Primer combination and method for multiple PCR-CE identification of zaocys dhumnade and five mixed counterfeit medicinal materials and aqueous extracts and application

Abstract

The invention discloses a primer combination for multiple PCR-CE identification of zaocys dhumnade and adulterated medicinal materials and aqueous extracts thereof, the primer combination comprises a first primer pair, a second primer pair, a third primer pair, a fourth primer pair, a fifth primer pair and a sixth primer pair, and the sequences are shown as SEQ ID NO: 1-SEQ ID NO: 12. The invention further discloses a kit based on the primer combination and application of the primer combination or the kit in identification of zaocys dhumnade and five common counterfeit medicinal materials and aqueous extracts thereof. By implementing the method, zaocys dhumnade, elaphe moellendorffii, dinodon rufozonatum, elaphe nigra, elaphe carinata and ptyas korros can be effectively identified at the same time, the identification efficiency is high, and the identification accuracy is good.

Description

Technical Field

[0001] The present invention relates to the technical field of Chinese medicinal material identification, and in particular to a primer combination, method and application thereof for multiplex PCR-CE identification of japones and five mixed and counterfeit medicinal materials and water extracts. Background Art

[0002] Snakes have a long history in Chinese medicine and folk medicine, and play an important role in long-term clinical applications. According to the "Reptile Database", there are 3,425 snake species in the world, 241 in China, and snakes used in Chinese medicine involve 5 families and 70 species. Li Shizhen of the Ming Dynasty recorded more than 17 medicinal snakes in the "Compendium of Materia Medica". The black-necked snake is the dried body of the black-necked snake Zaocys dhumnades (Cantor) of the Colubridae family. The black-necked snake is mostly caught in summer and autumn, the abdomen is cut open or the skin is peeled first, leaving the head and tail, the internal organs are removed, and it is coiled into a disc and dried. It is flat in nature and sweet in taste. It has the effects of dispelling wind, activating collaterals, relieving pain, removing dampness and attacking toxins. It is clinically used for rheumatism, numbness and cramps, stroke, facial paralysis, hemiplegia, convulsions, tetanus, leprosy, scrofula, and malignant sores.

[0003] The black-necked snake is listed as a national second-level protected wild medicinal species in the "National Key Protected Wild Medicinal Species List", which means that the black-necked snake is an important wild medicinal species with a shrinking distribution area and exhausted resources. In September 2020, the State Forestry and Grassland Administration issued the "Notice on Standardizing the Classification and Management Scope of Prohibited Wild Animals", prohibiting the breeding of black-necked snakes for the purpose of eating, and only allowing breeding for non-edible purposes such as medicine, display, and scientific research. In 2021, the black-necked snake was included in the "Red List of Endangered Species of the World Conservation Union (IUCN)", and is currently at the least-danger level. With the acceleration of the aging pace in my country, the number of people with cardiovascular and cerebrovascular diseases and hemiplegia due to stroke has increased, and the preferred traditional Chinese medicine for the treatment of hemiplegia due to stroke and wind is the black-necked snake. Among pharmaceutical companies across the country, Chinese patent medicines using black-necked snakes as feed materials continue to come out, such as Yixian Pills, Jingutong Capsules, Vitiligo Capsules and other products have emerged, and their usage has increased day by day.

[0004] In recent years, due to limited resources and high prices, there are widespread counterfeits and confusions in common snake medicines on the market, which poses a potential risk to the safety of clinical medication and the quality and efficacy of drugs. In addition, after processing, medicinal materials are difficult to identify, which is the reason for the difficulty in identifying their properties. For the same species, DNA will not change with the change of external factors. Its differences mainly exist between species, and it has the characteristics of high genetic stability and strong chemical stability. It can not only ignore the appearance of morphological similarity, but also avoid excessive variability of chemical characteristics, and provide a basis for identification at the genetic level. It has the characteristics of being more accurate and reliable. Therefore, in recent years, molecular identification is supplementing physical and chemical identification, strengthening the identification of medicinal materials, and playing an important role in human health and ensuring the quality of medicinal materials. At present, the main technologies for identifying black-necked snakes based on PCR include specific PCR, loop-mediated isothermal amplification, real-time fluorescence quantitative PCR, DNA barcodes, etc., but the identification of these technologies is mainly used to identify the medicinal materials of black-necked snakes. After the black-necked snake is subjected to processing methods such as heat extraction, its DNA structure will be broken. The existing methods for identifying medicinal materials are difficult to apply and the quality risk is relatively high. It is urgent to solve the problem of authenticity identification of the black-necked snake after it loses its appearance characteristics. Moreover, the existing methods do not involve the identification of counterfeit black-browed snakes. In addition, there are few reports on research literature that can simultaneously identify adulteration of multiple species of snakes. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a primer combination for multiplex PCR-CE identification of black-necked snake and 5 kinds of mixed and counterfeit medicinal materials and water extracts, which can effectively identify black-necked snake, hundred-flowered snake, red-banded snake, black-browed snake, king snake and gray rat snake at the same time.

[0006] The technical problem to be solved by the present invention is also to provide a multiplex PCR-CE identification method for identifying garter snake and 5 mixed and counterfeit medicinal materials and water extracts.

[0007] The technical problem to be solved by the present invention is also to provide an application of the above primer combination in identifying black-necked snake, hundred-flowered snake, red-banded snake, black-browed snake, king snake and gray rat snake.

[0008] In order to achieve the above technical effects, the present invention provides a primer combination for multiplex PCR-CE identification of garter snakes and their mixed and counterfeit medicinal materials and water extracts, comprising a first primer pair, a second primer pair, a third primer pair, a fourth primer pair, a fifth primer pair and a sixth primer pair;

[0009] The sequence of the upstream primer of the first primer pair is shown in SEQ ID NO: 1, and the sequence of the downstream primer is shown in SEQ ID NO: 2;

[0010] The sequence of the upstream primer of the second primer pair is shown in SEQ ID NO:3, and the sequence of the downstream primer is shown in SEQ ID NO:4;

[0011] The sequence of the upstream primer of the third primer pair is shown in SEQ ID NO:5, and the sequence of the downstream primer is shown in SEQ ID NO:6;

[0012] The sequence of the upstream primer of the fourth primer pair is shown in SEQ ID NO:7, and the sequence of the downstream primer is shown in SEQ ID NO:8;

[0013] The sequence of the upstream primer of the fifth primer pair is shown in SEQ ID NO:9, and the sequence of the downstream primer is shown in SEQ ID NO:10;

[0014] The sequence of the upstream primer of the sixth primer pair is shown as SEQ ID NO:11, and the sequence of the downstream primer is shown as SEQ ID NO:12.

[0015] Accordingly, the present invention also discloses an application of the above primer combination, including at least one of the following:

[0016] Identify the black-necked snake, the Elaphe striata, the red-banded snake, the black-browed Elaphe, the king snake, and the gray rat snake;

[0017] Prepare a kit for identifying black-necked snake, Elaphe striata, red-banded snake, black-browed Elaphe, king snake and gray rat snake;

[0018] Identify whether the snake to be tested is a black-necked snake, a hundred-flowered snake, a red-banded snake, a black-browed snake, a king snake or a gray rat snake;

[0019] Prepare a test kit for identifying whether the snake to be tested is a black-necked snake, a hundred-flowered snake, a red-banded snake, a black-browed snake, a king snake or a gray rat snake;

[0020] Identify whether the sample to be tested contains black-necked snake and / or Elaphe baicalensis and / or red-banded snake and / or black-browed Elaphe and / or king Elaphe and / or gray rat snake;

[0021] A kit is prepared for identifying whether a sample to be tested contains Garcinia charax, Elaphe dasyphylla, Elaphe rubrum, Elaphe nigromaculata, Elaphe nigromaculata, Elaphe striata, Elaphe striata and / or Elaphe gracilis.

