, 5-methylcytidine and / or 5-methoxycytidine. In some embodiments, polyribonucleotides include at least two (e.g., 2, 3, 4 or more) combinations of any of the above modified nucleobases, including but not limited to chemical modifications.

[0581] In some embodiments, the RNA nucleic acids of the present disclosure comprise N1-methyl-pseudouridine (m1ψ) substitutions at one or more or all uridine positions of the nucleic acid.

[0582] In some embodiments, the RNA nucleic acids of the present disclosure comprise N1-methyl-pseudouridine (m1ψ) substitutions at one or more or all uridine positions of the nucleic acid and 5-methylcytidine substitutions at one or more or all cytidine positions of the nucleic acid.

[0583] In some embodiments, the RNA nucleic acids of the present disclosure comprise pseudouridine (ψ) substitutions at one or more or all uridine positions of the nucleic acid.

[0584] In some embodiments, the RNA nucleic acids of the disclosure comprise a pseudouridine (ψ) substitution at one or more or all uridine positions of the nucleic acid and a 5-methylcytidine substitution at one or more or all cytidine positions of the nucleic acid.

[0585] In some embodiments, the RNA nucleic acids of the present disclosure comprise uridine at one or more or all uridine positions of the nucleic acid.

[0586] In some embodiments, nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids) are uniformly modified (e.g., completely modified, modified throughout the entire sequence) for specific modifications. For example, nucleic acids can be uniformly modified by N1-methyl-pseudouridine, meaning that all uridine residues in the mRNA sequence are replaced by N1-methyl-pseudouridine. Similarly, nucleic acids can be uniformly modified for any type of nucleoside residue present in the sequence by replacing them with modified residues (such as those described above).

[0587] The nucleic acid of the present disclosure can be partially or completely modified along the entire length of the molecule. For example, one or more or all or a given type of nucleotides (e.g., purine or pyrimidine, or any one or more or all of A, G, U, C) can be uniformly modified in the nucleic acid of the present disclosure or in its predetermined sequence region (e.g., in an mRNA including or not including a poly A tail). In some embodiments, all nucleotides X in the nucleic acid of the present disclosure (or in its sequence region) are modified nucleotides, wherein X can be any one of nucleotides A, G, U, C, or any one of the combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C or A+G+C.

[0588] The nucleic acid may contain from about 1% to about 100% modified nucleotides (relative to the total nucleotide content, or relative to one or more types of nucleotides, i.e., any one or more of A, G, U, or C), or any intermediate percentage (e.g., 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, 1% to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90%, 10% to 95%, 10% to 10 ... %, 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%). It will be understood that any remaining percentages are explained by the presence of unmodified A, G, U, or C.

[0589] Nucleic acid can contain at least 1% and at most 100% modified nucleotides, or any intermediate percentage, such as at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides or at least 90% modified nucleotides. For example, nucleic acid can contain modified pyrimidines, such as modified uracils or cytosines. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of uracils in nucleic acid are replaced by modified uracils (e.g., 5-substituted uracils). Modified uracils can be replaced by compounds with a single unique structure, or can be replaced by a variety of compounds with different structures (e.g., 2, 3, 4 or more unique structures). In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the cytosine in the nucleic acid is replaced by a modified cytosine (e.g., a 5-substituted cytosine). The modified cytosine can be replaced by a compound with a single unique structure, or can be replaced by a variety of compounds with different structures (e.g., 2, 3, 4 or more unique structures).

[0590] 14. Sequence optimization and its methods

[0591] In some embodiments, the polynucleotides of the present disclosure comprise sequence-optimized nucleotide sequences encoding polypeptides disclosed herein, e.g., polynucleotides encoding therapeutic payloads or prophylactic payloads. In some embodiments, the polynucleotides of the present disclosure comprise an open reading frame (ORF) encoding a therapeutic payload or a prophylactic payload, wherein the ORF has been sequence optimized.

[0592] The sequence-optimized nucleotide sequences disclosed herein differ from corresponding wild-type nucleotide sequences and other known sequence-optimized nucleotide sequences, for example, in that these sequence-optimized nucleic acids have unique compositional characteristics.

[0593] In some embodiments, relative to the percentage of uracil or thymine nucleobase in the reference wild-type nucleotide sequence, the percentage of uracil or thymine nucleobase in the sequence-optimized nucleotide sequence is modified (e.g., reduced). Such a sequence is referred to as a uracil-modified or thymine-modified sequence. The percentage of uracil or thymine content in the nucleotide sequence can be determined by dividing the number of uracil or thymine in the sequence by the total number of nucleotides and multiplied by 100. In some embodiments, the nucleotide sequence of sequence optimization has a uracil or thymine content lower than the uracil or thymine content in the reference wild-type sequence. In some embodiments, the uracil or thymine content in the nucleotide sequence of sequence optimization of the present disclosure is greater than the uracil or thymine content in the reference wild-type sequence and still maintains a beneficial effect, e.g., expression and / or signal response increased when compared with the reference wild-type sequence.

[0594] In some embodiments, the optimized sequence of the present disclosure contains a unique range of uracil or thymine (if it is DNA) in the sequence. The uracil or thymine content of the optimized sequence can be expressed in a variety of ways, for example, relative to the theoretical minimum (UTM% or TTM%), relative to the wild type (UWT% or TWT%) and relative to the uracil or thymine content of the optimized sequence of total nucleotide content (UTL% or TTL%). For DNA, it is recognized that thymine (T) replaces uracil (U) and is replaced with T where U appears. For RNA, it is recognized that uracil (U) replaces thymine (T) to exist. When providing a DNA sequence by replacing thymine in the DNA sequence with uracil, those skilled in the art can easily obtain RNA sequences. Therefore, all disclosures related to, for example, UTM%, UWT% or UTL% (about RNA) are equally applicable to TTM%, TWT% or TTL% (about DNA).

[0595] The uracil or thymine content relative to the uracil or thymine theoretical minimum refers to a parameter determined by dividing the number of uracil or thymine in the nucleotide sequence of sequence optimization by the total number of uracil or thymine in the hypothetical nucleotide sequence and multiplying by 100, wherein all codons in the hypothetical sequence are replaced by synonymous codons with the lowest possible uracil or thymine content. This parameter is abbreviated as UTM% or TTM% in this article.

[0596] In some embodiments, the uracil-modified sequence of the present disclosure has a continuous uracil with a reduced number relative to the corresponding wild-type nucleic acid sequence. For example, two continuous leucines can be encoded by the sequence CUUUUG, and the sequence includes a four-uracil cluster. This seed sequence can be substituted, for example, with CUGCUC, and the sequence removes the uracil cluster. Phenylalanine can be encoded by UUC or UUU. Therefore, even if the phenylalanine encoded by UUU is replaced by UUC, the synonymous codon still contains uracil pairs (UU). Therefore, the number of phenylalanine in the sequence establishes the minimum number of uracil pairs (UU) that cannot be eliminated when the number of phenylalanine in the encoded polypeptide is not changed.

[0597] In some embodiments, the uracil-modified sequences of the present disclosure have a reduced number of uracil triplets (UUU) relative to the wild-type nucleic acid sequence. In some embodiments, the uracil-modified sequences have a reduced number of uracil pairs (UU) relative to the number of uracil pairs (UU) in the wild-type nucleic acid sequence. In some embodiments, the uracil-modified sequences of the present disclosure have a number of uracil pairs (UU) corresponding to the minimum possible number of uracil pairs (UU) in the wild-type nucleic acid sequence.

[0598] The phrase "uracil pairs (UU) relative to uracil pairs (UU) in a wild-type nucleic acid sequence" refers to a parameter determined by dividing the number of uracil pairs (UU) in a sequence-optimized nucleotide sequence by the total number of uracil pairs (UU) in the corresponding wild-type nucleotide sequence and multiplying by 100. This parameter is abbreviated herein as UUwt%. In some embodiments, the uracil-modified sequence has a UUwt% of less than 100%.

[0599] In some embodiments, the polynucleotides of the present disclosure comprise uracil-modified sequences. In some embodiments, the uracil-modified sequences comprise at least one chemically modified nucleobase, e.g., 5-methoxyuracil. In some embodiments, at least 95% of the nucleobases (e.g., uracil) in the uracil-modified sequences of the present disclosure are modified nucleobases. In some embodiments, at least 95% of the uracils in the uracil-modified sequences are 5-methoxyuracil.

[0600] In some embodiments, the polynucleotides of the present disclosure are sequence optimized.

[0601] A sequence-optimized nucleotide sequence (nucleotide sequence is also referred to herein as a "nucleic acid") comprises at least one codon modification relative to a reference sequence (e.g., a wild-type sequence encoding a therapeutic payload or a prophylactic payload). Thus, in a sequence-optimized nucleic acid, at least one codon is different from the corresponding codon in the reference sequence (e.g., a wild-type sequence).

[0602] In general, sequence-optimized nucleic acids are produced by at least one step, the step comprising replacing codons in a reference sequence with synonymous codons (i.e., codons encoding the same amino acid). For example, such replacements can be achieved by applying a codon substitution map (i.e., providing a table of codons encoding each amino acid in a codon-optimized sequence) or by applying a set of rules (e.g., if glycine is immediately after a neutral amino acid, then glycine will be encoded by a certain codon, but if immediately after a polar amino acid, then it will be encoded by another codon). In addition to codon replacement (i.e., "codon optimization"), the sequence optimization method disclosed herein includes additional optimization steps that are not strictly for codon optimization, such as removing harmful motifs (destabilizing motif substitutions). Compositions and preparations comprising these sequence-optimized nucleic acids (e.g., RNA, e.g., mRNA) can be administered to subjects in need to promote in vivo expression of functionally active substances encoding therapeutic payloads or preventive payloads.

[0603] Additional and exemplary sequence optimization methods are disclosed in International PCT Application WO 2017 / 201325 filed on May 18, 2017, the entire contents of which are hereby incorporated by reference.

[0604] 15. Lipid Content of Lipid Nanoparticles

[0605] As described above, with respect to lipids, LNPs used as delivery vehicles disclosed herein comprise (i) ionizable lipids; (ii) sterols or other structural lipids; (iii) non-cationic auxiliary lipids or phospholipids; and optionally (iv) PEG lipids. These classes of lipids are described in more detail below.

