PGLYRP1 gene modified non-human animal

Abstract

The present invention provides a non-human animal expressing a human or chimeric (e.g., humanized) PGLYRP1 protein and methods of use thereof.

Description

Technical Field

[0001] The present invention provides a non-human animal expressing a human or chimeric (eg, humanized) PGLYRP1 protein and methods of using the same. Background Art

[0002] Traditional drug development usually uses in vitro screening methods, but these screening methods cannot provide the body environment (such as tumor microenvironment, stromal cells, extracellular matrix components and immune cell interactions, etc.), resulting in a high failure rate of drug development. In addition, given the differences between humans and animals, the test results obtained from in vivo pharmacology tests using conventional experimental animals may not reflect the actual disease state and the interaction of the target site, resulting in significant differences between the results of many clinical trials and the results of animal experiments.

[0003] Therefore, developing a humanized animal model suitable for screening and evaluation of human antibodies will significantly improve the efficiency of new drug development and reduce the cost of drug development.

[0004] However, the construction of humanized animal models is very difficult. For example, the non-patent literature: Generation and utility of genetically humanized mouse models (Scheer N, Snaith M, Wolf CR, Seibler J., Drug Discovery Today; 18(23-24): 1200-11, 2013) discloses that the humanization of any gene carries certain risks, and even with carefully designed strategies, the expression and function of human genes in animals cannot be ensured. Summary of the invention

[0005] The present application provides an animal model with human or chimeric PGLYRP1 protein. The animal model can express human or chimeric PGLYRP1 (e.g., humanized PGLYRP1) protein. It can be used for the study of PGLYRP1 gene function, and can also be used for the screening and evaluation of PGLYRP1 signaling pathway regulators (e.g., anti-human PGLYRP1 antibodies, oligonucleotide drugs and / or polypeptide drugs). In addition, the animal model prepared by the method described in the present application can be used for drug screening, pharmacodynamics research, treatment of immune diseases and treatment of diseases at human PGLYRP1 target sites; the animal model can also be used to promote new drug development and design, saving time and cost. In summary, the present invention provides a powerful tool for studying the function of PGLYRP1 protein and provides a platform for screening related drugs.

[0006] On the one hand, the present invention provides a genetically modified non-human animal or a method for constructing the same, wherein the genome of the non-human animal comprises at least one chromosome, the chromosome comprising a nucleotide sequence encoding a human or chimeric peptidoglycan recognition protein (PGLYRP1). In some embodiments, the nucleotide sequence encoding a human or chimeric PGLYRP1 protein is operably linked to an endogenous regulatory element (e.g., a promoter, an endogenous 5'UTR, or an endogenous 3'UTR) of an endogenous PGLYRP1 locus of at least one chromosome. In some embodiments, the chimeric PGLYRP1 protein is a humanized PGLYRP1 protein. In some embodiments, the amino acid sequence of the humanized PGLYRP1 protein is consistent with at least 50 to 196, for example, at least 50, 100, 175, 176, 177, 180, 190, or 196 continuous amino acid sequences of the human PGLYRP1 protein. In some embodiments, the amino acid sequence of the human or chimeric PGLYRP1 protein comprises SEQ ID NO: 2, or comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identity to SEQ ID NO: 2. In some embodiments, the non-human animal is a mammal, such as a monkey or a rodent. In some embodiments, the non-human animal is a mouse or a rat. In some embodiments, the non-human animal is a mouse. In some embodiments, the endogenous PGLYRP1 protein of the non-human animal is not expressed or is expressed at a reduced level compared to PGLYRP1 in wild-type animals. In some embodiments, one or more cells of the non-human animal express the human or chimeric PGLYRP1 protein.

[0007] On the one hand, the present invention provides a genetically modified non-human animal or a method for constructing the same, wherein the endogenous PGLYRP1 gene is replaced with a nucleotide sequence comprising human PGLYRP1 at the endogenous PGLYRP1 locus of the non-human animal. In some embodiments, the corresponding region of the endogenous PGLYRP1 gene is replaced with a nucleotide sequence comprising human PGLYRP1 at the endogenous PGLYRP1 locus of the non-human animal. In some embodiments, the nucleotide sequence of the human PGLYRP1 may be a CDS, genomic DNA, or cDNA. In some embodiments, the nucleotide sequence of the human PGLYRP1 may be operably linked to an endogenous regulatory element (promoter, endogenous 5'UTR, or endogenous 3'UTR) of the endogenous PGLYRP1 locus. In some embodiments, one or more cells of the non-human animal express a human or humanized PGLYRP1 protein. In some embodiments, the endogenous PGLYRP1 protein of the non-human animal is not expressed or the expression level is reduced compared to PGLYRP1 in wild-type animals. In some embodiments, the nucleotide sequence of the human PGLYRP1 comprises all or part of exon 1, exon 2, and / or exon 3 of the human PGLYRP1 gene. In some embodiments, the nucleotide sequence of human PGLYRP1 includes a portion of exon 1 to all of exon 3 of the human PGLYRP1 gene. In some embodiments, the portion of exon 1 of the human PGLYRP1 gene includes at least 5 bp to 319 bp, such as at least 5, 10, 50, 100, 150, 200, 210, 220, 230, 240, 248, 249, 250, 260, 270, 280, 284, 285, 286, 287, 288, 290, 300, 310 or 319 bp of continuous nucleotide sequence. In some embodiments, the portion of exon 1 of the human PGLYRP1 gene includes at least the coding region sequence of exon 1. In some embodiments, the portion of exon 1 of the human PGLYRP1 gene includes at least the start codon of exon 1 to the 3' end of exon 1. In some embodiments, the nucleotide sequence of human PGLYRP1 further includes at least 50 bp of continuous nucleotides downstream of the 3'UTR. In some embodiments, the nucleotide sequence of human PGLYRP1 comprises part of human exon 1, all of exons 2-3, and / or at least 50bp of continuous nucleotides downstream of 3'UTR. In some embodiments, the nucleotide sequence of human PGLYRP1 comprises at least 50bp of continuous nucleotides from the start codon of the human PGLYRP1 gene to the downstream of 3'UTR. In some embodiments, the nucleotide sequence of human PGLYRP1 comprises part of human exon 1, all of exons 2-3, and / or at least 300bp of continuous nucleotides downstream of 3'UTR.In some embodiments, the nucleotide sequence of human PGLYRP1 comprises at least 300bp of continuous nucleotides from the start codon to the 3'UTR downstream of the human PGLYRP1 gene. In some embodiments, the nucleotide sequence of human PGLYRP1 comprises SEQ ID NO: 5, or comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identity to the nucleotide sequence shown in SEQ ID NO: 5. In some embodiments, all or part of exon 1, exon 2 and / or exon 3 of the endogenous PGLYRP1 gene of the non-human animal is replaced. In some embodiments, part of exon 1 to all of exon 3 of the endogenous PGLYRP1 gene of the non-human animal is replaced. In some embodiments, the start codon to all of exon 3 of the endogenous PGLYRP1 gene of the non-human animal is replaced. In some embodiments, the modified PGLYRP1 gene in the genome of the non-human animal is homozygous or heterozygous for the endogenous replaced locus. In some embodiments, the mRNA transcribed from the modified PGLYRP1 gene in the genome of the non-human animal comprises SEQ ID NO: 6, or comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identity to the nucleotide sequence shown in SEQ ID NO: 6. In some embodiments, the non-human animal further comprises nucleotide sequences of human or chimeric proteins encoded by other genes, and the human or chimeric proteins are selected from at least one of LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1 and CTLA4.

[0008] In one aspect, the present invention provides a non-human animal or a method for constructing the same, wherein the non-human animal comprises at least one cell encoding a nucleotide sequence of a human or humanized PGLYRP1 protein, wherein the humanized PGLYRP1 protein comprises at least 50, 100, 190 or 196 consecutive amino acid sequences that are consistent with the continuous amino acid sequence of the corresponding region of a human, and the non-human animal expresses the human or humanized PGLYRP1 protein. In some embodiments, the nucleotide sequence encoding the human or humanized PGLYRP1 protein can be a CDS, genomic DNA or cDNA. In some embodiments, the nucleotide sequence encoding the human or humanized PGLYRP1 protein can be operably linked to an endogenous PGLYRP1 regulatory element. In some embodiments, the nucleotide sequence encoding the corresponding region of the human or humanized PGLYRP1 can be integrated into the endogenous PGLYRP1 locus of the non-human animal. In some embodiments, the human or humanized PGLYRP1 protein has at least one mouse PGLYRP1 activity and / or human PGLYRP1 activity.

[0009] On the one hand, the present invention provides a method for constructing a genetically modified non-human animal, in which at least one cell of the non-human animal, at the endogenous PGLYRP1 locus of the non-human animal, the nucleotide sequence encoding the endogenous PGLYRP1 region is replaced by the nucleotide sequence of the corresponding region of human PGLYRP1. In some embodiments, the nucleotide sequence of the corresponding region of human PGLYRP1 can be CDS, genomic DNA or cDNA. In some embodiments, the endogenous PGLYRP1 protein of the non-human animal is not expressed or the expression level is reduced compared with PGLYRP1 in wild-type animals. In some embodiments, the nucleotide sequence encoding the corresponding region of human PGLYRP1 includes all or part of exon 1, exon 2 and / or exon 3 of the human PGLYRP1 gene. In some embodiments, the nucleotide sequence encoding the corresponding region of human PGLYRP1 includes all of exon 1 to exon 3 of the human PGLYRP1 gene. In some embodiments, the nucleotide sequence encoding the corresponding region of human PGLYRP1 includes part of human exon 1, all of exons 2-3 and / or at least 50bp of continuous nucleotides downstream of 3'UTR. In some embodiments, the nucleotide sequence encoding the corresponding region of human PGLYRP1 comprises at least 50 bp of continuous nucleotides from part of exon 1 of the human PGLYRP1 gene to the downstream of the 3'UTR. In some embodiments, the nucleotide sequence encoding the corresponding region of human PGLYRP1 comprises at least 50 bp of continuous nucleotides from the start codon of the human PGLYRP1 gene to the downstream of the 3'UTR. In some embodiments, the nucleotide sequence encoding the corresponding region of human PGLYRP1 comprises at least 300 bp of continuous nucleotides from part of human exon 1, all of exons 2-3, and / or the downstream of the 3'UTR. In some embodiments, the nucleotide sequence encoding the corresponding region of human PGLYRP1 comprises at least 300 bp of continuous nucleotides from the start codon of the human PGLYRP1 gene to the downstream of the 3'UTR. In some embodiments, the amino acid sequence encoded by the nucleotide sequence encoding the corresponding region of human PGLYRP1 comprises SEQ ID NO: 2, or comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identity to the amino acid sequence shown in SEQ ID NO: 2. In some embodiments, the nucleotide sequence encoding the corresponding region of human PGLYRP1 comprises SEQ ID NO: 5, or comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identity to the nucleotide sequence shown in SEQ ID NO: 5. In some embodiments, the nucleotide sequence encoding the endogenous PGLYRP1 region comprises all or part of exon 1, exon 2 and / or exon 3 of the non-human animal PGLYRP1 gene.In some embodiments, the nucleotide sequence encoding the endogenous PGLYRP1 region includes all of exon 1 to exon 3 of the non-human animal PGLYRP1 gene. In some embodiments, the nucleotide sequence encoding the endogenous PGLYRP1 region includes all of the start codon to exon 3 of the non-human animal PGLYRP1 gene. In some embodiments, the nucleotide sequence encoding the corresponding region of human PGLYRP1 is operably linked to an endogenous PGLYRP1 regulatory element, such as a promoter. In some embodiments, the non-human animal is a mammal, such as a monkey or a rodent. In some embodiments, the non-human animal is a mouse or a rat.