[0022] Correspondingly, the present invention also discloses a kit for identifying the medicinal materials and water extracts of the black-necked snake and its mixed and counterfeit products, comprising the above-mentioned primer combination.

[0023] Correspondingly, the present invention also discloses a multiplex PCR-CE identification method for identifying the medicinal materials and water extracts of the black-necked snake and its mixed and counterfeit products, comprising the following steps:

[0024] (1) extracting DNA from the sample to be tested;

[0025] (2) performing multiplex PCR amplification using the DNA of the sample to be tested as a template;

[0026] (3) Performing electrophoresis detection on the amplified product. If the amplified product contains a DNA characteristic peak of 347 bp, the sample to be detected contains the medicinal material of Agkistrodon davidianus and / or the aqueous extract of Agkistrodon davidianus;

[0027] If the amplified product contains a 247 bp DNA characteristic peak, the sample to be tested contains Elaphe baihuaensis medicinal materials and / or Elaphe baihuaensis water extract;

[0028] If the amplified product contains a 206 bp DNA characteristic peak, the sample to be tested contains the medicinal material of the snake and / or the water extract of the snake;

[0029] If the amplified product contains a 144 bp DNA characteristic peak, the sample to be tested contains Elaphe dioica medicinal materials and / or Elaphe dioica water extract;

[0030] If the amplified product contains a 125 bp DNA characteristic peak, the sample to be tested contains Elaphe kingi medicinal materials and / or Elaphe kingi water extract;

[0031] If the amplified product contains a 99 bp DNA characteristic peak, the sample to be tested contains gray rat snake medicinal materials and / or gray rat snake water extract.

[0032] As an improvement of the above technical solution, the multiplex PCR amplification program in step (2) includes the following steps: pre-denaturation at 92°C to 96°C for 4min to 8min; denaturation at 92°C to 95°C for 20s to 40s, annealing at 60°C to 70°C for 30s to 50s, and cycling 20 to 30 times; and extension at 70°C to 75°C for 3min to 6min.

[0033] As an improvement of the above technical solution, the multiplex PCR amplification procedure in step (2) includes the following steps: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 65°C for 45 s, and 25 cycles; and extension at 72°C for 5 min.

[0034] As an improvement of the above technical solution, the PCR amplification system for multiple PCR amplification in step (2) includes the following substances: 2 μL to 8 μL of DNA polymerase, 0.3 μL to 0.6 μL of the first primer pair, 0.3 μL to 0.6 μL of the second primer pair, 0.3 μL to 0.6 μL of the third primer pair, 0.3 μL to 0.6 μL of the fourth primer pair, 0.3 μL to 0.6 μL of the fifth primer pair, 0.3 μL to 0.6 μL of the sixth primer pair, 0.5 μL to 1.5 μL of template DNA, and sterile distilled water is supplemented to a final volume of 25 μL.

[0035] As an improvement of the above technical solution, the PCR amplification system for multiple PCR amplification in step (2) includes the following substances: 5 μL of DNA polymerase, 0.5 μL of the first primer pair, 0.5 μL of the second primer pair, 0.5 μL of the third primer pair, 0.3 μL of the fourth primer pair, 0.6 μL of the fifth primer pair, 0.6 μL of the sixth primer pair, 1 μL of template DNA, and sterile distilled water is added to the final volume of 25 μL.

[0036] As an improvement of the above technical solution, the concentration of the template DNA is 50 ng / μL to 300 ng / μL.

[0037] As an improvement of the above technical solution, the sample to be detected in step (1) is a medicinal material or water extract of pygmy snake and its mixed and counterfeit products;

[0038] The extraction of DNA from the to-be-detected snake and its mixed and counterfeit medicinal materials comprises the following steps: fully grinding the to-be-detected snake and its mixed and counterfeit medicinal materials, taking 30 mg to 80 mg of the ground sample, extracting DNA using a DNA kit, testing the purity and concentration of the sample DNA, and then freezing and storing;

[0039] The extraction of DNA from the water extract of the to-be-detected garter snake and its mixed products includes the following steps: taking 30mg to 80mg of freeze-dried powder of the water extract of the to-be-detected garter snake and its mixed products, extracting DNA using a two-step CTAB method, and freezing and storing the sample DNA after testing the purity and concentration.

[0040] As an improvement of the above technical solution, the electrophoresis detection in step (3) is agarose gel electrophoresis detection, comprising the following steps: mixing the PCR amplification product with the buffer, taking 6 μL to 8 μL and spotting it on the agarose gel, electrophoresing for 25 min to 45 min at a voltage of 120 V to 140 V, and developing with GelRed to obtain gel imaging results.

[0041] As an improvement of the above technical solution, the electrophoresis detection in step (3) is capillary electrophoresis detection, comprising the following steps: performing capillary electrophoresis detection on the PCR amplification product through an analyzer, and performing spectrum correction according to the target band size, with a peak detection threshold intensity of 100 to 30,000, and exporting data.

[0042] Implementing the embodiments of the present invention has the following beneficial effects:

[0043] 1. The invention designs multiplex PCR identification primers for the black-necked snake, the hundred-flowered snake, the red-banded snake, the black-browed snake, the king snake and the gray rat snake, and establishes an identification method for the black-necked snake and five common mixed and counterfeit medicinal materials and water extracts thereof, which solves the problem that the snake water extract is difficult to identify after losing its morphology and the DNA structure breaks after the water extract is extracted by heat. Six different species of snakes can be identified under the same amplification conditions, with high identification efficiency, low cost and good identification accuracy.

[0044] 2. The present invention combines capillary electrophoresis with multiplex PCR technology to improve the sensitivity of detection. The detection limit of raw materials in the multiplex system is 2.344 ng, and the detection limit of water extract is 18.75 ng. In addition, the identification system can detect 1% of adulterated products in the garter snake medicinal materials and 1% of adulterated products in the garter snake water extract. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 The figure is the result of agarose gel electrophoresis detection of the primer screening of the garter snake in Example 1; wherein 1 and 2 are garter snake medicinal materials; 3 and 4 are garter snake water extracts; 5 and 6 are garter snake formula granules; 7 is elaphe medicinal materials; 8 is red chain snake medicinal materials; 9 is black browed snake medicinal materials; 10 is king snake medicinal materials; 11 is gray rat snake medicinal materials; 12 is cobra original medicinal materials; 13 is mouse snake medicinal materials; 14 is Bungarus bungarus medicinal materials; 15 is round spot viper medicinal materials; 16 is short tailed agkistrodon medicinal materials; 17 is money white flower snake medicinal materials; 18 is bamboo leaf green medicinal materials; N is blank control (ddH2O);

[0046] Figure 2 The agarose gel electrophoresis test result diagram of the successful screening of primers for mixed counterfeits in Example 1; wherein 1 and 2 are the medicinal materials and water extracts of the black-banded snake, respectively; 3 and 4 are the medicinal materials and water extracts of the hundred-flowered snake, respectively; 5 and 6 are the medicinal materials and water extracts of the red-chained snake, respectively; 7 and 8 are the medicinal materials and water extracts of the black-browed snake, respectively; 9 and 10 are the medicinal materials and water extracts of the king snake, respectively; 11 and 12 are the medicinal materials and water extracts of the gray rat snake, respectively; 13 is the medicinal materials of the cobra; 14 is the medicinal materials of the smooth rat snake; 15 is the medicinal materials of the Bungarus bungeut; 16 is the medicinal materials of the round-spotted viper; 17 is the medicinal materials of the short-tailed agkistrodon; 18 is the medicinal materials of the golden money white flower snake; 19 is the medicinal materials of the Agkistrodon acutus; 20 is the medicinal materials of the bamboo leaf green; N is a blank control (ddH2O);