[0606] In some embodiments, the nucleic acid of the present invention is formulated into a lipid nanoparticle (LNP) composition. Lipid nanoparticles generally include amino lipids, phospholipids, structural lipids and PEG lipid components and nucleic acid cargo of interest. The lipid nanoparticles of the present invention can be produced using components, compositions and methods generally known in the art, see, for example, PCT / US2016 / 052352; PCT / US2016 / 068300; PCT / US2017 / 037551; PCT / US2015 / 027400; PCT / US2016 / 047406; PCT / US2016000129; PCT / US2016 / 014280; PCT / US PCT / US2014 / 66242, all of which are incorporated herein by reference in their entirety.

[0607] In some embodiments, the lipid nanoparticles comprise amino lipids at a molar ratio of 20-60% relative to other lipid components. For example, the lipid nanoparticles can comprise amino lipids at a molar ratio of 20-50%, 20-40%, 20-30%, 30-60%, 30-50%, 30-40%, 40-60%, 40-50% or 50-60%. In some embodiments, the lipid nanoparticles comprise amino lipids at a molar ratio of 20%, 30%, 40%, 50 or 60%.

[0608] In some embodiments, the lipid nanoparticles comprise a phospholipid at a molar ratio of 5-25% relative to other lipid components. For example, the lipid nanoparticles can comprise a phospholipid at a molar ratio of 5-30%, 5-15%, 5-10%, 10-25%, 10-20%, 10-25%, 15-25%, 15-20%, 20-25% or 25-30%. In some embodiments, the lipid nanoparticles comprise a non-cationic lipid at a molar ratio of 5%, 10%, 15%, 20%, 25% or 30%.

[0609] In some embodiments, lipid nanoparticles include structural lipids with a molar ratio of 25-55% relative to other lipid components. For example, lipid nanoparticles can include structural lipids with a molar ratio of 10-55%, 25-50%, 25-45%, 25-40%, 25-35%, 25-30%, 30-55%, 30-50%, 30-45%, 30-40%, 30-35%, 35-55%, 35-50%, 35-45%, 35-40%, 40-55%, 40-50%, 40-45%, 45-55%, 45-50% or 50-55%. In some embodiments, lipid nanoparticles include structural lipids with a molar ratio of 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% or 55%.

[0610] In some embodiments, the lipid nanoparticle comprises a PEG lipid at a molar ratio of 0.5-15% relative to other lipid components. For example, the lipid nanoparticle can comprise a PEG lipid at a molar ratio of 0.5-10%, 0.5-5%, 1-15%, 1-10%, 1-5%, 2-15%, 2-10%, 2-5%, 5-15%, 5-10% or 10-15%. In some embodiments, the lipid nanoparticle comprises a PEG-lipid at a molar ratio of 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14% or 15%.

[0611] In some embodiments, the lipid nanoparticles comprise a molar ratio of 20-60% amino lipids, 5-25% phospholipids, 25-55% structural lipids, and 0.5-15% PEG lipids.

[0612] In some embodiments, the lipid nanoparticles comprise a molar ratio of 20-60% amino lipids, 5-30% phospholipids, 10-55% structural lipids, and 0.5-15% PEG lipids.

[0613] Ionizable amino lipids

[0614] In some aspects, the present disclosure relates to compounds of formula (I):

[0615] or an N-oxide thereof, or a salt or isomer thereof,

[0616] wherein R'a is an R' branch; wherein

[0617] The R′ branch is: in Indicates a connection point;

[0618] wherein Raα, Raβ, Ray and Raδ are each independently selected from the group consisting of H, C2-12 alkyl and C2-12 alkenyl;

[0619] R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl;

[0620] R4 is selected from the group consisting of: -(CH2)nOH, wherein n is selected from the group consisting of 1, 2, 3, 4 and 5, and

[0621] in represents a connection point;

[0622] R10 is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10;

[0623] Each R5 is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl and H;

[0624] Each R6 is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl and H;

[0625] M and M' are each independently selected from the group consisting of -C(O)O- and -OC(O)-;

[0626] R′ is a C1-12 alkyl group or a C2-12 alkenyl group;

[0627] 1 is selected from the group consisting of 1, 2, 3, 4 and 5; and

[0628] m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12 and 13.

[0629] In some embodiments of the compound of formula (I), R'a is R' branched;

[0630] The R′ branch is represents the point of attachment; Raα, Raβ, Raγ and Raδ are each H; R2 and R3 are each C1-14 alkyl; R4 is -(CH2)nOH; n is 2; each R5 is H; each R6 is H; M and M′ are each -C(O)O-; R′ is C1-12 alkyl; 1 is 5; and m is 7.

[0631] In some embodiments of the compound of formula (I), R'a is R' branched;

[0632] The R′ branch is represents the point of attachment; Raα, Raβ, Ray and Raδ are each H; R2 and R3 are each C1-14 alkyl; R4 is -(CH2)nOH; n is 2; each R5 is H; each R6 is H; M and M′ are each -C(O)O-; R′ is C1-12 alkyl; l is 3; and m is 7.

[0633] In some embodiments of the compound of formula (I), R'a is R' branched;

[0634] The R′ branch is represents the point of attachment; Raα is a C2-12 alkyl group; Raβ, Raγ and Raδ are each H; R2 and R3 are each a C1-14 alkyl group; R4 is R10 is NH(C1-6 alkyl); n2 is 2; R5 is H; each R6 is H; M and M′ are each -C(O)O-; R′ is C1-12 alkyl; 1 is 5; and m is 7.

[0635] In some embodiments of the compound of formula (I), R'a is R' branched;

[0636] The R′ branch is represents the point of attachment; Raα, Raβ and Raδ are each H; Raγ is C2-12 alkyl; R2 and R3 are each C1-14 alkyl; R4 is -(CH2)nOH; n is 2; each R5 is H; each R6 is H; M and M′ are each -C(O)O-; R′ is C1-12 alkyl; 1 is 5; and m is 7.

[0637] In some embodiments, the compound of formula (I) is selected from:

[0638]

[0639] and

[0640]

[0641] In some embodiments, the compound of formula (I) is:

[0642]

[0643] In some embodiments, the compound of formula (I) is:

[0644]

[0645] In some embodiments, the compound of formula (I) is:

[0646]

[0647] In some embodiments, the compound of formula (I) is:

[0648]

[0649] In some aspects, the present disclosure relates to compounds of formula (Ia):

[0650] or its N-oxide, or its salt or isomer, wherein R'a is an R' branched chain; wherein

[0651] The R′ branch is: in Indicates a connection point;

[0652] wherein Raβ, Ray and Raδ are each independently selected from the group consisting of C2-12 alkyl and C2-12 alkenyl;

[0653] R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl;

[0654] R4 is selected from the group consisting of: -(CH2)nOH, wherein n is selected from the group consisting of 1, 2, 3, 4 and 5, and

[0655] in represents a connection point;

[0656] R10 is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10;

[0657] Each R5 is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl and II;

[0658] Each R6 is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl and H;

[0659] M and M' are each independently selected from the group consisting of -C(O)O- and -OC(O)-;

[0660] R′ is a C1-12 alkyl group or a C2-12 alkenyl group;

[0661] l is selected from the group consisting of 1, 2, 3, 4 and 5; and

[0662] m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12 and 13.

[0663] In some aspects, the present disclosure relates to compounds of formula (Ib):

[0664] or an N-oxide thereof, or a salt or isomer thereof,

[0665] wherein R'a is an R' branch; wherein

[0666] The R′ branch is: in Indicates a connection point;

[0667] wherein Raα, Raβ, Ray and Raδ are each independently selected from the group consisting of H, C2-12 alkyl and C2-12 alkenyl;

[0668] R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl;

[0669] R4 is -(CH2)nOH, wherein n is selected from the group consisting of 1, 2, 3, 4 and 5;

[0670] Each R5 is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl and H;

[0671] Each R6 is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl and H;

[0672] M and M' are each independently selected from the group consisting of -C(O)O- and -OC(O)-;

[0673] R′ is a C1-12 alkyl group or a C2-12 alkenyl group;

[0674] 1 is selected from the group consisting of 1, 2, 3, 4 and 5; and

[0675] m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12 and 13.

[0676] In some embodiments of Formula (I) or Formula (Ib), R'a is R' branched; R' branched is represents the point of attachment; Raβ, Raγ and Raδ are each H; R2 and R3 are each C1-14 alkyl; R4 is -(CH2)nOH; n is 2; each R5 is H; each R6 is H; M and M′ are each -C(O)O-; R′ is C1-12 alkyl; 1 is 5; and m is 7.

[0677] In some embodiments of Formula (I) or Formula (Ib), R'a is R' branched; R' branched is represents the point of attachment; Raβ, Ray and Raδ are each H; R2 and R3 are each C1-14 alkyl; R4 is -(CH2)nOH; n is 2; each R5 is H; each R6 is H; M and M′ are each -C(O)O-; R′ is C1-12 alkyl; 1 is 3; and m is 7.

[0678] In some embodiments of Formula (I) or Formula (Ib), R'a is R' branched; R' branched is represents the point of attachment; Raβ and Raδ are each H; Ray is C2-12 alkyl; R2 and R3 are each C1-14 alkyl; R4 is -(CH2)nOH; n is 2; each R5 is H; each R6 is H; M and M′ are each -C(O)O-; R′ is C1-12 alkyl; 1 is 5; and m is 7.

[0679] In some aspects, the present disclosure relates to compounds of formula (Ic):

[0680] or an N-oxide thereof, or a salt or isomer thereof,

[0681] wherein R'a is an R' branch; wherein

[0682] The R′ branch is: in Indicates a connection point;

[0683] wherein Raα, Raβ, Raγ and Raδ are each independently selected from the group consisting of H, C2-12 alkyl and C2-12 alkenyl;

[0684] R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl;

[0685] R4 is

[0686] in represents a connection point;

[0687] R10 is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl and H; n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10;

[0688] Each R5 is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl and H;

[0689] Each R6 is independently selected from the group consisting of C1-3 alkyl, C2-3 alkenyl and H;

[0690] M and M' are each independently selected from the group consisting of -C(O)O- and -OC(O)-;

[0691] R′ is a C1-12 alkyl group or a C2-12 alkenyl group;

[0692] 1 is selected from the group consisting of 1, 2, 3, 4 and 5; and

[0693] m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12 and 13.

[0694] In some embodiments, R'a is an R' branch; an R' branch is represents the point of attachment; Raβ, Ray and Raδ are each H; Raα is a C2-12 alkyl group; R2 and R3 are each a C1-14 alkyl group; R4 is represents the point of attachment; R10 is NH(C1-6 alkyl); n2 is 2; each R5 is H; each R6 is H; M and M′ are each -C(O)O-; R′ is C1-12 alkyl; 1 is 5; and m is 7.