[0010] On the one hand, the present invention provides a method for constructing a genetically modified non-human animal cell expressing human or chimeric PGLYRP1, the construction method comprising replacing the nucleotide sequence encoding the endogenous PGLYRP1 region with the nucleotide sequence of the corresponding region of human PGLYRP1 at the endogenous PGLYRP1 locus of the non-human animal, producing a genetically modified non-human animal cell, the non-human animal cell expressing human or chimeric PGLYRP1 protein. In some embodiments, the nucleotide sequence encoding the corresponding region of human PGLYRP1 comprises all or part of exon 1, exon 2 and / or exon 3 of the human PGLYRP1 gene. In some embodiments, the nucleotide sequence encoding the corresponding region of human PGLYRP1 comprises all of exon 1 to exon 3 of the human PGLYRP1 gene. In some embodiments, the nucleotide sequence encoding the corresponding region of human PGLYRP1 comprises all of the start codon of the human PGLYRP1 gene to exon 3. In some embodiments, the nucleotide sequence encoding the corresponding region of human PGLYRP1 comprises part of exon 1, all of exons 2-3 and / or at least 50bp of continuous nucleotides downstream of the 3'UTR. In some embodiments, the nucleotide sequence encoding the corresponding region of human PGLYRP1 comprises a portion of exon 1 of the human PGLYRP1 gene to at least 50 bp of continuous nucleotides downstream of the 3'UTR. In some embodiments, the nucleotide sequence encoding the corresponding region of human PGLYRP1 comprises at least 50 bp of continuous nucleotides from the start codon of the human PGLYRP1 gene to the downstream of the 3'UTR. In some embodiments, the nucleotide sequence encoding the corresponding region of human PGLYRP1 comprises a portion of human exon 1, all of exons 2-3, and / or at least 300 bp of continuous nucleotides downstream of the 3'UTR. In some embodiments, the nucleotide sequence encoding the corresponding region of human PGLYRP1 comprises at least 300 bp of continuous nucleotides from the start codon of the human PGLYRP1 gene to the downstream of the 3'UTR. In some embodiments, the amino acid sequence encoded by the nucleotide sequence encoding the corresponding region of human PGLYRP1 comprises SEQ ID NO: 2, or comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identity to the amino acid sequence shown in SEQ ID NO: 2. In some embodiments, the nucleotide sequence encoding the corresponding region of human PGLYRP1 comprises SEQ ID NO: 5, or comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identity to the nucleotide sequence shown in SEQ ID NO: 5. In some embodiments, the nucleotide sequence encoding the endogenous PGLYRP1 region comprises all or part of exon 1, exon 2 and / or exon 3 of the non-human animal PGLYRP1 gene.In some embodiments, the nucleotide sequence encoding the endogenous PGLYRP1 region includes all of exon 1 to exon 3 of the non-human animal PGLYRP1 gene. In some embodiments, the nucleotide sequence encoding the endogenous PGLYRP1 region includes all of the start codon to exon 3 of the non-human animal PGLYRP1 gene. In some embodiments, the nucleotide sequence encoding the human or chimeric PGLYRP1 protein is operably linked to a regulatory element of endogenous PGLYRP1, such as a promoter. In some embodiments, the non-human animal is a mouse. In some embodiments, the non-human animal also includes nucleotide sequences of human or chimeric proteins encoded by other genes, and the human or chimeric proteins are selected from at least one of LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1 and CTLA4.

[0011] In one aspect, the present invention provides a chimeric PGLYRP1 gene. In some embodiments, the chimeric PGLYRP1 gene includes a humanized PGLYRP1 gene. In some embodiments, the chimeric PGLYRP1 gene includes all or part of a nucleotide sequence encoding a human PGLYRP1 protein. In some embodiments, the human PGLYRP1 protein includes a signal peptide. In some embodiments, the human PGLYRP1 protein does not include a signal peptide. In some embodiments, the chimeric PGLYRP1 gene includes all or part of a nucleotide sequence encoding a human PGLYRP1 mature protein. In some embodiments, the chimeric PGLYRP1 gene includes at least 50 to at least 196 amino acid sequences encoding a human PGLYRP1 protein, for example, at least 50, 100, 175, 176, 177, 180, 190 or 196 nucleotide sequences of continuous amino acid sequences. In some embodiments, the chimeric PGLYRP1 gene comprises a nucleotide sequence encoding SEQ ID NO: 2 or positions 22-196 of SEQ ID NO: 2, or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 99.5% identical to a nucleotide sequence encoding SEQ ID NO: 2 or positions 22-196 of SEQ ID NO: 2. In some embodiments, the chimeric PGLYRP1 gene comprises a nucleotide sequence that is at least 20 to at least 4201 bp, such as at least 20, 50, 100, 200, 300, 400, 500, 676, 708, 800, 900, 1000, 2000, 3000, 3500, 3900, 3901, 4000, 4100, 4169, or 4201 bp (continuous or non-continuous) identical to a human PGLYRP1 gene. In some embodiments, the chimeric PGLYRP1 gene includes all or part of exons 1-3 of the human PGLYRP1 gene. In some embodiments, the chimeric PGLYRP1 gene includes part of exon 1 of the human PGLYRP1 gene to all of exon 3. In some embodiments, the chimeric PGLYRP1 gene also includes at least 50bp of continuous nucleotide sequence downstream of the 3'UTR. In some embodiments, the chimeric PGLYRP1 gene also includes at least 50bp to at least 1000bp, such as 50, 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1000bp of continuous nucleotide sequence downstream of the 3'UTR. In some embodiments, the chimeric PGLYRP1 gene includes part of exon 1 of the human PGLYRP1 gene to at least 50bp to at least 1000bp of continuous nucleotide sequence downstream of the 3'UTR. In some embodiments, the portion of exon 1 includes at least 5bp of continuous nucleotide sequence of exon 1 of the human PGLYRP1 gene.In some embodiments, the portion of exon 1 of the human PGLYRP1 gene includes at least the coding region sequence of exon 1. In some embodiments, the portion of exon 1 of the human PGLYRP1 gene includes at least the sequence from the start codon of exon 1 to the 3' end of exon 1. In some embodiments, the chimeric PGLYRP1 gene includes the entirety of the start codon to exon 3 of the human PGLYRP1 gene. In some embodiments, the chimeric PGLYRP1 gene includes at least 50bp to at least 1000bp of continuous nucleotide sequence from the start codon to the 3'UTR downstream of the human PGLYRP1 gene. In some embodiments, the chimeric PGLYRP1 gene also includes a portion of an endogenous PGLYRP1 gene of a non-human animal. In some embodiments, the chimeric PGLYRP1 gene also includes all or part of exons 1-3 of an endogenous PGLYRP1 gene of a non-human animal. In some embodiments, the chimeric PGLYRP1 gene includes the 5'UTR and / or 3'UTR of an endogenous PGLYRP1 gene of a non-human animal. In some embodiments, the chimeric PGLYRP1 gene comprises SEQ ID NO: 5, or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the nucleotide sequence shown in SEQ ID NO: 5. In some embodiments, the chimeric PGLYRP1 gene comprises, from 5' to 3', a portion of exon 1 of an endogenous PGLYRP1 gene of a non-human animal, a portion of exon 1 of a human PGLYRP1 gene, all of exon 2 of a human PGLYRP1 gene, all of exon 3 of a human PGLYRP1 gene, and at least 50 bp to at least 1000 bp of a continuous nucleotide sequence downstream of the 3'UTR of the human PGLYRP1 gene. In some embodiments, the chimeric PGLYRP1 gene comprises, from 5' to 3', a noncoding region of exon 1 of an endogenous PGLYRP1 gene of a non-human animal, a coding region of exon 1 to all of exon 3 of a human PGLYRP1 gene.

[0012] In one aspect, the present invention provides a chimeric PGLYRP1 protein, the chimeric PGLYRP1 protein is encoded by the chimeric PGLYRP1 gene. In some embodiments, the chimeric PGLYRP1 protein is a humanized PGLYRP1 protein. In some embodiments, the chimeric PGLYRP1 protein is identical to 5-196 amino acids (continuous or discontinuous) of a human PGLYRP1 protein, such as 5, 10, 20, 50, 100, 175, 176, 177, 180, 190, or 196 amino acids.

[0013] In one aspect, the present invention provides a non-human animal genome, the non-human animal genome comprising at least one chromosome comprising a nucleotide sequence encoding a human or chimeric PGLYRP1 protein. In some embodiments, the chromosome comprises a human or chimeric PGLYRP1 gene.

[0014] In one aspect, the present invention provides a non-human animal genome, the non-human animal genome comprising: at the endogenous PGLYRP1 locus of the non-human animal, a nucleotide sequence comprising human PGLYRP1 is introduced. In some embodiments, at the endogenous PGLYRP1 locus of the non-human animal, the endogenous PGLYRP1 gene is replaced with a nucleotide sequence comprising human PGLYRP1. In some embodiments, a nucleotide sequence comprising a human or chimeric PGLYRP1 gene or protein replaces the endogenous PGLYRP1 gene of the non-human animal.

[0015] In one aspect, the present invention provides a cell comprising the above-mentioned non-human animal genome.

[0016] In one aspect, the present invention provides a non-human animal comprising the above-mentioned non-human animal genome or the above-mentioned cell.

[0017] In one aspect, the present invention provides a method for determining the effectiveness of a therapeutic agent in treating a disease, the method comprising: 1) administering a therapeutic agent to the non-human animal or the non-human animal obtained by the construction method, wherein the non-human animal suffers from a disease; 2) determining the inhibitory effect of the therapeutic agent on the disease. In some embodiments, the therapeutic agent comprises an anti-PGLYRP1 antibody. In some embodiments, the therapeutic agent further comprises an additional therapeutic agent, such as an anti-PD-1 antibody, an anti-PD-L1 antibody, or an anti-CTLA4 antibody. In some embodiments, the disease is cancer, an immune disease, or inflammation. In some embodiments, the tumor comprises one or more tumor cells injected into a non-human animal. In some embodiments, determining the inhibitory effect of the anti-PGLYRP1 antibody on the tumor involves measuring the tumor volume in the animal. In some embodiments, the non-human animal further comprises a sequence encoding human or chimeric PD-1, human or chimeric PD-L1, and / or human or chimeric CTLA4. In some embodiments, the tumor comprises one or more tumor cells expressing PD-L1. In some embodiments, the cancer is melanoma, urogenital cancer, solid tumor, hematological tumor, head and neck cancer, liver cancer, or lung cancer. In some embodiments, the immune disease is asthma, rheumatoid arthritis or multiple sclerosis. In some embodiments, the inflammation is inflammatory bowel disease (IBD).

[0018] In one aspect, the present invention provides a method for determining the toxicity of a PGLYRP1 therapeutic agent, the method comprising: 1) administering a PGLYRP1 therapeutic agent to the non-human animal or the non-human animal obtained by the construction method; 2) determining the effect of the PGLYRP1 therapeutic agent on the non-human animal. In some embodiments, the determination of the effect of the PGLYRP1 therapeutic agent on the non-human animal comprises measuring the weight of the non-human animal or a blood test. In some embodiments, the blood test comprises one or more of a red blood cell count, a hematocrit, or a hemoglobin content.

[0019] In one aspect, the present invention provides a humanized PGLYRP1 gene, which comprises any of the following nucleotide sequences: A) a nucleotide sequence encoding SEQ ID NO: 2; B) SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 15 and / or 16; C) a nucleotide sequence that is at least 90% identical to SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 15 and / or 16; D) a nucleotide sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 3, 4, 5, 6, 7, 8, 9, 10, 15 and / or 16.

[0020] In one aspect, the present invention provides a cell, tissue or organ, comprising the above-mentioned humanized PGLYRP1 gene.

[0021] In one aspect, the present invention provides an animal model, comprising the above-mentioned humanized PGLYRP1 gene.