[0047] Figure 3 This is a graph showing the agarose gel electrophoresis test result of the primers that failed to screen for counterfeit products in Example 1; Figure 3(A) is the result of primer screening of WJS6-F / WJS6-R, where 1 and 2 are Elaphe kingi medicinal materials and water extracts, respectively; 3 is Agkistrodon davidianus medicinal materials; 4 is Elaphe baihuaensis medicinal materials; 5 is Elaphe rubrum medicinal materials; 6 is Elaphe nigromaculata medicinal materials; 7 is Griseus grizzlyus medicinal materials; 8 is Cobra original medicinal materials; 9 is Slippery rat snake medicinal materials; 10 is Bungarus bungeutum medicinal materials; 11 is Vipera rotundus medicinal materials; 12 is Agkistrodon short-tailed; 13 is Agkistrodon moniliformis medicinal materials; 14 is Trimeresurus baculum medicinal materials; 15 is Agkistrodon acutus medicinal materials; N is blank control (ddH2O); Figure 3 (B) is the result of primer screening of HMJS3-F / HMJS3-R, where 1 and 2 are Elaphe nigromaculata medicinal materials and water extracts, respectively; 3 is Agkistrodon davidianus medicinal materials; 4 is Elaphe floridus medicinal materials; 5 is Agkistrodon rubripes medicinal materials; 6 is Elaphe regius medicinal materials; 7 is Rat Snake medicinal materials; 8 is Cobra original medicinal materials; 9 is Rat Snake medicinal materials; 10 is Bungarus bungeutum medicinal materials; 11 is Vipera rotundus medicinal materials; 12 is Agkistrodon acutus medicinal materials; 13 is Agkistrodon scrofa medicinal materials; 14 is Trimeresurus baculum medicinal materials; 15 is Agkistrodon acutus medicinal materials; N is blank control (ddH2O); Figure 3 (C) is the result of primer screening of primers HUISS6-F / HUISS6-R, where 1 and 2 are the medicinal materials and water extracts of gray rat snake, respectively; 3 is the medicinal materials of black-necked snake; 4 is the medicinal materials of Elaphe striata; 5 is the medicinal materials of red-chain snake; 6 is the medicinal materials of king snake; 7 is the medicinal materials of black-browed Elaphe; 8 is the original medicinal materials of cobra; 9 is the medicinal materials of smooth rat snake; 10 is the medicinal materials of Bungarus bungeut; 11 is the medicinal materials of Vipera rotundus; 12 is the medicinal materials of Agkistrodon short-tailed; 13 is the medicinal materials of white flower snake; 14 is the medicinal materials of Trimeresurus tridentatus; 15 is the medicinal materials of Agkistrodon acutus; N is the blank control (ddH2O);

[0048] Figure 4 The results of agarose gel electrophoresis detection by triple PCR primer screening in Example 1; wherein 1 and 2 are respectively the medicinal materials and water extracts of the black-banded snake; 3 and 4 are respectively the medicinal materials and water extracts of the hundred-flowered elaphe; 5 and 6 are respectively the medicinal materials and water extracts of the gray rat snake; 7 and 8 are respectively the medicinal materials and water extracts of the king snake; 9 and 10 are respectively the medicinal materials and water extracts of the black-browed elaphe; 11 and 12 are respectively the medicinal materials and water extracts of the red-chained snake; 13 and 14 are respectively the medicinal materials and water extract mixtures of the six target species of snakes; 15 is the medicinal materials of the cobra; 16 is the medicinal materials of the smooth rat snake; 17 is the medicinal materials of the Bungarus bungarus; 18 is the medicinal materials of the round-spotted viper; 19 is the medicinal materials of the short-tailed agkistrodon; 20 is the medicinal materials of the golden money white flower snake; 21 is the medicinal materials of the Agkistrodon acutus; 22 is the medicinal materials of the bamboo leaf green; N is a blank control (ddH2O);

[0049] Figure 5The results of agarose gel electrophoresis detection for the six-plex PCR primer screening in Example 1; 1 and 2 are the medicinal materials and water extracts of Agkistrodon davidianus, respectively; 3 and 4 are the medicinal materials and water extracts of Elaphe striata, respectively; 5 and 6 are the medicinal materials and water extracts of Elaphe rubrum, respectively; 7 and 8 are the medicinal materials and water extracts of Elaphe nigromaculata, respectively; 9 and 10 are the medicinal materials and water extracts of Elaphe striata, respectively; 11 and 12 are the medicinal materials and water extracts of Gnathospermum officinale, respectively; 13 and 14 are the medicinal materials and water extract mixtures of the six target species of snakes, respectively; 15 is the medicinal materials of Cobra; 16 is the medicinal materials of Rat Snake; 17 is the medicinal materials of Bungarus bungarus; 18 is the medicinal materials of Vipera rotundus; 19 is the medicinal materials of Agkistrodon acutus; 20 is the medicinal materials of Snake moniliformis; 21 is the medicinal materials of Agkistrodon acutus; 22 is the medicinal materials of Trimeresurus tridentatus; N is a blank control (ddH2O);

[0050] Figure 6 It is a graph of the multiplex PCR agarose gel electrophoresis detection results under different types of DNA polymerases in Example 2; wherein 1 and 2 are respectively the medicinal materials and water extracts of the black-banded snake; 3 and 4 are respectively the medicinal materials and water extracts of the hundred-flowered snake; 5 and 6 are respectively the medicinal materials and water extracts of the red-chained snake; 7 and 8 are respectively the medicinal materials and water extracts of the black-browed snake; 9 and 10 are respectively the medicinal materials and water extracts of the king snake; 11 and 12 are respectively the medicinal materials and water extracts of the gray rat snake; 13 is the medicinal materials of the cobra; 14 is the medicinal materials of the smooth rat snake; 15 is the medicinal materials of the Bungarus bungeut; 16 is the medicinal materials of the round-spotted viper; 17 is the medicinal materials of the short-tailed agkistrodon; 18 is the medicinal materials of the white flower snake; 19 is the medicinal materials of the Agkistrodon acutus; 20 is the medicinal materials of the bamboo leaf green; N is a blank control (ddH2O);

[0051] Figure 7 The multiplex PCR agarose gel electrophoresis test results at different annealing temperatures in Example 2 are shown in Figure 1; wherein 1 and 2 are the medicinal materials and water extracts of Agkistrodon davidianus, respectively; 3 and 4 are the medicinal materials and water extracts of Elaphe floridula, respectively; 5 and 6 are the medicinal materials and water extracts of Snake erythraea, respectively; 7 and 8 are the medicinal materials and water extracts of Elaphe nigromaculata, respectively; 9 and 10 are the medicinal materials and water extracts of Elaphe regius, respectively; 11 and 12 are the medicinal materials and water extracts of Rattus grizzlyus, respectively; N is a blank control (ddH2O);

[0052] Figure 8 The multiplex PCR agarose gel electrophoresis results at different cycle numbers in Example 2; 1 and 2 are the medicinal materials and water extracts of Agkistrodon davidianus, respectively; 3 and 4 are the medicinal materials and water extracts of Elaphe philadelphus, respectively; 5 and 6 are the medicinal materials and water extracts of Agkistrodon erythroxylon, respectively; 7 and 8 are the medicinal materials and water extracts of Elaphe nigromaculata, respectively; 9 and 10 are the medicinal materials and water extracts of Elaphe chinensis, respectively; 11 and 12 are the medicinal materials and water extracts of Gnathospermum grizzlyi, respectively; N is a blank control (ddH2O);

