Tea tree tissue rapid DNA extraction method capable of being directly used for PCR

Abstract

The invention belongs to the technical field of biochemistry and molecular biology, and discloses a tea tree tissue rapid DNA extraction method capable of being directly used for PCR. Comprising the following steps: taking 2-10 mg of a tea tree tissue sample, grinding plant tissues, adding 80-100 [mu] L of an extraction buffer solution, and continuously grinding the plant tissues until the plant tissues are pasty to obtain a pasty tea tree tissue sample; boiling the pulpy tea tree tissue sample at the temperature of 95-100 DEG C for 10-20 minutes; and adding sterile ddH2O, uniformly mixing, centrifuging, and carrying out PCR (Polymerase Chain Reaction) detection by taking supernate as a template. According to the method, the buffer solution is improved, so that the influence of substances such as polysaccharides, pigments and phenols is reduced to the greatest extent, and meanwhile, the extraction conditions are improved, so that the efficiency of the DNA extraction method is greatly improved.

Description

Technical Field

[0001] The invention belongs to the technical field of biochemistry and molecular biology, and relates to a DNA extraction method, in particular to a tea tree tissue rapid DNA extraction method which can be directly used for PCR. Background Art

[0002] Genomic DNA is an important genetic material of organisms. Efficient and rapid extraction of genomic DNA is an indispensable premise and basis for various molecular detections and one of the most basic steps in molecular biology research. In plants, there are often a large number of substances such as polysaccharides, pigments, phenols, etc., which are very easy to contaminate the extracted DNA and have an adverse effect on subsequent experiments based on enzyme activity, such as PCR and enzyme digestion reactions. Therefore, it is difficult to extract DNA from plant materials, especially from woody plant tissues rich in phenols and highly keratinized and waxy. Tea tree is an evergreen shrub or small tree of the genus Camellia in the family Theaceae. It is an important economic crop in my country and is rich in phenolic substances. Its content in fresh leaves can reach 1 / 3 of the dry matter content. In addition, the large amount of alkaloids and other secondary metabolites it contains also greatly affect the acquisition rate of genomic DNA. There are also large differences in the composition and content of secondary metabolites between different growth environments, different varieties, and different tissue parts. Therefore, the use of traditional extraction methods to extract tea tree DNA often cannot obtain satisfactory results.

[0003] Plant DNA extraction methods include: CTAB method, SDS method, high salt and low pH method, urea method, guanidine isothiocyanate method, etc. CTAB (Yuan Changchun et al., 2001; Huang Jianan et al., 2003) and SDS method (Luo Junwu et al., 2002; Chen Liang et al., 1997; Tang Xiangkai et al., 2015; You Xiaomei et al., 2008) are commonly used for tea tree tissues. Although the improved CTAB method and SDS method can effectively remove impurities such as proteins, polysaccharides and phenols according to the characteristics of high secondary metabolic accumulation of tea trees, the extracted DNA has good purity and high yield, but this method requires repeated centrifugation, extraction, long precipitation, washing and other steps during the extraction process, and even requires purification of cell nuclei before lysing to release genomic DNA. Therefore, there are shortcomings such as complex steps, cumbersome operations, and long time consumption. The use of highly corrosive and toxic reagents such as phenol and chloroform in the lysis and impurity removal process not only harms human health but also pollutes the environment. The tea tree genome extraction methods reported so far are also limited in terms of sample tissue extraction, and most of them require the use of tender bud and leaf tissues, while callus tissue and root transformation mediated by Agrobacterium rhizogenes still dominate the genetic transformation of tea trees. On the other hand, the complicated DNA extraction methods are difficult to meet the needs of high-throughput detection of samples, especially in the face of a large number of transgenic samples to be tested due to the low efficiency of tea tree genetic transformation, and DNA extraction consumes a lot of time, manpower and material resources when conducting variety purity identification and germplasm resource identification. Although the use of the kit simplifies some steps, since polyphenol plants usually require additional processing, the time saving is not too significant when used to extract tea tree tissues, and the resulting increased economic costs are also difficult for some researchers to accept. Recently, a simplified method for rapid extraction of tea tree genomic DNA that can be directly used for PCR was published (Shen Chaofeng et al., 2020). The steps are as follows: sample grinding → place at room temperature for 10 minutes → add 1 / 10 volume of 3M NaAc (pH 5.2) solution and mix → add equal volume of chloroform: isoamyl alcohol: ethanol (80:4:16) and mix thoroughly → let stand for 5 minutes → centrifuge at 10000rpm, 4℃ for 10 minutes → take the supernatant → add equal volume of isopropanol (precooled) and mix → place at -20℃ for 20 minutes → centrifuge at 10000rpm for 10 minutes → remove the supernatant and collect the precipitate → add 75% ethanol to wash → add 75% ethanol to rinse again → add 50μL TE to dissolve, which is the tea tree genomic DNA. This method still requires purification with chloroform, precipitation with isopropanol, and multiple rinses after precipitation. Therefore, the inventors have developed a faster and simpler method for extracting DNA from tea tree tissues. This method does not require multiple purifications and rinsing precipitations, can be directly used for PCR identification, and is suitable for different tissues of tea trees, including leaves, roots, stems, callus tissues, flowers, etc. at different leaf positions. It is also suitable for different tea tree varieties and other Camellia plants. Summary of the invention