[0022] In one aspect, the present invention provides an application of the non-human animal, the non-human animal obtained by the construction method, the humanized PGLYRP1 gene, the animal model, the cell, tissue or organ. In some embodiments, the application includes: A) application in the development of products involving immune processes related to PGLYRP1 in human cells; B) application in a model system related to PGLYRP1 for pharmacological, immunological, microbiological and medical research; C) application involving the production and use of animal experimental disease models for PGLYRP1-related etiological research and / or for the development of diagnostic strategies and / or for the development of therapeutic strategies; D) application in the screening, efficacy detection, efficacy evaluation, verification or evaluation of human PGLYRP1 signaling pathway regulators in vivo; or, E) study of PGLYRP1 gene function, study of drugs and efficacy targeting human PGLYRP1 target sites, and study of PGLYRP1-related inflammation, cancer, and immune disease drugs.

[0023] The term "all or part" in the present invention, "all" refers to the whole, and "part" refers to a part of the whole, or an individual part that constitutes the whole.

[0024] The term "locus" in the present invention refers to the position of a gene on a chromosome in a broad sense, and refers to a DNA fragment on a gene in a narrow sense, which can be a gene, a part of a gene, or a regulatory region of a gene, etc. For example, the "PGLYRP1 locus" includes a DNA fragment selected from exons 1 to 3 of the PGLYRP1 gene. For example, the "PGLYRP1 locus" includes a DNA fragment selected from exons 1 to 3 of the PGLYRP1 gene.

[0025] The term "part of exon XX" of the present invention means that a continuous or interval of several, dozens or hundreds of nucleotide sequences are consistent with the entire exon nucleotide sequence, such as a portion of exon 1 of the human PGLYRP1 gene, including continuous 5-319 bp, such as 5, 10, 50, 100, 150, 200, 210, 220, 230, 240, 248, 249, 250, 260, 270, 280, 284, 285, 286, 287, 288, 290, 300, 310 or 319 bp of continuous nucleotides. In some embodiments, the portion of exon 1 of the human PGLYRP1 gene includes the nucleotide sequence of the coding region.

[0026] The term "exon XX to exon XXX" or "exon XX-XXX" or "exon XX to all of exon XXX" or "all of exon XX to all of exon XXX" in the present invention refers to exons and introns in between, for example, exon 1 to exon 3 includes all of exon 1, all of intron 1, all of exon 2, all of intron 2 and all of exon 3.

[0027] The term "a portion of exon x to a portion of exon xx" or "a portion of exon x to the entirety of exon xx" of the present invention includes the entirety or portion of an exon and introns therebetween. For example, "a portion of exon 1 to the entirety of exon 3" includes a portion of exon 1, the entirety of intron 1, the entirety of exon 2, the entirety of intron 2, and the entirety of exon 3.

[0028] The term "intron xx" in this application refers to an intron between two exons, for example, intron 1 is an intron between exon 1 and exon 2.

[0029] The term "comprising" or "including" in the present invention is an open-ended writing method, which contains the specified components or steps described, as well as other specified components or steps that will not be substantially affected. When used to describe a protein or nucleic acid sequence, the protein or nucleic acid may be composed of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, but still have the same or similar activity as the original sequence.

[0030] The term "and / or" of the present invention includes all combinations of items connected by the term, and each combination should be deemed to have been listed separately in the present application. For example, "A and / or B" includes "A", "A and B" and "B". For another example, "A, B and / or C" includes "A", "B", "C", "A and B", "A and C", "B and C" and "A and B and C".

[0031] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as those commonly understood by those of ordinary skill in the art to which the invention belongs. This application describes methods and materials for use in the present invention; other suitable methods and materials known in the art may be used. The materials, methods, and examples are exemplary and non-limiting only. All publications, patent applications, patents, sequences, database entries, and other references mentioned in this application are incorporated by reference in their entirety. In the event of a conflict, the present specification (including definitions) shall prevail.

[0032] Those skilled in the art can easily discern other aspects and advantages of the present application from the following detailed description.

[0033] Detailed description

[0034] PGLYRP1

[0035] In the human genome, the PGLYRP1 gene (NCBI Gene ID: 8993, located at positions 46019153 to 46023053 of chromosome 19 NC_000019.10) contains three exons, namely exon 1, exon 2 and exon 3. The corresponding position of each exon in the nucleotide sequence and amino acid sequence of the transcript NM_005091.3 and its encoded protein NP_005082.1 (SEQ ID NO: 2) is shown in Table 1.

[0036] Table 1

[0037]

[0038] In the mouse genome, the PGLYRP1 gene (NCBI Gene ID: 21946, located at positions 18618615 to 18624363 of chromosome 7 NC_000073.7) contains three exons, namely exon 1, exon 2 and exon 3. The corresponding position of each exon in the nucleotide sequence and amino acid sequence of the transcript NM_009402.2 and its encoded protein NP_033428.1 (SEQ ID NO: 1) is shown in Table 2.

[0039] Table 2

[0040]

[0041] PGLYRP1 genes, proteins and gene loci of other species are also known in the art. For example, the relevant information (e.g., intron sequences, exon sequences and amino acid sequences) of these genes of Rattus norvegicus (rat), Macaca mulatta (rhesus monkey), Canis lupus familiaris (dog), Sus scrofa (pig) can be found in NCBI, the entire contents of which are incorporated into this application by reference.

[0042] In order to determine the percent identity of two amino acid sequences or two nucleic acid sequences, the sequences are compared for the purpose of optimal comparison (e.g., for optimal comparison, gaps can be introduced in one or both of the first and second amino acid or nucleic acid sequences, and non-homologous sequences can be ignored for the purpose of comparison). The amino acid residues or nucleotides on the corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, which needs to be introduced to achieve the optimal comparison of the two sequences, taking into account the number of gaps and the length of each gap. For example, the comparison of the sequences and the determination of the percent identity between the two sequences can be completed using the Blossum 62 scoring matrix with a gap penalty of 12, a gap extension penalty of 4, and a frameshift gap penalty of 5.

[0043] The percentage (homology percentage) of conservative residues with similar physicochemical properties, such as leucine and isoleucine, can also be used to measure sequence similarity. Families of amino acid residues with similar physicochemical properties have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chains (e.g., threonine, valine and isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). In many cases, the homology percentage is higher than the identity percentage.

[0044] Carrier

[0045] The present invention provides a targeting vector, comprising: a) a DNA fragment homologous to the 5' end of the region to be changed (5' arm or 5' homologous arm), which is selected from the genomic DNA of the PGLYRP1 gene and has a length of 100 to 10,000 nucleotides; b) a donor region; and c) a DNA fragment homologous to the 3' end of the region to be changed (3' arm or 3' homologous arm), which is selected from the genomic DNA of the PGLYRP1 gene and has a length of 100 to 10,000 nucleotides.

[0046] In some embodiments, a) the DNA fragment homologous to the 5' end of the region to be changed is selected from a nucleotide sequence having at least 90% homology to NCBI Accession No. NC_000073.7; c) the DNA fragment homologous to the 3' end of the region to be changed is selected from a nucleotide sequence having at least 90% homology to NCBI Accession No. NC_000073.7.

[0047] In some embodiments, a) a DNA fragment homologous to the 5' end of the region to be changed is selected from the nucleotide sequence at positions 18614737 to 18618650 with NCBI Accession No. NC_000073.7; c) a DNA fragment homologous to the 3' end of the region to be changed is selected from the nucleotide sequence at positions 18624364 to 18628402 with NCBI Accession No. NC_000073.7.

[0048] In some embodiments, a) a DNA fragment homologous to the 5' end of the region to be changed is selected from the nucleotide sequence at positions 18617076 to 18618650 with NCBI Accession No. NC_000073.7; c) a DNA fragment homologous to the 3' end of the region to be changed is selected from the nucleotide sequence at positions 18624364 to 18625869 with NCBI Accession No. NC_000073.7.

[0049] In some embodiments, the length of the genomic nucleotide sequence selected for the targeting vector can exceed about 0.8 kb, 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 6.5 kb, 7 kb, 7.5 kb, 8 kb, 8.5 kb, 9 kb, 9.5 kb, 10 kb, 15 kb, 16 kb, 18 kb, 19 kb or 20 kb.

[0050] In some embodiments, the region to be changed is located on exon 1 to exon 3 of the PGLYRP1 gene of a non-human animal.

[0051] In some embodiments, the 5' arm sequence comprises the nucleotide sequence set forth in SEQ ID NO: 3. In some embodiments, the 3' arm sequence comprises the nucleotide sequence set forth in SEQ ID NO:4.

[0052] In some embodiments, the 5' arm sequence comprises the nucleotide sequence set forth in SEQ ID NO: 15. In some embodiments, the 3' arm sequence comprises the nucleotide sequence set forth in SEQ ID NO:16.

[0053] In some embodiments, the targeting vector comprises a human sequence (e.g., positions 46018853 to 46023021 of NC_000019.10). For example, the targeting region in the targeting vector includes: a partial or complete nucleotide sequence of the human PGLYRP1 gene, preferably exon 1, exon 2, and / or exon 3 of the human PGLYRP1 gene. In some embodiments, the nucleotide sequence of the targeting vector encodes all or part of the human PGLYRP1 protein, and the protein number of NCBI is NP_005082.1 (SEQ ID NO: 2).

[0054] In some embodiments, the targeting vector further comprises one or more marker genes (or resistance genes). For example, a positive screening marker gene or a negative screening marker gene. In some embodiments, the resistance gene for positive clone screening is a neomycin phosphotransferase coding sequence Neo. Preferably, the targeting vector further comprises two Frt recombination sites arranged in the same direction on both sides of the marker gene. In some embodiments, the coding gene of the negative screening marker is a coding gene (DTA) of the diphtheria toxin A subunit.

[0055] The present invention also provides a vector for constructing a humanized animal model or a knockout model. In some embodiments, the vector comprises an sgRNA sequence, wherein the sgRNA sequence targets the PGLYRP1 gene, and the sgRNA is unique on the target sequence of the gene to be changed, and satisfies the sequence arrangement rule of 5'-NNN(20)-NGG3' or 5'-CCN-N(20)-3'. In some embodiments, the targeting site of the sgRNA in the mouse PGLYRP1 gene is located in exon 1, intron 1, exon 2, intron 2 and / or exon 3. In some embodiments, the targeting site of the sgRNA in the mouse PGLYRP1 gene is located on exon 1 or upstream thereof, or on exon 3 or downstream thereof.

[0056] In some embodiments, the targeting sequence is shown as SEQ ID NO: 18 and / or 19. Therefore, the present invention provides sgRNA sequences for constructing genetically modified animal models. In some embodiments, the oligonucleotide sgRNA sequences are listed in SEQ ID NO: 20 and 22. In some embodiments, the oligonucleotide sgRNA sequences are listed in SEQ ID NO: 21 and 23. In some embodiments, the oligonucleotide sgRNA sequences are listed in SEQ ID NO: 24 and 26. In some embodiments, the oligonucleotide sgRNA sequences are listed in SEQ ID NO: 25 and 27.

[0057] In some embodiments, the present disclosure relates to a plasmid construct (e.g., pT7-sgRNA) comprising an sgRNA sequence and / or a cell comprising the construct.

[0058] The present invention also relates to a cell comprising a targeting vector or an sgRNA vector as described above.

[0059] In addition, the present invention also provides a non-human mammalian cell having any one of the above-mentioned targeting vectors and one or more in vitro transcripts of the construct described in the present application. In some embodiments, the cell comprises Cas9mRNA or its in vitro transcript.

[0060] In some embodiments, the cell is heterozygous for the gene. In some embodiments, the cell is homozygous for the gene.

[0061] In some embodiments, the non-human mammalian cell is a mouse cell. In some embodiments, the cell is a fertilized egg cell. In some embodiments, the cell is an embryonic stem cell.