[0695] In some embodiments, the compound of formula (Ic) is:

[0696]

[0697] In some aspects, the present disclosure relates to compounds of formula (II):

[0698] or its N-oxide, or its salt or isomer, wherein R'a is R' branched or R' cyclic; wherein

[0699] The R′ branch is: And the R′ annularity is: and

[0700] R′b is:

[0701] in Indicates a connection point;

[0702] Raγ and Raδ are each independently selected from the group consisting of H, C1-12 alkyl and C2-12 alkenyl, wherein at least one of Raγ and Raδ is selected from the group consisting of C1-12 alkyl and C2-12 alkenyl;

[0703] Rbγ and Rbδ are each independently selected from the group consisting of H, C1-12 alkyl and C2-12 alkenyl, wherein at least one of Rbγ and Rbδ is selected from the group consisting of C1-12 alkyl and C2-12 alkenyl;

[0704] R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl;

[0705] R4 is selected from the group consisting of: -(CH2)nOH, wherein n is selected from the group consisting of 1, 2, 3, 4 and 5, and

[0706] in represents a connection point;

[0707] R10 is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10;

[0708] Each R′ is independently C1-12 alkyl or C2-12 alkenyl;

[0709] Ya is a C3-6 carbon ring;

[0710] R*″a is selected from the group consisting of C1-15 alkyl and C2-15 alkenyl; and

[0711] s is 2 or 3;

[0712] m is selected from 1, 2, 3, 4, 5, 6, 7, 8 and 9;

[0713] 1 is selected from 1, 2, 3, 4, 5, 6, 7, 8 and 9.

[0714] In some aspects, the present disclosure relates to compounds of formula (II-a):

[0715] or its N-oxide, or its salt or isomer, wherein R'a is R' branched or R' cyclic; wherein

[0716] The R′ branch is: and R'b is:

[0717] in Indicates a connection point;

[0718] Raγ and Raδ are each independently selected from the group consisting of H, C1-12 alkyl and C2-12 alkenyl, wherein at least one of Ray and Raδ is selected from the group consisting of C1-12 alkyl and C2-12 alkenyl;

[0719] Rbγ and Rbδ are each independently selected from the group consisting of H, C1-12 alkyl and C2-12 alkenyl, wherein at least one of Rbγ and Rbδ is selected from the group consisting of C1-12 alkyl and C2-12 alkenyl;

[0720] R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl;

[0721] R4 is selected from the group consisting of: -(CH2)nOH, wherein n is selected from the group consisting of 1, 2, 3, 4 and 5, and

[0722] in represents a connection point;

[0723] R70 is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10;

[0724] Each R′ is independently C1-12 alkyl or C2-12 alkenyl;

[0725] m is selected from 1, 2, 3, 4, 5, 6, 7, 8 and 9;

[0726] 1 is selected from 1, 2, 3, 4, 5, 6, 7, 8 and 9.

[0727] In some aspects, the present disclosure relates to compounds of formula (II-b):

[0728] or its N-oxide, or its salt or isomer, wherein R'a is R' branched or R' cyclic; wherein

[0729] The R′ branch is: And R′b is:

[0730] in Indicates a connection point;

[0731] Raγ and Rbγ are each independently selected from the group consisting of C1-12 alkyl and C2-12 alkenyl;

[0732] R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl;

[0733] R4 is selected from the group consisting of: -(CH2)nOH, wherein n is selected from the group consisting of 1, 2, 3, 4 and 5, and

[0734] in represents a connection point;

[0735] R10 is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10;

[0736] Each R′ is independently C1-12 alkyl or C2-12 alkenyl;

[0737] m is selected from 1, 2, 3, 4, 5, 6, 7, 8 and 9;

[0738] 1 is selected from 1, 2, 3, 4, 5, 6, 7, 8 and 9.

[0739] In some aspects, the present disclosure relates to compounds of formula (II-c):

[0740] or its N-oxide, or its salt or isomer, wherein R'a is R' branched or R' cyclic; wherein

[0741] The R′ branch is: And R′b is:

[0742] in Indicates a connection point;

[0743] wherein RaT is selected from the group consisting of C1-12 alkyl and C2-12 alkenyl;

[0744] R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl;

[0745] R4 is selected from the group consisting of: -(CH2)nOH, wherein n is selected from the group consisting of 1, 2, 3, 4 and 5, and

[0746] in represents a connection point;

[0747] R10 is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10;

[0748] R′ is a C1-12 alkyl group or a C2-12 alkenyl group;

[0749] m is selected from 1, 2, 3, 4, 5, 6, 7, 8 and 9;

[0750] l is selected from 1, 2, 3, 4, 5, 6, 7, 8 and 9.

[0751] In some aspects, the present disclosure relates to compounds of formula (II-d):

[0752] or its N-oxide, or its salt or isomer, wherein R'a is R' branched or R' cyclic; wherein

[0753] The R′ branch is: And R′b is:

[0754] in Indicates a connection point;

[0755] wherein Raγ and Rbγ are each independently selected from the group consisting of C1-12 alkyl and C2-12 alkenyl;

[0756] R4 is selected from the group consisting of: -(CH2)nOH, wherein n is selected from the group consisting of 1, 2, 3, 4 and 5, and

[0757] in represents a connection point;

[0758] R10 is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10;

[0759] Each R′ is independently C1-12 alkyl or C2-12 alkenyl;

[0760] m is selected from 1, 2, 3, 4, 5, 6, 7, 8 and 9;

[0761] 1 is selected from 1, 2, 3, 4, 5, 6, 7, 8 and 9.

[0762] In some aspects, the present disclosure relates to compounds of formula (II-e):

[0763] or its N-oxide, or its salt or isomer, wherein R'a is R' branched or R' cyclic; wherein

[0764] The R′ branch is: And R′b is:

[0765] in Indicates a connection point;

[0766] wherein RaT is selected from the group consisting of C1-12 alkyl and C2-12 alkenyl;

[0767] R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl;

[0768] R4 is -(CH2)nOH, wherein n is selected from the group consisting of 1, 2, 3, 4 and 5;

[0769] R′ is a C1-12 alkyl group or a C2-12 alkenyl group;

[0770] m is selected from 1, 2, 3, 4, 5, 6, 7, 8 and 9;

[0771] 1 is selected from 1, 2, 3, 4, 5, 6, 7, 8 and 9.

[0772] In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d) or (II-e), m and l are each independently selected from 4, 5 and 6. In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d) or (II-e), m and l are each 5.

[0773] In some embodiments of compounds of formula (II), (II-a), (II-b), (II-c), (II-d) or (II-e), each R′ is independently a C1-12 alkyl. In some embodiments of compounds of formula (II), (II-a), (II-b), (II-c), (II-d) or (II-e), each R′ is independently a C2-5 alkyl.

[0774] In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d) or (II-e), R′b is: and R2 and R3 are each independently C1-14 alkyl. In some embodiments of the compound of formula (II), formula (II-a), formula (II-b), formula (II-c), formula (II-d) or formula (II-e), R′b is: and R2 and R3 are each independently C6-10 alkyl. In some embodiments of the compound of formula (II), formula (II-a), formula (II-b), formula (II-c), formula (II-d) or formula (II-e), R′b is: And R2 and R3 are each a C8 alkyl group.

[0775] In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), the R′ branch is: and R'b is: Raγ is C1-12 alkyl and R2 and R3 are each independently C6-10 alkyl. In some embodiments of the compound of formula (II), formula (II-a), formula (II-b), formula (II-c), formula (II-d) or formula (II-e), the R' branch is: and R'b is: Raγ is C2-6 alkyl and R2 and R3 are each independently C6-10 alkyl. In some embodiments of the compound of formula (II), formula (II-a), formula (II-b), formula (II-c), formula (II-d) or formula (II-e), the R' branch is: and R'b is: Raγ is a C2-6 alkyl group, and R2 and R3 are each a C8 alkyl group.

[0776] In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), the R′ branch is: R′b is: and Raγ and Rbγ are each C1-12 alkyl. In some embodiments of the compound of formula (II), formula (II-a), formula (II-b), formula (II-c), formula (II-d) or formula (II-e), the R′ branch is: R'b is: And Ray and Rbγ are each a C2-6 alkyl group.

[0777] In some embodiments of compounds of formula (II), (II-a), (II-b), (II-c), (II-d) or (II-e), m and l are each independently selected from 4, 5 and 6, and each R' is independently C1-12 alkyl. In some embodiments of compounds of formula (II), (II-a), (II-b), (II-c), (II-d) or (II-e), m and l are each 5 and each R' is independently C2-5 alkyl.

[0778] In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), the R′ branch is: R′b is: m and l are each independently selected from 4, 5 and 6, each R' is independently C1-12 alkyl, and Raγ and Rbγ are each C1-12 alkyl. In some embodiments of the compound of formula (II), formula (II-a), formula (II-b), formula (II-c), formula (II-d) or formula (II-e), the R' branch is: R'b is: m and l are each 5, each R' is independently a C2-5 alkyl group, and Ray and Rbγ are each a C2-6 alkyl group.

[0779] In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), the R′ branch is: and R'b is: m and 1 are each independently selected from 4, 5 and 6, R' is a C1-12 alkyl, Raγ is a C1-12 alkyl and R2 and R3 are each independently a C6-10 alkyl. In some embodiments of the compound of formula (II), formula (II-a), formula (II-b), formula (II-c), formula (II-d) or formula (II-e), the R' branch is: and R'b is: m and 1 are each 5, R' is a C2-5 alkyl group, Raγ is a C2-6 alkyl group, and R2 and R3 are each a C8 alkyl group.

[0780] In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d) or (II-e), R4 is wherein R10 is NH(C1-6 alkyl) and n2 is 2. In some embodiments of the compound of formula (II), (II-a), (II-b), (II-c), (II-d) or (II-e), R4 is wherein R10 is NH(CH3) and n2 is 2.

[0781] In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), the R′ branch is: R′b is: m and 1 are each independently selected from 4, 5 and 6, each R′ is independently C1-12 alkyl, Raγ and Rbγ are each C1-12 alkyl, and R4 is wherein R10 is NH(C1-6 alkyl), and n2 is 2. In some embodiments of the compound of formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), the R′ branch is: R'b is: m and l are each 5, each R' is independently C2-5 alkyl, Ray and Rbγ are each C2-6 alkyl, and R4 is wherein R10 is NH(CH3) and n2 is 2.

