Protein FH related to plant nodulation ability and coding gene and application thereof

Abstract

The invention discloses a protein FH related to plant nodulation ability and a coding gene and application thereof, and aims to reduce the expression quantity of a target gene FH in soybeans or silence the target gene FH to cultivate soybean plants with high nodulation ability. The cDNA sequence of the gene FH is as shown in SEQ ID NO: 1. By reducing the expression quantity of the target gene FH in the soybean or silencing the target gene FH, the soybean plant with high nodulation capacity is cultivated, and the method has a wide practical application prospect in the aspects of increasing the yield of leguminous plants and reducing the application of chemical fertilizers.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, in particular to a protein FH related to plant nodulation ability and a coding gene and application thereof. Background Art

[0002] Soybean (Glycine max) is an important food and oil crop and a major source of high-quality protein. my country is a major consumer of soybeans, but my country's soybeans are mainly imported, so it is particularly important to increase soybean yields (Zhang et al., 2022). Nitrogen, phosphorus, and potassium are three important nutrients required for crop growth, and nitrogen is the primary and most demanded nutrient for crops (Ma and Chen, 2021).

[0003] Leguminosae and rhizobia have established a good symbiotic relationship in the long-term evolution process. Leguminosae form unique nodule structures to perform symbiotic nitrogen fixation. In agricultural production, the highly efficient symbiotic nitrogen fixation system can provide soybeans with 50%-60% of the total nitrogen required for growth and development.

[0004] The rhizobium-legume symbiotic nitrogen fixation system is a highly efficient nitrogen utilization system in nature. Analyzing the operating mode of this system has always been a hot topic and difficulty in scientific research. Identifying the functional genes in soybean nodulation and symbiotic nitrogen fixation is of great significance for enhancing the symbiotic nitrogen fixation ability of legumes, especially soybeans, an important grain and oil economic crop. It also provides greater possibilities for reducing the application of nitrogen fertilizers in production and increasing soybean yields.

[0005] Formin genes are an important class of actin nucleation factors. Studies have shown that Formin 8 (FH8) has a variety of important physiological functions in non-leguminous plants. However, there are no studies or reports on the involvement of the gene FH in soybean in regulating the number of soybean nodules. Studying the molecular mechanism of gene FH regulating soybean nodule formation and symbiotic nitrogen fixation will provide new gene resources for improving soybean nitrogen fixation capacity, which is of great significance to ensuring national food security and promoting sustainable agricultural development. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide a protein FH related to plant nodulation ability and its encoding gene and application.

[0007] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0008] Application of FH protein in the following 1)-3): 1) Regulate plant nodulation ability; 2) Cultivate transgenic plants with high nodulation ability; 3) Cultivate transgenic plants with low nodulation ability; The FH protein is a1) or a2) or a3) or a4): a1) the amino acid sequence is the protein shown in SEQ ID NO: 2; a2) a fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of the protein shown in SEQ ID NO: 2; a3) a protein related to plant nodulation ability obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 2; a4) a protein having 90% identity with the amino acid sequence shown in SEQ ID NO: 2, derived from soybean and associated with plant nodulation ability.

[0009] Application of biomaterials related to FH protein in the following 1)-3): 1) Regulate plant nodulation ability; 2) Cultivate transgenic plants with low nodulation ability; 3) Cultivate transgenic plants with high nodulation ability; The biological material is any one of the following A1) to A8): A1) a nucleic acid molecule encoding a FH protein; A2) an expression cassette containing the nucleic acid molecule described in A1); A3) a recombinant vector containing the nucleic acid molecule described in A1); A4) a recombinant vector containing the expression cassette described in A2); A5) a recombinant microorganism containing the nucleic acid molecule described in A1); A6) a recombinant microorganism containing the expression cassette described in A2); A7) a recombinant microorganism containing the recombinant vector described in A3); A8) A recombinant microorganism containing the recombinant vector described in A4).

[0010] Further preferably, the nucleic acid molecule described in A1) is a gene shown in B1) or B2) or B3) or B4) as follows: B1) cDNA molecule shown in SEQ ID NO: 1; B2) a genomic DNA molecule corresponding to the cDNA molecule shown in SEQ ID NO: 1; B3) a cDNA molecule or genomic DNA molecule that has 75% or more identity with the nucleotide sequence defined in B1) or B2) and encodes the FH protein described in claim 1; B4) a cDNA molecule or a genomic DNA molecule that hybridizes with the nucleotide sequence defined in B1) or B2) or B3) under stringent conditions and encodes the FH protein described in claim 1.