[0004] The present invention provides a rapid DNA extraction method for tea tree tissue that can be directly used for PCR. The present invention reduces the influence of polysaccharides, pigments, phenols and other substances to the maximum extent by improving the buffer solution, and at the same time improves the extraction conditions in the present application, so that the efficiency of the DNA extraction method is greatly improved.

[0005] The purpose of the present invention is achieved by at least one of the following technical solutions.

[0006] A rapid DNA extraction method for tea trees that can be directly used for PCR comprises the following steps:

[0007] (1) taking 2 to 10 mg of a tea tree tissue sample, grinding the plant tissue, adding 80 to 100 μL of an extraction buffer, and continuing to grind until it becomes a slurry to obtain a slurry tea tree tissue sample;

[0008] (2) boiling the pulped tea tree tissue sample obtained in step (1) at 95-100° C. for 10-20 min, preferably at 100° C. for 10 min;

[0009] (3) Add sterile ddH2O, mix well, centrifuge, and use the supernatant as a template for PCR detection.

[0010] Preferably, the tea tree tissue sample is prepared by using a simple punch sampling device (a 200 μL pipette tip is inverted on the leaf, the lower end of the leaf is aligned with the mouth of a 0.5 mL centrifuge tube, and the tip and the centrifuge tube are pressed slightly) to punch a circular leaf, avoiding the main veins, weighing about 8 mg ( Figure 1 ).

[0011] Preferably, step (1) is specifically as follows: 2-10 mg of tea tree tissue sample is taken and placed in a centrifuge tube, the plant tissue is ground for 8-15 seconds using a pipette tip or a micro-grinding rod, 80-100 μL of extraction buffer is added, and grinding is continued for 12-30 seconds until it becomes a slurry.

[0012] Preferably, the amount of sterile ddH2O added in step (3) is 5 to 10 times the volume of the buffer solution.

[0013] Preferably, in step (3), the mixing is performed by inverting 5 to 10 times.

[0014] Preferably, the tea tree tissue sample is selected from 10 mg of fresh plant samples or 2 mg of finished tea.

[0015] Preferably, the fresh plant samples are callus tissue, lateral roots, flower buds, petals, stamens, leaves, and stem segments; and the finished tea is a dry sample of unfermented finished tea.

[0016] Preferably, the sample grinding method in step (1) can also use liquid nitrogen to quickly freeze the sample, grind it into powder, and then add buffer to mix. Specifically, take 2-10 mg of tea tree tissue sample, grind it into powder in liquid nitrogen once, and then directly add 80-100 μL of extraction buffer, shake and mix, and obtain a slurry tea tree tissue sample.

[0017] Preferably, the extraction buffer comprises 100-250 mM Tris-HCl, pH 8.0; 0.9-1.5 M KCl; 1-10 mM EDTA, pH 8.0; 1-2% Triton-X100; and 2-20 mM DTT.

[0018] As a preferred example, the extraction buffer comprises 100 mM Tris-HCl, pH 8.0; 1 M KCl; 10 mM EDTA, pH 8.0; 1% Triton-X100; and 20 mM DTT.

[0019] Preferably, the addition of extraction buffer in step (1) is measured as follows: for samples of 8 mg or more, the amount is measured at 10 μL (buffer) / mg (fresh sample), i.e., 80 μL of extraction buffer is added to 8 mg of sample; for samples below 8 mg, 80 μL of extraction buffer is added to prevent the liquid from being boiled dry due to too little liquid.

[0020] Preferably, the extraction buffer added in step (1) is measured at 80 μL (buffer) / mg (finished dry tea sample), that is, 2 mg of finished tea sample requires 160 μL of extraction buffer.