[0053] Fig. 9The multiplex PCR agarose gel electrophoresis results at different primer amounts in Example 2; 1 and 2 are the medicinal materials and water extracts of Agkistrodon davidianus, respectively; 3 and 4 are the medicinal materials and water extracts of Elaphe floridula, respectively; 5 and 6 are the medicinal materials and water extracts of Snake erythraea, respectively; 7 and 8 are the medicinal materials and water extracts of Elaphe nigromaculata, respectively; 9 and 10 are the medicinal materials and water extracts of Elaphe chinensis, respectively; 11 and 12 are the medicinal materials and water extracts of Gnathospermum grizzlyi, respectively; N is a blank control (ddH2O);

[0054] Fig.10 The multiplex PCR agarose gel electrophoresis test results under different template amounts in Example 3 are shown in Figure 1; wherein 1 and 2 are the medicinal materials and water extracts of Agkistrodon davidianus, respectively; 3 and 4 are the medicinal materials and water extracts of Elaphe philadelphus, respectively; 5 and 6 are the medicinal materials and water extracts of Agkistrodon erythroxylon, respectively; 7 and 8 are the medicinal materials and water extracts of Elaphe nigromaculata, respectively; 9 and 10 are the medicinal materials and water extracts of Elaphe chinensis, respectively; 11 and 12 are the medicinal materials and water extracts of Gnathospermum grizzlyi, respectively; N is a blank control (ddH2O);

[0055] Fig.11 The capillary electrophoresis detection result diagram of the durability of different instruments in Example 3; wherein 1 and 2 are the medicinal materials and water extracts of the black-banded snake, respectively; 3 and 4 are the medicinal materials and water extracts of the hundred-flowered snake, respectively; 5 and 6 are the medicinal materials and water extracts of the red-chained snake, respectively; 7 and 8 are the medicinal materials and water extracts of the black-browed snake, respectively; 9 and 10 are the medicinal materials and water extracts of the king snake, respectively; 11 and 12 are the medicinal materials and water extracts of the gray rat snake, respectively; 13 is the medicinal materials of the cobra; 14 is the medicinal materials of the smooth rat snake; 15 is the medicinal materials of the Bungarus bungeut; 16 is the medicinal materials of the round-spotted viper; 17 is the medicinal materials of the short-tailed agkistrodon; 18 is the medicinal materials of the golden money white flower snake; 19 is the medicinal materials of the Agkistrodon acutus; 20 is the medicinal materials of the bamboo leaf green; N is the blank control (ddH2O);

[0056] Fig.12 The figure is the result of capillary electrophoresis detection of the applicability investigation in Example 3; wherein 1-10 are Agkistrodon davidianus medicinal materials; 11-20 are Agkistrodon davidianus water extracts; 21-23 are Agkistrodon davidianus formula granules; 24-26 are Elaphe baihuaensis medicinal materials; 27-29 are Elaphe baihuaensis water extracts; 30-32 are Elaphe rubrum medicinal materials; 33-35 are Elaphe rubrum water extracts; 36-38 are Elaphe nigromaculata medicinal materials; 39-41 are Elaphe nigromaculata water extracts; 42-44 are Elaphe regius medicinal materials; 45-47 are Elaphe regius water extracts; 48-50 are Griseus grizzlyus medicinal materials; 51-53 are Griseus grizzlyus water extracts; N is a blank control (ddH2O);

[0057] Fig.13The capillary electrophoresis detection result diagram of the specificity investigation in Example 3; wherein 1 is a mixture of six snake medicinal materials; 2 and 3 are respectively the medicinal materials and water extracts of the black-banded snake; 4 and 5 are respectively the medicinal materials and water extracts of the hundred-flowered snake; 6 and 7 are respectively the medicinal materials and water extracts of the red-banded snake; 8 and 9 are respectively the medicinal materials and water extracts of the black-browed snake; 10 and 11 are respectively the medicinal materials and water extracts of the king snake; 12 and 13 are respectively the medicinal materials and water extracts of the gray rat snake; 14-16 are the medicinal materials of the cobra; 17-19 are the water extracts of the cobra; 20-22 are respectively the medicinal materials of the smooth rat snake Medicinal materials; 23-25 ​​are water extracts of snakes; 26-28 are water extracts of snakes; 29-31 are water extracts of snakes; 32-34 are water extracts of vipers; 35-37 are water extracts of vipers; 38-40 are water extracts of Agkistrodon acutus; 41-43 are water extracts of Agkistrodon acutus; 44-46 are water extracts of Agkistrodon acutus; 47-49 are water extracts of Agkistrodon acutus; 50-52 are water extracts of Agkistrodon acutus; 53-55 are water extracts of Agkistrodon acutus; 56-58 are water extracts of Trimeresurus tridentatus; N is blank control (ddH2O);

[0058] Fig.14 The capillary electrophoresis detection result diagram of specificity in Example 4; 1 to 3 are the granules of the formula of Agkistrodon davidianus; 4 to 8 are the water extracts of Agkistrodon davidianus; 9 to 13 are the medicinal materials of Agkistrodon davidianus; N is the blank control (ddH2O);

[0059] Fig.15 The capillary electrophoresis detection result diagram of specificity investigation in Example 4; wherein 1 to 3 are mixed and counterfeit medicinal materials; 4 to 6 are mixed and counterfeit water extracts; N is a blank control (ddH2O);

[0060] Fig.16 This is a graph showing the results of capillary electrophoresis testing of the sensitivity of Chinese medicinal materials and water extracts in Example 4; Fig.16 (A) is a graph showing the results of capillary detection of medicinal materials sensitivity, where 1 to 11 are 300 to 0.293 ng of DNA mixture (corresponding to numbers 1 to 11 in Table 3); N is a blank control (ddH2O, corresponding to number 17 in Table 3); Fig.16 (B) is a capillary electrophoresis test result diagram of water extract sensitivity investigation, wherein 1 to 9 are 300 to 1.172 ng of DNA mixture (corresponding to sequence numbers 1 to 9 in Table 4); N is a blank control (ddH2O, corresponding to sequence number 12 in Table 4);

[0061] Fig.17 This is a capillary electrophoresis test result diagram of the sensitivity of adulteration of Chinese medicinal materials and water extracts in Example 4; Fig.17 (A) is a capillary electrophoresis test result diagram for the sensitivity investigation of adulteration of medicinal materials, wherein 1 to 15 are mixtures of 99% to 1% DNA of garter snake medicinal materials and adulterated medicinal materials (corresponding to numbers 1 to 15 in Table 5); N is a blank control (ddH2O, corresponding to number 16 in Table 5); Fig.17(B) is a capillary electrophoresis test result diagram for the investigation of water extract adulteration sensitivity, wherein 1 to 15 are mixtures of 99% to 1% DNA of water extract of Garcinia charantia: water extract of adulterated products (corresponding to numbers 1 to 15 in Table 6); N is a blank control (ddH2O, corresponding to number 16 in Table 6). DETAILED DESCRIPTION

[0062] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention will be further described in detail below in conjunction with specific embodiments.

[0063] The present invention provides a primer combination for multiplex PCR-CE identification of garter snakes and mixed and counterfeit medicinal materials and water extracts thereof, comprising a first primer pair, a second primer pair, a third primer pair, a fourth primer pair, a fifth primer pair and a sixth primer pair, and the specific sequences are shown in Table 1.

[0064] Table 1 Primer sequence information

[0065]

[0066] The primer combination provided by the present invention has good stability and strong specificity, and includes at least one of the following applications:

[0067] (1) Identify the black-necked snake, the Elaphe dione, the red-banded snake, the black-browed Elaphe dione, the king Elaphe dione and the gray rat snake.

[0068] (2) Prepare a kit for identifying black-necked snake, Elaphe striata, red-banded snake, black-browed Elaphe, king snake and gray rat snake.