[0011] m1. Substances that inhibit or reduce the activity or content of FH protein in plants; m2. A substance that inhibits or silences the expression of a nucleic acid encoding a FH protein in a plant or a substance that knocks out a nucleic acid encoding a FH protein in a plant; The FH protein is a1) or a2) or a3) or a4): a1) the amino acid sequence is the protein shown in SEQ ID NO: 2; a2) a fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of the protein shown in SEQ ID NO: 2; a3) a protein related to plant nodulation ability obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 2; a4) A protein having 90% identity with the amino acid sequence shown in the sequence, which is derived from soybean and is related to plant nodulation ability.

[0012] A method for cultivating a transgenic plant with high nodulation ability comprises the following steps: reducing the content and / or activity of the FH protein in a receptor plant to obtain a transgenic plant; the transgenic plant has a higher nodulation ability than the receptor plant.

[0013] Further preferably, the method for reducing the content and / or activity of the FH protein in claim 1 in the recipient plant is achieved by knocking out, inhibiting or silencing the gene encoding the FH protein in claim 1 in the recipient plant using RNAi technology.

[0014] Further preferably, the substance that silences the gene encoding the FH protein in the recipient plant is a nucleic acid molecule that interferes with the expression of the gene encoding the FH protein in the recipient plant; Further preferably, the nucleic acid molecule interfering with the expression of the gene encoding the FH protein in the recipient plant is SEQ ID NO:10.

[0015] A nucleic acid molecule interfering with the expression of the gene encoding the above FH protein in a receptor plant or an expression box, vector, or cell line containing the nucleic acid molecule, wherein the nucleic acid molecule is SEQ ID NO: 10.

[0016] A method for cultivating a transgenic plant with low nodulation ability comprises the following steps: increasing the content and / or activity of the FH protein in a receptor plant to obtain a transgenic plant; the transgenic plant has a lower nodulation ability than the receptor plant.

[0017] Further preferably, the method for increasing the content and / or activity of the above-mentioned FH protein in the recipient plant is to overexpress the FH protein in the recipient plant; And / or, the overexpression method is to introduce the gene encoding the FH protein into the recipient plant.

[0018] More preferably, the plant is soybean.

[0019] The beneficial effect of adopting the above technical scheme is that the theoretical research and experimental research of the research group of the present invention have confirmed that by reducing the expression level of the target gene FH in soybeans or silencing the target gene FH, soybean plants with high nodulation ability can be cultivated, which has broad practical application prospects in increasing the yield of leguminous plants and reducing the application of chemical fertilizers. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Schematic diagram of the analysis of the expression pattern of gene FH of the present invention, wherein: A is a schematic diagram of the histochemical localization of gene FH in the tip meristem of the root before rhizobium infection; B is a schematic diagram of the histochemical localization of gene FH at the outward growth point of the lateral root before rhizobium infection; C is a schematic diagram of the histochemical localization of gene FH in the tip meristem of the root after rhizobium infection; D is a schematic diagram of the histochemical localization of gene FH in the nodule primordium after rhizobium infection; E is a schematic diagram of the histochemical localization of gene FH in the nodule after rhizobium infection; F is an enlarged schematic diagram of the black frame portion in Figure E; wherein the scale bars of Figures A, B, and C are 200 μm; the scale bars of Figures D and E are 500 μm; the scale bar of Figure F is 200 μm; Figure 2 The figure is a schematic diagram showing that down-regulating the expression of gene FH in hairy roots increases the number of nodules, wherein: A is a schematic diagram showing the expression of the FH gene in hairy roots transformed with pK7GWⅡRR empty vector and pK7GWⅡRR-FH RNAi vector (FH-RNAi); B is a schematic diagram showing the empty vector and FH-RNAi hairy roots, with a scale of 1 cm; C is a statistical schematic diagram showing the number of nodules in the empty vector and FH-RNAi hairy roots. DETAILED DESCRIPTION

[0021] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are conventional commercial products and can be directly obtained by purchasing from the market. The experimental methods used in the following examples are conventional methods unless otherwise specified.

[0022] It should be understood that when used in the present specification and the appended claims, the term "comprising" indicates the presence of described features, wholes, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, wholes, steps, operations, elements, components and / or combinations thereof.