[0782] In some embodiments of the compound of Formula (II), (II-a), (II-b), (II-c), (II-d), or (II-e), the R′ branch is: and R'b is: m and 1 are each independently selected from 4, 5 and 6, R' is a C1-12 alkyl group, R2 and R3 are each independently a C6-10 alkyl group, Ray is a C1-12 alkyl group, and R4 is wherein R10 is NH(C1-6 alkyl) and n2 is 2. In some embodiments of the compound of formula (II), formula (Il-a), formula (II-b), formula (II-c), formula (II-d) or formula (II-e), the R′ branch is: and R'b is: m and l are each 5, R' is a C2-5 alkyl group, Ray is a C2-6 alkyl group, R2 and R3 are each a C8 alkyl group, and R4 is wherein R10 is NH(CH3) and n2 is 2.

[0783] In some embodiments of compounds of Formula (II), (II-a), (II-b), (II-c), (II-d) or (II-e), R4 is -(CH2)nOH and n is 2, 3 or 4. In some embodiments of compounds of Formula (II), (II-a), (II-b), (II-c), (II-d) or (II-e), R4 is -(CH2)nOH and n is 2.

[0784] In some embodiments of the compound of Formula (II), Formula (TI-a), Formula (TT-b), Formula (II-c), Formula (II-d), or Formula (II-e), the R′ branch is: R′b is: m and 1 are each independently selected from 4, 5 and 6, each R′ is independently C1-12 alkyl, Raγ and Rbγ are each C1-12 alkyl, R4 is -(CH2)nOH, and n is 2, 3 or 4. In some embodiments of the compound of formula (II), (II-a), (II-b), (II-c), (II-d) or (II-e), the R′ branch is: R′b is: m and 1 are each 5, each R′ is independently a C2-5 alkyl group, Ray and Rbγ are each a C2-6 alkyl group, R4 is -(CH2)nOH, and n is 2.

[0785] In some aspects, the present disclosure relates to compounds of formula (II-f):

[0786] or its N-oxide, or its salt or isomer, wherein R'a is R' branched or R' cyclic; wherein

[0787] The R′ branch is: and R'b is:

[0788] in Indicates a connection point;

[0789] Raγ is C1-12 alkyl;

[0790] R2 and R3 are each independently C1-14 alkyl;

[0791] R4 is -(CH2)nOH, wherein n is selected from the group consisting of 1, 2, 3, 4 and 5;

[0792] R′ is a C1-12 alkyl group;

[0793] m is selected from 4, 5 and 6; and

[0794] 1 is selected from 4, 5 and 6.

[0795] In some embodiments of the compound of Formula (II-f), m and l are each 5, and n is 2, 3 or 4.

[0796] In some embodiments of the compound of formula (II-f), R' is C2-5 alkyl, Ray is C2-6 alkyl, and R2 and R3 are each C6-10 alkyl.

[0797] In some embodiments of compounds of formula (II-f), m and l are each 5, and n is 2, 3 or 4, R' is C2-5 alkyl, Ray is C2-6 alkyl, and R2 and R3 are each C6-10 alkyl.

[0798] In some aspects, the present disclosure relates to compounds of formula (II-g):

[0799] in

[0800] Ray is a C2-6 alkyl group;

[0801] R' is C2-5 alkyl; and

[0802] R4 is selected from the group consisting of: -(CH2)nOH, wherein n is selected from the group consisting of 3, 4 and 5, and

[0803] in represents the point of attachment, R10 is NH(C1-6 alkyl), and n2 is selected from the group consisting of 1, 2 and 3.

[0804] In some aspects, the present disclosure relates to compounds of formula (II-h):

[0805] in

[0806] Ray and Rby are independently C2-6 alkyl;

[0807] Each R' is independently C2-5 alkyl; and

[0808] R4 is selected from the group consisting of: -(CH2)nOH, wherein n is selected from the group consisting of 3, 4 and 5, and

[0809] in represents the point of attachment, R10 is NH(C1-6 alkyl), and n2 is selected from the group consisting of 1, 2 and 3.

[0810] In some embodiments of the compound of Formula (II-g) or Formula (II-h), R4 is in

[0811] R10 is NH(CH3) and n2 is 2.

[0812] In some embodiments of compounds of Formula (II-g) or Formula (II-h), R4 is -(CH2)2OH.

[0813] In some aspects, the present disclosure relates to compounds having formula (III):

[0814]

[0815] or a salt or isomer thereof, wherein

[0816] R1, R2, R3, R4 and R5 are independently selected from the group consisting of C5-20 alkyl, C5-20 alkenyl, -R"MR', -R*YR", -YR" and -R*OR";

[0817] each M is independently selected from the group consisting of -C(O)O-, -OC(O)-, -OC(O)O-, -C(O)N(R′)-, -N(R′)C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR′)O-, -S(O)2-, aryl, and heteroaryl;

[0818] X1, X2 and X3 are independently selected from the group consisting of a bond, -CH2-, -(CH2)2-, -CHR-, -CHY-, -C(O)-, -C(O)O-, -OC(O)-, -C(O)-CH2-, -CH2-C(O)-, -C(O)O-CH2-, -OC(O)-CH2-, -CH2-C(O)O-, -CH2-OC(O)-, -CH(OH)-, -C(S)- and -CH(SH)-;

[0819] Each Y is independently a C3-6 carbocyclic ring;

[0820] Each R* is independently selected from the group consisting of C1-12 alkyl and C2-12 alkenyl;

[0821] Each R is independently selected from the group consisting of C1-3 alkyl and C3-6 carbocycle;

[0822] Each R′ is independently selected from the group consisting of C1-12 alkyl, C2-12 alkenyl, and H; and

[0823] Each R″ is independently selected from the group consisting of C3-12 alkyl and C3-12 alkenyl, and wherein:

[0824] i) at least one of X1, X2 and X3 is not -CH2-; and / or

[0825] ii) at least one of R1, R2, R3, R4 and R5 is -R"MR'.

[0826] In some embodiments, R1, R2, R3, R4 and R5 are each C5-20 alkyl; X1 is -CH2-; and X2 and X3 are each -C(O)-.

[0827] In some embodiments, the compound of formula (III) is:

[0828] or a salt or isomer thereof.

[0829] Phospholipids

[0830] The lipid composition of the lipid nanoparticle composition disclosed herein can comprise one or more phospholipids, for example, one or more saturated or (poly) unsaturated phospholipids or combinations thereof. In general, a phospholipid comprises a phospholipid portion and one or more fatty acid portions.

[0831] The phospholipid moiety may be selected from, for example, the non-limiting group consisting of phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidic acid, 2-lysophosphatidylcholine, and sphingomyelin.

[0832] The fatty acid moiety can be selected from, for example, the non-limiting group consisting of lauric acid, myristic acid, myristic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanic acid, arachidic acid, arachidic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid.

[0833] Specific phospholipids can promote fusion with membrane.For example, cationic phospholipids can interact with one or more negatively charged phospholipids of membrane (e.g., cell membrane or intracellular membrane).The fusion of phospholipids with membrane can allow one or more elements (e.g., therapeutic agent) of lipid-containing compositions (e.g., LNP) to be transmitted through the membrane, thereby allowing, for example, the one or more elements to be delivered to the target tissue.

[0834] Non-natural phospholipid materials are also contemplated, including natural materials with modifications and substitutions including branching, oxidation, cyclization, and alkynes. For example, phospholipids can be functionalized with one or more alkynes (e.g., alkenyl groups in which one or more double bonds are replaced by triple bonds) or cross-linked with one or more alkynes. Under appropriate reaction conditions, the alkyne group can undergo a copper-catalyzed cycloaddition after exposure to azide. Such reactions can be used to functionalize the lipid bilayer of nanoparticle compositions to promote membrane penetration or cell recognition, or can be used to conjugate nanoparticle compositions to useful components, such as targeting or imaging moieties (e.g., dyes).

[0835] Phospholipids include, but are not limited to, glycerophospholipids such as phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidylglycerol, and phosphatidic acid. Phospholipids also include phospho-sphingolipids such as sphingomyelin.

[0836] In some embodiments, the phospholipids of the present invention include 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn- Glycerol-3-phosphocholine (DPPC), 1,2-di-decanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), 1-oleoyl-2 cholesterol hemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dialinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-di-docosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytyl-sn-glycero-3-phosphoethanolamine (ME 16.0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-di-docosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-racemic-(1-glycerol) sodium salt (DOPG), sphingomyelin and mixtures thereof.

[0837] In certain embodiments, the phospholipid useful or potentially useful in the present invention is an analog or variant of DSPC. In certain embodiments, the phospholipid useful or potentially useful in the present invention is a compound of formula (IV):

[0838]

[0839] or a salt thereof, wherein:

[0840] each R1 is independently optionally substituted alkyl; or optionally two R1 are joined together with an intervening atom to form an optionally substituted monocyclic carbocyclyl or an optionally substituted monocyclic heterocyclyl; or optionally three R1 are joined together with an intervening atom to form an optionally substituted bicyclic carbocyclyl or an optionally substituted bicyclic heterocyclyl;

[0841] n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10;

[0842] m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10;

[0843] A has the following formula:

[0844] each instance of L2 is independently a bond or optionally substituted C1-6 alkylene, wherein one methylene unit of the optionally substituted C1-6 alkylene is optionally replaced by O, N(RN), S, C(O), C(O)N(RN), NRNC(O), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, or NRNC(O)N(RN);

[0845] Each instance of R2 is independently optionally substituted C1-30 alkyl, optionally substituted C1-30 alkenyl, or optionally substituted C1-30 alkynyl; optionally wherein one or more methylene units of R2 are independently optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), NRN C(=NRN), NRNC(=NRN)N(RN), C(S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(RN)S(O), S(O)N(RN), N(RN)S(O)N(RN), oS(O)N(RN), N(RN)S(O)O, S(O)2, N(RN)S(O)2, S(O)2N(RN), N(RN)S(O)2N(RN), OS(O)2N(RN) or N(RN)S(O)2O substitution;

[0846] Each instance of RN is independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group;

[0847] Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl or optionally substituted heteroaryl; and

[0848] p is 1 or 2;

[0849] The prerequisite is that the compound does not have the formula:

[0850]

[0851] wherein each instance of R2 is independently unsubstituted alkyl, unsubstituted alkenyl or unsubstituted alkynyl.

[0852] In some embodiments, the phospholipid can be one or more of the phospholipids described in US Application No. 62 / 520,530.

[0853] i) Phospholipid head modification

[0854] In certain embodiments, the phospholipids useful or potentially useful in the present invention comprise a modified phospholipid head (e.g., a modified choline group). In certain embodiments, the phospholipid with a modified head is DSPC or an analog thereof with a modified quaternary amine. For example, in embodiments of formula (IV), at least one R1 is not methyl. In certain embodiments, at least one R1 is not hydrogen or methyl. In certain embodiments, the compound of formula (IV) has one of the following formulas:

[0855]

[0856] or a salt thereof, wherein:

[0857] each t is independently 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10;

[0858] each u is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10; and

[0859] Each v is independently 1, 2 or 3.