[0069] (3) Identify whether the snake to be tested is a black-necked snake, a hundred-flowered rat snake, a red-banded snake, a black-browed rat snake, a king snake, or a gray rat snake.

[0070] (4) Prepare a test kit for identifying whether the snake to be tested is a black-necked snake, a hundred-flowered snake, a red-banded snake, a black-browed snake, a king snake or a gray rat snake.

[0071] (5) Identify whether the sample to be tested contains black-necked snake and / or hundred-flowered snake and / or red-banded snake and / or black-browed snake and / or king snake and / or gray rat snake.

[0072] (6) Prepare a kit for identifying whether the sample to be tested contains Garcinia charax, Elaphe dasyphylla, Elaphe rubrum, Elaphe nigromaculata, Elaphe nigromaculata, Elaphe striata, and Elaphe chinensis.

[0073] The present invention also provides a kit comprising the primer combination, which is used for identifying the medicinal materials and water extracts of the black-necked snake and its mixed and counterfeit products.

[0074] Based on the above primers, the present invention also provides a multiplex PCR-CE identification method for identifying the black-necked snake and its mixed and counterfeit medicinal materials and water extracts, which comprises:

[0075] (1) Extract DNA from the sample to be tested, use BioSpec-nano micro-volume UV spectrophotometer to measure the DNA concentration, record OD260 / OD230, OD260 / OD280, and adjust the concentration to the corresponding concentration. The sample to be tested is snake medicinal material or snake water extract.

[0076] (1.1) The DNA extraction method of snake medicinal materials is as follows:

[0077] Use of snake medicine DNA was extracted using the SV Genomic DNA Purification Kit (Promega (Beijing) Biotechnology Co., Ltd.). The specific extraction steps are as follows:

[0078] (1.1.1) Take the sample to be tested and add EDTA solution containing protease to lyse the cells.

[0079] Specifically, grind the sample to be tested, take 30 mg to 80 mg of the ground sample and place it in a 2 mL centrifuge tube, add 200 μL of Nuclei Lysis Solution, 50 μL of 0.5 mol / L EDTA (pH 8.0), 20 μL of Proteinase K (20 mg / mL), and 5 μL of RNase A Solution (4 mg / mL), vortex oscillate for 30 seconds, and heat in a 55°C water bath for 120 minutes; add 250 μL of SV Lysis Buffer, vortex oscillate for 30 seconds, and centrifuge at 8000 rpm for 30 seconds.

[0080] (1.1.2) Take the solution after cell lysis for purification.

[0081] Specifically, the supernatant was added to the SV Minicolumn column and centrifuged at 12000 rpm for 3 min; the filtrate was discarded, 650 μL of Column Wash Solution was added to the SV Minicolumn column, and centrifuged at 12000 rpm for 1 min. The column was rinsed repeatedly 2 to 4 times until the collected solution was colorless.

[0082] (1.1.3) Take the purified solution and incubate it to obtain the genomic DNA of the sample to be tested.

[0083] Specifically, centrifuge at 12000 rpm for 2 min, discard the collection tube and filtrate, take the collection column and place it in a new 1.5 mL centrifuge tube, add 50 μL of PE buffer, let it stand at room temperature for 2 min, centrifuge at 12000 rpm for 1 min, collect the solution in a centrifuge tube as a template DNA solution, use an ultra-micro spectrophotometer to detect the purity and concentration of the sample DNA, and then store it at -20°C.

[0084] (1.2) The DNA extraction method of snake water extract is as follows:

[0085] (1.2.1) Preparation of snake water extract: Take each batch of snake medicinal materials, remove the head, tail and scales, cut into segments, take 10g of snake segments into a 250mL flask, add 100mL of water and heat under reflux for 2h, filter the filtrate with a 250-mesh sieve while hot, and concentrate to 15mL, and dispense into 10mL brown vials. The volume of each bottle is 2mL, and after dispensing, transfer to a vacuum freeze dryer for freeze drying to obtain the extract.

[0086] (1.2.2) Take the sample to be tested, add CTAB precipitation solution and extract 2 to 3 times to obtain a precipitate;

[0087] Specifically, 30 mg to 80 mg of the lyophilized powder is placed in a centrifuge tube, 1 mL to 1.5 mL of CTAB precipitation solution is added and mixed evenly, heated in a water bath at 60 to 70° C. for 55 to 75 min, centrifuged at 10,000 rpm to 14,000 rpm for 2 min to 6 min, and the supernatant is discarded; 1 mL to 1.5 mL of CTAB precipitation solution is added and mixed evenly, heated in a water bath at 60 to 70° C. for 25 to 45 min, centrifuged at 10,000 rpm to 14,000 rpm for 2 min to 6 min, and the supernatant is discarded.

[0088] The composition of the CTAB precipitation solution is 1% to 3% (w / v) CTAB, 80 mmol / L to 120 mmol / L Tris HCl, and 10 mmol / L to 30 mmol / L EDTA (pH 8.0).

[0089] (1.2.3) Take the precipitate and add CTAB extraction solution and β-mercaptoethanol to extract, then add chloroform isoamyl alcohol to extract 2 to 3 times to obtain the supernatant after extraction;

[0090] Specifically, add 0.8mL~1.2mL CTAB extraction solution, 5μL~15μL proteinase K, and 5μL~15μL β-mercaptoethanol to the precipitate, mix well, heat in a water bath at 60~70°C for 100min~150min, centrifuge at 10000rpm~14000rpm for 2min~6min, take the supernatant after extraction, add an equal volume of chloroform isoamyl alcohol (volume ratio 24:1) mixed solution, shake and mix well, and then centrifuge, take 700~800μL of the supernatant, add an equal volume of chloroform isoamyl alcohol (24:1) mixed solution, shake and mix well, and centrifuge at 10000rpm~14000rpm for 2min~6min, take 400~500μL of the supernatant, and obtain.

[0091] The composition of the CTAB extract is 1% to 3% (w / v) CTAB, 80mmol / L to 120mmol / LTris HCl, 10mmol / L to 30mmol / L EDTA (pH 8.0), 1mol / L to 3mol / L NaCl, and 1% to 3% (w / v) PVP40.

[0092] (1.2.4) Add isopropanol to the extract to precipitate. Wash and dissolve the precipitate to obtain the genomic DNA of the sample to be tested.

[0093] Specifically, take the extract, add an equal volume of isopropanol, let it stand at 30°C to 20°C for 40min to 80min, discard the supernatant after centrifugation, wash the precipitate with ethanol 2 to 4 times, place it in a metal bath at 37°C to evaporate the solvent, add 40μL to 60μL of sterile water to dissolve it, and obtain the genomic DNA of the sample to be tested as a DNA template. Use an ultra-micro spectrophotometer to detect the purity and concentration of the sample DNA and then store it at -20°C.

[0094] (2) Perform multiplex PCR amplification using the DNA of the sample to be tested as a template.

[0095] Specifically, the PCR reaction system includes the following substances: 2 μL to 8 μL of DNA polymerase, 0.3 μL to 0.6 μL of the first primer pair, 0.3 μL to 0.6 μL of the second primer pair, 0.3 μL to 0.6 μL of the third primer pair, 0.3 μL to 0.6 μL of the fourth primer pair, 0.3 μL to 0.6 μL of the fifth primer pair, 0.3 μL to 0.6 μL of the sixth primer pair, 0.5 μL to 1.5 μL of template DNA, and supplemented with sterile distilled water to a final volume of 25 μL;

[0096] Preferably, the PCR reaction system includes the following substances: 5 μL of DNA polymerase, 0.5 μL of the first primer pair, 0.5 μL of the second primer pair, 0.5 μL of the third primer pair, 0.3 μL of the fourth primer pair, 0.6 μL of the fifth primer pair, 0.6 μL of the sixth primer pair, 1 μL of template DNA, and supplemented with sterile distilled water to a final volume of 25 μL;

[0097] Premix Taq TM (Ex Taq TM Version 2.0), 2×Taq PCR Mix, 2×SanTaq PCR Master Mix (with Blue Dye), Multiplex PCR 5×Master Mix.