[0021] Preferably, in step (3), the centrifugal speed is 10000-14000 rpm, preferably 12000 rpm, the time is 30s-3min, preferably 1min, the temperature is room temperature, and the supernatant is the tea tree genomic DNA, which is directly used as a PCR template.

[0022] Preferably, in step (3), the PCR detection is specifically as follows: taking the dilution as a template for PCR detection, using the forward primer EF1semi-F1 and the reverse primer EF1semi-R1 located in the tea tree translation elongation factor encoding gene CsEF-1α, and the amplified fragment length is 513 bp;

[0023] The total volume of the PCR system was 15 μL, including 1.5 μL of template, 0.4 μL of 10 μM upstream and downstream primers, 7.5 μL of 2× PCR Taq enzyme mixture, and 5.2 μL of ddH2O;

[0024] PCR reaction procedure: ①95℃, 4~7min; ②95℃, 30s; ③54~57℃, 30s; ④72℃, 40s~2min; ⑤Repeat ②③④ for a total of 35~44 cycles; ⑥72℃, 6~10min.

[0025] Preferably, the PCR system has a total volume of 15 μL, including 1.5 μL of template, 0.4 μL of 10 μM upstream and downstream primers, 7.5 μL of 2× PCR Taq enzyme mixture, and 5.2 μL of ddH2O;

[0026] PCR reaction program: ①95℃, 4min; ②95℃, 30s; ③54℃, 30s; ④72℃, 40s; ⑤Repeat ②③④ for 35 cycles; ⑥72℃, 6min.

[0027] The key to the present invention's ability to efficiently and quickly obtain DNA from various tea tree tissues is:

[0028] (1) 1% Triton-X100 added to the extraction buffer helps to quickly destroy the tea tree cell membrane and nuclear membrane at a high temperature of 100°C and release genomic DNA. Both are indispensable (see S3 and S4 in the comparative example). The simultaneous use is the key point of this method;

[0029] (2) The addition of DTT to the extraction buffer not only inhibits the browning of tea plant samples during lysis, but also helps to improve the enzyme activity during PCR;

[0030] (3) The pH 8.0 of Tris-HCl in the rapid buffer is the optimal pH for tea plant DNA extraction. A higher pH (9.2) will cause the sample to easily brown at high temperatures.

[0031] Compared with the prior art, the tea tree tissue DNA extraction method provided by the present invention has the following advantages:

[0032] (1) Simple operation: The extraction method provided by the present invention has simple operation steps, only requires one extraction buffer, does not require repeated extraction and purification, and does not require complicated instruments and equipment, and is suitable for high-throughput sample detection;

[0033] (2) Safety: No need to use toxic organic chemical reagents such as phenol, chloroform, and isoamyl alcohol;

[0034] (3) Economical: The present invention uses a small number of reagents and no expensive reagents, so the cost is low;

[0035] (4) Wide applicability: The tea tree tissue DNA extraction method provided by the present invention can be used for various tea tree tissues (roots, stems, leaves, flowers, callus, etc.), can also be used for different tea tree varieties and other woody plants of the genus Camellia, and can also be used for unfermented finished tea;

[0036] (5) Small sample volume requirement: 8 mg is sufficient for ordinary tissue samples, which can be reduced to 2 mg for some precious genetically modified materials, and only 2 mg for dry tea samples;

[0037] (6) Little damage to plants: Since the tissue site for sampling is not restricted and the sample quantity required is small, the damage to precious germplasm materials can be minimized. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 It is a simple punching device and the weight of the tea sample taken.

[0039] Figure 2 This is a graph showing the PCR test results after DNA extraction from tea leaves at different leaf positions in Example 1.

[0040] Figure 3 This is a diagram of the PCR test results after DNA extraction from different tea tree tissues in Example 2.

[0041] Figure 4 This is a diagram showing the PCR test results after DNA extraction from different tea tree varieties and other plants of the genus Camellia in Example 3.

[0042] Figure 5 This is a graph showing the PCR test results after DNA extraction from different finished tea products in Example 4.

[0043] Figure 6 This is a graph showing the PCR test results after tea tree DNA was extracted using the extraction buffer adjusted in Comparative Example 1.

[0044] Figure 7 PCR test results after DNA extraction from tea leaves in Comparative Example 2.

[0045] Figure 8 This is the PCR test result after extracting DNA from tea tree (A) and Arabidopsis thaliana (B) using different methods in Comparative Example 3.