[0860] In certain embodiments, the compound of formula (IV) has formula (IV-a):

[0861]

[0862] or a salt thereof.

[0863] In certain embodiments, the phospholipids useful or potentially useful in the present invention comprise a cyclic portion in place of the glyceride portion. In certain embodiments, the phospholipids useful in the present invention are DSPC or an analog thereof, which has a cyclic portion in place of the glyceride portion. In certain embodiments, the compound of formula (IV) has formula (IV-b):

[0864]

[0865] or a salt thereof.

[0866] (ii) Phospholipid tail modification

[0867] In certain embodiments, the phospholipids useful or potentially useful in the present invention comprise modified tails. In certain embodiments, the phospholipids useful or potentially useful in the present invention are DSPC or analogs thereof with modified tails. As described herein, the "modified tail" can be a tail with a shorter or longer aliphatic chain, an aliphatic chain with a branched chain, an aliphatic chain with a substituent, an aliphatic chain in which one or more methylene groups are replaced by a cyclic or heteroatom group, or any combination thereof. For example, in certain embodiments, the compound of (IV) has the formula (IV-a), or a salt thereof, wherein at least one instance of R2 is each instance of R2 is optionally substituted C1-30 alkyl, wherein one or more methylene units of R2 are independently optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, C(O)S, SC(O), C(=NRN), C(=NRN)N (RN), NRNC(=NRN), NRNC(=NRN)N(RN), C(S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(RN)S (O), S(O)N(RN), N(RN)S(O)N(RN), OS(O)N(RN), N(RN)S(O)O, S(O)2, N(RN)S(O)2, S(O)2N(RN), N(RN)S(O)2N(RN), OS(O)2N(RN) or N(RN)S(O)2O substitution.

[0868] In certain embodiments, the compound of formula (IV) has formula (IV-c):

[0869]

[0870] or a salt thereof, wherein:

[0871] Each x is independently an integer between 0 and 30, inclusive; and

[0872] Each instance of G is independently selected from the group consisting of optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), NRNC(=NRN), NRNC(=NRN)N(RN), C( S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(RN)S(O), S(O)N(RN), N(RN)S(O)N(RN), OS(O)N(RN), N(RN)S(O)O, S(O)2, N(RN)S(O)2, S(O)2N(RN), N(RN)S(O)2N(RN), OS(O)2N(RN) or N(RN)S(O)2O. Each possibility represents a separate embodiment of the invention.

[0873] In certain embodiments, the phospholipids useful or potentially useful in the present invention comprise a modified phosphorylcholine moiety in which the alkyl chain connecting the quaternary amine to the phosphoryl group is not ethylene (e.g., n is not 2). Thus, in certain embodiments, the phospholipids useful or potentially useful in the present invention are compounds of formula (IV), wherein n is 1, 3, 4, 5, 6, 7, 8, 9, or 10.

[0874] For example, in certain embodiments, the compound of formula (IV) has one of the following formulae:

[0875]

[0876] or a salt thereof.

[0877] Alternative lipids

[0878] In certain embodiments, phospholipids useful or potentially useful in the present invention comprise a modified phosphorylcholine moiety in which the alkyl chain connecting the quaternary amine to the phosphoryl group is not ethylene (e.g., n is not 2). Thus, in certain embodiments, phospholipids are useful.

[0879] In certain embodiments, alternative lipids are used in place of the phospholipids of the disclosure.

[0880] In certain embodiments, the alternative lipid of the invention is oleic acid.

[0881] In certain embodiments, the alternative lipid is one of the following:

[0882]

[0883]

[0884] Structural lipids

[0885] The lipid composition of the pharmaceutical compositions disclosed herein may comprise one or more structured lipids.As used herein, the term "structured lipid" refers to a sterol and also refers to a lipid containing a sterol moiety.

[0886] Incorporating structural lipids into lipid nanoparticles can help alleviate the aggregation of other lipids in the particles. The structural lipids can be selected from a group including but not limited to cholesterol, coprosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, α-tocopherol, hopane, plant sterols, steroids and mixtures thereof. In some embodiments, the structural lipid is a sterol. As defined herein, "sterol" is a steroid subgroup consisting of steroidal steroids. In certain embodiments, the structural lipid is a steroid. In certain embodiments, the structural lipid is cholesterol. In certain embodiments, the structural lipid is an analog of cholesterol. In certain embodiments, the structural lipid is α Alpha-tocopherol.

[0887] In some embodiments, the structured lipid may be one or more of the structured lipids described in US Application No. 62 / 520,530.

[0888] Polyethylene glycol (PEG)-lipid

[0889] The lipid composition of the pharmaceutical compositions disclosed herein may comprise one or more polyethylene glycol (PEG) lipids.

[0890] As used herein, the term "PEG-lipid" refers to a lipid modified by polyethylene glycol (PEG). Non-limiting examples of PEG-lipid include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines and PEG-modified 1,2-diacyloxypropane-3-amine. Such lipids are also referred to as PEGylated lipids. For example, PEG lipids can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC or PEG-DSPE lipids.

[0891] In some embodiments, PEG-lipids include but are not limited to 1,2-dimyristoyl-snn-glyceromethoxypolyethylene glycol (PEG-DMG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)] (PEG-DSPE), PEG-distearylglycerol (PEG-DSG), PEG-dipalmitoleyl, PEG-dioleyl, PEG-distearyl, PEG-diacylglyceramide (PEG-DAG), PEG-dipalmitoylphosphatidylethanolamine (PEG-DPPE), or PEG-1,2-dimyristyloxypropyl-3-amine (PEG-c-DMA).

[0892] In one embodiment, the PEG-lipid is selected from the group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof.

[0893] In some embodiments, the lipid portion of the PEG-lipid includes those with a length of about C14 to about C22, preferably about C14 to about C16. In some embodiments, the size of the PEG portion (e.g., mPEG-NH2) is about 1000, 2000, 5000, 10,000, 15,000 or 20,000 Daltons. In one embodiment, the PEG-lipid is PEG2k-DMG.

[0894] In one embodiment, the lipid nanoparticles described herein may comprise a PEG lipid that is a non-diffusible PEG. Non-limiting examples of non-diffusible PEGs include PEG-DSG and PEG-DSPE.

[0895] PEG-lipids are known in the art, such as those described in U.S. Pat. No. 8,158,601 and International Publication No. WO 2015 / 130584 A2, which are incorporated herein by reference in their entireties.

[0896] In general, some other lipid components (e.g., PEG lipids) of the various formulas described herein can be synthesized as described in International Patent Application No. PCT / US2016 / 000129, entitled “Compositions and Methods for Delivery of Therapeutic Agents,” filed on December 10, 2016, which is incorporated by reference in its entirety.

[0897] The lipid component of lipid nanoparticle composition can include one or more molecules comprising polyethylene glycol, such as PEG or PEG modified lipids. Such substances can be alternatively referred to as PEGylated lipids. PEG lipids are lipids modified with polyethylene glycol. PEG lipids can be selected from the non-limiting groups including PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol and their mixtures. For example, PEG lipids can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC or PEG-DSPE lipids.

[0898] In some embodiments, the PEG-modified lipid is a modified form of PEG DMG. PEG-DMG has the following structure:

[0899]

[0900] In one embodiment, the PEG lipid that can be used for the present invention can be the PEGylated lipid described in International Publication No. WO2012099755, the content of the publication is incorporated herein by reference in its entirety. Any of these exemplary PEG lipids described herein can be modified to include a hydroxyl group on the PEG chain. In certain embodiments, the PEG lipid is a PEG-OH lipid. As generally defined herein, "PEG-OH lipid" (also referred to herein as "hydroxy-PEGylated lipid") is a PEGylated lipid with one or more hydroxyl (-OH) groups on a lipid. In certain embodiments, the PEG-OH lipid is included in one or more hydroxyls on the PEG chain. In certain embodiments, PEG-OH or hydroxy-PEGylated lipids are included in the-OH group at the end of the PEG chain. Each possibility represents a separate embodiment of the present invention.

[0901] In certain embodiments, the PEG lipids useful in the present invention are compounds of formula (V). Provided herein are compounds of formula (V):

[0902]

[0903] or a salt thereof, wherein:

[0904] R3 is -ORO;

[0905] RO is hydrogen, optionally substituted alkyl or oxygen protecting group;

[0906] r is an integer between 1 and 100, inclusive;

[0907] L1 is an optionally substituted C1-10 alkylene group, wherein at least one methylene group of the optionally substituted C1-10 alkylene group is independently replaced by an optionally substituted carbocyclylene group, an optionally substituted heterocyclylene group, an optionally substituted arylene group, an optionally substituted heteroarylene group, O, N(RN), S, C(O), C(O)N(RN), NRNC(O), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O or NRNC(O)N(RN);

[0908] D is a moiety obtained by click chemistry or a moiety cleavable under physiological conditions;

[0909] m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10;

[0910] A has the following formula:

[0911] each instance of L2 is independently a bond or optionally substituted C1-6 alkylene, wherein one methylene unit of the optionally substituted C1-6 alkylene is optionally replaced by O, N(RN), S, C(O), C(O)N(RN), NRNC(O), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, or NRNC(O)N(RN);

[0912] Each instance of R2 is independently optionally substituted C1-30 alkyl, optionally substituted C1-30 alkenyl, or optionally substituted C1-30 alkynyl; optionally wherein one or more methylene units of R2 are independently optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), NRN C(=NRN), NRNC(=NRN)N(RN), C(S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(RN)S(O), S(O)N(RN), N(RN)S(O)N(RN), OS(O)N(RN), N(RN)S(O)O, S(O)2, N(RN)S(O)2, S(O)2N(RN), N(RN)S(O)2N(RN), OS(O)2N(RN) or N(RN)S(O)2O substitution;

[0913] Each instance of RN is independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group;

[0914] Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl or optionally substituted heteroaryl; and

[0915] p Either 1 or 2.

[0916] In certain embodiments, the compound of formula (V) is a PEG-OH lipid (ie, R3 is -ORO, and RO is hydrogen). In certain embodiments, the compound of formula (V) has the formula (V-OH):

[0917]

[0918] or a salt thereof.

[0919] In certain embodiments, the PEG lipid useful in the present invention is a PEGylated fatty acid. In certain embodiments, the PEG lipid useful in the present invention is a compound of formula (VI).