[0098] Preferably, the DNA polymerase used is Multiplex PCR 5×Master Mix.

[0099] The multiplex PCR amplification program includes the following steps: pre-denaturation at 92°C to 96°C for 4min to 8min; denaturation at 92°C to 95°C for 20s to 40s, annealing at 60°C to 70°C for 30s to 50s, and cycling 20 to 30 times; and extension at 70°C to 75°C for 3min to 6min.

[0100] Preferably, the multiplex PCR amplification procedure comprises the following steps: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 65°C for 45 s, 25 cycles; and extension at 72°C for 5 min.

[0101] (3) Detect the amplified product by electrophoresis.

[0102] Specifically, the amplification product can be analyzed by agarose gel electrophoresis or capillary electrophoresis, but is not limited thereto.

[0103] The amplification product is detected and analyzed by agarose gel electrophoresis, including the following steps:

[0104] After the PCR amplification reaction is completed, add 3μL~6μL 6× loading buffer to the reaction system, mix well, take 6μL~8μL of the mixed product and spot it on 3.5% agarose gel, electrophoresed at 120V~140V voltage for 25min~45min, and developed with GelRed to obtain gel imaging results.

[0105] Preferably, the amplification product is detected and analyzed by capillary electrophoresis, which is more accurate, sensitive and efficient than agarose gel electrophoresis. Specifically, the capillary electrophoresis detection includes the following steps:

[0106] After the PCR amplification reaction is completed, the PCR product is detected by capillary electrophoresis using an ABI3730 analyzer. The capillary electrophoresis detection results are analyzed for fragment size using GeneMarker V2.2.0. According to the target band size, GS500 is selected as the fluorescent DNA molecular weight standard for spectrum correction, the analysis type is selected as fragment (animal), the peak detection threshold intensity is 100 to 30000, and finally the data is exported. If the amplified product contains a DNA characteristic peak of 347bp, the sample to be tested contains the medicinal material of black-necked snake and / or its water extract; if the amplified product contains a DNA characteristic peak of 247bp, the sample to be tested contains the medicinal material of Elaphe dioica and / or its water extract; if the amplified product contains a DNA characteristic peak of 206bp, the sample to be tested contains the medicinal material of red-bellied snake and / or its water extract; if the amplified product contains a DNA characteristic peak of 144bp, the sample to be tested contains the medicinal material of Elaphe dioica and / or its water extract; if the amplified product contains a DNA characteristic peak of 125bp, the sample to be tested contains the medicinal material of Elaphe dioica and / or its water extract; if the amplified product contains a DNA characteristic peak of 99bp, the sample to be tested contains the medicinal material of Gray Rat Snake and / or its water extract.

[0107] The present invention is further described below with reference to specific embodiments.

[0108] Example 1 Primer design and screening

[0109] The mitochondrial gene sequences of various snakes, such as cytochrome oxidase subunit I (COⅠ) and 16S ribosomal RNA (16S rRNA), were downloaded from the NCBI (http: / / www.ncbi.nlm.nih.gov) database, and homology comparison was performed using Bioedit to obtain the differential sites of Elaphe elegans, Elaphe rubrum, Elaphe nigromaculata, Elaphe striata and Elaphe striata. After determining the differential sites, the effects of the six snake species and the damage to DNA by high-temperature water extraction were considered comprehensively, and specific primers were designed using primer premier 5 and verified by Blast. The primers were synthesized by Shenggong Biotechnology (Guangzhou) Co., Ltd. The following table shows the information of the designed primers:

[0110] Table 2 Primer design information

[0111]

[0112]

[0113] The specific PCR amplification system for primer screening was 12.5 μL of 2×T5 Super PCR Mix, 0.3 μL of upstream and downstream primers (10 μmol / L), 1 μL of template DNA, and sterilized distilled water was added to make up to 25 μL. The PCR amplification conditions were 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 64°C annealing for 45 s, 27 cycles; 72°C extension for 5 min. Figure 1 and Figure 2 To screen successful primers, it can be seen that specific primers all have the characteristics of good stability and strong specificity. Figure 3 To screen out failed primers, the target band brightness was weak and non-target species showed positive interference. Three pairs of primers, WSS5-F / WSS5-R, BHJS-F / BHJS-R and HUISS-F / HUISS-R, were used to establish triple PCR. Figure 4 It was found that the primers interfered with each other, and non-target species showed positive interference. Then WSS5-F / WSS5-R was replaced with WSSYD-F / WSSYD-R to establish a six-fold system. The results are shown in Figure 5 .

[0114] Primer screening must ensure that only the target species amplifies the band, and the other mixed species and blank control group have no amplification. When multiple pairs of primers are mixed, it is necessary to prevent the non-specific amplification caused by the interaction between different primers from interfering with the test results. Therefore, the more species are tested at the same time, the more difficult the primer screening is. The final primer combination screened is as follows.

[0115] The first primer pair for identifying the black-necked snake consists of primer WSSYD-F and primer WSSYD-R (5' to 3'):

[0116] WSSYD-F: GCGAAAGCTCGACCTAGCAAGGGGACCACA;

[0117] WSSYD-R:CAGGCTCCTCTAGGTTGTTATGGGGTACCG;

[0118] The second primer pair used to identify Elaphe baihuaensis consists of primer BHJS-F and primer BHJS-R (5' to 3'):

[0119] BHJS-F:ATGACCAGGTTTTTAATGTTCTG;

[0120] BHJS-R: ACGGGGGGTAGGCTGTTC;

[0121] The third primer pair for identifying the red snake consists of primer CLS-F and primer CLS-R (5' to 3'):

[0122] CLS-F:ACCGTGTACCCGCCACTG;

[0123] CLS-R: AAGCATGATAGCAGTAATTAGCACA;

[0124] The fourth primer pair for identifying Elaphe nigromaculata consists of primer HMJS-F and primer HMJS-R (5' to 3'):

[0125] HMJS-F:CGACCAGATCTTTAATGTTCTAGTC;

[0126] HMJS-R:GTTTATCCTGGAAAAGCTATG;

[0127] The fifth primer pair for identifying Elaphe draco consists of primer WJS-F and primer WJS-R (5' to 3'):

[0128] WJS-F:TTTTTAATGTGCTAGTTACTGCTCA;

[0129] WJS-R: TGGAAAGGCTATGTCGGGA;

[0130] The sixth primer pair for identifying gray rat snakes consists of primer HUISS-F and primer HUISS-R (5' to 3'):

[0131] HUISS-F: CCTAAATCCATACCAATGTTCAACC;

[0132] HUISS-R: GATTGCTGCTGCTAGTACGGGA.

[0133] The first primer pair, the second primer pair, the third primer pair, the fourth primer pair, the fifth primer pair and the sixth primer pair form a primer combination for the identification of the black-necked snake and five mixed and counterfeit snakes.

[0134] Example 2 Optimization of multiplex PCR reaction conditions

[0135] (2.1) Investigation of different enzymes

[0136] By single factor investigation, DNA polymerase was Premix Taq TM (Ex Taq TMVersion 2.0), 2×TaqPCR Mix, 2×SanTaq PCR Master Mix (with Blue Dye), Multiplex PCR 5×Master Mix, the effect on PCR amplification, the results are as follows Figure 6 The results showed that the amplification effects of 2×Taq PCR Mix and 2×SanTaq PCR Mix were poor, and the bands amplified by Multiplex PCR 5×Master Mix were brighter, so MultiplexPCR 5×Master Mix was determined as the DNA polymerase for multiplex PCR of garter snake.