[0046] Fig. 9 This is the PCR test result after DNA extraction from the finished tea leaves in Comparative Example 4. DETAILED DESCRIPTION

[0047] The present invention will be further described in detail below in conjunction with specific embodiments, but the embodiments of the present invention are not limited thereto. For process parameters not particularly noted, conventional techniques may be used.

[0048] The extraction buffer components in all the following examples are 100 mM Tris-HCl, pH 8.0; 1 M KCl; 10 mM EDTA, pH 8.0; 1% Triton-X100; and 20 mM DTT.

[0049] Example 1 Extraction of DNA from leaves of different tea plant leaf positions

[0050] (1) Using the developed simple punch sampling device, approximately 8 mg of leaf samples from the 1st to 5th leaf positions of tea plants were collected and placed in 1.5 mL centrifuge tubes. The tubes were immersed in liquid nitrogen for cooling, and the plant tissues were crushed using a handheld micro-grinder;

[0051] (2) Add 80 μL of extraction buffer, vortex for 2 seconds to mix, and boil at 100°C for 10 minutes;

[0052] (3) Add 720 μL of sterile ddH2O, invert 5 times to mix, and centrifuge at 12000 rpm for 1 min;

[0053] (4) 1.5 μL of the supernatant after centrifugation was used as a template for PCR detection. The primers used were the forward primer EF1semi-F1 (5'AAAGGTCAACCAACCTCGAC3') and the reverse primer EF1semi-R1 (5'CCTTACCAGACCTCCTGTCA3') located in the tea tree translation elongation factor encoding gene CsEF-1α. The length of the amplified fragment was 513 bp;

[0054] (5) The total volume of the PCR system was 15 μL, including 1.5 μL of template, 0.4 μL of 10 μM upstream and downstream primers, 7.5 μL of 2× PCR Taq enzyme premix, and 5.2 μL of ddH2O;

[0055] (6) PCR reaction procedure: ① 95°C, 4 min; ② 95°C, 30 s; ③ 54°C, 30 s; ④ 72°C, 40 s; ⑤ Repeat ②, ③, and ④ for 35 cycles; ⑥ 72°C, 6 min.

[0056] (7) Electrophoresis detection: The PCR amplification products were detected by 1% agarose gel electrophoresis. It can be seen that the PCR product bands are clear and the size is correct, indicating that the DNA extracted from different leaf positions of the tea plant in the present invention can be completely used as a template for PCR amplification. For details, see Figure 2 . Figure 2 These are the PCR test results after DNA extraction from tea leaves at different leaf positions, where 1 represents the first leaf position, 2 represents the second leaf position, 3 represents the third leaf position, 4 represents the fourth leaf position, and 5 represents the fifth leaf position.

[0057] Example 2 DNA extraction from different tissues of tea plant

[0058] (1) About 10 mg of tea plant lateral roots, flower buds, petals, stamens, and callus tissue samples were placed in 1.5 mL centrifuge tubes. After the tubes were immersed in liquid nitrogen for cooling, the tissues were broken up with a handheld micro-grinder, and 100 μL of extraction buffer was added and vortexed for 2 seconds to mix;

[0059] (2) 10 mg of callus tissue sample and green stem that is not completely lignified was placed in a 1.5 mL centrifuge tube, ground with a micro-grinding rod for 10 seconds, and then 100 μL of extraction buffer was added. The sample was ground for another 15 seconds until it became a slurry.

[0060] (3) Boil at 100°C for 10 min, add 900 μL of sterile ddH2O, invert 5 times to mix, and centrifuge at 12000 rpm for 1 min;

[0061] (4) 1.5 μL of the supernatant after centrifugation was used as a template for PCR detection. The primers used were the forward primer EF1semi-F1 (5'AAAGGTCAACCAACCTCGAC3') and the reverse primer EF1semi-R1 (5'CCTTACCAGACCTCCTGTCA3') located in the tea tree translation elongation factor encoding gene CsEF-1α. The length of the amplified fragment was 513 bp;

[0062] (5) The total volume of the PCR system was 15 μL, including 1.5 μL of template, 0.4 μL of 10 μM upstream and downstream primers, 7.5 μL of 2× PCR Taq enzyme premix, and 5.2 μL of ddH2O;

[0063] (6) PCR reaction program: ① 95°C, 4 min; ② 95°C, 30 s; ③ 54°C, 30 s; ④ 72°C, 40 s; ⑤ Repeat ②, ③, and ④ for 35 cycles; ⑥ 72°C, 6 min;

[0064] (7) Electrophoresis detection: The PCR amplification product was detected by 1% agarose gel electrophoresis. It can be seen that the PCR product bands are clear and the size is correct, indicating that the DNA extracted from various tissues of the tea plant in the present invention can be fully used as a template for PCR amplification ( Figure 3 ).