[0920] Provided herein are compounds of formula (VI):

[0921]

[0922] or a salt thereof, wherein:

[0923] R3 is -ORO;

[0924] RO is hydrogen, optionally substituted alkyl or oxygen protecting group;

[0925] r is an integer between 1 and 100, inclusive;

[0926] R5 is optionally substituted C10-40 alkyl, optionally substituted C10-40 alkenyl or optionally substituted C10-40 alkynyl; and optionally one or more methylene groups of R5 are optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), NRNC(=NRN ), NRNC(=NRN)N(RN), C(S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(RN)S(O), S(O) and

[0927] Each instance of RN is independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group.

[0928] In certain embodiments, the compound of formula (VI) has the formula (VI-OH):

[0929]

[0930] or a salt thereof. In some embodiments, r is 45.

[0931] In other embodiments, the compound of formula (VI) is:

[0932]

[0933] or a salt thereof.

[0934] In one embodiment, the compound of formula (VI) is

[0935]

[0936] (Compound I).

[0937] In some aspects, the lipid composition of the pharmaceutical compositions disclosed herein does not comprise PEG-lipid.

[0938] In some embodiments, the PEG-lipid can be one or more of the PEG lipids described in US Application No. 62 / 520,530.

[0939] In some embodiments, the PEG lipids of the present invention include PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol and mixtures thereof. In some embodiments, the PEG-modified lipid is PEG-DMG, PEG-c-DOMG (also referred to as PEG-DOMG), PEG-DSG and / or PEG-DPG.

[0940] In some embodiments, the LNPs of the invention comprise an ionizable cationic lipid of any one of Formula I, Formula II, or Formula III, a phospholipid comprising DSPC, a structural lipid, and a PEG lipid comprising PEG-DMG.

[0941] In some embodiments, the LNPs of the invention comprise an ionizable cationic lipid of any one of Formula I, Formula II, or Formula III, a phospholipid comprising DSPC, a structural lipid, and a PEG lipid comprising a compound having Formula VI.

[0942] In some embodiments, the LNPs of the invention comprise an ionizable cationic lipid of Formula I, Formula II, or Formula III, a phospholipid comprising a compound having Formula IV, a structural lipid, and a PEG lipid comprising a compound having Formula V or Formula VI.

[0943] In some embodiments, the LNPs of the invention comprise an ionizable cationic lipid of Formula I, Formula II, or Formula III, a phospholipid comprising a compound having Formula IV, a structural lipid, and a PEG lipid comprising a compound having Formula V or Formula VI.

[0944] In some embodiments, the LNPs of the invention comprise an ionizable cationic lipid of Formula I, Formula II, or Formula III, a phospholipid having Formula IV, a structural lipid, and a PEG lipid comprising a compound having Formula VI.

[0945] In some embodiments, the LNPs of the invention comprise an ionizable cationic lipid of the formula

[0946]

[0947] and a PEG lipid comprising Formula VI.

[0948] In some embodiments, the LNPs of the invention comprise an ionizable cationic lipid of the formula

[0949]

[0950] and alternative lipids including oleic acid.

[0951] In some embodiments, the LNPs of the invention comprise an ionizable cationic lipid of the formula

[0952]

[0953] Alternative lipids comprising oleic acid, structured lipids comprising cholesterol, and PEG lipids comprising a compound having Formula VI.

[0954] In some embodiments, the LNPs of the invention comprise an ionizable cationic lipid of the formula

[0955]

[0956] A phospholipid comprising DOPE, a structured lipid comprising cholesterol, and a PEG lipid comprising a compound having Formula VI.

[0957] In some embodiments, the LNPs of the invention comprise an ionizable cationic lipid of the formula

[0958]

[0959] A phospholipid comprising DOPE, a structured lipid comprising cholesterol, and a PEG lipid comprising a compound having Formula VI.

[0960] In some embodiments, the LNPs of the invention comprise an N:P ratio of about 2:1 to about 30:1.

[0961] In some embodiments, the LNPs of the invention comprise an N:P ratio of about 6:1.

[0962] In some embodiments, the LNPs of the invention comprise an N:P ratio of about 3:1.

[0963] In some embodiments, the LNPs of the invention comprise a weight / weight ratio of ionizable cationic lipid component to RNA of about 10:1 to about 100:1.

[0964] In some embodiments, the LNPs of the invention comprise a weight / weight ratio of ionizable cationic lipid component to RNA of about 20:1.

[0965] In some embodiments, the LNPs of the invention comprise a weight / weight ratio of ionizable cationic lipid component to RNA of about 10:1.

[0966] In some embodiments, the LNPs of the invention have an average diameter of about 50 nm to about 150 nm.

[0967] In some embodiments, the LNPs of the invention have an average diameter of about 70 nm to about 120 nm.

[0968] As used herein, the term "alkyl", "alkyl group" or "alkylene" means a straight or branched chain saturated hydrocarbon including one or more carbon atoms (e.g., one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty or more carbon atoms), which is optionally substituted. Note that "C1-14 alkyl" means an optionally substituted straight or branched chain saturated hydrocarbon including 1-14 carbon atoms. Unless otherwise specified, the alkyl groups described herein refer to unsubstituted and substituted alkyl groups.

[0969] As used herein, the term "alkenyl", "alkenyl group" or "alkenylene" means a straight or branched hydrocarbon comprising two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty or more carbon atoms) and at least one double bond, which is optionally substituted. The notation "C2-14 alkenyl" means an optionally substituted straight or branched hydrocarbon comprising 2-14 carbon atoms and at least one carbon-carbon double bond. The alkenyl group may include one, two, three, four or more carbon-carbon double bonds. For example, the C18 alkenyl may include one or more double bonds. The C18 alkenyl group comprising two double bonds may be linoleyl. Unless otherwise specified, the alkenyl groups described herein refer to unsubstituted and substituted alkenyl groups.

[0970] As used herein, the term "alkynyl," "alkynyl group," or "alkynylene" means a straight or branched hydrocarbon comprising two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty or more carbon atoms) and at least one carbon-carbon triple bond, which is optionally substituted. The notation "C2-14 alkynyl" means an optionally substituted straight or branched hydrocarbon comprising 2-14 carbon atoms and at least one carbon-carbon triple bond. An alkynyl group may include one, two, three, four or more carbon-carbon triple bonds. For example, a C18 alkynyl group may include one or more carbon-carbon triple bonds. Unless otherwise specified, an alkynyl group described herein refers to an unsubstituted and substituted alkynyl group.

[0971] As used herein, the term "carbocycle" or "carbocyclic group" means a monocyclic or polycyclic system including one or more carbon atom rings that is optionally substituted. The ring can be a three-membered, four-membered, five-membered, six-membered, seven-membered, eight-membered, nine-membered, ten-membered, eleven-membered, twelve-membered, thirteen-membered, fourteen-membered, fifteen-membered, sixteen-membered, seventeen-membered, eighteen-membered, nineteen-membered or twenty-membered ring. The notation "C3-6 carbocycle" means a carbocycle containing a monocyclic ring with 3-6 carbon atoms. The carbocycle can include one or more carbon-carbon double bonds or triple bonds and can be non-aromatic or aromatic (e.g., cycloalkyl or aryl groups). Examples of carbocycles include cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl and 1,2 dihydronaphthyl groups. As used herein, the term "cycloalkyl" means a non-aromatic carbocycle and may or may not include any double or triple bonds. Unless otherwise specified, the carbocycle described herein refers to unsubstituted and substituted carbocyclic groups, that is, optionally substituted carbocycles.

[0972] As used herein, the term "heterocycle" or "heterocyclic group" means an optionally substituted monocyclic or polycyclic system including one or more rings, wherein at least one ring includes at least one heteroatom. The heteroatom can be, for example, a nitrogen, oxygen or sulfur atom. The ring can be a three-membered, four-membered, five-membered, six-membered, seven-membered, eight-membered, nine-membered, ten-membered, eleven-membered, twelve-membered, thirteen-membered or fourteen-membered ring. The heterocycle can include one or more double bonds or triple bonds and can be non-aromatic or aromatic (for example, heterocycloalkyl or heteroaryl groups). Examples of heterocycles include imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furanyl, tetrahydrofuranyl, thienyl, pyridyl, piperidinyl, quinolyl and isoquinolyl groups. As used herein, the term "heterocycloalkyl" means a non-aromatic heterocycle and may or may not include any double or triple bonds. Unless otherwise specified, the heterocycles described herein refer to both unsubstituted and substituted heterocyclic groups, ie, optionally substituted heterocycles.

[0973] As used herein, the term "heteroalkyl", "heteroalkenyl" or "heteroalkynyl" refers to an alkyl, alkenyl, alkynyl, as defined herein, respectively, which further comprises one or more (e.g., 1, 2, 3 or 4) heteroatoms (e.g., oxygen, sulfur, nitrogen, boron, silicon, phosphorus), wherein one or more heteroatoms are inserted between adjacent carbon atoms within the parent carbon chain, and / or one or more heteroatoms are inserted between a carbon atom and the parent molecule, i.e., between the points of attachment. Unless otherwise specified, heteroalkyl, heteroalkenyl or heteroalkynyl described herein refers to unsubstituted and substituted heteroalkyl, heteroalkenyl or heteroalkynyl, i.e., optionally substituted heteroalkyl, heteroalkenyl or heteroalkynyl.

[0974] As used herein, a "biodegradable group" is a group that can promote faster metabolism of lipids in mammalian entities. The biodegradable group can be selected from the group consisting of, but not limited to, -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, aryl groups and heteroaryl groups. As used herein, an "aryl group" is an optionally substituted carbocyclic group comprising one or more aromatic rings. Examples of aryl groups include phenyl and naphthyl groups. As used herein, a "heteroaryl group" is an optionally substituted heterocyclic group comprising one or more aromatic rings. Examples of heteroaryl groups include pyrrolyl, furanyl, thienyl, imidazolyl, oxazolyl and thiazolyl. Both aryl and heteroaryl groups can be optionally substituted. For example, M and M' can be selected from the non-limiting group consisting of optionally substituted phenyl, oxazole and thiazole. In each formula herein, M and M' can be independently selected from the list of biodegradable groups above. Unless otherwise specified, the aryl or heteroaryl groups described herein refer to unsubstituted and substituted groups, that is, optionally substituted aryl or heteroaryl groups.