[0023] It should also be understood that the term “and / or” used in the specification and appended claims refers to any and all possible combinations of one or more of the associated listed items, and includes these combinations.

[0024] References to "one embodiment" or "some embodiments" etc. described in the specification of this application mean that one or more embodiments of the present application include specific features, structures or characteristics described in conjunction with the embodiment. Therefore, the statements "in one embodiment", "in some embodiments", "in some other embodiments", "in some other embodiments", etc. that appear in different places in this specification do not necessarily refer to the same embodiment, but mean "one or more but not all embodiments", unless otherwise specifically emphasized in other ways. The terms "including", "comprising", "having" and their variations all mean "including but not limited to", unless otherwise specifically emphasized in other ways.

[0025] In addition, in the description of the present application specification and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the descriptions and cannot be understood as indicating or implying relative importance.

[0026] The following will be combined with specific embodiments of the present invention to clearly and completely describe the technical solution of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0027] Example 1 Analysis of the expression pattern of soybean gene FH (1) Construction of GUS expression vector In order to study the expression pattern of soybean gene FH, an expression vector was constructed with a promoter sequence of about 2235 bp upstream of the FH coding region fused to the reporter gene GUS. The vector construction process was as follows: genomic DNA of wild-type soybean Williams 82 was extracted, primer pairs F2 and R2 were designed to amplify the promoter sequence, and PCR amplification was performed using DNA high-fidelity enzyme.

[0028] F2: TATATTATACAAAAATATTATT (SEQ ID NO.5); R2: GAATGCTGAGGAACAAAGA (SEQ ID NO. 6); The PCR reaction system was as follows: DNA template: 1 μL; F2: 2 μL; R2: 2 μL; buffer: 25 μL; ddH2O: 18 μL; dNTP: 1 μL; Polymerase: 1 μL; total reaction system 50 μL. Reaction conditions: 94°C: 2 min, 98 °C: 20 s, 56 °C: 30 s, 68 °C: 2 min, 68 °C: 10 min, 16°C: ∞; 39 cycles were set for three steps of 98 °C: 20 s, 56 °C: 30 s, and 68 °C: 2 min. 50 μL of PCR amplification product was analyzed by 1% agarose gel electrophoresis. The Tiangen Gel Recovery Kit was used for recovery and purification. The promoter sequence of the obtained FH gene was 2235 bp in total, as shown in the sequence SEQ ID NO.7. This sequence was inserted into the expression vector pBI121 fused with the reporter gene GUS to construct the pBI121-proFH-GUS plasmid.

[0029] (2) Hairy root transformation The pBI121-proFH-GUS plasmid was transformed into soybean seedlings that were about 1 week old by transient hairy root transformation experiment. The specific process is as follows: pBI121-proFH-GUS plasmid was transformed into Agrobacterium rhizogenes K599, and positive clones were selected for overnight culture until the OD value was about 0.6, and the bacteria were collected by centrifugation. Then 2 mL ddH2O, 20 μL 1M MgCl2, and 20 μL 1MMES were added, and the bacteria were resuspended in a shaker at 28℃ / 200 rpm. Use a syringe to inject the bacterial solution under the cotyledons of soybean seedlings that have grown for about 1 week. After about 2 weeks, soybean hairy roots can grow. Cut the soybean seedlings that have grown hairy roots neatly, soak them in water for 3-5 days to slow down the seedlings, and then move them into a clean culture pot filled with vermiculite. After 3-5 days of cultivation, the seedlings were inoculated with a bacterial solution of rhizobium USDA110 with an OD value of 0.05, and seedlings without rhizobium inoculation were used as controls. On the 21st day after inoculation, hairy roots were taken for GUS staining.

[0030] (3) Expression pattern analysis Taking the period before and after rhizobium inoculation as the control, the tissue staining results showed that the gene FH was expressed in the tip meristem and the outgrowth point of the lateral root before rhizobium inoculation (such as Figure 1 A and B); after inoculation with rhizobia, gene FH was not only expressed in the tip meristem and nodule primordium of soybean roots, but also highly expressed in nodules (e.g. Figure 1 medium CF).

[0031] Example 2 Cloning of FH gene cDNA sequence RNA of wild soybean Williams 82 was extracted and reverse transcribed into single-stranded DNA. The cDNA sequence of gene FH was amplified using forward primer F3 and reverse primer R3 using the sequence as a template, and PCR amplification was performed using DNA high-fidelity enzyme.