[0065] Example 3 DNA extraction from different varieties of tea trees and other Camellia plants

[0066] (1) Using the developed simple punch sampling device, approximately 8 mg of leaf samples from various tea varieties (Table 1) were collected and placed in 1.5 mL centrifuge tubes. The tubes were immersed in liquid nitrogen for cooling, and the leaf tissues were crushed using a handheld micro-grinder.

[0067] (2) Add 80 μL of extraction buffer, vortex for 2 seconds to mix, and boil at 100°C for 10 minutes;

[0068] (3) Add 720 μL of sterile ddH2O, invert 5 times to mix, and centrifuge at 12000 rpm for 1 min;

[0069] (4) 1.5 μL of the supernatant after centrifugation was used as a template for PCR detection. The primers used were the forward primer EF1semi-F1 (5'AAAGGTCAACCAACCTCGAC3') and the reverse primer EF1semi-R1 (5'CCTTACCAGACCTCCTGTCA3') located in the tea tree translation elongation factor encoding gene CsEF-1α. The length of the amplified fragment was 513 bp;

[0070] (5) The total volume of the PCR system was 15 μL, including 1.5 μL of template, 0.4 μL of 10 μM upstream and downstream primers, 7.5 μL of 2× PCRTaq enzyme mixture, and 5.2 μL of ddH2O;

[0071] (6) PCR reaction program: ① 95°C, 4 min; ② 95°C, 30 s; ③ 54°C, 30 s; ④ 72°C, 40 s; ⑤ Repeat ②, ③, and ④ for 35 cycles; ⑥ 72°C, 6 min;

[0072] (7) Electrophoresis detection: The PCR amplification products were detected by 1% agarose gel electrophoresis. It can be seen that the PCR product bands are clear and the size is correct, indicating that the different tea plant DNAs extracted by the present invention can be completely used as templates for PCR amplification ( Figure 4 ).

[0073] Table 1 Different tea varieties

[0074]

[0075] Example 4 DNA extraction from different finished tea products

[0076] (1) Take about 2 mg of each finished tea sample (Table 2) and put it into a 1.5 mL centrifuge tube. Add 160 μL of extraction buffer and grind it into a slurry using a micro-grinding rod.

[0077] (2) Mix well and cook at 100°C for 10 min;

[0078] (3) Add 1.2 mL of sterile ddH2O, invert 5 times to mix, and centrifuge at 12000 rpm for 1 min;

[0079] (4) 1.5 μL of the supernatant after centrifugation was used as a template for PCR detection. The primers used were the forward primer EF1semi-F1 (5'AAAGGTCAACCAACCTCGAC3') and the reverse primer EF1semi-R1 (5'CCTTACCAGACCTCCTGTCA3') located in the tea tree translation elongation factor encoding gene CsEF-1α. The length of the amplified fragment was 513 bp;

[0080] (5) The total volume of the PCR system was 15 μL, including 1.5 μL of template, 0.4 μL of 10 μM upstream and downstream primers, 7.5 μL of 2× PCR Taq enzyme premix, and 5.2 μL of ddH2O;

[0081] (6) PCR reaction program: ① 95°C, 4 min; ② 95°C, 30 s; ③ 54°C, 30 s; ④ 72°C, 40 s; ⑤ Repeat ②, ③, and ④ for 35 cycles; ⑥ 72°C, 6 min;

[0082] (7) Electrophoresis detection: The PCR amplification product was detected by 1% agarose gel electrophoresis. It can be seen that the product bands of the DNA extracted from the finished tea were clear and the size was correct after PCR detection, indicating that the DNA extracted from the unfermented finished tea of ​​the present invention can be completely used as a template for PCR amplification ( Figure 5 ).

[0083] Table 2 Different types of finished tea

[0084]

[0085] Comparative Example 1

[0086] In this comparative example, the extraction buffer and processing conditions of the present invention were modified as follows (Table 3) to extract DNA from tea leaves. The variety used was Jinxuan. 1.5 μL of extracted DNA was used as a template for PCR detection. The primers used were the forward primer EF1semi-F1 (5'AAAGGTCAACCAACCTCGAC3') and the reverse primer EF1semi-R1 (5'CCTTACCAGACCTCCTGTCA3') located in the tea tree translation elongation factor encoding gene CsEF-1α. The length of the amplified fragment was 513 bp. The PCR system had a total volume of 15 μL, including 1.5 μL of template, 0.4 μL of 10 μM upstream and downstream primers, 7.5 μL of 2× PCR Taq enzyme premix, and 5.2 μL of ddH2O. The PCR reaction program was as follows: ① 95°C, 4 min; ② 95°C, 30 s; ③ 54°C, 30 s; ④ 72°C, 40 s; ⑤ Repeat ②, ③, and ④ for a total of 35 cycles; ⑥ 72°C, 6 min.