[0975] Unless otherwise specified, alkyl, alkenyl and cyclic (e.g., carbocyclic and heterocyclic) groups may be optionally substituted. Optional substituents may be selected from the group consisting of, but not limited to, halogen atoms (e.g., chloro, bromo, fluoro or iodo groups), carboxylic acids (e.g., C(O)OH), alcohols (e.g., hydroxyl, OH), esters (e.g., C(O)OR, OC(O)R), aldehydes (e.g., C(O)H), carbonyls (e.g., C(O)R, alternatively represented by C=O), acyl halides (e.g., C(O)X, wherein X is a halide selected from bromide, fluoride, chloride and iodide), carbonates (e.g., OC(O)OR), alkoxy alkyl (e.g., OR), acetal (e.g., C(OR)2R″″″, wherein each OR is an alkoxy group which may be the same or different and R″′″ is an alkyl or alkenyl group), phosphate (e.g., P(O)43-), thiol (e.g., SH), sulfoxide (e.g., S(O)R), sulfinic acid (e.g., S(O)OH), sulfonic acid (e.g., S(O)2OH), thialdehyde (e.g., C(S)H), sulfate (e.g., S(O)42-), sulfonyl (e.g., S(O)2), amide (e.g., C(O)43-), NR2 or N(R)C(O)R), azido (e.g., N3), nitro (e.g., NO2), cyano (e.g., CN), isocyano (e.g., NC), acyloxy (e.g., OC(O)R), amino (e.g., NR2, NRH, or NH2), carbamoyl (e.g., OC(O)NR2, OC(O)NRH, or OC(O)NH2), sulfonamide (e.g., S(O)2NR2, S(O)2NRH, S(O)2NH2, N(R)S(O)2R, N(H)S(O) In some embodiments, the substituent groups themselves may be further substituted with, for example, one, two, three, four, five, or six substituents as defined herein. For example, a C1-6 alkyl group may be further substituted with one, two, three, four, five, or six substituents as described herein.

[0976] The nitrogen-containing compounds of the present disclosure can be converted to N-oxides by treatment with an oxidant (e.g., 3-chloroperoxybenzoic acid (mCPBA) and / or hydrogen peroxide) to provide other compounds of the present disclosure. Therefore, when valence and structure permit, all nitrogen-containing compounds shown and claimed are deemed to include compounds as shown and N-oxide derivatives thereof (which can be designated as N→O or N+-O-). In addition, in other cases, the nitrogen in the compounds of the present disclosure can be converted into N-hydroxyl or N-alkoxyl compounds. For example, N-hydroxyl compounds can be prepared by oxidizing the parent amine using an oxidant such as mCPBA. When valence and structure permit, all nitrogen-containing compounds shown and claimed are also deemed to cover compounds as shown and N-hydroxyl (i.e., N-OH) and N-alkoxy (i.e., N-OR, wherein R is substituted or unsubstituted C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, 3-14-membered carbocyclic ring or 3-14-membered heterocyclic ring) derivatives.

[0977] mRNA-lipid adducts

[0978] It has been determined that some ionizable lipids are prone to form lipid-polynucleotide adducts. Specifically, the ionizable lipids comprising tertiary amine groups can be decomposed into one or both of secondary amines and reactive aldehyde substances, which can interact with polynucleotides (such as mRNA) to form ionizable lipid-polynucleotide adduct impurities, which can be detected by reverse phase ion pair chromatography (RP-IP HPLC). For example, the oxidation of tertiary amines can lead to the formation of N-oxides, which can undergo acid / base catalyzed hydrolysis at amines to generate aldehydes and secondary amines, which can form adducts with mRNA. Therefore, in some aspects, ionizable lipid-polynucleotide adduct impurities are aldehyde-mRNA adduct impurities.

[0979] It has also been determined that such adducts can destroy mRNA translation and affect the activity of mRNA products formulated with lipid nanoparticles (LNPs). Therefore, it may be advantageous to prepare and use an LNP composition with reduced ionizable lipid-polynucleotide adduct impurity content, such as wherein less than about 20%, less than about 10%, less than about 5%, or less than about 1% of the mRNA is in the form of ionizable lipid-polynucleotide adduct impurities, as can be measured by RP-IP HPLC. Therefore, according to some aspects, a LNP composition is provided, wherein less than about 10%, less than about 5%, or less than about 1% of the mRNA is in the form of ionizable lipid-polynucleotide adduct impurities, including less than 10%, less than 5%, or less than 1%, as can be measured by RP-IP HPLC.

[0980] In some aspects, the amount of lipid aldehyde in the composition is less than about 50ppm, including less than 50ppm. In addition or alternatively, in some aspects, the amount of N-oxide compounds in the composition is less than about 50ppm, including less than 50ppm. In addition or alternatively, in some aspects, the amount of transition metals (such as Fe) in the composition is less than about 50ppm, including less than 50ppm. In addition or alternatively, in some aspects, the amount of alkyl halide compounds in the composition is less than about 50ppm, including less than 50ppm. In addition or alternatively, in some aspects, the amount of anhydride compounds in the composition is less than about 50ppm, including less than 50ppm. In addition or alternatively, in some aspects, the amount of ketone compounds in the composition is less than about 50ppm, including less than 50ppm. In addition or alternatively, in some aspects, the amount of conjugated diene compounds in the composition is less than about 50ppm, including less than 50ppm.

[0981] In some aspects, the composition is stable for the formation of ionizable lipid-polynucleotide adduct impurities. In some aspects, when stored at a temperature of about 25 ° C or lower, the amount of ionizable lipid-polynucleotide adduct impurities in the composition increases at an average rate of less than about 2% per day, including an average rate of less than 2% per day. In some aspects, when stored at a temperature of about 5 ° C or lower, the amount of ionizable lipid-polynucleotide adduct impurities in the composition increases at an average rate of less than about 0.5% per day, including an average rate of less than 0.5% per day. In some aspects, when stored at refrigerated temperatures, the amount of ionizable lipid-polynucleotide adduct impurities in the composition increases at an average rate of less than about 0.5% per day, optionally wherein the refrigerated temperature is about 5 ° C.

[0982] Lipid vehicle (e.g., LNP) compositions with reduced ionizable lipid-polynucleotide adduct impurity content can be prepared by a method for suppressing the formation of one or both of N-oxides and aldehydes. Such methods may include treating a composition comprising an ionizable lipid, wherein the ionizable lipid comprises a tertiary amine group, to suppress the formation of one or both of N-oxides and aldehydes, such as by treating the composition with a reducing agent; treating the composition with a chelating agent; adjusting the pH of the composition; adjusting the temperature of the composition; and adjusting the buffer in the composition. Such methods may include one or more of the following: treating the ionizable lipid with a scavenger before combining the ionizable lipid with the polynucleotide; treating the ionizable lipid with a reducing agent; treating the ionizable lipid with a reducing agent; treating the ionizable lipid with a chelating agent; treating the polynucleotide with a reducing agent; and treating the polynucleotide with a chelating agent.

[0983] According to any of the foregoing items, the scavenger, the reducing agent and / or the reducing agent may be an agent that reacts with an aldehyde, a ketone, an anhydride and / or a diene compound. The scavenger may include one or more selected from the following: (O-(2,3,4,5,6-pentafluorobenzyl)hydroxylamine hydrochloride) (PFBHA), methoxyamine (e.g., methoxyamine hydrochloride), benzyloxyamine (e.g., benzyloxyamine hydrochloride), ethoxyamine (e.g., ethoxyamine hydrochloride), 4-[2-(aminooxy)ethyl]morpholine dihydrochloride, butoxyamine (e.g., tert...

Claims

1. A messenger RNA (mRNA) comprising a 5'UTR, an open reading frame encoding a polypeptide and a 3'UTR, wherein the 3'UTR comprises: (i) a nucleotide sequence that is at least 98% identical to the nucleic acid sequence of SEQ ID NO:139, SEQ ID NO:140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146 or SEQ ID NO:147; or (ii) a nucleotide sequence corresponding to the nucleic acid sequence of SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146 or SEQ ID NO: 147, or a deletion variant thereof, in which 1 to 75 consecutive nucleotides are deleted from SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146 or SEQ ID NO: 147, wherein the nucleic acid sequence or deletion variant thereof is modified to include: a) one or more miRNA binding sites inserted into said nucleic acid sequence or a deletion variant thereof, and / or b) a TENT recruitment sequence, a FUT8 recruitment sequence, one or more identification and ratio determination (IDR) sequences, one or more ribosome attachment detection assay (REDA) sequences, or a combination of one or more IDR sequences and one or more REDA sequences inserted into the nucleic acid sequence or a deletion variant thereof. 2 . The mRNA of claim 1 , wherein the 3′UTR comprises a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO:

139.

3. The mRNA of claim 1, wherein the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

139. 4 . The mRNA of claim 1 , wherein the 3′UTR comprises a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO:

140.

5. The mRNA of claim 1, wherein the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

140. 6 . The mRNA of claim 1 , wherein the 3′UTR comprises a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO:

141.

7. The mRNA of claim 1, wherein the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

141.

8. The mRNA of claim 1, wherein the 3'UTR comprises a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO:

142.

9. The mRNA of claim 1, wherein the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

142.

10. The mRNA of claim 1, wherein the 3'UTR comprises a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO:

143.

11. The mRNA of claim 1, wherein the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

143.

12. The mRNA of claim 1, wherein the 3'UTR comprises a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO:

144.

13. The mRNA of claim 1, wherein the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

144.

14. The mRNA of claim 1, wherein the 3'UTR comprises a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO:

145.

15. The mRNA of claim 1, wherein the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

145.

16. The mRNA of claim 1, wherein the 3'UTR comprises a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO:

146.

17. The mRNA of claim 1, wherein the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

146.

18. The mRNA of claim 1, wherein the 3'UTR comprises a nucleotide sequence that is at least 99% identical to the nucleic acid sequence of SEQ ID NO:

147.

19. The mRNA of claim 1, wherein the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

147.

20. The mRNA of claim 1, wherein the 3'UTR comprises a nucleotide sequence corresponding to a nucleic acid sequence of SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147, wherein the nucleic acid sequence is modified to include one or more miRNA binding sites inserted into the nucleic acid sequence.

21. The mRNA of claim 20, wherein the one or more miRNA binding sites are selected from SEQ ID NOs: 148-157.

22. The mRNA of claim 20, wherein the one or more miRNA binding sites comprise at least one copy of SEQ ID NO: 149 and at least one copy of SEQ ID NO:

150.

23. The mRNA of claim 20, wherein the one or more miRNA binding sites comprise at least three copies of SEQ ID NO:

150.

24. The mRNA of claim 20, wherein the one or more miRNA binding sites comprise at least two copies of SEQ ID NO:

149.