[0062] Genetically modified non-human animals

[0063] The "genetically modified non-human animal" described in the present invention refers to a non-human animal in which at least one chromosome in the genome of the non-human animal has exogenous DNA. In some embodiments, at least one or more cells, for example, at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40% or 50% of the cells in the genetically modified non-human animal have exogenous DNA. Cells with exogenous DNA can be various cells, for example, somatic cells, immune cells (e.g., T cells, B cells, NK cells, antigen presenting cells, macrophages, dendritic cells), germ cells, blastocysts or tumor cells. In some embodiments, a genetically modified non-human animal is provided, the non-human animal comprising a modified endogenous PGLYRP1 locus, comprising an exogenous sequence (e.g., a human sequence), for example, replacing one or more non-human sequences with one or more human sequences, or inserting one or more human and / or non-human sequences. Non-human animals are generally able to pass genetic modifications to offspring through germline transmission.

[0064] The "chimeric gene" or "chimeric nucleic acid" of the present invention refers to a gene or nucleic acid, wherein two or more parts of the gene or nucleic acid are from different species, or at least one sequence of the gene or nucleic acid is different from the nucleic acid in a wild-type animal. In some embodiments, a chimeric gene or chimeric nucleic acid has at least a portion of a sequence having two or more different species sources, for example, a sequence encoding different proteins or a sequence encoding the same (or homologous) protein of two or more different species. In some embodiments, a chimeric gene or chimeric nucleic acid refers to a humanized gene or humanized nucleic acid.

[0065] The "chimeric protein" or "chimeric polypeptide" of the present invention refers to a protein or polypeptide, wherein two or more parts of the polypeptide or protein are from different species, or at least one sequence of the protein or polypeptide is different from the amino acid sequence in a wild-type animal. In some embodiments, at least a portion of the sequence of a chimeric protein or chimeric polypeptide has two or more different species sources, for example, the same (or homologous) protein of different species. In some embodiments, a chimeric protein or chimeric polypeptide refers to a humanized protein or humanized polypeptide.

[0066] The "humanized protein" or "humanized polypeptide" of the present invention refers to a protein or polypeptide, wherein at least a portion of the protein or polypeptide is derived from a human protein or polypeptide. In some embodiments, the humanized protein or polypeptide refers to a human protein or polypeptide.

[0067] The "humanized nucleic acid" of the present invention refers to a nucleic acid, wherein at least a portion of the nucleic acid is derived from a human. In some embodiments, the nucleic acids in the humanized nucleic acid are all derived from a human. In some embodiments, the humanized nucleic acid refers to a humanized exon, and the humanized exon can be a human exon or a chimeric exon.

[0068] In some embodiments, the chimeric gene or chimeric nucleic acid is a humanized PGLYRP1 gene or a humanized PGLYRP1 nucleic acid. In some embodiments, at least a portion of the gene or nucleic acid is derived from a human PGLYRP1 gene, and at least a portion of the gene or nucleic acid is derived from a non-human PGLYRP1 gene. In some embodiments, the gene or nucleic acid comprises a sequence encoding a PGLYRP1 protein. The encoded PGLYRP1 protein has at least one activity of a human PGLYRP1 protein or a non-human animal PGLYRP1 protein.

[0069] In some embodiments, the chimeric protein or chimeric polypeptide is a humanized PGLYRP1 protein or a humanized PGLYRP1 polypeptide. In some embodiments, at least one or more portions of the amino acid sequence of the protein or polypeptide are from a human PGLYRP1 protein, and at least one or more portions of the amino acid sequence of the protein or polypeptide are from a non-human animal PGLYRP1 protein. The humanized PGLYRP1 protein or humanized PGLYRP1 polypeptide is functional, or has at least one activity of a human PGLYRP1 protein or a non-human animal PGLYRP1 protein.

[0070] The non-human animal of genetic modification can be various animals, for example, mouse, rat, rabbit, pig, cattle (for example, cattle, bull, buffalo), deer, sheep, goat, chicken, cat, dog, ferret, primate (for example, marmoset, rhesus monkey).For the non-human animal of suitable genetically modified embryonic stem cell (ES) that is not easy to obtain, adopt alternative methods to construct the non-human animal comprising genetic modification.Such method includes, for example, modifying non-ES cell genome (for example, fibroblast or induced pluripotent stem cell) and adopting nuclear transplantation to transfer the modified genome to suitable cell, for example oocyte, and incubating the modified cell (for example, modified oocyte) in non-human animal under appropriate conditions to form embryo.The above-mentioned construction method is known in the art, and is described in "A.Nagy, et al., "Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition), " Cold Spring Harbor Laboratory Press, 2006 ", the entire contents of which are incorporated into the present application by reference.

[0071] In one aspect, the non-human animal is a mammal. In some embodiments, the genetically modified non-human animal is a rodent. Rodents can be selected from mice, rats and hamsters. In some embodiments, the rodent is selected from the family Muridae. In one embodiment, the genetically modified animal is selected from the family of Cricetidae (e.g., mouse-like hamsters), Cricetidae (e.g., hamsters, New World rats and mice, voles), Muroidea (true mice and rats, gerbils, spiny mice, crested rats), Malboridae (climbing mice, rock mice, tailed rats, Madagascar rats and mice), Spiny Dormouse (e.g., spiny dormouse) and Muridae (e.g., mole rats, bamboo rats and zokors). In a specific embodiment, the genetically modified rodent is selected from true mice or rats (Muroidea), gerbils, spiny mice and crested rats. In one embodiment, the genetically modified mouse is from a member of the Muridae family. In one embodiment, the animal is a rodent. In a specific embodiment, the rodent is selected from mice and rats. In one embodiment, the non-human animal is a mouse.

[0072] In some embodiments, the non-human animal can be an immunodeficient non-human mammal. For example, an immunodeficient rodent, an immunodeficient rabbit, an immunodeficient pig, an immunodeficient monkey, etc. In some embodiments, the non-human animal is a mouse of the C57BL strain, and the C57BL strain is selected from C57BL / a, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL6, C57BL / 10, C57BL10ScSn, C57BL / 10Cr and C57BL / Ola. In some embodiments, the mouse is a 129 strain selected from 129 / J, 129 / ReJ, 129 / OlaHsd, 129 / Sv, 129 / SvJ, 129 / Re, 129 / RrJ, 129 / Sv-ter / +. These mice are described in, for example, Festing et al., Revised nomenclature for strain 129 mice, Mammalian Genome 10: 836 (1999); Auerbach et al., Establishment and Chimera Analysis of 129 / SvEv-and C57BL / 6-Derived Mouse Embryonic Stem Cell Lines (2000), the relevant contents of which are incorporated herein by reference in their entirety. In some embodiments, the genetically modified mouse is a hybrid of the 129 strain and the C57BL / 6 strain. In some embodiments, the mouse is a hybrid of the 129 strain, or a hybrid of the C57BL / 6 strain. In some embodiments, the mouse is a BALB strain, such as a BALB / c strain. In some embodiments, the mouse is a hybrid of a BALB strain and another strain. In some embodiments, the mouse is from a hybrid strain (e.g., 50% BALB / c-50% 12954 / Sv; or 50% C57BL / 6-50% 129). In certain embodiments, non-human animals are rodents. In certain embodiments, non-human animals are mice with BALB / c, BALB / cHeAn, BALB / cJ, BALB / cR1, BALB / cWt, C57BL / 10, C57BL / 10ScSn, C57BL (C57BL / 10Cr and C57BL / Ola), C58, CBA / Br, CBA / Ca, CBA / J, CBA / st or CBA / H strains. In certain embodiments, non-human animals are rats. Rats can be selected from Wistar rats, LEA strains, Sprague-Dawley strains, Fischer strains, F344, F6 and Dark Agouti.In some embodiments, the rat strain is a hybrid of two or more strains selected from Wistar, LEA, Sprague-Dawley, Fischer, F344, F6, and Dark Agouti.

[0073] The non-human animal may have one or more other genetic modifications and / or other modifications that are suitable for the specific purpose of preparing a humanized animal. For example, a suitable mouse for maintaining a xenograft (e.g., a human cancer or tumor) may have one or more modifications that damage, inactivate, or destroy all or part of the immune system of the non-human animal. Damage, inactivation, or destruction of the immune system of the non-human animal may include, for example, chemical means (e.g., administration of toxins), physical means (e.g., irradiation of the animal), and / or genetic modification (e.g., knocking out one or more genes). Non-limiting examples of such mice include, for example, NOD mice, SCID mice, NOD / SCID mice, IL2Rγ knockout mice, NOD / SCID / γc null Mice (Ito, M. et al., NOD / SCID / γc null mouse:an excellent recipient mouse model for engraftment of human cells, Blood 100(9):3175-3182, 2002), nude mice, and Rag1 and / or Rag2 knockout mice. These mice can be optionally irradiated or otherwise treated to destroy one or more immune cell types. Therefore, in various embodiments, a genetically modified mouse is provided, which can include humanization of at least a portion of the endogenous non-human PGLYRP1 locus, and also includes damage, inactivation or partial destruction of the immune system (or one or more cell types of the immune system) of the non-human animal. In some embodiments, the mouse modification type is selected from NOD mice, SCID mice, NOD / SCID mice, IL-2Rγ knockout mice, NOD / SCID / γc null Mice, nude mice, Rag1 and / or Rag2 knockout mice, NOD Prkdc scid IL-2Rγ null Mouse, NOD Rag 1 - / - IL - / -

[0074] (NRG) mouse, Rag2 - / - IL - / -(RG) mice and modifications thereof. These transgenic animals are described, for example, in US10820580B2, which is incorporated herein by reference in its entirety. In some embodiments, the mice may include replacing all or part of the mouse endogenous mature PGLYRP1 coding sequence with all or part of the human mature PGLYRP1 coding sequence, respectively.

[0075] The genetically modified non-human animal includes a modification of the endogenous non-human animal PGLYRP1 gene site. In some embodiments, the modification comprises a nucleotide sequence encoding at least a portion of a mature PGLYRP1 protein (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% identity to the mature PGLYRP1 protein amino acid sequence). Although cells (e.g., ES cells, somatic cells) that may include the genetic modifications described herein are provided in the present invention, in many embodiments, the genetically modified non-human animal includes a modification of the endogenous PGLYRP1 gene site in the non-human animal.

[0076] The genetically modified non-human animal can express human PGLYRP1 and / or chimeric (e.g., humanized) PGLYRP1 at the endogenous locus of the non-human animal, wherein the endogenous PGLYRP1 gene of the non-human animal has been replaced or inserted with a gene of human PGLYRP1 and / or a nucleotide sequence encoding a region of the human PGLYRP1 sequence or a nucleotide sequence that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97% or 99.5% identical to the human PGLYRP1 sequence. In various embodiments, the endogenous PGLYRP1 locus of the non-human animal is modified by comprising all or part of a nucleic acid sequence encoding a mature human PGLYRP1 protein.

[0077] In some embodiments, the genetically modified mouse can express human PGLYRP1 and / or chimeric PGLYRP1 (e.g., humanized PGLYRP1) under the control of a mouse promoter and / or mouse regulatory elements. Insertion or replacement at the mouse endogenous locus provides a non-human animal that expresses human PGLYRP1 or chimeric PGLYRP1 (e.g., humanized PGLYRP1) in a suitable cell and in a manner that does not cause potential pathology observed in some other transgenic mice known in the art. Human PGLYRP1 or chimeric PGLYRP1 (e.g., humanized PGLYRP1) expressed in a non-human animal can maintain one or more functions of a wild-type mouse or human PGLYRP1 in a non-human animal. In addition, in some embodiments, the non-human animal does not express endogenous PGLYRP1. In some embodiments, the expression level of endogenous PGLYRP1 in a non-human animal is reduced compared to the expression level of PGLYRP1 in a wild-type animal. As used in the present invention, the term "endogenous PGLYRP1" refers to a PGLYRP1 protein expressed by an endogenous PGLYRP1 nucleotide sequence of a non-human animal (e.g., a mouse) before any genetic modification.