[0087] Gel electrophoresis results Figure 6As shown, compared with the extraction buffer (S1) of the present invention, a higher pH value (S2), no heating treatment (S3), no addition of 1% Triton-X100 (S4), and direct use of the extract for PCR detection without dilution (S9) will reduce the amplification efficiency of PCR. Changing the ratio of sample to extraction buffer (S6-S8), that is, increasing the amount of tea sample, will reduce the DNA acquisition rate and affect the PCR amplification efficiency. In addition, a higher pH value (pH 9.2; S2) and removal of DTT (S5) will cause the sample to brown severely after high temperature treatment ( Figure 6 (Figure C).

[0088] Table 3 Adjustment of extraction buffer

[0089]

[0090]

[0091] Comparative Example 2

[0092] This comparative example refers to the patent "Extraction-free nucleic acid releaser for conventional PCR amplification" CN 115851700 A. Prepare an extraction buffer, the components of which include 1% Triton-X100, DTT 12.5mM, EDTA 2mM, Tris-HCl 10mM, and NaOH 100mM. Take tea tree samples according to the steps described in the patent: grind 8mg of fresh leaves of Jinxuan variety tea tree with liquid nitrogen, add 80( Figure 7 Lanes 4 to 6) or 160 μL ( Figure 7 7-9), and 1 mg of Longjing green tea powder was added into 80 μL extraction buffer ( Figure 7 The mixture was vortexed for 15-30 seconds to make it uniform; then incubated at room temperature for 10-15 minutes, and mixed by inversion every 3-5 minutes during the incubation period; after the incubation, centrifuged at 12000 rpm for 2 minutes to extract tea tree DNA. 1.5 μL of extracted DNA was used as a template for PCR detection. The primers used were the forward primer EF1semi-F1 (5'AAAGGTCAACCAACCTCGAC3') and the reverse primer EF1semi-R1 (5'CCTTACCAGACCTCCTGTCA3') located in the tea tree translation elongation factor encoding gene CsEF-1α. The length of the amplified fragment was 513 bp. The PCR system had a total volume of 15 μL, including 1.5 μL of template, 0.4 μL of 10 μM upstream and downstream primers, 7.5 μL of 2× PCR Taq enzyme premix, and 5.2 μL of ddH2O. The PCR reaction program was as follows: ① 95°C, 4 min; ② 95°C, 30 s; ③ 54°C, 30 s; ④ 72°C, 40 s; ⑤ Repeat ②, ③, and ④ for a total of 35 cycles; ⑥ 72°C, 6 min.

[0093] Gel electrophoresis results Figure 7 Compared with the extraction buffer of the present invention (lanes 1 to 3), the method used in the comparative example did not extract tea tree ( Figure 7 Middle lanes 4 to 9) and finished tea DNA ( Figure 7 The reason is that although 1% Triton-X100 was added in the comparative example, there was no high temperature treatment condition to assist. For the tea tree, a woody plant with severe lignification and keratinization and a high degree of cell wall fibrosis, it is difficult to lyse the cells and release DNA (see method S3 in comparative example 1). In addition, in view of the concentration of the components in the comparative example, even if the high temperature treatment step is simply added to the comparative example, it is difficult to improve the efficiency of DNA acquisition. High salt (1M KCl used in the present invention) and buffer components (100mM Tris-HCl used in the present invention) can effectively stabilize DNA under high temperature and long-term treatment, while the concentration of this type of component in the comparative example is low, only about 1 / 10 of that in the method of the present invention.

[0094] Comparative Example 3

[0095] This comparative example refers to the following patent

[0096] M1: "A method for rapid extraction of oat leaf genome" CN 114250223A;

[0097] M2: "Plant leaf DNA extraction lysis buffer, plant leaf DNA rapid extraction method and application" CN112899267 A;

[0098] M3: "A simple and rapid method for extracting genomic DNA from tobacco leaves" CN 116103283A;

[0099] M4: "A method for rapidly extracting trace DNA from rapeseed" CN 104195133A.