[0137] (2.2) Annealing temperature investigation

[0138] The effects of annealing temperatures of 63°C, 64°C, 65°C, and 66°C on PCR amplification were investigated by single factor analysis. The results are as follows: Figure 7 The results showed that at 63℃, there were miscellaneous bands in the medicinal material of Elaphe baihuaensis except the target band, and no non-specific bands appeared in other species. In order to ensure the specificity and accuracy of the PCR reaction, the reaction annealing temperature was determined to be 65℃.

[0139] (2.3) Investigation of different cycle numbers

[0140] The effects of 23, 25, 27, and 29 cycles on PCR amplification were investigated by single factor analysis. The results are as follows Figure 8 As shown. The results showed that in 29 cycles, there were miscellaneous bands in addition to the target band in the Elaphe baihuaensis medicinal material, and no non-specific bands appeared in other species. Under the premise of ensuring the brightness of the product band, a lower number of cycles can be selected to avoid contamination, thereby ensuring the accuracy of experimental identification. Therefore, the number of reaction cycles was determined to be 25 cycles.

[0141] (2.4) Investigation of different primer amounts

[0142] At the beginning of the experiment, the amount of primers used for each species was 0.5 μL (10 μmol / L). According to the adjustment principle of "reducing nonspecific amplification and enhancing specific amplification", the amount of primers for each species was adjusted. Finally, the amount of primers for the black-necked snake, the hundred-flowered snake and the red-banded snake was determined to be 0.5 μL (10 μmol / L); the amount of primers for the black-browed snake was 0.3 μL (10 μmol / L); the amount of primers for the king snake and the gray rat snake was 0.6 μL (10 μmol / L). The results are as follows Fig. 9 shown.

[0143] (2.5) Investigation of different template amounts

[0144] The effects of DNA template amounts of 300ng / μL, 150ng / μL, 100ng / μL, and 50ng / μL on PCR amplification were investigated by single factor analysis. The results are as follows Fig.10 The results showed that when the template amount was 50ng-100ng, the band brightness of the water extract of some species was weak, and the band brightness of 300ng and 150ng was similar, so 150ng of DNA template was finally selected.

[0145] In summary, the optimal parameters of the multiplex PCR reaction conditions were: 95℃ pre-denaturation for 5min; 95℃ denaturation for 30s, 65℃ annealing for 45s, 25 cycles; 72℃ extension for 5min. The optimal PCR reaction system included Multiplex PCR 5X MasterMix 5μL, 0.5μL (10μmol / L) of upstream and downstream primers for the black-banded snake, Elaphe striata and red-banded snake, 0.3μL (10μmol / L) of upstream and downstream primers for the black-browed Elaphe striata, 0.6μL (10μmol / L) of upstream and downstream primers for the king snake and gray rat snake, 1μL (150ng / μL) of template DNA, and added sterile distilled water to 25μL.

[0146] Example 3 Investigation of the durability, applicability and specificity of the multiplex PCR method

[0147] The optimized identification method of Example 2 was used to identify the snake samples. The species information of the snake samples is shown in Table 3.

[0148] Table 3 Snake sample list

[0149]

[0150]

[0151] (3.1) Durability test of different instruments

[0152] In order to test the influence of different PCR instruments on the identification results, the identification method optimized in Example 2 was selected and amplified using four PCR instruments. The results are as follows: Fig.11 The results show that the brightness of the bands amplified by different instruments is different, but accurate identification results can be obtained, indicating that this identification method has a certain stability.

[0153] (3.2) Applicability investigation

[0154] The identification method optimized in Example 2 was used to identify 10 batches of Agkistrodon acutus medicinal materials, 10 batches of Agkistrodon acutus water extracts, 3 batches of Agkistrodon acutus formula granules, and 3 batches of Elaphe striata, Elaphe rubrum, Elaphe nigromaculata, Elaphe striata and Elaphe chinensis medicinal materials and water extracts, and the results were as follows: Fig.12The results showed that the target bands of the corresponding species could be amplified in each batch of samples to be tested, indicating that this identification method is applicable.

[0155] (3.3) Specificity investigation

[0156] The identification method optimized in Example 2 was used to identify 14 snake species. The results are as follows: Fig.13 The results showed that except for six snakes (black-necked snake, Elaphe baicalensis, red-banded snake, black-browed Elaphe, king Elaphe, and gray rat snake), no other counterfeit products showed bands, indicating that this identification method is specific.

[0157] Example 4 Investigation of the specificity and sensitivity of multiplex PCR-CE

[0158] (4.1) Specificity study of multiplex PCR-CE in black snake

[0159] The optimized identification method of Example 2 was used to amplify the six snake species, and the amplified samples were detected by capillary electrophoresis. The results were as follows: Fig.14 and Fig.15 The results showed that the identification method was specific and could amplify the water extract of the corresponding species and the formula granules of the black-necked snake, and the fragment sizes amplified from the water extract and the medicinal materials of the corresponding species were consistent.

[0160] (4.2) Sensitivity study of multiplex PCR-CE in black snake

[0161] The concentration of DNA in medicinal materials and water extracts of six snake species was measured using a UV-visible spectrophotometer. The DNA concentration of each species was adjusted to 300 ng / μL and mixed. The mixed DNA was serially diluted two times from 300 ng / μL to 0.009 ng / μL, and the diluted mixed DNA was used to evaluate the sensitivity of the identification method. Fig.16 (A) and Table 4 show that the detection limit of this identification method for medicinal materials is 2.344ng. When the DNA mixture is 1.172ng, medicinal materials of other species except the gray rat snake can still be detected; when the DNA mixture is 0.073ng, the medicinal materials of King Elaphe, Black-browed Elaphe and Black-necked Snake can still be detected; when the mixture is 0.018ng, King Elaphe and Black-browed Elaphe can still be detected. Fig.16 As can be seen from (B) and Table 5, the detection limit of the identification method for the water extract is 18.75 ng.

[0162] Table 4 Multiplex PCR detection limit of medicinal materials Capillary electrophoresis detection peak height

[0163]

[0164]

[0165] Table 5 Detection limit of multiplex PCR water extract Capillary electrophoresis detection peak height

[0166]

[0167] Based on the above results, it was found that the peak height had a trend of increasing first and then decreasing as the DNA concentration decreased. The amplification efficiency was generally higher at 150ng than at other concentrations, which was consistent with the final selection of 150ng after the template amount investigation. When the medicinal materials were extracted with heated water, the DNA fragments larger than 200bp were relatively reduced, and the peak heights of the water extracts of the black-necked snake, the hundred-flowered snake, and the red-banded snake were significantly reduced. This phenomenon is consistent with the phenomenon mentioned in many literatures that after being processed by heat extraction and other processing methods, the DNA structure will break, thereby reducing the content of relatively large fragments.

[0168] (4.3) Sensitivity study on adulteration percentage of multiplex PCR-CE in black snake

[0169] The DNA concentration of Elaphe baihuaensis, Elaphe rubrum, Elaphe nigromaculata, Elaphe chinensis and Elaphe grissima was adjusted to 300 ng / μL with sterilized water and mixed to obtain a mixed counterfeit snake DNA with a concentration of 300 ng / μL. Subsequently, the DNA of Dinocampus garrulus (300 ng / μL) and the counterfeit snake DNA (300 ng / μL) were mixed at a ratio of 99:1, 98:2, 95:5, 9:1, 8:2, 7:3, 6:4, 1:1, 4:6, 3:7, 2:8, 1:9, 5:95, 2:98 and 1:99, respectively, to prepare Dinocampus garrulus counterfeit with a known content. The identification method optimized in Example 2 was used for detection to evaluate the adulteration percentage sensitivity of this method. From Table 6 and Fig.17 (A) It can be seen that this identification method can detect 1% of adulterated products in the black-necked snake medicinal materials. Fig.17 (B) It can be seen that this identification method can detect 1% adulteration in the water extract of the black-necked snake.