[0032] F3: gagaaaattgaatacacctg (SEQ ID NO.8); R3: aatgcaaaagcacacactg (SEQ ID NO.9); The PCR reaction system was as follows: cDNA template: 3 μL; F3: 2 μL; R3: 2 μL; buffer: 25 μL; ddH2O: 16 μL; dNTP: 1 μL; Polymerase: 1 μL; total reaction system 50 μL. Reaction conditions: 94°C: 2 min, 98 °C: 20 s, 56 °C: 30 s, 68 °C: 2 min, 68 °C: 10 min, 16°C: ∞; 39 cycles were set for three steps of 98 °C: 20 s, 56 °C: 30 s, and 68 °C: 2 min. 50 μL of PCR amplification product was analyzed by 1% agarose gel electrophoresis. The product was recovered and purified using a Tiangen Gel recovery kit. The cDNA sequence of the obtained FH gene was 2898 bp in total, as shown in SEQ ID NO.1; the FH protein includes 804 amino acids, and the sequence is shown in SEQ ID NO.2.

[0033] Example 3 Reducing the expression of FH gene significantly increases the number of nodules (1) Construction of RNAi vector Using the cDNA of FH obtained in Example 2 as a template, PCR amplification was performed using a primer pair consisting of F1 and R1 to obtain a PCR amplification product, the sequence of which is shown in SEQ ID NO.10.

[0034] F1: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGCACAACCAAAGCCACAAGC (SEQ IDNO.3); R1: GGGGACCACTTTGTACAAGAAAGCTGGGTTTCCCTTCCATTCTCTTGAACACGT (SEQ IDNO.4); The recovered product of the sequence shown in SEQ ID NO. 10 was connected to the intermediate vector pDonor221 by BP reaction (Invitrogen 11789-020) to obtain the recombinant plasmid pDonor221-FH. The plasmid pDonor221-FH was connected to the final vector pK7GWⅡRR by LR reaction (Invitrogen 11791-020) to obtain the recombinant plasmid pK7GWⅡRR-FH.

[0035] (2) Obtaining transgenic hairy roots The pK7GWⅡRR-FH plasmid was transformed into Agrobacterium rhizogenes K599, and the positive clones were selected for overnight culture until the OD value was about 0.6, and the cells were collected by centrifugation. Then 2 mL ddH2O, 20 μL 1M MgCl2, and 20 μL 1M MES were added, and the cells were resuspended in a shaker at 28℃ / 200 rpm. The bacterial solution was injected into the cotyledons of soybean seedlings that had grown for about 1 week using a syringe. After about 2 weeks, the hairy roots of soybeans can grow. The soybean seedlings that have grown hairy roots were cut neatly, soaked in water for 3-5 days, and then moved into a clean culture pot filled with vermiculite. After 3-5 days of culture, the rhizobium USDA110 bacterial solution with an OD value of 0.05 was inoculated, and the seedlings without rhizobium were used as controls. On the 21st day after inoculation, the hairy roots were taken for FH expression analysis and nodule number statistics.

[0036] (3) Phenotypic analysis RNA was extracted from hairy roots using TriZol reagent (Thermo), reverse transcribed into single-stranded DNA, and qRT-PCR was performed using the following primers.

[0037] F4:GGTTCTTTCAGGGTTGATGATG (SEQ ID NO.11); R4: CCAGAGACTTCAAAACAATA (SEQ ID NO.12); The relative expression levels of genes in hairy roots transformed with the pK7GWⅡRR empty vector and the pK7GWⅡRR-FH RNAi vector were statistically analyzed, and it was found that the expression level of gene FH decreased significantly (e.g. Figure 2 The number of nodules on each hairy root was counted and it was found that the number of nodules in the FH RNAi material was significantly higher than that in the control group ( Figure 2 B, C), indicating that down-regulating the expression of FH gene can enhance the nodulation ability of soybean, showing great application prospects.

[0038] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that numerous changes, modifications, substitutions and variations may be made to the examples without departing from the principles and spirit of the invention, the scope of the invention being defined by the appended claims and their equivalents.

[0039] In the above embodiments, the description of each embodiment has its own emphasis. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0040] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. Such modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included in the protection scope of the present invention.