[0100] Using the method steps in the above patent, as shown in Table 4, DNA was extracted from fresh tea leaves and PCR detection was performed. The variety used was Jinxuan. 1.5 μL of extracted DNA was used as a template for PCR detection. The primers used were the forward primer EF1semi-F1 (5'AAAGGTCAACCAACCTCGAC3') and the reverse primer EF1semi-R1 (5'CCTTACCAGACCTCCTGTCA3') located in the tea tree translation elongation factor encoding gene CsEF-1α. The length of the amplified fragment was 513 bp. The PCR system had a total volume of 15 μL, including 1.5 μL of template, 0.4 μL of 10 μM upstream and downstream primers, 7.5 μL of 2× PCR Taq enzyme premix, and 5.2 μL of ddH2O. The PCR reaction program was as follows: ① 95°C, 4 min; ② 95°C, 30 s; ③ 54°C, 30 s; ④ 72°C, 40 s; ⑤ Repeat ②, ③, and ④ for a total of 35 cycles; ⑥ 72°C, 6 min.

[0101] The model plant Arabidopsis thaliana was used as a control, and the same method was used to extract DNA and perform PCR detection. The primers used were the forward primer TUB2semi-F1 (5'ATCCGTGAAGAGTACCCAGAT3') and the reverse primer TUB2semi-R1 (5'TCACCTTCTTCATCCGCAGTT 3') located in the Arabidopsis internal reference gene TUB2, and the amplified fragment length was 1362bp. The PCR system had a total volume of 15μL, including 1.5μL of template, 0.4μL of 10μM upstream and downstream primers, 7.5μL of 2× PCR Taq enzyme premix, and 5.2μL of ddH2O; PCR reaction program: ①95℃, 4min; ②95℃, 30s; ③54℃, 30s; ④72℃, 2min; ⑤Repeat ②③④ for a total of 35 cycles; ⑥72℃, 6min.

[0102] The PCR results detected by gel electrophoresis were compared with the method of the present invention ( Figure 8 Compared with lanes 1 to 3 in A, methods M1 to M3 failed to extract tea plant DNA ( Figure 8 Lane A 4-11), tea plant DNA extracted by M4 only amplified a weak band ( Figure 8 A lanes 12 to 14). The Arabidopsis DNA extracted by the method of the present invention can amplify a strong band ( Figure 8 B lanes 1 to 3), except for the weaker bands amplified from Arabidopsis DNA extracted by methods M2 and M3 ( Figure 8 B lanes 5 to 8), and the other methods (M1 and M4) can amplify strong bands in Arabidopsis ( Figure 8 Lane B: 3, 4, 9, 10). Therefore, the rapid extraction method applicable to other plants is not applicable to tea plant tissue.

[0103] Table 4 Different methods for rapid DNA extraction from plants

[0104]

[0105] Comparative Example 4

[0106] This comparative example refers to the patent "A method for extracting tea tree DNA from processed green tea leaves" CN 117802093A. According to the requirements of the patent, the extraction buffer components are configured as follows: 100mM Tris-HCl (pH8.0), 20mM EDTA, pH8.0, 1.4M NaCl. Take 80mg of green tea Longjing finished tea dry sample, add 800μL extraction buffer and mix well, and then follow the following steps: heat at 94℃ for 50min→add 800μL chloroform:isoamyl alcohol=24:1 solution and shake and mix well→centrifuge at 12000rpm for 12min→take the supernatant and add 0.8 volume isopropanol-20℃ precipitation for 30min→rinse with 70% ethanol→centrifuge at 12000rpm for 2min to remove the supernatant→rinse with 70% ethanol again→centrifuge at 12000rpm for 2min to remove the supernatant→air dry at room temperature for 15min→add 100μL water to dissolve DNA.

[0107] 1.5 μL of extracted DNA was used as a template for PCR detection. The primers used were the forward primer EF1semi-F1 (5'AAAGGTCAACCAACCTCGAC3') and the reverse primer EF1semi-R1 (5'CCTTACCAGACCTCCTGTCA3') located in the tea tree translation elongation factor encoding gene CsEF-1α. The length of the amplified fragment was 513 bp. The PCR system had a total volume of 15 μL, including 1.5 μL of template, 0.4 μL of 10 μM upstream and downstream primers each, 7.5 μL of 2× PCR Taq enzyme premix, and 5.2 μL of ddH2O. The PCR reaction procedure was as follows: ① 95°C, 4 min; ② 95°C, 30 s; ③ 54°C, 30 s; ④ 72°C, 40 s; ⑤ Repeat ② ③ ④ for a total of 35 cycles; ⑥ 72°C, 6 min.