[0078] In some embodiments, the humanized PGLYRP1 locus comprises a human 5'UTR. In some embodiments, the humanized PGLYRP1 locus comprises an endogenous (e.g., mouse) 5'UTR. In some embodiments, the humanized PGLYRP1 locus comprises an endogenous (e.g., mouse) 3'UTR. Where appropriate, it is reasonable to assume that, based on the similarity of the 5' flanking sequences of the mouse and human PGLYRP1 genes, they appear to be similarly regulated. As shown in the application, humanized PGLYRP1 mice comprising insertions or substitutions in the endogenous mouse PGLYRP1 locus, which retain mouse regulatory elements but comprise humanization of the PGLYRP1 coding sequence, do not exhibit pathological phenomena. Both genetically modified mice, either heterozygous or homozygous for humanized PGLYRP1, are normal.

[0079] The present invention further relates to the PGLYRP1 genomic DNA sequence of humanized mice, a DNA sequence obtained by reverse transcription of mRNA that is consistent with or complementary to the DNA sequence; a construct expressing the amino acid sequence thereof; a cell comprising the construct thereof; and a tissue or organ comprising the cell thereof.

[0080] The present invention further relates to a non-human mammal or its progeny produced by the above construction method. In some embodiments, its genome comprises human genes.

[0081] In some embodiments, the non-human mammal is a rodent, preferably, the non-human mammal is a mouse.

[0082] In some embodiments, the non-human mammal expresses a protein encoded by a humanized PGLYRP1 gene.

[0083] In addition, the present invention also provides a non-human mammal model carrying a tumor, wherein the non-human mammal model is obtained by the method described in the present application. In some embodiments, the non-human mammal is a rodent (eg, mouse).

[0084] The present invention also provides a cell or cell line derived from a non-human mammal or its offspring, or a non-human mammal carrying a tumor, or a primary cell culture, which is derived from a non-human mammal or its offspring, or a non-human mammal carrying a tumor, or a tissue, organ, or culture thereof derived from a non-human mammal or its offspring. When it carries a tumor, it is derived from a tumor tissue of a non-human mammal or its offspring, or a non-human mammal carrying a tumor.

[0085] The present invention provides a non-human mammal produced by any of the methods described herein. In some embodiments, a non-human mammal or a genetically modified non-human animal is provided, wherein the genome of the genetically modified non-human animal comprises DNA of human or humanized PGLYRP1.

[0086] In some embodiments, a non-human mammal comprises a gene construct described herein. In some embodiments, a non-human mammal expressing a human or humanized PGLYRP1 protein is provided. In some embodiments, a cell, tissue or organ that specifically expresses a human or humanized PGLYRP1 protein is provided.

[0087] In some embodiments, the expression of non-human animal human or humanized PGLYRP1 protein is controllable. For example, by adding a specific inducer or repressor. In some embodiments, the specific inducer is selected from the tetracycline system (Tet-Off System / Tet-On System) or the tamoxifen system (Tamoxifen System).

[0088] The non-human mammal can be any non-human animal known in the art that can be used in the methods described herein. Preferred non-human animals are non-human mammals (eg, rodents). In some embodiments, the non-human mammal is a mouse.

[0089] The non-human mammals described above are subjected to genetic, molecular and behavioral analyses. The present invention provides offspring produced by mating with non-human mammals of the same genotype or other genotypes.

[0090] The present invention provides a cell line or primary cell culture derived from a non-human mammal or its progeny. For example, a cell culture-based model can be prepared by the following method. The cell culture can be obtained by isolation from a non-human mammal, or cells can be obtained from a cell culture established using the same construct and standard cell transfection techniques. The integration of a genetic construct comprising a DNA sequence encoding a human PGLYRP1 protein can be detected by a variety of methods.

[0091] There are many analytical methods that can be used to detect exogenous DNA, including nucleic acid level methods (including the use of reverse transcription-polymerase chain reaction (RT-PCR) or Southern Blot and in situ hybridization) and protein level methods (including histochemical analysis, immunoblot analysis and in vitro binding studies). In addition, the expression level of the target gene can be quantified by the ELSA method well known to those skilled in the art. Many standard analytical methods can be used to achieve quantitative detection. For example, RT-PCR and hybridization methods can be used to detect transcription levels, including RNase protection assays, Southern Blots, and RNA dot hybridization analysis (RNAdot). Immunohistochemical staining, flow cytometry, and Western blots can also be used to detect the presence of human or humanized PGLYRP1 protein.

[0092] In some embodiments, the genetically modified non-human animals described herein (eg, PGLYRP1 gene homozygous mice) can express human or humanized PGLYRP1 in one or more liver tissue cells.

[0093] Methods for constructing genetically modified non-human animals

[0094] Genetically modified non-human animals can be prepared by several techniques known in the art, including gene targeting technology using embryonic stem cells, CRISPR / Cas9 technology, zinc finger nuclease technology, transcription activator-like effector nuclease technology, homing endonuclease or other molecular biology techniques. In some embodiments, homologous recombination technology is preferably used. In some embodiments, CRISPR / Cas9 gene editing technology can construct genetically modified non-human animals. In some embodiments, CRISPR-Cas9 genome editing is used to produce genetically modified non-human animals. Many of these genome editing technologies are known in the art and are described in Yin et al. "Delivery technologies for genome editing," Nature Reviews Drug Discovery 16.6 (2017): 387-399, which is incorporated herein by reference. The present invention also provides many other methods for genome editing, for example, microinjecting transgenic cells into enucleated oocytes and fusing the enucleated oocytes with another transgenic cell.

[0095] In some embodiments, the nucleotide sequence encoding the endogenous PGLYRP1 region in the endogenous genome of at least one cell of the non-human animal is replaced by the nucleotide sequence encoding the corresponding region of human PGLYRP1. In some embodiments, the expression of the endogenous PGLYRP1 protein of the non-human animal is reduced or absent compared to the wild type. In some embodiments, the replacement occurs in cells such as germ cells, somatic cells, blastocysts or fibroblasts. The nucleus of a somatic cell or fibroblast can be inserted into an enucleated oocyte.

[0096] The present invention provides a targeting vector. The targeting vector comprises a vector consisting of a 5' homology arm, a human or humanized PGLYRP1 gene fragment and a 3' homology arm. The process involves replacing the endogenous corresponding PGLYRP1 sequence with a human or humanized PGLYRP1 sequence using homologous recombination. In some embodiments, cleavage upstream and downstream of the target site (e.g., by zinc finger nuclease, TALEN or CRISPR) can result in a double-stranded DNA break, and homologous recombination is used to replace the endogenous PGLYRP1 sequence of a non-human animal with a human or humanized PGLYRP1 sequence.

[0097] Therefore, in some embodiments, the method of preparing a genetically modified humanized animal comprises replacing a nucleic acid sequence encoding an endogenous PGLYRP1 region with a nucleotide sequence encoding a corresponding region of human PGLYRP1 at the endogenous PGLYRP1 locus (or site).

[0098] The present invention also provides a method for establishing a PGLYRP1 gene humanized animal model, comprising the following steps:

[0099] (a) providing cells (e.g., fertilized egg cells) based on the method described in the present application;

[0100] (b) culturing the cells; preferably culturing the cells in a liquid culture medium;

[0101] (c) transplanting the cultured cells into the oviduct or uterus of a recipient female non-human mammal, allowing the cells to develop in the uterus of the female non-human mammal;

[0102] (d) identifying germline transmission in offspring of the genetically modified humanized non-human mammal of the pregnant female in step (c).

[0103] In some embodiments, the non-human mammal in the above methods is a mouse (eg, a C57BL / 6 mouse).

[0104] In some embodiments, the non-human mammal in step (c) is a female with pseudopregnancy (or pregnancy).

[0105] In some embodiments, the fertilized eggs used in the above methods are C57BL / 6 fertilized eggs. Other fertilized eggs that can also be used in the methods described herein include, but are not limited to, FVB / N fertilized eggs, BALB / c fertilized eggs, DBA / 1 fertilized eggs, and DBA / 2 fertilized eggs.

[0106] The fertilized egg can be from any non-human animal, such as any non-human animal described herein. In some embodiments, the fertilized egg cell is derived from a rodent. The gene construct can be introduced into the fertilized egg by microinjection. For example, by culturing the fertilized egg after microinjection, the cultured fertilized egg can be transferred to a pseudopregnant non-human animal, and then the pseudopregnant non-human animal gives birth to a non-human mammal, thereby producing the non-human mammal mentioned in the above method.

[0107] In some embodiments, the method for preparing a genetically modified non-human animal includes modifying the coding frame of the PGLYRP1 gene of the non-human animal, for example, by replacing the nucleic acid sequence (e.g., DNA or cDNA sequence) encoding the endogenous PGLYRP1 region with a nucleotide sequence encoding the corresponding region of human PGLYRP1 under the control of the endogenous regulatory elements of the PGLYRP1 gene of the non-human animal. For example, one or more functional region sequences of the PGLYRP1 gene of the non-human animal can be knocked out or inserted into a sequence so that the endogenous PGLYRP1 protein of the non-human animal cannot be expressed or the expression level is reduced. In some embodiments, the coding frame of the PGLYRP1 gene of the modified non-human animal can be all or part of the nucleotide sequence of exon 1 to exon 3 of the PGLYRP1 gene of the non-human animal.

[0108] In some embodiments, the method for preparing a genetically modified non-human animal comprises inserting a nucleotide sequence and / or an auxiliary sequence encoding a human or humanized PGLYRP1 protein after the endogenous regulatory element of the PGLYRP1 gene of the non-human animal. In some embodiments, the auxiliary sequence can be a stop codon so that the PGLYRP1 gene humanized animal model can express a human or humanized PGLYRP1 protein in vivo, but does not express the PGLYRP1 protein of the non-human animal. In some embodiments, the auxiliary sequence comprises WPRE (WHP post-transcriptional response element), loxP, STOP and / or polyA.

[0109] In some embodiments, a method for preparing a genetically modified non-human animal comprises:

[0110] (1) providing a plasmid comprising a human PGLYRP1 gene fragment, wherein the plasmid is flanked by a 5' homology arm and a 3' homology arm, wherein the 5' homology arm and the 3' homology arm target endogenous PGLYRP1 of a non-human animal;

[0111] (2) providing one or more guide RNAs (sgRNAs) targeting the endogenous PGLYRP1 gene;

[0112] (3) modifying the genome of a fertilized egg or embryonic stem cell by using the plasmid of step (1), the sgRNA of step (2) and Cas9;

[0113] (4) transplanting the fertilized egg obtained in step (3) into the oviduct of a pseudo-pregnant female mouse, or transplanting the embryonic stem cells obtained in step (3) into a blastocyst, and then transplanting the blastocyst into the oviduct of a pseudo-pregnant female mouse to produce offspring mice that functionally express humanized PGLYRP1 protein;

[0114] (5) The offspring mice obtained in step (4) are mated to obtain homozygous mice.

[0115] In some embodiments, the fertilized egg is modified by CRISPR with sgRNAs targeting a 5'-terminal targeting site and a 3'-terminal targeting site.

[0116] In some embodiments, the sequence encoding the humanized PGLYRP1 protein is operably linked to endogenous regulatory elements at the endogenous PGLYRP1 locus.

[0117] In some embodiments, the genetically modified non-human animal does not express endogenous PGLYRP1 protein.

[0118] In some embodiments, a method for preparing a genetically modified non-human animal comprises:

[0119] (1) providing a plasmid comprising a human or chimeric PGLYRP1 gene fragment, wherein the plasmid is flanked by a 5' homology arm and a 3' homology arm, wherein the 5' homology arm and the 3' homology arm target endogenous PGLYRP1 of a non-human animal;

[0120] (2) providing one or more guide RNAs (sgRNAs) targeting the endogenous PGLYRP1 gene;

[0121] (3) Modifying the genome of a fertilized egg or embryonic stem cell by inserting the human or chimeric PGLYRP1 gene fragment into the genome.