[0170] Table 6 Peak height of multiplex PCR medicinal material adulteration percentage capillary electrophoresis detection

[0171]

[0172] Table 7. Percentage of adulteration in water extract of multiplex PCR. Peak height detected by capillary electrophoresis

[0173]

[0174]

[0175] The above is a preferred embodiment of the present invention. It should be pointed out that a person skilled in the art can make several improvements and modifications without departing from the principle of the present invention. These improvements and modifications are also considered to be within the scope of protection of the present invention.

Claims

1. A primer combination for multiplex PCR-CE identification of garter snakes and their mixed and counterfeit medicinal materials and water extracts, characterized in that: comprising a first primer pair, a second primer pair, a third primer pair, a fourth primer pair, a fifth primer pair and a sixth primer pair; The sequence of the upstream primer of the first primer pair is shown in SEQ ID NO: 1, and the sequence of the downstream primer is shown in SEQ ID NO: 2; The sequence of the upstream primer of the second primer pair is shown in SEQ ID NO:3, and the sequence of the downstream primer is shown in SEQ ID NO:4; The sequence of the upstream primer of the third primer pair is shown in SEQ ID NO:5, and the sequence of the downstream primer is shown in SEQ ID NO:6; The sequence of the upstream primer of the fourth primer pair is shown in SEQ ID NO:7, and the sequence of the downstream primer is shown in SEQ ID NO:8; The sequence of the upstream primer of the fifth primer pair is shown in SEQ ID NO:9, and the sequence of the downstream primer is shown in SEQ ID NO:10; The sequence of the upstream primer of the sixth primer pair is shown as SEQ ID NO:11, and the sequence of the downstream primer is shown as SEQ ID NO:

12.

2. The use of the primer combination according to claim 1, characterized in that: Include at least one of the following: Identify the black-necked snake, the Elaphe striata, the red-banded snake, the black-browed Elaphe, the king snake, and the gray rat snake; Prepare a kit for identifying black-necked snake, Elaphe striata, red-banded snake, black-browed Elaphe, king snake and gray rat snake; Identify whether the snake to be tested is a black-necked snake, a hundred-flowered snake, a red-banded snake, a black-browed snake, a king snake or a gray rat snake; Prepare a test kit for identifying whether the snake to be tested is a black-necked snake, a hundred-flowered snake, a red-banded snake, a black-browed snake, a king snake or a gray rat snake; Identify whether the sample to be tested contains black-necked snake and / or Elaphe baicalensis and / or red-banded snake and / or black-browed Elaphe and / or king Elaphe and / or gray rat snake; A kit is prepared for identifying whether a sample to be tested contains Garcinia charax, Elaphe dasyphylla, Elaphe rubrum, Elaphe nigromaculata, Elaphe nigromaculata, Elaphe striata, Elaphe striata and / or Elaphe gracilis.

3. A kit for identifying medicinal materials and water extracts of garter snakes and their mixed and counterfeit products, comprising the primer combination as claimed in claim 1.

4. A multiplex PCR-CE identification method for black-necked snake and its mixed and counterfeit medicinal materials and water extracts, characterized in that: The following steps are involved: (1) extracting DNA from the sample to be tested; (2) performing multiplex PCR amplification using the DNA of the sample to be tested as a template; (3) Performing electrophoresis detection on the amplified product. If the amplified product contains a DNA characteristic peak of 347 bp, the sample to be detected contains the medicinal material of Agkistrodon davidianus and / or the aqueous extract of Agkistrodon davidianus; If the amplified product contains a 247 bp DNA characteristic peak, the sample to be tested contains Elaphe baihuaensis medicinal materials and / or Elaphe baihuaensis water extract; If the amplified product contains a 206 bp DNA characteristic peak, the sample to be tested contains the medicinal material of the snake and / or the water extract of the snake; If the amplified product contains a 144 bp DNA characteristic peak, the sample to be tested contains Elaphe dioica medicinal materials and / or Elaphe dioica water extract; If the amplified product contains a 125 bp DNA characteristic peak, the sample to be tested contains Elaphe kingi medicinal materials and / or Elaphe kingi water extract; If the amplified product contains a 99 bp DNA characteristic peak, the sample to be tested contains gray rat snake medicinal materials and / or gray rat snake water extract.

5. The multiplex PCR-CE identification method of the black-necked snake and its mixed and counterfeit medicinal materials and water extracts as claimed in claim 4, characterized in that: The multiplex PCR amplification procedure in step (2) includes the following steps: pre-denaturation at 92°C to 96°C for 4min to 8min; denaturation at 92°C to 95°C for 20s to 40s, annealing at 60°C to 70°C for 30s to 50s, and cycling 20 to 30 times; and extension at 70°C to 75°C for 3min to 6min.

6. The multiplex PCR-CE identification method of the black-necked snake and its mixed and counterfeit medicinal materials and water extracts as claimed in claim 5, characterized in that: The multiplex PCR amplification procedure in step (2) includes the following steps: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 65°C for 45 s, 25 cycles; and extension at 72°C for 5 min.

7. The multiplex PCR-CE identification method of the black-necked snake and its mixed and counterfeit medicinal materials and water extracts as claimed in claim 4, characterized in that: The PCR amplification system for multiplex PCR amplification in step (2) includes the following substances: 2 μL to 8 μL of DNA polymerase, 0.3 μL to 0.6 μL of the first primer pair, 0.3 μL to 0.6 μL of the second primer pair, 0.3 μL to 0.6 μL of the third primer pair, 0.3 μL to 0.6 μL of the fourth primer pair, 0.3 μL to 0.6 μL of the fifth primer pair, 0.3 μL to 0.6 μL of the sixth primer pair, 0.5 μL to 1.5 μL of template DNA, and supplemented with sterile distilled water to a final volume of 25 μL.

8. The multiplex PCR-CE identification method of the black-necked snake and its mixed and counterfeit medicinal materials and water extracts as claimed in claim 7, characterized in that: The concentration of the template DNA is 50 ng / μL to 300 ng / μL.

9. The multiplex PCR-CE identification method of the black-necked snake and its mixed and counterfeit medicinal materials and water extracts as claimed in claim 4, characterized in that: The sample to be tested in step (1) is a snake medicinal material or a snake water extract; The extraction of DNA from the snake medicinal material to be tested includes the following steps: fully grinding the snake medicinal material to be tested, taking 30 mg to 80 mg of the ground sample, extracting DNA using a DNA kit, testing the purity and concentration of the DNA, and then freezing and storing; The extraction of DNA from the water extract of the snake to be detected includes the following steps: taking 30mg to 80mg of freeze-dried powder of the water extract of the snake to be detected, extracting DNA using a two-step CTAB method, and freezing and storing the DNA after detecting the purity and concentration of the DNA.

10. The multiplex PCR-CE identification method of the black-necked snake and its mixed and counterfeit medicinal materials and water extracts as claimed in claim 4, characterized in that: The electrophoresis detection in step (3) is agarose gel electrophoresis detection and / or capillary electrophoresis detection; The agarose gel electrophoresis detection comprises the following steps: mixing the PCR amplification product with a buffer, taking 6 μL to 8 μL of the sample and spotting it on an agarose gel, performing electrophoresis at a voltage of 120 V to 140 V for 25 min to 45 min, developing the color with GelRed, and obtaining gel imaging results; The capillary electrophoresis detection comprises the following steps: performing capillary electrophoresis detection on the PCR amplification product through an analyzer, and performing spectrum correction according to the target band size, with the peak detection threshold intensity being 100 to 30,000, and exporting data.

Images