[0108] Gel electrophoresis results Fig. 9 Lanes 4 to 6 show that the method of the present invention (see Example 4 for the specific method and the results for Fig. 9 Compared with lanes 1 to 3), the PCR amplification efficiency of the extracted DNA is comparable, but the operation steps are much more complicated and time-consuming, and more sample volume is required.

[0109] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. A rapid DNA extraction method for tea tree tissue that can be directly used for PCR, characterized in that: The steps include: (1) taking 2 to 10 mg of a tea tree tissue sample, grinding the plant tissue, adding 80 to 100 μL of an extraction buffer, and continuing to grind until it becomes a slurry to obtain a slurry tea tree tissue sample; (2) boiling the pulped tea tree tissue sample obtained in step (1) at 95-100° C. for 10-20 min; (3) Add sterile ddH2O, mix well, centrifuge, and use the supernatant as a template for PCR detection; The extraction buffer comprises 100-250 mM Tris-HCl, pH 8.0; 0.9-1.5 M KCl; 1-10 mM EDTA, pH 8.0; 1-2% Triton-X100; and 2-20 mM DTT.

2. The method for rapid DNA extraction from tea tree tissue that can be directly used for PCR according to claim 1, characterized in that: Step (1) is specifically as follows: Take 2-10 mg of tea tree tissue sample and put it into a centrifuge tube. Use a pipette tip or a micro-grinding rod to grind the plant tissue for 8-15 seconds, then add 80-100 μL of extraction buffer and continue grinding for 12-30 seconds until it becomes a slurry.

3. The method for rapid DNA extraction from tea tree tissue that can be directly used for PCR according to claim 1, characterized in that: In step (3), the amount of sterile ddH2O added is 5 to 10 times the volume of the buffer solution.

4. The rapid DNA extraction method for tea tree tissue that can be directly used for PCR according to claim 1, characterized in that: In step (3), the mixing is performed by inverting 5 to 10 times.

5. The method for rapid DNA extraction from tea tree tissue that can be directly used for PCR according to claim 1, characterized in that: In step (1), the tea tree tissue sample is selected from callus tissue, lateral roots, flower buds, petals, stamens, leaves, stem segments or finished tea leaves.

6. The method for rapid DNA extraction from tea tree tissue that can be directly used for PCR according to claim 1, characterized in that: In step (1), the sample is ground by quick-freezing the sample with liquid nitrogen; specifically, 2 to 10 mg of tea tree tissue sample is taken, ground into powder in liquid nitrogen at one time, and then 80 to 100 μL of extraction buffer is directly added, and the mixture is shaken to obtain a slurry of tea tree tissue sample.

7. The method for rapid DNA extraction from tea tree tissue that can be directly used for PCR according to claim 1, characterized in that: In step (1), the extraction buffer comprises 100 mM Tris-HCl, pH 8.0; 1 M KCl; 10 mM EDTA, pH 8.0; 1% Triton-X100; and 20 mM DTT.

8. The method for rapid DNA extraction from tea tree tissue that can be directly used for PCR according to claim 1, characterized in that: In step (3), the centrifugal speed is 10000-14000 rpm, the centrifugal time is 30s-3min; the centrifugal temperature is room temperature, and the supernatant is the tea tree genomic DNA, which is directly used as a PCR template.

9. The method for rapid DNA extraction from tea tree tissue that can be directly used for PCR according to claim 1, characterized in that: In step (3), the PCR system has a total volume of 10 to 30 μL, including 1 to 3 μL of DNA template, 0.25 to 0.5 μL of 10 μM upstream and downstream primers, 5 to 15 μL of 2× PCR Taq enzyme premix, and the remaining volume is supplemented with ddH2O.

10. The method for rapid DNA extraction from tea tree tissue that can be directly used for PCR according to claim 1, characterized in that: In step (3), the PCR detection is specifically as follows: directly taking the dilution as a template for PCR detection, the PCR system has a total volume of 15 μL, including 1.5 μL of template, 0.4 μL of 10 μM upstream and downstream primers, 7.5 μL of 2× PCR Taq enzyme mixture, and 5.2 μL of ddH2O; PCR reaction procedure: ①95℃, 4~7min; ②95℃, 30s; ③54~57℃, 30s; ④72℃, 30s~2min; ⑤Repeat ②③④ for a total of 35~44 cycles; ⑥72℃, 6~10min.

Images