[0122] In some embodiments, the nucleotide sequence encoding the PGLYRP1 protein endogenously in the non-human animal is deleted. In some embodiments, all or part of exons 1-3 of the endogenous PGLYRP1 gene of the non-human animal is deleted. In some embodiments, part of exon 1 to all of exon 3 of the endogenous PGLYRP1 gene of the non-human animal is deleted. In some embodiments, the start codon to all of exon 3 of the endogenous PGLYRP1 gene of the non-human animal is deleted. In some embodiments, intron 1 and / or intron 2 of the endogenous PGLYRP1 gene of the non-human animal is deleted.

[0123] In some embodiments, the construction method comprises replacing the nucleotide sequence of the non-human animal PGLYRP1 protein with the nucleotide sequence encoding the human PGLYRP1 protein. In some embodiments, the construction method comprises replacing the nucleotide sequence of the non-human animal endogenous encoding SEQ ID NO: 1 or SEQ ID NO: 1 with the nucleotide sequence encoding SEQ ID NO: 2 or SEQ ID NO: 2 at positions 22-196. In some embodiments, the construction method comprises replacing the non-human animal endogenous encoding SEQ ID NO: 1 or SEQ ID NO: 1 at positions 19-182 with the nucleotide sequence encoding SEQ ID NO: 2 or SEQ ID NO: 2. In some embodiments, the construction method comprises replacing the non-human animal PGLYRP1 gene exon 1 with the human PGLYRP1 gene exon 1 to the exon 3. In some embodiments, the construction method comprises replacing the non-human animal PGLYRP1 gene exon 1 with the exon 3 of the human PGLYRP1 gene. In some embodiments, the construction method comprises replacing the non-human animal PGLYRP1 gene exon 1 with the exon 3 of the human PGLYRP1 gene. In some embodiments, the construction method comprises replacing the non-human animal PGLYRP1 gene exon 3 with the start codon of the human PGLYRP1 gene. The start codon to the 3'UTR downstream of at least 50bp to 1000bp of continuous nucleotides replace the start codon to the exon 3 of the non-human animal PGLYRP1 gene. In some embodiments, the construction method comprises replacing the nucleotide sequence encoding SEQ ID NO: 1 in the genome of a non-human animal with SEQ ID NO: 5 or 6. In some embodiments, the construction method comprises replacing the endogenous nucleotide sequence encoding SEQ ID NO: 1 in a non-human animal with a nucleotide sequence encoding a human or humanized PGLYRP1 protein or a humanized PGLYRP1 gene.

[0124] Use of genetically modified non-human animals

[0125] Replacing a non-human animal gene with a homologous or orthologous human gene or human sequence or inserting a homologous or orthologous human gene or human sequence into a non-human animal at an endogenous non-human animal locus and under the control of an endogenous promoter and / or regulatory element can produce a non-human animal with qualities and characteristics that may be significantly different from a typical knockout plus transgenic animal. In a typical knockout plus transgenic animal, the endogenous locus is removed or destroyed, and a full human transgene is inserted into the genome of the animal and may be randomly integrated into the genome. Typically, the location of the integrated transgene is unknown; expression of the human protein is measured by transcription of a human gene and / or protein assay and / or functional assay. In a human transgene, the upstream and / or downstream of the human sequence provides suitable support for expression and / or regulation of the transgene.

[0126] In some cases, transgenes with human regulatory elements are expressed in a non-physiological or otherwise unsatisfactory manner, and may actually be harmful to the animal. The present invention demonstrates that replacement or insertion of human sequences at endogenous loci under the control of endogenous regulatory elements to produce humanized animals provides physiologically appropriate expression patterns and levels that are meaningful and appropriate in the context of the physiology of the humanized animal with respect to the physiology of the replaced gene.

[0127] Genetically modified animals that express human or humanized PGLYRP1 protein, e.g., in a physiologically appropriate manner, provide a variety of uses, including but not limited to developing treatments for human diseases and disorders, and evaluating the toxicity and / or efficacy of these human treatments in animal models.

[0128] The present invention also provides a use of the above-mentioned PGLYRP1 gene-modified non-human animal and a non-human animal obtained by any of the above-mentioned construction methods.

[0129] In some embodiments, the application comprises:

[0130] A) Applications in the development of products involving PGLYRP1-related immune processes in human cells;

[0131] B) Application as a model system related to PGLYRP1 for pharmacology, immunology, microbiology and medical research;

[0132] C) Applications involving the production and use of animal experimental disease models for the study of PGLYRP1-related etiology and / or for the development of diagnostic strategies and / or for the development of therapeutic strategies;

[0133] D) in vivo studies on the screening, efficacy testing, efficacy assessment, validation or evaluation of human PGLYRP1 signaling pathway modulators; or,

[0134] E) Study the function of the PGLYRP1 gene, study the drugs and efficacy targeting the human PGLYRP1 target site, and study the application of drugs related to PGLYRP1 in tumors, inflammation, and immune diseases.

[0135] The present invention provides a non-human animal expressing human or humanized PGLYRP1 protein, which can be used for screening of human PGLYRP1-specific modulators. In some embodiments, the non-human animal is a human disease animal model. For example, the disease is genetically induced (knock-in or knock-out). In various embodiments, the genetically modified non-human animal also comprises an impaired immune system, such as a genetically modified human-derived tissue xenograft, including a human solid tumor (e.g., breast cancer) or a blood cell tumor (e.g., a lymphocyte tumor, a B or T cell tumor).

[0136] In some embodiments, the anti-PGLYRP1 antibody blocks or inhibits a PGLYRP1-mediated signaling pathway. In some embodiments, the anti-PGLYRP1 antibody described herein can block the interaction between PGLYRP1 complexes, thereby inhibiting the PGLYRP1 signaling pathway.

[0137] In some embodiments, genetically modified non-human animals can be used to determine the effectiveness of therapeutic agents (e.g., anti-PGLYRP1 antibodies) in treating various immune diseases. In some embodiments, the immune diseases include, but are not limited to, GVHD (graft versus host disease), psoriasis, allergies, asthma, myocarditis, nephritis, hepatitis (preferably non-alcoholic fatty hepatitis), systemic lupus erythematosus, rheumatoid arthritis, scleroderma, hyperthyroidism, idiopathic thrombocytopenic purpura, autoimmune hemolytic anemia, ulcerative colitis, autoimmune liver disease, diabetes, pain or neurological disorders, etc. In some embodiments, the immune disease is asthma, rheumatoid arthritis or multiple sclerosis.

[0138] In some embodiments, genetically modified non-human animals can be used to determine the effectiveness of PGLYRP1 therapeutic agents (e.g., anti-PGLYRP1 antibodies) in treating various inflammations or infections. In some embodiments, the inflammation includes acute inflammation and chronic inflammation. Specifically, it includes but is not limited to degenerative inflammation, exudative inflammation (serous inflammation, fibrinous inflammation, suppurative inflammation, hemorrhagic inflammation, necrotizing inflammation, catarrhal inflammation), proliferative inflammation, specific inflammation (tuberculosis, syphilis, leprosy, lymphogranuloma, etc.). In some embodiments, inflammation is inflammatory bowel disease (IBD).

[0139] In some embodiments, genetically modified non-human animals can be used to determine the effectiveness of PGLYRP1 therapeutic agents (e.g., anti-PGLYRP1 antibodies) for treating cancer. In some embodiments, a therapeutic agent (e.g., an anti-PGLYRP1 antibody) is administered to a non-human animal, wherein the non-human animal has cancer or a tumor, and the inhibitory effect of the therapeutic agent on the cancer or tumor is detected. In some embodiments, the detection includes determining the size and / or proliferation rate of tumor cells. In some embodiments, the detection method includes vernier caliper measurement, flow cytometry, and / or in vivo animal imaging detection. In some embodiments, the detection includes assessing individual body weight, fat mass, activation pathways, neuroprotective activity, or metabolic changes, including changes in food consumption or water consumption.

[0140] In some embodiments, the tumor cells include one or more cancer cells injected into an animal (e.g., cancer cells derived from a human or non-human animal). In some embodiments, the therapeutic agent inhibits the PGLYRP1 signaling pathway. In some embodiments, the therapeutic agent does not inhibit the PGLYRP1 signaling pathway.

[0141] In some embodiments, genetically modified non-human animals can be used to detect whether an anti-PGLYRP1 antibody is an agonist or antagonist. In some embodiments, the methods described herein can be used to detect the function of a therapeutic agent (e.g., an anti-PGLYRP1 antibody), for example, whether the therapeutic agent can upregulate an immune response or downregulate an immune response, and / or whether the therapeutic agent can induce complement-mediated cytotoxicity (CMC) or antibody-dependent cellular cytotoxicity (ADCC). In some embodiments, genetically modified non-human animals can be used to determine the effective dose of a therapeutic agent for treating a disease in a subject (e.g., an immune disease). The inhibitory effect on tumors can also be determined by methods known in the art, for example, measuring tumor volume in non-human animals, and / or determining the tumor (volume) inhibition rate (TGI). TV ). The tumor growth inhibition rate can be calculated using the formula TGI TV (%)=(1–T Vt / T Vc ) x 100, where T Vt and T Vc is the average tumor volume (or weight) of the treatment group and the control group.

[0142] In some embodiments, PGLYRP1 therapeutic agents (e.g., anti-PGLYRP1 antibodies) can be used to treat various cancers. The "cancer" of the present invention refers to cells with autonomous growth ability, that is, an abnormal state or condition characterized by rapid cell growth and proliferation. The term is intended to include all types of cancerous growth or carcinogenic processes, metastatic tissues or malignantly transformed cells, tissues or organs, regardless of the histopathological type or invasive stage. The "tumor" of the present invention includes, but is not limited to, lymphoma, non-small cell lung cancer, cervical cancer, leukemia, ovarian cancer, nasopharyngeal cancer, breast cancer, endometrial cancer, colon cancer, rectal cancer, gastric cancer, bladder cancer, brain glioma, lung cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver and bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myelodysplastic syndrome, and sarcoma. Wherein, the leukemia is selected from acute lymphocytic (lymphoblastic) leukemia, acute myeloid leukemia, myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma, plasma cell leukemia, and chronic myeloid leukemia; the lymphoma is selected from Hodgkin's lymphoma and non-Hodgkin's lymphoma, including B-cell lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone B-cell lymphoma, T-cell lymphoma, and Waldenstrom's macroglobulinemia; the sarcoma is selected from osteosarcoma, Ewing's sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma, and chondrosarcoma. In a specific embodiment of the present invention, the tumor is breast cancer, pancreatic cancer, endocrine cancer, head and neck cancer, gastrointestinal cancer, colorectal cancer, bladder cancer, non-small cell lung cancer, glioblastoma, prostate cancer, neuroendocrine tumor, mesothelial tumor, oropharyngeal tumor, female reproductive system cancer or meningioma. In some embodiments, the tumor is melanoma, urogenital cancer, solid tumor, hematological tumor, head and neck cancer or lung cancer.

[0143] The present invention also provides a detection method for determining the toxicity of a PGLYRP1 therapeutic agent (e.g., an anti-PGLYRP1 antibody). The detection method comprises administering an antibody to the non-human animal described above, and evaluating the animal's weight change or blood test. In some embodiments, the blood test includes one or more of red blood cell count, hematocrit, or hemoglobin content. In some embodiments, the antibody can reduce red blood cells (RBC), hematocrit, or hemoglobin by 20%, 30%, 40%, or more than 50%. In some embodiments, the body weight of the non-human animal is at least 5%, 10%, 20%, 30%, or 40% less than that of a control group (e.g., the average weight of an animal not treated with the antibody).