Claims

1. Application of FH protein in the following 1)-3): 1) Regulate plant nodulation ability; 2) Cultivate transgenic plants with high nodulation ability; 3) Cultivate transgenic plants with low nodulation ability; The FH protein is a1) or a2) or a3) or a4): a1) the amino acid sequence is the protein shown in SEQ ID NO: 2; a2) a fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of the protein shown in SEQ ID NO: 2; a3) a protein related to plant nodulation ability obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 2; a4) a protein having 90% identity with the amino acid sequence shown in SEQ ID NO: 2, derived from soybean and associated with plant nodulation ability.

2. Application of biomaterials related to FH protein in the following 1)-3): 1) Regulate plant nodulation ability; 2) Cultivate transgenic plants with low nodulation ability; 3) Cultivate transgenic plants with high nodulation ability; The biological material is any one of the following A1) to A8): A1) a nucleic acid molecule encoding a FH protein; A2) an expression cassette containing the nucleic acid molecule described in A1); A3) a recombinant vector containing the nucleic acid molecule described in A1); A4) a recombinant vector containing the expression cassette described in A2); A5) a recombinant microorganism containing the nucleic acid molecule described in A1); A6) a recombinant microorganism containing the expression cassette described in A2); A7) a recombinant microorganism containing the recombinant vector described in A3); A8) A recombinant microorganism containing the recombinant vector described in A4).

3. The use according to claim 2, characterized in that: A1) The nucleic acid molecule is the gene shown in B1) or B2) or B3) or B4) below: B1) cDNA molecule shown in SEQ ID NO: 1; B2) a genomic DNA molecule corresponding to the cDNA molecule shown in SEQ ID NO: 1; B3) a cDNA molecule or genomic DNA molecule that has 75% or more identity with the nucleotide sequence defined in B1) or B2) and encodes the FH protein described in claim 1; B4) a cDNA molecule or a genomic DNA molecule that hybridizes with the nucleotide sequence defined in B1) or B2) or B3) under stringent conditions and encodes the FH protein described in claim 1.

4. Use of the substance shown in m1 or m2 in improving the nodulation ability of plants or cultivating transgenic plants with high nodulation ability; m1. Substances that inhibit or reduce the activity or content of FH protein in plants; m2. A substance that inhibits or silences the expression of a nucleic acid encoding a FH protein in a plant or a substance that knocks out a nucleic acid encoding a FH protein in a plant; The FH protein is a1) or a2) or a3) or a4): a1) the amino acid sequence is the protein shown in SEQ ID NO: 2; a2) a fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of the protein shown in SEQ ID NO: 2; a3) a protein related to plant nodulation ability obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO: 2; a4) A protein having 90% identity with the amino acid sequence shown in the sequence, which is derived from soybean and is related to plant nodulation ability.

5. A method for cultivating a transgenic plant with high nodulation ability, comprising the following steps: reducing the content and / or activity of the FH protein of claim 1 in a recipient plant to obtain a transgenic plant; the transgenic plant has a higher nodulation ability than the recipient plant.

6. The method according to claim 5, characterized in that: The method for reducing the content and / or activity of the FH protein in claim 1 in the recipient plant is achieved by knocking out, inhibiting or silencing the gene encoding the FH protein in claim 1 in the recipient plant using RNAi technology; Furthermore, the substance for silencing the gene encoding the FH protein in the recipient plant is a nucleic acid molecule that interferes with the expression of the gene encoding the FH protein in the recipient plant; Furthermore, the nucleic acid molecule that interferes with the expression of the gene encoding the FH protein in the recipient plant is SEQ ID NO:

10.

7. A nucleic acid molecule that interferes with the expression of the gene encoding the FH protein of claim 1 in a receptor plant, or an expression cassette, vector, or cell line containing the nucleic acid molecule, wherein the nucleic acid molecule is SEQ ID NO:

10.

8. A method for cultivating transgenic plants with low nodulation ability, comprising the following steps: increasing the content and / or activity of the FH protein of claim 1 in a recipient plant to obtain a transgenic plant; the nodulation ability of the transgenic plant is lower than that of the recipient plant.

9. The method according to claim 8, characterized in that: The method for increasing the content and / or activity of the FH protein of claim 1 in the recipient plant is to overexpress the FH protein in the recipient plant; And / or, the overexpression method is to introduce the gene encoding the FH protein into the recipient plant.

10. The use according to any one of claims 1 to 4 or the method according to claim 5 or 6 or the method according to claim 8 or 9, characterized in that: The plant is soybean.

Images