25. The mRNA of claim 20, wherein the one or more miRNA binding sites comprise at least two copies of SEQ ID NO: 149 and at least one copy of SEQ ID NO:

150.

26. The mRNA of claim 20, wherein the one or more miRNA binding sites comprise at least three copies of SEQ ID NO:

148.

27. The mRNA of claim 1, wherein the 3'UTR comprises a nucleotide sequence corresponding to a nucleic acid sequence of SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147, wherein the nucleic acid sequence is modified to include a TENT recruitment sequence inserted into the nucleic acid sequence.

28. The mRNA of claim 1, wherein the 3'UTR comprises a nucleotide sequence corresponding to a nucleic acid sequence of SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147, wherein the nucleic acid sequence is modified to include a FUT8 recruitment sequence inserted into the nucleic acid sequence.

29. The mRNA of claim 1, wherein the 3'UTR comprises a nucleotide sequence corresponding to a nucleic acid sequence of SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147, wherein the nucleic acid sequence is modified to include one or more IDR sequences inserted into the nucleic acid sequence.

30. The mRNA of claim 1, wherein the 3'UTR comprises a nucleotide sequence corresponding to a nucleic acid sequence of SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145, SEQ ID NO: 146, or SEQ ID NO: 147, wherein the nucleic acid sequence is modified to include one or more REDA sequences inserted into the nucleic acid sequence.

31. mRNA as claimed in claim 1, wherein in the deletion variant, 1 to 60 consecutive nucleotides are deleted from SEQ ID NO:139, SEQ ID NO:140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146 or SEQ ID NO:

147.

32. mRNA as claimed in claim 1, wherein in the deletion variant, 1 to 50 consecutive nucleotides are missing from SEQ ID NO:139, SEQ ID NO:140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146 or SEQ ID NO:

147.

33. mRNA as described in claim 1, wherein in the deletion variant, 1 to 40 consecutive nucleotides are missing from SEQ ID NO:139, SEQ ID NO:140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146 or SEQ ID NO:

147.

34. mRNA as described in claim 1, wherein in the deletion variant, 1 to 30 consecutive nucleotides are deleted from SEQ ID NO:139, SEQ ID NO:140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146 or SEQ ID NO:

147.

35. mRNA as described in claim 1, wherein in the deletion variant, 1 to 20 consecutive nucleotides are deleted from SEQ ID NO:139, SEQ ID NO:140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146 or SEQ ID NO:

147.

36. mRNA as described in claim 1, wherein in the deletion variant, 1 to 10 consecutive nucleotides are deleted from SEQ ID NO:139, SEQ ID NO:140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146 or SEQ ID NO:

147.

37. mRNA as described in claim 1, wherein in the deletion variant less than 10 consecutive nucleotides are missing from SEQ ID NO:139, SEQ ID NO:140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146 or SEQ ID NO:

147.

38. The mRNA of any of the preceding claims, wherein the 5'UTR comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:

50.

39. The mRNA of any one of the preceding claims, wherein the 5'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

50.

40. The mRNA of claim 1, wherein the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO: 139, and wherein the 5'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

50.

41. The mRNA of claim 1, wherein the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO: 140, and wherein the 5'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

50.

42. The mRNA of claim 1, wherein the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO: 141, and wherein the 5'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

50.

43. The mRNA of claim 1, wherein the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO: 142, and wherein the 5'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

50.

44. The mRNA of claim 1, wherein the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO: 143, and wherein the 5'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

50.

45. The mRNA of claim 1, wherein the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO: 144, and wherein the 5'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

50.

46. ​​The mRNA of claim 1, wherein the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO: 145, and wherein the 5'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

50.

47. The mRNA of claim 1, wherein the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO: 146, and wherein the 5'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

50.

48. The mRNA of claim 1, wherein the 3'UTR comprises the nucleic acid sequence shown in SEQ ID NO: 147, and wherein the 5'UTR comprises the nucleic acid sequence shown in SEQ ID NO:

50.

49. The mRNA of any one of the preceding claims, wherein the mRNA comprises a termination box.

50. The mRNA of claim 49, wherein the termination box is selected from the group consisting of SEQ ID NOs: 158-174.

51. The mRNA of claim 50, wherein the termination box is UAAAGC UCCCCGGGG (SEQ ID NO: 165) or UAAGCCCCUCCGGGG (SEQ ID NO: 164).

52. The mRNA of any one of the preceding claims, wherein the mRNA comprises a 5' terminal cap.

53. mRNA as claimed in claim 52, wherein the 5' end cap comprises m 7 GpppG 2′OMe , m7G-ppp-Gm-A, m7G-ppp-Gm-AG, cap 0, cap 1, ARCA, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azidoguanosine, cap 2, cap 4, 5'methyl G cap or its analogues.

54. mRNA as described in any one of the preceding claims, wherein the mRNA comprises a poly A region.

55. mRNA as claimed in claim 54, the length of wherein said poly A district is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90 nucleotides, or the length is at least about 100 nucleotides.

56. mRNA as claimed in claim 54, the length of wherein said poly A district is about 10 to about 200, about 20 to about 180, about 50 to about 160, about 70 to about 140 or about 80 to about 120 nucleotides.

57. The mRNA of any one of claims 54 to 56, wherein the poly A region comprises A100-UCUAG-A20-inverted deoxy-thymidine.

58. mRNA as described in any one of the preceding claims, wherein the mRNA comprises at least one chemically modified nucleobase, sugar, backbone or any combination thereof.

59. The mRNA of claim 58, wherein the at least one chemically modified nucleobase is selected from the group consisting of pseudouracil (ψ), N1-methylpseudouracil (m1ψ), 1-ethylpseudouracil, 2-thiouracil (s2U), 4'-thiouracil, 5-methylcytosine, 5-methyluracil, 5-methoxyuracil, and any combination thereof.

60. mRNA as described in any one of the preceding claims, wherein the polypeptide comprises a secretory protein, a membrane-bound protein or an intercellular protein.

61. mRNA as claimed in claim 60, wherein the polypeptide is a cytokine, an antibody, a vaccine, a receptor, an enzyme, a hormone, a transcription factor, a ligand, a membrane transporter, a structural protein, a nuclease or a component, variant or fragment thereof.

62. A pharmaceutical composition comprising the mRNA of any one of the preceding claims and a pharmaceutically acceptable carrier.

63. A lipid nanoparticle comprising the mRNA of any one of claims 1 to 61.

64. The lipid nanoparticle of claim 63, wherein the lipid nanoparticle comprises: (i) ionizable lipids, (ii) phospholipids, (iii) structural lipids, and (iv) PEG-lipid.

65. The lipid nanoparticle of claim 63 or 64, wherein the lipid nanoparticle comprises a compound of formula (I): or an N-oxide thereof, or a salt or isomer thereof, Where R' a It's R' 支链 ;in R' 支链 yes: in Indicates a connection point; Where R aα , R aβ , R aγ and R aδ Each independently selected from H, C 2-12 Alkyl and C 2-12 A group consisting of alkenyl groups; R 2 and R 3 Each independently selected from C 1-14 Alkyl and C 2-14 A group consisting of alkenyl groups; R 4 Selected from the group consisting of: -(CH2) n OH, wherein n is selected from the group consisting of 1, 2, 3, 4 and 5, and in represents a connection point; R 10 is N(R)2; each R is independently selected from C 1-6 Alkyl, C 2-3 alkenyl and H; and n2 is selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10; Each R 5 Independently selected from C 1-3 Alkyl, C 2-3 A group consisting of an alkenyl group and H; Each R 6 Independently selected from C 1-3 Alkyl, C 2-3 A group consisting of an alkenyl group and H; M and M' are each independently selected from the group consisting of -C(O)O- and -OC(O)-; R' is C 1-12 Alkyl or C 2-12 alkenyl; l is selected from the group consisting of 1, 2, 3, 4 and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 11, 12 and 13.

66. The lipid nanoparticle of any one of claims 63-65, wherein the lipid nanoparticle comprises: (a) (i) Compound II, (ii) cholesterol, and (iii) PEG-DMG or Compound I; (b) (i) Compound VI, (ii) cholesterol, and (iii) PEG-DMG or Compound I; (c) (i) Compound II, (ii) DSPC or DOPE, (iii) cholesterol, and (iv) PEG-DMG or Compound I; (d) (i) Compound VI, (ii) DSPC or DOPE, (iii) cholesterol, and (iv) PEG-DMG or Compound I; (e) (i) Compound II, (ii) cholesterol, and (iii) Compound I; (f) (i) Compound II, (ii) DSPC or DOPE, (iii) cholesterol, and (iv) Compound I; (g) (i) Compound B, (ii) DSPC or DOPE, (iii) cholesterol, and (iv) PEG-DMG or Compound I; (h) (i) Compound B, (ii) cholesterol, and (iii) Compound I; or (i) (i) Compound B, (ii) DSPC or DOPE, (iii) cholesterol, and (iv) Compound I.

67. The lipid nanoparticle of any one of claims 63-65, wherein the lipid nanoparticle comprises Compound II and Compound I.

68. The lipid nanoparticle of any one of claims 63-65, wherein the lipid nanoparticle comprises Compound B and Compound I.

69. The lipid nanoparticle of any one of claims 63-65, wherein the lipid nanoparticle comprises Compound II, DSPC, cholesterol, and Compound I.

70. The lipid nanoparticle of any one of claims 63-69, wherein the lipid nanoparticle comprises a molar ratio of about 20-60% ionizable lipid: 5-25% phospholipid: 25-55% cholesterol: and 0.5-15% PEG lipid.

71. The lipid nanoparticle of any one of claims 63-70, wherein the lipid nanoparticle is formulated for intravenous, subcutaneous, intramuscular, intranasal, intraocular, rectal, pulmonary or oral delivery.

72. A pharmaceutical composition comprising the lipid nanoparticles of any one of claims 63 to 71.

73. A cell comprising the lipid nanoparticle of any one of claims 63 to 71.

74. A method of increasing polypeptide expression, the method comprising administering to a cell the lipid nanoparticle of any one of claims 63 to 71.

75. A method of delivering the lipid nanoparticle of any one of claims 63 to 71 to a cell, the method comprising contacting the cell with the lipid nanoparticle in vitro, in vivo or ex vivo.

76. A method of delivering the lipid nanoparticle of any one of claims 63 to 71 to a human subject suffering from a disease or condition, the method comprising administering an effective amount of the lipid nanoparticle to the human subject in need thereof.

77. A method of treating, preventing, or preventing a symptom of a disease or condition in a human subject in need thereof, the method comprising administering to the human subject an effective amount of the lipid nanoparticle of any one of claims 63 to 71.

Images