[0144] The present invention also provides an animal model constructed by the method described in the present application for developing products related to human cellular immune processes, producing human antibodies, or a model system for pharmacology, immunology, microbiology and medical research.

[0145] In some embodiments, an animal model generated by the methods described herein is provided for producing and utilizing animal experimental disease models of immune processes of human cells, studying pathogens, or developing new diagnostic strategies and / or therapeutic strategies.

[0146] The present invention also provides an animal model generated by the method described in the present application to screen, verify, evaluate or study the PGLYRP1 gene function, human PGLYRP1 antibodies, drugs or effectiveness of human PGLYRP1 target sites, drugs for immune diseases and anti-tumor drugs.

[0147] In some embodiments, the present invention provides a method for verifying the in vivo efficacy of TCR-T, CAR-T and / or other immunotherapies (e.g., T cell adoptive transfer therapy). For example, the method comprises transplanting human tumor cells into non-human animals described herein, and applying human CAR-T to non-human animals with human tumor cells. The effectiveness of CAR-T treatment can be determined and evaluated. In some embodiments, the non-human animal is selected from a PGLYRP1 gene humanized non-human animal prepared by the method described herein, a double or multiple humanized non-human animal (or its offspring) produced by the method described herein, a non-human animal expressing a human or humanized PGLYRP1 protein, or a tumor-bearing, immune disease or inflammatory animal model described herein. In some embodiments, TCR-T, CAR-T and / or other immunotherapies can treat PGLYRP1-related diseases described herein. In some embodiments, TCA-T, CAR-T and / or other immunotherapies provide evaluation methods for treating PGLYRP1-related diseases described herein.

[0148] Non-human animal models with two or more human or chimeric genes

[0149] The present invention also provides a method for producing a genetically modified animal model having two or more human or chimeric genes. The animal may comprise a human or chimeric PGLYRP1 gene and a sequence encoding an additional human or chimeric protein.

[0150] In some embodiments, the additional human or chimeric gene is a non-human animal modified with at least one gene of LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and CTLA4. In some embodiments, the non-human animal further expresses at least one of human or humanized LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and CTLA4 proteins.

[0151] The present invention also provides a method for constructing a non-human animal with two or more human or chimeric genes, the method comprising:

[0152] (1) Providing the above-mentioned construction method to obtain a non-human animal;

[0153] (ii) mating, in vitro fertilization, or direct gene editing of the non-human animal provided in step (i) with other genetically modified non-human animals, and screening to obtain two or more genetically modified non-human animals.

[0154] In some embodiments, the other genetically modified non-human animals include non-human animals humanized with one or a combination of two or more of the genes LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1 and CTLA4.

[0155] In some embodiments, PGLYRP1 humanization is performed directly on non-human animals with human or chimeric LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and CTLA4 gene modifications.

[0156] Since these proteins may be involved in different mechanisms, a combination therapy targeting two or more of these proteins may be a more effective treatment method. In fact, many related clinical trials are underway and show good results. Multigene modified non-human animal models can be used to determine the effectiveness of combination therapies targeting two or more proteins, for example, anti-PGLYRP1 antibodies, and additional therapeutic agents for treating cancer or immune diseases (e.g., asthma or atopic dermatitis) or inflammation. The method includes administering an anti-PGLYRP1 antibody and an additional therapeutic agent to an animal, wherein the animal has a tumor or immune disease or inflammation, and determining the effect of the combined treatment on inflammation or tumor or immune disease. In some embodiments, the additional therapeutic agent is an antibody that specifically binds to LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and CTLA4. In some embodiments, the additional therapeutic agent is an anti-CTLA4 antibody (e.g., ipilimumab), an anti-PD-1 antibody (e.g., nivolumab), or an anti-PD-L1 antibody. In some embodiments, the non-human animal further comprises a sequence encoding human or humanized PD-1, a sequence encoding human or humanized PD-L1, or a sequence encoding human or humanized CTLA-4. In some embodiments, the additional therapeutic agent is an anti-PD-1 antibody (e.g., nivolumab, pembrolizumab), an anti-PD-L1 antibody, or an anti-CTLA-4 antibody. In some embodiments, the tumor comprises one or more tumor cells expressing PD-L1 and / or PD-L2.

[0157] In some embodiments, the combination therapy is used to treat various cancers described in the present application, for example, breast cancer, ovarian cancer, endometrial cancer, melanoma, kidney cancer, lung cancer or cancer. In some embodiments, the combination therapy is designed to treat immune disorders described in the present application, such as psoriasis. In some embodiments, the method described in the present application can be used to evaluate the combination therapy with some other methods. The method for treating cancer that can be used alone or in combination with the method described in the present application includes, for example, treating the subject with chemotherapy, for example, camphor alkali, doxorubicin, cisplatin, carboplatin, procarbazine, methylclorazepate, cyclophosphamide, doxorubicin, ifosamide, melphalan, chloramphenicol, thiophene, nitrosourea, dacrynic acid, daunorubicin, bleomycin, primycin, mitomycin, etoposide, verapamil, podophyllotoxin, tamoxifen, paclitaxel, transplatinum, 5-fluorouric acid, vincristine, vinblastine and / or methotrexate. Alternatively, or in addition, the method can include performing surgery on the subject to remove at least a portion of the cancer, for example, removing a portion or all of a tumor from the patient. BRIEF DESCRIPTION OF THE DRAWINGS

[0158] Figure 1: Schematic diagram comparing the mouse PGLYRP1 locus and the human PGLYRP1 locus (not to scale);

[0159] Figure 2 : Schematic diagram of PGLYRP1 gene targeting strategy and targeting vector V1 design (not to scale);

[0160] Figure 3 : Schematic diagram of PGLYRP1 gene targeting strategy and targeting vector V2 design (not to scale);

[0161] Figure 4 :The Southern blot results of the F1 generation of humanized PGLYRP1 mice, where WT is the wild-type control;

[0162] Figure 5 : ELISA test results, where + / + represents wild-type C57BL / 6 mice, and H / H represents homozygous PGLYRP1 gene humanized mice. DETAILED DESCRIPTION

[0163] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0164] In each of the following examples, equipment and materials were obtained from the following companies:

[0165] C57BL / 6 mice and Flp transgenic mice were purchased from the National Rodent Laboratory Animal Seed Center, China Food and Drug Inspection Institutes;

[0166] PshAI enzyme was purchased from NEB, catalog number R0593S;

[0167] AleI enzyme was purchased from NEB, catalog number R0634;

[0168] Origene Mouse Pglyrp1 ELISA KIT was purchased from Origene, catalog number EA102442;

[0169] Human PGLYRP1 / PGRP-SDuoSet ELISA was purchased from R&D Systems with the catalog number DY2590.

[0170] Example 1 PGLYRP1 gene humanized mice

[0171] A schematic diagram of the comparison between the mouse PGLYRP1 gene (NCBI Gene ID: 21946, located at positions 18618615 to 18624363 on chromosome 7 NC_000073.7, based on transcript NM_009402.2 and its encoded protein NP_033428.1 (SEQ ID NO: 1)) and the human PGLYRP1 gene (NCBI Gene ID: 8993, located at positions 46019153 to 46023053 on chromosome 19 NC_000019.10, based on transcript NM_005091.3 and its encoded protein NP_005082.1 (SEQ ID NO: 2)) is shown in FIG. Figure 1 shown.

[0172] In order to achieve the purpose of the present invention, a nucleotide sequence encoding a human PGLYRP1 protein can be introduced into the mouse endogenous PGLYRP1 locus, so that the mouse expresses a human or humanized PGLYRP1 protein. Specifically, using gene editing technology, under the control of the mouse PGLYRP1 gene regulatory element, a partial sequence of exon 1 of the human PGLYRP1 gene to a partial sequence of about 4.1 kb downstream of the 3'UTR is used to replace the partial sequence of exon 1 of the mouse to the entire sequence of exon 3, about 5.7 kb, to obtain a humanized PGLYRP1 locus, thereby achieving humanization of the mouse PGLYRP1 gene.

[0173] In order to realize the targeting strategy of the present invention, a targeting vector was constructed. The targeting vector V1 ( Figure 2 ) contains upstream and downstream homology arm sequences of the mouse PGLYRP1 gene, and an A fragment containing a human PGLYRP1 fragment. Among them, the upstream 5' homology arm sequence (SEQ ID NO: 3) is identical to the nucleotide sequence of positions 18614737 to 18618650 of NCBI accession number NC_000073.7, and the downstream 3' homology arm sequence (SEQ ID NO: 4) is identical to the nucleotide sequence of positions 18624364 to 18628402 of NCBI accession number NC_000073.7. The nucleotide sequence of the human PGLYRP1 gene fragment (SEQ ID NO: 5) is identical to the nucleotide sequence of positions 46018853 to 46023021 of NCBI accession number NC_000019.10; the connection design of the upstream of the human PGLYRP1 fragment sequence and the mouse is: 5'-GGCCAGCTCATACACAGCCCTGCAGTCCTGTGCGGCACGT CCAGCATGTC CCGCCGCT CTATGCTGCTTGCCTGGGCTCTCCCCAG-3' (SEQ ID NO: 7), wherein the sequence " CCAGCThe last "C" in the sequence is the last nucleotide in the mouse. ATGTC The "A" in the sequence is the first nucleotide of the human sequence. The downstream connection of the human PGLYRP1 fragment sequence and the mouse sequence is designed as: 5'-GGCAGTGAACCACGCTGCAAGACACCTCCTTCC CA CCAAACCA TGCTCCCTCCGGTGAATCTCGGTCACA-3' (SEQ ID NO: 8), wherein the sequence " CACCA The last "A" in the human sequence is the last nucleotide in the sequence " AACCA The first "A" in " is the first nucleotide of the mouse sequence.

[0174] The targeting vector also includes a resistance gene for positive clone screening, namely the neomycin phosphotransferase coding sequence Neo, and two site-specific recombination system Frt recombination sites arranged in the same direction are installed on both sides of the resistance gene to form a Neo cassette. The connection between the 5' end of the Neo cassette and the human PGLYRP1 gene is designed as: 5'-CCACGCTGCAAGACACCTCCTTCC CACCAGAAGT TCCTATTCTCTAGAAAGTATAGGA ACTT-3' (SEQ ID NO: 9), wherein the sequence " CACCA The last "A" in the sequence is the last nucleotide of the human PGLYRP1 gene. GAAGT The first "G" in the " is the first nucleotide of the Neo box; the connection between the 3' end of the Neo box and the mouse PGLYRP1 gene is designed as: 5'-CGAAGTTCCTATTCTCTAGAAAGTATAGGA ACTTCAACCA TGCTCCCTCCGGTGAATCTCGGTCACATGACC-3' (SEQ ID NO: 10), wherein the sequence " ACTTC The last "C" in the sequence is the last nucleotide of the Neo box. AACCA The first "A" in " is the first nucleotide of the mouse PGLYRP1 gene. The mRNA sequence of the modified humanized mouse PGLYRP1 is shown in SEQ ID NO: 6, and the expressed protein sequence is shown in SEQ ID NO: 2.

[0175] The construction of the targeting vector can be carried out by conventional methods, such as enzyme digestion and ligation. After the constructed targeting vector is initially verified by enzyme digestion, it is sent to a sequencing company for sequencing verification. The targeting vector verified by sequencing is electroporated and transfected into the embryonic stem cells of C57BL / 6 mice, and the obtained cells are screened using the positive clone screening marker gene to screen the correct positive clone cells. The screened correct positive clone cells (black mice) are introduced into the separated blastocysts (white mice) according to the technology known in the art, and the obtained chimeric blastocysts are transferred to the culture medium for short-term culture and then transplanted into the oviduct of the recipient mother mouse (white mouse), and F0 generation chimeric mice (black and white) can be produced. F0 generation chimeric mice are backcrossed with wild-type mice to obtain F1 generation mice, and then F1 generation heterozygous mice are mated with each other to obtain F2 generation homozygous mice. Positive mice can also be mated with Flp tool mice to remove the positive clone screening marker gene, and then mated with each other to obtain PGLYRP1 gene humanized homozygous mice.

[0176] In addition, CRISPR / Cas9 technology can be used for gene editing to further design the targeting vector V2( Figure 3 ), the targeting vector V2 contains upstream and downstream homology arm sequences of the mouse PGLYRP1 gene, and a human PGLYRP1 fragment. Among them, the upstream 5' homology arm sequence (SEQ ID NO: 15) is identical to the nucleotide sequence of positions 18617076 to 18618650 of NCBI accession number NC_000073.7, and the downstream 3' homology arm sequence (SEQ ID NO: 16) is identical to the nucleotide sequence of positions 18624364 to 18625869 of NCBI accession number NC_000073.7. The nucleotide sequence of the human PGLYRP1 fragment (SEQ ID NO: 5) is identical to the nucleotide sequence of positions 46018853 to 46023021 of NCBI accession number NC_000019.10. The mRNA sequence of the modified humanized PGLYRP1 mouse is shown in SEQ ID NO: 6, and the expressed protein sequence is shown in SEQ ID NO: 2.

[0177] Conventional methods can be used to construct the targeting vector, such as enzyme digestion, ligation, direct synthesis, etc. After the constructed targeting vector is initially verified by enzyme digestion, it is sent to a sequencing company for sequencing verification. The targeting vector that is verified to be correct by sequencing is used for subsequent experiments.

[0178] The target sequence determines the targeting specificity of sgRNA and the efficiency of inducing Cas9 to cut the target gene. Therefore, efficient and specific target sequence selection and design are the prerequisites for constructing sgRNA expression vectors. Design and synthesize sgRNA sequences that recognize target sites. The target sequence of an exemplary sgRNA on the PGLYRP1 gene is as follows:

[0179] sgRNA1 target site (SEQ ID NO: 18): 5'-GCGGGGCACGATGAAACTGCAGG-3';

[0180] sgRNA2 target site (SEQ ID NO: 19): 5′-AGTCTTTATTGGGGGTCAATGGG-3′;

[0181] The activity of sgRNA was detected by UCA kit. After confirming that it could mediate efficient cutting efficiency, restriction sites were added to its 5' end and complementary chain to obtain forward oligonucleotide and reverse oligonucleotide sequences as shown in Table 3. After annealing, the annealing products were connected to pT7-sgRNA plasmid (the plasmid was linearized with BbsI first) to obtain expression vectors pT7-PGLYRP1-1 and pT7-PGLYRP1-2.

[0182] Table 3 sgRNA1 and sgRNA2 sequence list

[0183]

[0184] The pT7-sgRNA vector was synthesized by a plasmid synthesis company with a fragment DNA containing a T7 promoter and sgRNA scaffold (SEQ ID NO: 17) and connected to a backbone vector (source: Takara, item number 3299) by restriction digestion (EcoRI and BamHI) in sequence. The result of sequencing verification by a professional sequencing company showed that the target plasmid was obtained. Take a mouse pronuclear fertilized egg, such as a C57BL / 6 mouse, and use a microinjector to pre-mix the in vitro transcription products of pT7-PGLYRP1-1 and pT7-PGLYRP1-2 plasmids (using the Ambion in vitro transcription kit, according to the instructions for transcription), the targeting vector and Cas9 mRNA and inject them into the cytoplasm or nucleus of the mouse fertilized egg. Microinjection of fertilized eggs was performed according to the method in the Mouse Embryo Manipulation Experiment Manual (3rd Edition) (Andras Nagy, Chemical Industry Press, 2006). The injected fertilized eggs were transferred to culture medium for a short period of culture and then transplanted into the oviduct of the recipient mother mouse for development. The obtained mice (F0 generation) were hybridized and self-fertilized to expand the population and establish a stable PGLYRP1 gene humanized mouse strain.

[0185] The PCR method can be used to identify the somatic cell genotype of F1 generation mice, and the F1 generation PCR-positive mice are subjected to Southern blot detection to confirm whether there is random insertion. The mouse tail is cut to extract genomic DNA, and the genome is digested with PshAI enzyme or AleI enzyme, respectively, transferred to a membrane, and hybridized. The A probe (A Probe) and the 3' probe (3'Probe) are located on the human PGLYRP1 genomic fragment and downstream of the 3' homology arm, respectively. The specific probes and target fragment lengths are shown in Table 4). The exemplary results are shown in Table 4. Figure 4 As shown, combined with the PCR and sequencing results, 6 mice numbered F1-1 to F1-6 were positive mice. This shows that the present method can be used to construct a PGLYRP1 gene humanized mouse that can be stably propagated and has no random insertion.

[0186] Table 4 Length of specific probes and target fragments

[0187]

[0188]

[0189] A Probe-F (SEQ ID NO: 11): 5'-TGGTGCGACGTGGGGCTACAA-3',

[0190] A Probe-R (SEQ ID NO: 12): 5'-ACACCTTGGTGTGTGTTAGG-3';

[0191] 3'Probe-F (SEQ ID NO: 13): 5'-AGACCGCAACCAAGGACCACAG-3', 3'Probe-R (SEQ ID NO: 14): 5'-GCAGCTCCTCAGGTAACCAG-3';

[0192] In addition, the expression of human PGLYRP1 protein in PGLYRP1 humanized mice can be detected by conventional methods such as ELISA. Specifically, 3 6-week-old female C57BL / 6 mice (+ / +) and 3 6-week-old female PGLYRP1 homozygotes (H / H) prepared in this example were selected, and serum was collected and tested using the mouse Origene Mouse Pglyrp1 ELISA KIT and the human PGLYRP1 / PGRP-SDuoSet ELISA kit. The test results are shown in FIG. Figure 5 shown.

[0193] from Figure 5It can be seen that only mouse PGLYRP1 protein expression was detected in wild-type C57BL / 6 mice, and only human PGLYRP1 protein expression was detected in PGLYRP1 humanized homozygous mice, proving that human PGLYRP1 protein can be successfully expressed in humanized homozygous PGLYRP1 gene mice.

[0194] Example 2 Pharmacodynamic Model

[0195] The PGLYRP1 humanized mice prepared by this method can be used to evaluate the efficacy of modulators targeting human PGLYRP1 in tumor diseases. For example, PGLYRP1 humanized mice homozygous for MC38 cells were subcutaneously inoculated, and the tumor volume grew to about 100 mm. 3 The mice were then divided into a control group or a treatment group according to the tumor volume. The treatment group randomly selected drugs targeting human PGLYRP1, and the control group was injected with an equal volume of saline. The tumor volume was measured regularly and the mice were weighed. By comparing the weight changes of the mice and the tumor size, the in vivo safety and in vivo efficacy of the compound can be effectively evaluated.

[0196] Example 3 Preparation of double-gene or multi-gene humanized mice

[0197] The PGLYRP1 gene humanized mouse prepared by the present method can also be used to prepare a multi-gene humanized mouse model. For example, in the above-mentioned Example 1, the embryonic stem cells used for microinjection can be selected from mice modified with at least one gene containing LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1 and CTLA4, or, on the basis of humanized PGLYRP1 mice, mouse ES embryonic stem cells can be separated and gene recombination targeting technology can be used to obtain a double-gene humanized or multi-gene humanized mouse model. The homozygous or heterozygous PGLYRP1 mouse obtained by this method can also be mated with other gene-modified mice, and the offspring can be screened. According to Mendel's genetic law, there is a certain probability of obtaining a multi-gene mouse modified with a humanized PGLYRP1 gene and other genes, and then the heterozygotes can be mated with each other to obtain a homozygous modified with two genes or multiple genes.

[0198] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0199] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0200] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A method for constructing a genetically modified non-human animal, characterized in that: The genome of the non-human animal comprises at least one chromosome comprising a nucleotide sequence encoding a human or chimeric peptidoglycan recognition protein (PGLYRP1).

2. The construction method according to claim 1, characterized in that: The chimeric PGLYRP1 protein is a humanized PGLYRP1 protein, and the amino acid sequence of the humanized PGLYRP1 protein is identical to at least 50 to 196 consecutive amino acid sequences of the human PGLYRP1 protein; Preferably, the human or chimeric PGLYRP1 protein comprises SEQ ID NO:2, or comprises at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identity to SEQ ID NO:

2.

3. A method for constructing a genetically modified non-human animal, characterized in that: At the endogenous PGLYRP1 gene locus of the non-human animal, the endogenous PGLYRP1 gene is replaced with a nucleotide sequence comprising human PGLYRP1.

4. The construction method according to any one of claims 1 to 3, characterized in that: The nucleotide sequence of human PGLYRP1 or the nucleotide sequence encoding human or chimeric PGLYRP1 protein is operably linked to an endogenous regulatory element of an endogenous PGLYRP1 locus; Preferably, the endogenous PGLYRP1 protein of the non-human animal is not expressed or is expressed at a reduced level compared to PGLYRP1 in wild-type animals; Preferably, the modified PGLYRP1 gene in the genome of the non-human animal is homozygous or heterozygous for the endogenous replaced locus.

5. The construction method according to claim 3 or 4, characterized in that: The nucleotide sequence of human PGLYRP1 includes part of exon 1 to all of exon 3 of the human PGLYRP1 gene; Preferably, it also includes at least 50 bp of continuous nucleotides downstream of the 3'UTR; Preferably, the portion of exon 1 includes at least 5 bp of continuous nucleotide sequence; Further preferably, the nucleotide sequence of human PGLYRP1 comprises at least 50 bp of continuous nucleotides from the start codon of the human PGLYRP1 gene to the downstream of the 3'UTR.

6. The construction method according to any one of claims 3 to 5, characterized in that: The nucleotide sequence of human PGLYRP1 comprises SEQ ID NO: 5, or comprises a nucleotide sequence with an identity of at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% to the nucleotide sequence shown in SEQ ID NO:

5.

7. The construction method according to any one of claims 3 to 6, characterized in that: The endogenous PGLYRP1 gene includes a portion of exon 1 to all of exon 3 of the non-human animal PGLYRP1 gene; Preferably, the endogenous PGLYRP1 gene comprises the entirety of the start codon to exon 3 of the non-human animal PGLYRP1 gene.

8. The construction method according to any one of claims 1 to 7, characterized in that: The non-human animal is a mammal, such as a monkey or a rodent; preferably, the rodent is a mouse or a rat.

9. The construction method according to any one of claims 1 to 8, characterized in that: The mRNA transcribed from the modified PGLYRP1 gene in the genome of the non-human animal comprises SEQ ID NO: 6, or comprises a nucleotide sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99% or 99.5% identical to the nucleotide sequence shown in SEQ ID NO:

6.

10. The construction method according to any one of claims 1 to 9, characterized in that: The non-human animal also includes nucleotide sequences of human or chimeric proteins encoded by other genes, and the human or chimeric proteins are selected from at least one of LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1 and CTLA4.

11. An application of a non-human animal obtained by the construction method according to any one of claims 1 to 10, characterized in that: The application includes: A) Applications in product development involving PGLYRP1-related immune processes in human cells; B) Application as a model system related to PGLYRP1 for pharmacology, immunology, microbiology and medical research; C) Applications involving the production and use of animal experimental disease models for the study of PGLYRP1-related etiology and / or for the development of diagnostic strategies and / or for the development of therapeutic strategies; D) in vivo studies on the screening, efficacy testing, efficacy assessment, validation or evaluation of human PGLYRP1 signaling pathway modulators; or, E) Study the function of the PGLYRP1 gene, study the drugs and efficacy targeting the human PGLYRP1 target site, and study the application of drugs related to PGLYRP1 in inflammation, cancer, and immune diseases.

Images